Roles of HLA-DRB107 :01 and HLA-B15 :01 in the risk of acute Graft Versus Host Disease in pediatric patients undergoing HSCT | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Roles of HLA-DRB1 07 :01 and HLA-B 15 :01 in the risk of acute Graft Versus Host Disease in pediatric patients undergoing HSCT Maja Krajinovic, Covida Mootoosamy, Marc Ansari, Vincent Gagné, and 15 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6821862/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 9 You are reading this latest preprint version Abstract Graft Versus Host Disease (GVHD) is a common complication of allogeneic hematopoietic stem cell transplantation (HSCT). Previous studies suggest that genes coding for different components of the immune system, like human leukocyte antigen (HLA), may contribute to the development of GVHD. This study evaluates associations between patients’ HLA alleles and higher grades of acute (a) GVHD to identify potential marker of this HSCT complication. The HSCT pediatric patients recruited were distributed in discovery (n = 87) and replication (n = 154) cohorts. The genotypes were obtained through whole exome sequencing (WES) for discovery cohort and by allele specific PCR for associated alleles for replication cohort. Fifty-eight HLA alleles with carrier frequency above 5% were identified from WES data and analyzed with aGVHD grades II-IV. Two HLA alleles, HLA-DRB1*07:01 and HLA-B*15:01 , were associated with higher aGVHD risk, (p = 0.004 and p = 0.009, respectively). Stratifications according to the donor type revealed positive associations limited to HLA-matched unrelated donors (p = 0.007 and p = 0.0009, respectively). Furthermore, carriers of either HLA allele were more likely to have non-permissive HLA-DPB1 mismatches (p = 0.008 and p = 0.015, respectively). Overall, these findings could influence clinical decisions in donor selection, as the presence of HLA-B*15:01 and/or HLA-DRB1*07:01 might suggest the presence of a non-permissive HLA-DPB1 mismatch. Health sciences/Risk factors Health sciences/Medical research/Genetics research Biological sciences/Genetics/Clinical genetics/Genetic testing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Allogenic hematopoietic stem cell transplantation (alloHSCT) is a common therapy for patients with incurable malignant and non-malignant hematological diseases [ 1 , 2 ]. Excluding disease relapse, the major complication after an alloHSCT is acute Graft Versus Host Disease (aGVHD) [ 3 ]. GVHD remains a critical challenge in transplantation medicine, contributing to significant morbidity and mortality, with rates of up to 56.5% and 37.3%, respectively, even with modern preventive strategies [ 3 – 7 ]. In pediatric alloHSCT patients, the cumulative 100-day incidence of aGVHD ranges between 49% and 62%, underscoring its clinical importance [ 8 ]. GVHD is a systemic inflammatory disorder resulting from donor T-cell recognition of host antigens as foreign, leading to immune-mediated damage primarily affecting the skin, liver and gastrointestinal tract [ 1 , 9 ]. Clinically, GVHD presents along a spectrum of severity, with acute cases graded from I to IV based on the extent of skin rash, serum bilirubin levels, diarrhea volume and the presence of persistent nausea and vomiting [ 10 ]. While grade I aGVHD is often mild and has minimal effect on patient outcome, grades II to IV are associated with significantly worse outcomes, including prolonged hospitalization and higher mortality rates [ 11 ]. The development of aGVHD is influenced by numerous clinical and biological risk factors. Among these, the degree of human leukocyte antigen (HLA) compatibility between the donor and recipient is a key determinant, alongside patient age, donor type, sex mismatch, stem cell source, underlying disease, conditioning regimen and the use of immunosuppressive prophylaxis [ 1 , 9 ]. While diagnostic biomarkers for aGVHD have been developed to guide treatment strategies, no useful predictive biomarkers of aGVHD are currently available. To address this important gap, we conducted a comprehensive evaluation of the association between aGVHD grades II-IV and genetic variants in HLA genes obtained from whole-exome sequencing (WES) in pediatric patients undergoing alloHSCT followed by the validation analysis in replication cohort. The study identified novel HLA variants associated with higher aGVHD incidence, providing new insights into the genetic determinants of alloimmune responses in the context of pediatric transplantation. Patients and Methods Patients groups . Participants were recruited from the Institutional Hematopoietic Stem Cell Transplantation (HSCT) biobank at Sainte-Justine University Health Center (SJUHC) in Montreal, Quebec, Canada, and as part of a multicentric study by the European Society for Blood and Marrow Transplantation Pediatric Working Disease Parties (EBMT PDWP) (ClinicalTrials.gov Identifier: NCT01257854) [ 12 ]. Discovery and replication cohorts have been previously described [ 13 , 14 ]. Briefly, the discovery cohort consisted of 87 pediatric patients who underwent an allo-HSCT between 2000 and 2013 at SJUHC and who had their DNA sequenced on the Illumina HiSeq2500 platform (Integrated Clinical Genomic Centre in Pediatrics, SJUHC). The replication cohort was an independent group comprising the remaining 154 unselected patients who underwent an alloHSCT. This cohort included 48 patients from SJUHC who were either excluded from sequencing due to insufficient DNA or recruited after sequencing had been completed (2013–2015). The remaining 106 pediatric patients underwent an alloHSCT between 2001 and 2015 at five additional centers: Geneva University Hospital (Switzerland), University Medical Center Utrecht (Netherlands), Leiden University Medical Center (Netherlands), Robert Debré Hospital (France), and Alberta Children’s Hospital (Canada). Patient characteristics for both the discovery and replication cohorts are described in detail in a previous study [ 13 , 14 ] and are also presented in Supplementary Material (Item S1). Data on aGVHD were collected from medical records based on clinical signs, including skin rash, serum bilirubin levels, diarrhea, and upper gastrointestinal symptoms, following the 1994 Consensus Conference criteria [ 15 ]. Acute GVHD was diagnosed up to 180 days post-HSCT to account for late-onset cases, and only moderate to severe cases (grades II-IV) were included in the analysis. Prophylaxis for GVHD was administered to all patients, although data were unavailable for four patients in the replication cohort. Prophylactic regimens primarily involved calcineurin inhibitors, with or without methotrexate, mycophenolate mofetil, and/or corticosteroids, as detailed in Supplementary Material (Item S1). Whole-exome sequencing (WES) . WES was performed on patient DNA from the discovery cohort, as previously described [ 13 ]. Reads were aligned to the hg19 reference genome using BWA-MEM [ 16 ]; PICARD [ 17 ] was used to mark PCR duplicates and collect sequencing quality control metrics; Bwakit implemented in BWA-MEM [ 18 ] was used to infer four-digit HLA alleles of the 6 major classes: HLA-A, HLA-B, HLA-C, HLA-DQA1, HLA-DQB1 and HLA-DRB1 . One hundred and ninety-seven HLA alleles were recovered from WES data. Only alleles with at least 5% frequency were further analyzed (n = 58) for an association with aGVHD. The analyses for associated HLA allele ( HLA-DRB1*07:01 and HLA-B*15:01 ) were then extended to the replication group. Additionally, HLA-DPB1 allele information was retrieved from the same sequencing dataset using a bioinformatics tool, HLA-HD [ 19 ]. Association study . For all association analyses, patients who developed aGVHD grades II-IV were classified as cases, and those without aGVHD were considered controls. Their association with HLA alleles was analyzed in SPSS (version 29, SPSS Inc, NY) using Fisher test and Kaplan-Meier (KM) 1- survival curves for cumulative aGVHD incidence, with genotype differences evaluated by the log-rank test. Univariate Cox regression analyses were conducted to derive hazard ratio (HR) with 95% confidence interval (CI) for significantly associated HLA alleles and multivariate Cox regression (using stepwise selection) was employed to evaluate the impact of these alleles in the presence of non-genetic covariates. Covariates included age, sex, diagnosis, type of conditioning regimen, busulfan exposure, stem cell source, HLA matching status/type of donor, population and the use of serotherapy. Stratified analyses were additionally done by established risk/confounding factors for aGVHD: donor type/matching status, recipient ethnicity, and sex differences. These factors were selected based on existing literature demonstrating their role in aGVHD outcomes. HLA matching significantly impacts aGVHD risk, with unrelated donors associated with higher incidence than matched siblings [ 20 ]. Caucasian recipients exhibit higher aGVHD rates Asians possibly due to genetic variability [ 21 , 22 ]. Male recipients, especially with female donors, face increased GVHD risk, influenced by immunological disparities [ 23 ]. For the HLA positive subgroup, the analyses were restricted to at least two carriers. Of the 58 HLA alleles analyzed, two were statistically significant and were genotyped in the replication cohort via allele-specific PCR and analyzed for an association with aGVHD II-IV as described above. The combined effect across the discovery and replication cohorts was evaluated using a meta-analysis conducted with the Mantel-Haenszel method, implemented in MedCalc software, under a fixed-effects model assumption [ 24 ]. Allele-Specific PCR. PCR assay for identification of HLA DRB1*07:01 was based on the analysis of SNP rs28724121, as previously described [ 25 ]. PCR assay for identification of HLA-B*15:01 was done using a two-step PCR. The first PCR was based on the SNP rs4999717, common to several closely related alleles including HLA-B*15:01, HLA-B*15:02, HLA-B*15:03, HLA-B*15:17 and HLA-B*15:18 . The following forward primer GAGGCCGCGGGACCCGGCCA(G/ A ) and reverse primer GATGTAATCCTTGCCGTCGT were used. If the first PCR was positive for the A allele, a second PCR was done where the presence of amplification of the C allele confirms the presence of HLA-B*15:01 with the use of following forward and reverse primers, GCTGAATCCAATCCCATCTC(A/ C ) and CCGCCTATGTTTTTCTCAGC, respectively. HLA-DBP1 Classification. The immunogenicity of HLA-DPB1 matching for each patient-donor pair was calculated through a web tool hosted on the IMGT/HLA Database website ( http://www.ebi.ac.uk/ipd/imgt/hla/dpb.html ) [ 26 ]. With the immunogenicity classification, it is possible to predict is the patient has a permissive mismatch or a non-permissive Host Versus Graft or Graft Versus Host mismatch. Because we did not have the genetic material or information of the donors, we adjusted this classification based on highest probability (Supplementary Material Item 2). In summary, we identified each patient-donor pair that were not likely to have non-permissive Graft Versus Host mismatches because they definitely had a permissive mismatch or a non-permissive Host Versus Graft mismatch, based on the immunogenicity of the patient (referred to as “permissive mismatches” relative to graft versus host). Then, we expected the rest of the patient-donor pairs to have a high probability of being non-permissive Graft Versus Host mismatches (referred to as “probable non-permissive mismatches”). Results HLA-B*15:01 and HLA-DRB1*07:01 and aGVHD II-IV The association analysis between 58 HLA alleles derived from WES data of the discovery cohort revealed 4 HLA-loci significantly associated with aGVHD II-IV (Table 1): HLA-B*15:01 (p = 0.009), HLA-DRB1*07:01 (p = 0.004), HLA-DQA1*02:01 (p = 0.002) and HLA-DRB1*01:01 (p = 0.006). Given that HLA-DRB1*01:01 is seen most often in diplotype with HLA-DRB1*07:01 and that HLA-DQA1*02:01 is in linkage disequilibrium with HLA-DRB1*07:01 , only HLA-DRB1*07:01 and HLA-B*15:01 were retained for further analyses (Fig. 1 ). The association remained significant in multivariate model, (Supplementary Material Item 3), but was modified by the matching status and type of donor. Significant association with aGVHD II-IV was observed for an HLA-matched unrelated-donor group, for both HLA-DRB1*07:01 and HLA-B*15:01 alleles (p = 0.007, p = 0.0009, respectively, Fig. 2 ). No such association was noted for HLA-matched sibling-donors (Supplementary Material Item 4). In the discovery cohort, the stem cell sources were distributed as follows: 49.4% bone marrow, 48.3% cord blood, and 2.4% peripheral blood. Each of these sources, have distinct immunological characteristics and matching requirements that can influence the development of aGVHD [ 27 ]. Specifically, the grading of HLA matching differs between bone marrow and cord blood transplants, as cord blood tolerates a higher degree of HLA mismatch due to its immunologically naïve state [ 28 ]. To confirm that the observed association between the HLA loci and aGVHD was not confounded by the stem cell source, we evaluated whether the association between HLA loci and aGVHD grades II-IV remained consistent in patients who received a bone marrow transplant. The results indicate that the association of HLA-B*15:01 and HLA-DRB1*07:01 with aGVHD remained significant in patients who received a transplant from a matched unrelated donor. (Supplementary Material Item 5). HLA-DPB1 and aGVHD II-IV To get further insight into the identified association we further focused on HLA-DPB1 , a well-known locus implicated in the compatibility of an allogenic transplantation from unrelated donors, particularly in case of non-permissive mismatches [ 29 – 31 ]. We analyzed the presence of permissive and probable non-permissive HLA-DBP1 mismatches in presence of HLA-DRB1*07:01 and HLA-B*15:01 (Fig. 3 ). In the discovery group, the presence of HLA-DRB1*07:01 in patients with a probable non-permissive HLA-DBP1 mismatch were significantly associated with a risk of aGVHD II-IV (p = 0.008, Fig. 3 a). The same observation was made with HLA-B*15:01 (p = 0.015, Fig. 3 c). Contrarily, when assessing the presence of these alleles in the subgroup of patients with permissive HLA-DBP1 mismatches, there was no significant association with aGVHD (p = 0.163 and p = 0.388, respectively, Figs. 3 b, d). This suggests that HLA-B*15:01 and HLA-DRB1*07:01 might indicate the presence of probable non-permissive HLA-DPB1 mismatch. The limited number of cases did not allow for further stratification by the type of donor. Replication in independent cohort The analyses in the replication cohort did not show an association of HLA-DRB1*07:01 with aGVHD II-IV, whereas similar trend as in discovery cohort was seen for carriers of HLA-B*15:01 in unrelated matched donors (Fig. 4 a). Although the association was of borderline significance (p = 0.158), it was significant in males (p = 0.041) and Caucasians (p = 0.036) (Fig. 5 ). Comparable results were obtained in the unrelated unmatched donors of discovery cohort, where the presence of HLA-B*15:01 was mostly confined to males and Caucasians (Supplementary Material Item 6). Multivariate analysis in the replication cohort did not yield additional insights or alter the significance of the observed associations. Given the similar behaviour of HLA-B*15:01 in discovery and replication cohorts, we also performed a meta-analysis The results showed that in the presence of HLA-B*15:01 , patients receiving an HSCT from an HLA-matched unrelated donor have an overall increased risk to have aGVHD II-IV of almost 6 times (OR, 95% CI = 5.9, 1.3–27.3, Fig. 4 b). The HLA-DBP1 information was not available for replication cohort and the association in relation to non-permissive HLA-DBP1 mismatches could not be addressed in this cohort. Discussion In this study, we identified two novel HLA loci, HLA-B*15:01 and HLA-DRB1*07:01 , that are significantly associated with a higher risk of developing aGVHD grades II-IV, in pediatric patients undergoing an HSCT. Our findings are of particular relevance for patients with HLA-matched unrelated donors. The association with HLA-B*15:01 seem to be modulated by sex and population background, whereas associations of both HLA alleles were irrespective of stem cell source. Although these loci were not previously related to aGVHD, they have been reported to be associated with other conditions. HLA-DRB1*07:01 is associated with an increased risk of cytomegalovirus reactivation following HSCT [ 32 ]. A previous study addressing the role of HLA alleles in asparaginase hypersensitivity in children with acute lymphoblastic leukemia also identified an association with HLA-DRB1*07:01 , driven by the haplotype that harbors both HLA-DRB1*07:01 and HLA-DQB1*02:02 [ 25 ]. In this study, the association of HLA-DRB1*07:01 was not dependent on HLA-DQB1*02:02 , suggesting that HLA-DRB1*07:01 is acting on its own (Supplementary Material Item 7). In a meta-analysis done on an Asian Population, Grave’s Disease patients have been reported to have a significant decrease in HLA-DRB1*07:01 frequency [ 33 ]. In a Taiwanese population, it was reported that HLA-DRB1*07:01 allele was positively associated with psoriasis vulgaris [ 34 ]. Increased frequency of HLA-DRB1*07 was found in a Mexican population with severe ulcerative colitis [ 35 ]. In a recent study, individuals carrying HLA-B*15:01 were shown to be strongly associated with asymptomatic infection of SARS-CoV-2 [ 36 ]. The importance of HLA mismatches in GVHD development have been largely documented. For instance, mismatches at HLA-B and HLA-DRB1 have been reported to increase the risk of aGVHD II-IV, primarily because of their roles in presenting peptides to T cells, which can provoke strong alloreactive immune responses [ 37 , 38 ]. Our findings suggest that the presence of HLA-B*15:01 and/or HLA-DRB1*07:01 in HLA-matched unrelated donors are associated with higher risk of aGVHD. Given that these alleles are matched between donors and recipients, their presence should not theoretically influence the risk of aGVHD. One of the possible explanations for these differences might be related to the non-permissive T-cell epitope mismatches of HLA-DPB1 , a locus well-known for its implication in GVHD [ 39 , 40 ]. Non-permissive HLA-DPB1 mismatches are associated with stronger alloimmune responses due to the presentation of immunogenic peptides, which can trigger donor T cells and escalate the risk of GVHD [ 31 ]. Furthermore, studies have highlighted that specific HLA-DPB1 mismatches can result in differential risks depending on their level of permissiveness, making this locus a critical factor in transplantation outcomes and donor selection [ 41 ]. It has been reported that the risk of aGVHD after an unrelated-donor HSCT with matched HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 alleles is higher when there is a non-permissive T-cell epitope mismatch of HLA-DPB1 [ 42 – 44 ]. Our analyses indeed have shown that the association between HLA-DRB1*07:01 or HLA-B*15:01 with aGVHD II-IV was significant only in patients with probable non-permissive HLA-DPB1 mismatches. We could not address this effect among HLA-matched unrelated donors only due to the limited sample size. Based on an Allele Frequency Net Database website ( http://allelefrequencies.net/default.asp ), we estimated the frequency of non-permissive DPB1 alleles in HLA-DRB1*07:01 and HLA-B*15:01 bearing haplotypes. There are at least 211 different haplotypes in 9 unique Caucasian populations from different regions with HLA-B*15:01 and different HLA-DBP1 allele combinations of which 33% are estimated as probable non-permissive DPB1 alleles. Among 448 different haplotypes in 8 unique Caucasian populations from different regions with HLA-DRB1*07:01 , 36% have probable non-permissive HLA-DPB1 alleles. There were only 8 different haplotypes in 4 unique Caucasian populations from different regions with both HLA alleles, but none of associated HLA-DPB1 alleles is estimated as probable non-permissive. The association between these two HLA loci and HLA-DPB1 indicates a mechanistic link that could explain the increased GVHD risk observed, pointing to a potential synergistic effect with HLA-DPB1 . The molecular interaction between class I and class II HLA molecules influence the nature of the immune response [ 37 , 45 – 47 ]. In fact, the CD8 + T-cells restricted by HLA-B*15:01 can influence the activation of CD4 + helper T-cells that recognize peptides presented by non-permissive TCE mismatches of HLA-DPB1 , resulting in enhanced T-cell activation [ 43 ]. Moreover, HLA-B*15:01 and HLA-DRB1*07:01 alleles can serve as markers for the presence of certain HLA-DBP1 alleles. To the best of our knowledge, there are currently no highly reliable biomarkers that exist to predict the onset or severity of aGVHD, as opposed to diagnostic biomarkers. Thus, predicting aGVHD risk remains an important challenge, and our findings suggest that pediatric patients with these HLA loci who receive an HSCT from matched unrelated-donor may face a higher risk of developing aGVHD II-IV. This predictive relationship of HLA-B*15:01 and/or HLA-DRB1*07:01 with HLA-DBP1 could stem from the interplay of peptide presentation. Although further research into the haplotypes and functional roles of these loci are needed, these findings could influence clinical decisions in donor selection, as the presence of HLA-B*15:01 and/or HLA-DRB1*07:01 might serve as a red flag suggesting closer monitoring. Also, these loci could be added into polygenic risk models to create more personalized approaches to GVHD prophylaxis and ultimately reduce the incidence of severe GVHD. Beyond HLA-B*15:01 and HLA-DRB1*07:01 , other studies have identified associations between GVHD and specific immunogenetic factors, such as mismatches in minor histocompatibility antigens, non-HLA immunogenetic variants (e.g., cytokine gene polymorphisms), and pathways involved in antigen processing and presentation [ 48 , 49 ]. Using WES study, we have also uncovered novel variants and loci outside the traditional HLA region that may contribute to GVHD risk [ 50 ]. Together, these findings emphasize the need for polygenic models that incorporate both HLA and non-HLA genetic factors to provide a more comprehensive risk assessment for GVHD and inform tailored therapeutic strategies. While our findings provide valuable insights, some limitations should be considered. Firstly, the replication cohort of our study has heterogeneous patient characteristics, with patients were recruited from different hospitals across Canada and Europe. Future studies should be done to validate these findings in larger and more homogeneous cohorts. Secondly, the lack of donor DNA put a hinderance on the study of the HLA-DPB1 allele. As previously described, an assumption had to be made for the HLA-DPB1 allele of the donor and their immunogenicity, making the results highly probable but not definite. In conclusion, HLA-B*15:01 and HLA-DRB1*07:01 , particularly in combination with HLA-DPB1 , hold promise as predictive biomarkers, offering a potential new tool for improving transplant outcomes for patients with HLA-matched unrelated-donors. Further research is needed to validate these findings and translate them into clinical practice, potentially paving the way for more personalized and effective GVHD prevention strategies. Declarations Data availability. The datasets used and/or analyzed during the current study are available upon request. The request should be made to the data access committee composed of senior authors of this study: Dr. M. Krajinovic, [email protected] ; Dr. H. Bittencourt, [email protected] ; Dr. M. Ansari, [email protected] , and President of Ethics committee at SJUHC, G. Cardinal, [email protected] . Acknowledgements. Reported on Behalf of the Pediatric Disease Working Party of the European Society for Blood and Marrow Transplantation. The authors would like to thank all patients and their parents for the participation in the study, as well as all study collaborators for their valuable contribution and M.A. Rezgui for his technical assistance. Author contributions. M.A., H.B., and M.K. designed the study; D.S. supervised WES analyses; P.S.-O., P.T.-D. and P.B. contributed to bioinformatics analyses; M.A., T.N., R.G.M.B., J.-H. D., V.L., K.K., H.B., J.-J. B. and Y.T. contributed to patients’ sample and data processing; C.M., and M.K. executed statistical analysis; V. M., Y. S. G. AND J.V. contributed to interpretation of results; C. M. and V. G. performed the genotyping analysis; C. M. and M. K. drafted the manuscript and all authors revised it critically. Funding. This investigation was supported by grants from the Swiss National Science Foundation (Grant No. 153389), CANSEARCH Foundation, and The Cole Foundation and the Foundation of Charles-Bruneau. Competing interests. The authors declare no competing interests. Ethics approval and consent. Written informed consent was obtained from every patient or parent/legal guardian. The study was conducted in accordance with the Declaration of Helsinki and was approved by Research Ethics Board of SJUHC. References Adom, D., et al., Biomarkers for Allogeneic HCT Outcomes. Front Immunol, 2020. 11 : p. 673. Niederwieser, D., et al., One and a half million hematopoietic stem cell transplants: continuous and differential improvement in worldwide access with the use of non-identical family donors. Haematologica, 2022. 107 (5): p. 1045-1053. Holtan, S.G., et al., Disease progression, hospital readmissions, and clinical outcomes for patients with steroid-refractory acute graft-versus-host disease: A multicenter, retrospective study. Bone Marrow Transplantation, 2022. 57 (9): p. 1399-1404. Shaw, P.J., et al., Outcomes of pediatric bone marrow transplantation for leukemia and myelodysplasia using matched sibling, mismatched related, or matched unrelated donors. Blood., 2010. 116 . Patterson, S.D., et al., Prospective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics, 2011. 12 (7): p. 939-51. Alsultan, A., et al., GVHD after unrelated cord blood transplant in children: characteristics, severity, risk factors and influence on outcome. Bone Marrow Transplant, 2011. 46 . Michonneau, D., et al., Treatment Patterns and Clinical Outcomes of Patients with Moderate to Severe Acute Graft-Versus-Host Disease: A Multicenter Chart Review Study. Hematology Reports, 2024. 16 (2): p. 283-294. Reshef, R., et al., Acute GVHD Diagnosis and Adjudication in a Multicenter Trial: A Report From the BMT CTN 1202 Biorepository Study. J Clin Oncol, 2021. 39 (17): p. 1878-1887. Zeiser, R. and B.R. Blazar, Acute graft-versus-host disease—biologic process, prevention, and therapy. N Engl J Med, 2017. 377 . Harris, A.C., et al., International, Multicenter Standardization of Acute Graft-versus-Host Disease Clinical Data Collection: A Report from the Mount Sinai Acute GVHD International Consortium. Biol Blood Marrow Transplant, 2016. 22 (1): p. 4-10. Cahn, J.Y., et al., Prospective evaluation of 2 acute graft-versus-host (GVHD) grading systems: a joint Société Française de Greffe de Moëlle et Thérapie Cellulaire (SFGM-TC), Dana Farber Cancer Institute (DFCI), and International Bone Marrow Transplant Registry (IBMTR) prospective study. Blood, 2005. 106 (4): p. 1495-500. Ansari, M., et al., GSTA1 diplotypes affect busulfan clearance and toxicity in children undergoing allogeneic hematopoietic stem cell transplantation: a multicenter study. Oncotarget., 2017. 8 . Ansari, M., et al., Genetic susceptibility to hepatic sinusoidal obstruction syndrome in pediatric patients undergoing hematopoietic stem cell transplantation. Biol. Blood Marrow Transplant, 2020. 26 . Ansari, M., et al., Genetic susceptibility to acute graft versus host disease in pediatric patients undergoing HSCT. Bone Marrow Transplantation, 2021. 56 (11): p. 2697-2704. Przepiorka, D., et al., 1994 Consensus Conference on Acute GVHD Grading. Bone Marrow Transplant., 1995. 15 . Li, H. and R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009. 25 (14): p. 1754-60. Picard tools. . (2018). ; Available from: https://broadinstitute.github.io/picard/. Li, H., Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv preprint arXiv:1303.3997, 2013. Kawaguchi, S., et al., HLA-HD: An accurate HLA typing algorithm for next-generation sequencing data. Hum Mutat, 2017. 38 (7): p. 788-797. Zhang, M.J., et al., Comparison of outcomes after HLA-matched sibling and unrelated donor transplantation for children with high-risk acute lymphoblastic leukemia. Biol Blood Marrow Transplant, 2012. 18 (8): p. 1204-10. Morishima, Y., et al., Significance of ethnicity in the risk of acute graft-versus-host disease and leukemia relapse after unrelated donor hematopoietic stem cell transplantation. Biol Blood Marrow Transplant, 2013. 19 (8): p. 1197-203. Kanda, J., et al., Graft-versus-Host Disease after HLA-Matched Sibling Bone Marrow or Peripheral Blood Stem Cell Transplantation: Comparison of North American Caucasian and Japanese Populations. Biol Blood Marrow Transplant, 2016. 22 (4): p. 744-751. Kumar, A.J., et al., Graft-versus-host disease in recipients of male unrelated donor compared with parous female sibling donor transplants. Blood Adv, 2018. 2 (9): p. 1022-1031. Ltd., M.S. MedCalc – Statistical Software for Biomedical Research . 2025; Available from: https://www.medcalc.org. Gagné, V., et al., HLA alleles associated with asparaginase hypersensitivity in childhood ALL: a report from the DFCI Consortium. Pharmacogenomics, 2020. 21 (8): p. 541-547. Baxter-Lowe, L.A., The changing landscape of HLA typing: Understanding how and when HLA typing data can be used with confidence from bench to bedside. Hum Immunol, 2021. 82 (7): p. 466-477. Panch, S.R., et al., Sources of Hematopoietic Stem and Progenitor Cells and Methods to Optimize Yields for Clinical Cell Therapy. Biology of Blood and Marrow Transplantation, 2017. 23 (8): p. 1241-1249. Spellman, S.R., Hematology 2022—what is complete HLA match in 2022? Hematology, 2022. 2022 (1): p. 83-89. Petersdorf, E.W., et al., High HLA-DP Expression and Graft-versus-Host Disease. N Engl J Med, 2015. 373 (7): p. 599-609. Crivello, P., et al., Functional distance between recipient and donor HLA-DPB1 determines nonpermissive mismatches in unrelated HCT. Blood, 2016. 128 (1): p. 120-9. Walz, J.S., The immunopeptidome guides permissive HLA mismatch. Blood, 2021. 137 (7): p. 864-865. Chen, Y., et al., Relationship between HLA alleles and cytomegalovirus infection after allogeneic hematopoietic stem cell transplant. Blood, 2001. 98 (2): p. 500-500. Li, W., et al., Association Between HLA-DRB1 Alleles and Graves' Disease in Asian Populations: A Meta-Analysis. Horm Metab Res, 2024. 56 (12): p. 859-868. Jee, S.H., et al., HLA-DRB1*0701 and DRB1*1401 are associated with genetic susceptibility to psoriasis vulgaris in a Taiwanese population. Br J Dermatol, 1998. 139 (6): p. 978-83. Yamamoto-Furusho, J.K., et al., Association of the HLA-DRB1*0701 allele with perinuclear anti-neutrophil cytoplasmatic antibodies in Mexican patients with severe ulcerative colitis. World J Gastroenterol, 2006. 12 (10): p. 1617-20. Augusto, D.G., et al., A common allele of HLA is associated with asymptomatic SARS-CoV-2 infection. Nature, 2023. 620 (7972): p. 128-136. Zou, J., et al., Molecular disparity in human leukocyte antigens is associated with outcomes in haploidentical stem cell transplantation. Blood Advances, 2020. 4 (15): p. 3474-3485. Shaw, B.E., et al., The importance of HLA-DPB1 in unrelated donor hematopoietic cell transplantation. Blood, 2007. 110 (13): p. 4560-4566. Yao, Y., et al., HLA Class II Genes HLA-DRB1, HLA-DPB1, and HLA-DQB1 Are Associated With the Antibody Response to Inactivated Japanese Encephalitis Vaccine. Front Immunol, 2019. 10 : p. 428. Fuchs, E.J., et al., Improving Donor Selection for Haploidentical Stem Cell Transplantation with Post-Transplant Cyclophosphamide through Selective HLA-Mis/Matching. Blood, 2020. 136 (Supplement 1): p. 24-26. Vié, H., J. Gaschet, and N. Milpied, Permissive, nonpermissive HLA-DPB1 epitope disparities and the specificity of T cells infiltrating the skin during acute graft-versus-host disease. Blood, 2011. 117 (21): p. 5779-5781. Fleischhauer, K., et al., Effect of T-cell-epitope matching at HLA-DPB1 in recipients of unrelated-donor haemopoietic-cell transplantation: a retrospective study. The Lancet Oncology, 2012. 13 (4): p. 366-374. Arrieta-Bolaños, E., et al., A core group of structurally similar HLA-DPB1 alleles drives permissiveness after hematopoietic cell transplantation. Blood, 2022. 140 (6): p. 659-663. Oran, B., et al., Effect of nonpermissive HLA-DPB1 mismatches after unrelated allogeneic transplantation with in vivo T-cell depletion. Blood, 2018. 131 (11): p. 1248-1257. Sajulga, R., et al., Assessment of HLA-DPB1 genetic variation using an HLA-DP tool and its implications in clinical transplantation. Blood Advances, 2023. 7 (17): p. 4809-4821. Rizvi, S.M., et al., Distinct Assembly Profiles of HLA-B Molecules. The Journal of Immunology, 2014. 192 (11): p. 4967-4976. Morishima, S., et al., Evolutionary basis of HLA-DPB1 alleles affects acute GVHD in unrelated donor stem cell transplantation. Blood, 2018. 131 (7): p. 808-817. Flowers, M.E.D., et al., Comparative analysis of risk factors for acute graft-versus-host disease and for chronic graft-versus-host disease according to National Institutes of Health consensus criteria. Blood, 2011. 117 (11): p. 3214-3219. Shahzad, M., et al., Factors Associated with Acute and Chronic Graft-Versus-Host Disease after Matched Unrelated Donor Hematopoietic Cell Transplantation Using Posttransplant Cyclophosphamide-Based GvHD Prophylaxis. Blood, 2024. 144 (Supplement 1): p. 2147-2147. Shreders, A., et al., Using Whole Exome Sequencing to Identify Genetic Variation and Polymorphisms Associated with Graft Versus Host Disease in Allogeneic Stem Cell Transplant Recipients. Blood, 2015. 126 (23): p. 5414-5414. Table 1 Table 1 is available in the Supplementary Files section. Additional Declarations The authors have declared there is NO conflict of interest to disclose. Supplementary Files Table1.xlsx Table 1. Association analyses of HLA alleles derived from whole exome sequencing data. HLA alleles with a frequency higher than 5% in the discovery cohort, along with their frequency and p-value for the association with aGVHD II-IV, as obtained by the Fisher exact test and Log-rank test. SupplementalItem1.xlsx Supplemental Item 1 – Patient Characteristics. BM bone marrow, PBSC peripheral blood stem cells, Bu Busulfan, CY cyclophosphamide, Mel melphalan, Flu fludarabine, VP16 etoposide, aGVHD acute Graft versus Host Disease, cumAUC cumulative area under the curve Supp2.jpg Supplemental Item 2 – HLA-DPB1 Classification. Table of HLA-DPB1 Classification of the 87 patients from the Discovery Cohort, used for HLA-DPB1 analysis. Patient Immunogenicity was obtained by entering HLA-DPB1 allele information as obtained from our sequencing data, in the IMGT/HLA Database Website (http://www.ebi.ac.uk/ipd/imgt/hla/dpb.html). Donor sequences were not available. All the possible donor immunogenicity and outcomes based on the patient immunogenicity are listed. Our assumption of the outcome and the number of patients in each group are listed. Supp3.jpg Supplemental Item 3 – Multivariate Stepwise Analysis of the Discovery Group. Covariates included age (as a continuous variable), sex (male vs. female), diagnosis (non-malignant disease vs. hematological malignancies), type of conditioning regimen (categorized by the number of alkylating agents), busulfan (Bu) exposure (cumulative area under the curve, cumAUC, mg×h/L), stem cell source (bone marrow vs. cord- or peripheral blood), HLA matching status/type of donor (matched and unmatched siblings or unrelated donors), population (Caucasians vs non-Caucasians) and the use of serotherapy. Supp4.jpg Supplemental Item 4 – Cumulative incidence of aGVHD II-IV in relation to top-ranking HLA alleles identified among matched sibling donors in the discovery cohort. Cumulative incidence of aGVHD 2-4 over time among matched sibling donors of discovery cohort in relation to HLA-DRB1 07:01 in (a), and HLA-B 15:01 in (b). The black curves correspond to the presence of a given HLA allele (+) and the grey curves correspond to the absence of the HLA allele (-). Differences between the groups were evaluated using the log-rank test (p-value). The total number of patients is indicated next to each curve and number of patients with aGVHD 2-4 is indicated in brackets. Supp5.jpg Supplemental Item 5 – Cumulative incidence of aGVHD II-IV in the Discovery Cohort, in patients who received a bone marrow transplant and in the presence of HLA-DRB1 07:01 and HLA- HLA-B 15:01. Association of HLA-DRB1 07:01 with aGVHD II-IV in patients of the entire discovery cohort in (a), of the subgroup “Matched Sibling Donor” in (b), and of the subgroup “Matched Unrelated Donor” in (c). Association of HLA-B 15:01 with aGVHD II-IV of the entire discovery cohort in (d), of the subgroup “Matched Sibling Donor” in (e), and of the subgroup “Matched Unrelated Donor” in (f). Differences between the groups were evaluated using the log-rank test (P-value). The total number of patients is indicated next to each curve and number of patients with aGVHD II-IV is indicated in brackets. Supp6.jpg Supplemental Item 6 – Cumulative incidence of aGVHD II-IV in relation to HLA-B 15:01 in the discovery cohort. Association of HLA-B 15:01 with aGVHD II-IV among matched unrelated donors in males and Caucasians of the discovery cohort in (a)and (b), respectively. Supp7.jpg Supplemental Item 7 – HLA-DRB1 07:01 and HLA-DQB1 02:02. Cumulative incidence of aGVHD II-IV over time in the Discovery Cohort, in the presence of HLA-DRB1 07:01 and HLA-DQB1 02:02. The black curves correspond to the presence of HLA-DRB1 07:01, in dark grey is the presence of HLA-DRB1 07:01 and HLA-DQB1 02:02, and in light grey is the absence of HLA-DRB1 07:01 and HLA-DQB1*02:02. Differences between the groups were evaluated using the log-rank test (P-value). The total number of patients is indicated next to each curve and number of patients with aGVHD II-IV is indicated in brackets. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 03 Sep, 2025 Review # 2 received at journal 13 Aug, 2025 Reviewer # 2 agreed at journal 28 Jul, 2025 Review # 1 received at journal 14 Jul, 2025 Reviewer # 1 agreed at journal 07 Jul, 2025 Reviewers invited by journal 19 Jun, 2025 Submission checks completed at journal 05 Jun, 2025 Editor assigned by journal 04 Jun, 2025 First submitted to journal 04 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6821862","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":473506422,"identity":"5ea70a1e-f40c-47d7-814f-40c20f066cd7","order_by":0,"name":"Maja Krajinovic","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABH0lEQVRIie2RvWrDMBCAzxicxfWsLvUTFGQMJkPjvMoZgbykUOiSMcHgjFnbt0j3DlcCngzdisFQXAyd3S1DoZXTvyFK2rGDvkXHnT7uTgIwGP4nCEAAVtbHHE6+895flXCbUwlwDjainzCZ/aacLuipg/LRtxdHd617Eaerh3XRvtye+Q7YqrRLVKJgUF0G88wTocvF+aqWKadnGeTghEynECKDDq155kbHV5yUMokY0drKwQWtct+IjVLGX0rKP5S3sVLsjU6pUKrBMOkV1nHCT4USpTjaLlUjh6gWUkrIOy6C61pKVpIQue1EQ+1gE1F1BY5ulmXQ4Gvse7Uo2JTi0XKQtZX2mV3sPxOC2U7F1t5XDGh7+PvqBoPBYHgHLFhpXZtxeeEAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-4772-7031","institution":"Université de Montréal","correspondingAuthor":true,"prefix":"","firstName":"Maja","middleName":"","lastName":"Krajinovic","suffix":""},{"id":473506423,"identity":"adfe3016-b1b3-4cfa-8ee8-dc512783a89e","order_by":1,"name":"Covida Mootoosamy","email":"","orcid":"https://orcid.org/0009-0003-8832-4009","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Covida","middleName":"","lastName":"Mootoosamy","suffix":""},{"id":473506424,"identity":"7aabb619-d63e-4fd7-97c6-56f334d9622d","order_by":2,"name":"Marc Ansari","email":"","orcid":"","institution":"University of Geneva, Geneva, Switzerland","correspondingAuthor":false,"prefix":"","firstName":"Marc","middleName":"","lastName":"Ansari","suffix":""},{"id":473506425,"identity":"7cbde2ca-f562-43ab-a196-d1b4d7df6bbf","order_by":3,"name":"Vincent Gagné","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Vincent","middleName":"","lastName":"Gagné","suffix":""},{"id":473506426,"identity":"26512120-a492-404f-b26b-7676d4db4ca1","order_by":4,"name":"Pascal St-Onge","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Pascal","middleName":"","lastName":"St-Onge","suffix":""},{"id":473506427,"identity":"f68ac0cd-579b-40dc-ae87-f9476a0dea37","order_by":5,"name":"Pascal Tremblay-Dauphinais","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Pascal","middleName":"","lastName":"Tremblay-Dauphinais","suffix":""},{"id":473506428,"identity":"124305b3-b33c-470a-83ee-cb1d7e87a57b","order_by":6,"name":"Patrick Beaulieu","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Patrick","middleName":"","lastName":"Beaulieu","suffix":""},{"id":473506429,"identity":"83bb8def-8f5a-4668-a67b-cf5e0ac7baad","order_by":7,"name":"Yves Théoret","email":"","orcid":"","institution":"Cancer Center Charles-Bruneau, Research Center CHU Sainte-Justine, Montreal, QC, Canada","correspondingAuthor":false,"prefix":"","firstName":"Yves","middleName":"","lastName":"Théoret","suffix":""},{"id":473506430,"identity":"59e5128d-0e29-4a86-9a8b-d0f24f8eecd8","order_by":8,"name":"Tiago Nava","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Tiago","middleName":"","lastName":"Nava","suffix":""},{"id":473506431,"identity":"df1d99dd-791e-4aa4-87cd-af9bcf731865","order_by":9,"name":"Vid Mlakar","email":"","orcid":"","institution":"Research platform for paediatric oncology and haematology","correspondingAuthor":false,"prefix":"","firstName":"Vid","middleName":"","lastName":"Mlakar","suffix":""},{"id":473506432,"identity":"d9012acb-ace5-408a-86f5-7f798ed860ea","order_by":10,"name":"Yvonne Gloor","email":"","orcid":"https://orcid.org/0000-0002-8790-0479","institution":"Geneva University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yvonne","middleName":"","lastName":"Gloor","suffix":""},{"id":473506433,"identity":"8fd60df9-243a-42ea-8a90-60d92efcc7f7","order_by":11,"name":"Jean Villard","email":"","orcid":"","institution":"Geneva University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jean","middleName":"","lastName":"Villard","suffix":""},{"id":473506434,"identity":"ff764ce6-0ec2-44d2-9d99-5fecc4737690","order_by":12,"name":"Jaap Jan Boelens","email":"","orcid":"https://orcid.org/0000-0003-2232-6952","institution":"Memorial Sloan Kettering Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Jaap","middleName":"Jan","lastName":"Boelens","suffix":""},{"id":473506435,"identity":"ad2ee03e-e393-458d-a6bb-1e61fee9a5f8","order_by":13,"name":"Robbert Bredius","email":"","orcid":"","institution":"Leiden University Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Robbert","middleName":"","lastName":"Bredius","suffix":""},{"id":473506436,"identity":"b2a143c5-c9e3-4930-8e7d-94004f1ea439","order_by":14,"name":"Jean-Hugues Dalle","email":"","orcid":"","institution":"Robert Debré","correspondingAuthor":false,"prefix":"","firstName":"Jean-Hugues","middleName":"","lastName":"Dalle","suffix":""},{"id":473506437,"identity":"097f3893-5f10-4970-a375-9b964fc54327","order_by":15,"name":"Victor Lewis","email":"","orcid":"","institution":"Alberto Childrens Hospital","correspondingAuthor":false,"prefix":"","firstName":"Victor","middleName":"","lastName":"Lewis","suffix":""},{"id":473506438,"identity":"0ddc0c12-ab2c-496c-9631-4fa51fc64cca","order_by":16,"name":"Krzysztof Kalwak","email":"","orcid":"https://orcid.org/0000-0003-1174-5799","institution":"Wroclaw Medical University","correspondingAuthor":false,"prefix":"","firstName":"Krzysztof","middleName":"","lastName":"Kalwak","suffix":""},{"id":473506439,"identity":"77bfb5ff-2245-43be-b3b3-091e8b15d622","order_by":17,"name":"Daniel Sinnett","email":"","orcid":"https://orcid.org/0000-0003-3625-6676","institution":"CHU Sainte-Justine","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Sinnett","suffix":""},{"id":473506440,"identity":"76e79070-d79d-4492-a5a4-8f772236f903","order_by":18,"name":"Henrique Bittencourt","email":"","orcid":"","institution":"CHU Sainte-Justine Research Center Azrieli","correspondingAuthor":false,"prefix":"","firstName":"Henrique","middleName":"","lastName":"Bittencourt","suffix":""}],"badges":[],"createdAt":"2025-06-04 15:10:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6821862/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6821862/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85391244,"identity":"4501d8a3-caa9-44bd-9c11-56b00f76587b","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":41587,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCumulative incidence of aGVHD II-IV in relation to top-ranking HLA alleles identified in the discovery cohort.\u003c/strong\u003e Cumulative incidence of aGVHD 2-4 over time in the discovery cohort in relation to HLA-DRB1*07:01 in \u003cstrong\u003e(a)\u003c/strong\u003e, and HLA-B*15:01 in \u003cstrong\u003e(b). \u003c/strong\u003eThe black curves correspond to the presence of a given HLA allele (+) and the grey curves correspond to the absence of the HLA allele (-). Differences between the groups were evaluated using the log-rank test (p-value). Hazard ratio (HR) with 95% confidence interval (in brackets) is calculated through univariate Cox regression. The total number of patients is indicated next to each curve and number of patients with aGVHD II-IV is indicated in brackets.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/5cfa4dda4b06b1d99226dd1a.jpg"},{"id":85392701,"identity":"7d3544aa-7543-499c-8a76-2440f9a68466","added_by":"auto","created_at":"2025-06-25 10:43:16","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":35654,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCumulative incidence of aGVHD II-IV in relation to top-ranking HLA alleles identified among matched unrelated donors in the discovery cohort.\u003c/strong\u003e Cumulative incidence of aGVHD 2-4 over time among matched unrelated donors of discovery cohort in relation HLA-DRB1*07:01 in \u003cstrong\u003e(a)\u003c/strong\u003e, and HLA-B*15:01 in \u003cstrong\u003e(b)\u003c/strong\u003e. The black curves correspond to the presence of a given HLA allele (+) and the grey curves correspond to the absence of the HLA allele (-). Differences between the groups were evaluated using the log-rank test (p-value). The total number of patients is indicated next to each curve and number of patients with aGVHD 2-4 is indicated in brackets.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/6e692c5775beec3bcc6fd5d2.jpg"},{"id":85391245,"identity":"b76fa495-175c-4af5-ae32-e38566dd286c","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":57815,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCumulative incidence of aGVHD II-IV in the discovery cohort in relation to top-ranking HLA alleles, relative to permissiveness status of HLA-DBP1 allele.\u003c/strong\u003e Association of HLA-DRB1*07:01 with aGVHD II-IV in the “Probable Non-Permissive” and “Permissive” subgroups in \u003cstrong\u003e(a)\u003c/strong\u003e and \u003cstrong\u003e(b)\u003c/strong\u003e, respectively. Association of HLA-B*15:01 with aGVHD II-IV in the “Probable Non-Permissive” and “Permissive” subgroups in \u003cstrong\u003e(d)\u003c/strong\u003e and \u003cstrong\u003e(e)\u003c/strong\u003e, respectively.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/0507eae0a1782cbb6e99f2da.jpg"},{"id":85393246,"identity":"b98a1871-a79c-4b18-ad97-9af00f0e6823","added_by":"auto","created_at":"2025-06-25 10:51:16","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":36813,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMeta-analysis of the association of HLA-B15:01 allele with aGVHD 2-4 in the matched unrelated donors of the discovery and replication cohorts. (a) \u003c/strong\u003eCumulative incidence of aGVHD II-IV in the Replication Cohort among matched unrelated donors. \u003cstrong\u003e(b)\u003c/strong\u003eThe results of a meta-analysis shown by the forest plot. Each horizontal line represents an individual study, with the square at the center indicating the study-specific effect size (e.g., odds ratio, OR) and the width of the line representing the 95% confidence interval, CI. The size of the square reflects the weight of each study in the meta-analysis. The diamond represents the pooled effect size with its 95% CI. Heterogeneity among studies was assessed using the I² statistic (I² = 46.53%) and the p-value for heterogeneity test (p = 0.171). Studies are ordered by effect size, and the vertical line indicates the null effect (OR= 1).\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/401f4ac35880419849d64104.jpg"},{"id":85391265,"identity":"bdf37cf2-52bc-4d8a-8a47-6dec6984af80","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":33058,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCumulative incidence of aGVHD II-IV in relation to HLA-B*15:01\u003c/strong\u003e \u003cstrong\u003ein the replication cohort.\u003c/strong\u003e Association of HLA-B*15:01 with aGVHD II-IV among matched unrelated donors in males and Caucasians in \u003cstrong\u003e(a)\u003c/strong\u003e and \u003cstrong\u003e(b)\u003c/strong\u003e, respectively.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/7dd1ff9fd29a2e5472a74ff0.jpg"},{"id":85394745,"identity":"e1c8d92b-0b8e-4b41-b6ca-df81a5f0f5db","added_by":"auto","created_at":"2025-06-25 10:59:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1214482,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/74f0c09b-8642-4dab-a965-94103185eadd.pdf"},{"id":85391242,"identity":"4a38683e-564a-4dd7-b325-56dc2e7bf74e","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11445,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable 1. Association analyses of HLA alleles derived from whole exome sequencing data. \u003c/strong\u003eHLA alleles with a frequency higher than 5% in the discovery cohort, along with their frequency and p-value for the association with aGVHD II-IV, as obtained by the Fisher exact test and Log-rank test.\u003c/p\u003e","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/fa35bd7fb7ea5d5554402bd6.xlsx"},{"id":85391802,"identity":"43f6fd2f-b76d-4397-afe9-7098e6df90eb","added_by":"auto","created_at":"2025-06-25 10:35:16","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":11735,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 1 – Patient Characteristics. \u003c/strong\u003e\u003cem\u003eBM\u003c/em\u003ebone marrow, \u003cem\u003ePBSC\u003c/em\u003e peripheral blood stem cells, \u003cem\u003eBu\u003c/em\u003e Busulfan, \u003cem\u003eCY\u003c/em\u003ecyclophosphamide, \u003cem\u003eMel\u003c/em\u003e melphalan, \u003cem\u003eFlu \u003c/em\u003efludarabine, \u003cem\u003eVP16 \u003c/em\u003eetoposide, \u003cem\u003eaGVHD\u003c/em\u003e acute Graft versus Host Disease, \u003cem\u003ecumAUC\u003c/em\u003e cumulative area under the curve\u003c/p\u003e","description":"","filename":"SupplementalItem1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/cabc4ce9bd8c8cc0e1820217.xlsx"},{"id":85391809,"identity":"939e5009-efef-4fa0-b30d-78db7ed32b61","added_by":"auto","created_at":"2025-06-25 10:35:16","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":81690,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Item 2 – HLA-DPB1 Classification. Table of HLA-DPB1 Classification of the 87 patients from the Discovery Cohort, used for HLA-DPB1 analysis. Patient Immunogenicity was obtained by entering HLA-DPB1 allele information as obtained from our sequencing data, in the IMGT/HLA Database Website (http://www.ebi.ac.uk/ipd/imgt/hla/dpb.html). Donor sequences were not available. All the possible donor immunogenicity and outcomes based on the patient immunogenicity are listed. Our assumption of the outcome and the number of patients in each group are listed.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Supp2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/d5d6dd2f72c8572f5e3368a5.jpg"},{"id":85391252,"identity":"33d7721d-4005-4533-af00-cc00f4c61d81","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":32092,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 3 – Multivariate Stepwise Analysis of the Discovery Group. \u003c/strong\u003eCovariates included age (as a continuous variable), sex (male vs. female), diagnosis (non-malignant disease vs. hematological malignancies), type of conditioning regimen (categorized by the number of alkylating agents), \u0026nbsp;busulfan (Bu) exposure (cumulative area under the curve, cumAUC, mg×h/L), stem cell source (bone marrow vs. cord- or peripheral blood), HLA matching status/type of donor (matched and unmatched siblings or unrelated donors), population (Caucasians vs non-Caucasians) and the use of serotherapy.\u003c/p\u003e","description":"","filename":"Supp3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/ce1c9d66813c059a08bd42b9.jpg"},{"id":85391259,"identity":"ba5359a4-209f-43cd-8dc2-5fc7515ccfdd","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":28552,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 4 – Cumulative incidence of aGVHD II-IV in relation to top-ranking HLA alleles identified among matched sibling donors in the discovery cohort.\u003c/strong\u003e Cumulative incidence of aGVHD 2-4 over time among matched sibling donors of discovery cohort in relation to HLA-DRB1*07:01 in \u003cstrong\u003e(a)\u003c/strong\u003e, and HLA-B*15:01 in \u003cstrong\u003e(b)\u003c/strong\u003e. The black curves correspond to the presence of a given HLA allele (+) and the grey curves correspond to the absence of the HLA allele (-). Differences between the groups were evaluated using the log-rank test (p-value). The total number of patients is indicated next to each curve and number of patients with aGVHD 2-4 is indicated in brackets.\u003c/p\u003e","description":"","filename":"Supp4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/ccba8f940979887234813a7b.jpg"},{"id":85391256,"identity":"7e514848-8af9-45e7-8f99-631fa97ceb1b","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":75211,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 5 – Cumulative incidence of aGVHD II-IV in the Discovery Cohort, in patients who received a bone marrow transplant and in the presence of HLA-DRB1*07:01 and HLA- HLA-B*15:01\u003c/strong\u003e. Association of HLA-DRB1*07:01 with aGVHD II-IV in patients of the entire discovery cohort in \u003cstrong\u003e(a)\u003c/strong\u003e, of the subgroup “Matched Sibling Donor” in \u003cstrong\u003e(b)\u003c/strong\u003e, and of the subgroup “Matched Unrelated Donor” in \u003cstrong\u003e(c)\u003c/strong\u003e. Association of HLA-B*15:01 with aGVHD II-IV of the entire discovery cohort in \u003cstrong\u003e(d)\u003c/strong\u003e, of the subgroup “Matched Sibling Donor” in \u003cstrong\u003e(e)\u003c/strong\u003e, and of the subgroup “Matched Unrelated Donor” in \u003cstrong\u003e(f).\u003c/strong\u003e Differences between the groups were evaluated using the log-rank test (P-value). The total number of patients is indicated next to each curve and number of patients with aGVHD II-IV is indicated in brackets.\u003c/p\u003e","description":"","filename":"Supp5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/b9eee45856c41a588377946d.jpg"},{"id":85391266,"identity":"f0c85307-6de7-41ec-b1be-4f0556b0be04","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":28566,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 6 – Cumulative incidence of aGVHD II-IV in relation to HLA-B*15:01\u003c/strong\u003e \u003cstrong\u003ein the discovery cohort.\u003c/strong\u003e Association of HLA-B*15:01 with aGVHD II-IV among matched unrelated donors in males and Caucasians of the discovery cohort in \u003cstrong\u003e(a)\u003c/strong\u003eand \u003cstrong\u003e(b)\u003c/strong\u003e, respectively.\u003c/p\u003e","description":"","filename":"Supp6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/2989cd6d6fd34c19a7202b63.jpg"},{"id":85391261,"identity":"6ccecbc6-0320-4fbf-b708-c0a740646e5b","added_by":"auto","created_at":"2025-06-25 10:27:16","extension":"jpg","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":13900,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplemental Item 7 – HLA-DRB1*07:01 and HLA-DQB1*02:02. \u003c/strong\u003eCumulative incidence of aGVHD II-IV over time in the Discovery Cohort, in the presence of HLA-DRB1*07:01 and HLA-DQB1*02:02. The black curves correspond to the presence of HLA-DRB1*07:01, in dark grey is the presence of HLA-DRB1*07:01 and HLA-DQB1*02:02, and in light grey is the absence of HLA-DRB1*07:01 and HLA-DQB1*02:02. Differences between the groups were evaluated using the log-rank test (P-value). The total number of patients is indicated next to each curve and number of patients with aGVHD II-IV is indicated in brackets.\u003c/p\u003e","description":"","filename":"Supp7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6821862/v1/365ed2d540d6c29caf22431e.jpg"}],"financialInterests":"The authors have declared there is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Roles of HLA-DRB1*07 :01 and HLA-B*15 :01 in the risk of acute Graft Versus Host Disease in pediatric patients undergoing HSCT","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAllogenic hematopoietic stem cell transplantation (alloHSCT) is a common therapy for patients with incurable malignant and non-malignant hematological diseases [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Excluding disease relapse, the major complication after an alloHSCT is acute Graft Versus Host Disease (aGVHD) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. GVHD remains a critical challenge in transplantation medicine, contributing to significant morbidity and mortality, with rates of up to 56.5% and 37.3%, respectively, even with modern preventive strategies [\u003cspan additionalcitationids=\"CR4 CR5 CR6\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e–\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn pediatric alloHSCT patients, the cumulative 100-day incidence of aGVHD ranges between 49% and 62%, underscoring its clinical importance [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. GVHD is a systemic inflammatory disorder resulting from donor T-cell recognition of host antigens as foreign, leading to immune-mediated damage primarily affecting the skin, liver and gastrointestinal tract [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Clinically, GVHD presents along a spectrum of severity, with acute cases graded from I to IV based on the extent of skin rash, serum bilirubin levels, diarrhea volume and the presence of persistent nausea and vomiting [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. While grade I aGVHD is often mild and has minimal effect on patient outcome, grades II to IV are associated with significantly worse outcomes, including prolonged hospitalization and higher mortality rates [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe development of aGVHD is influenced by numerous clinical and biological risk factors. Among these, the degree of human leukocyte antigen (HLA) compatibility between the donor and recipient is a key determinant, alongside patient age, donor type, sex mismatch, stem cell source, underlying disease, conditioning regimen and the use of immunosuppressive prophylaxis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. While diagnostic biomarkers for aGVHD have been developed to guide treatment strategies, no useful predictive biomarkers of aGVHD are currently available.\u003c/p\u003e \u003cp\u003eTo address this important gap, we conducted a comprehensive evaluation of the association between aGVHD grades II-IV and genetic variants in HLA genes obtained from whole-exome sequencing (WES) in pediatric patients undergoing alloHSCT followed by the validation analysis in replication cohort. The study identified novel HLA variants associated with higher aGVHD incidence, providing new insights into the genetic determinants of alloimmune responses in the context of pediatric transplantation.\u003c/p\u003e "},{"header":"Patients and Methods","content":"\u003cp\u003e\u003cb\u003ePatients groups\u003c/b\u003e. Participants were recruited from the Institutional Hematopoietic Stem Cell Transplantation (HSCT) biobank at Sainte-Justine University Health Center (SJUHC) in Montreal, Quebec, Canada, and as part of a multicentric study by the European Society for Blood and Marrow Transplantation Pediatric Working Disease Parties (EBMT PDWP) (ClinicalTrials.gov Identifier: NCT01257854) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Discovery and replication cohorts have been previously described [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBriefly, the discovery cohort consisted of 87 pediatric patients who underwent an allo-HSCT between 2000 and 2013 at SJUHC and who had their DNA sequenced on the Illumina HiSeq2500 platform (Integrated Clinical Genomic Centre in Pediatrics, SJUHC). The replication cohort was an independent group comprising the remaining 154 unselected patients who underwent an alloHSCT. This cohort included 48 patients from SJUHC who were either excluded from sequencing due to insufficient DNA or recruited after sequencing had been completed (2013–2015). The remaining 106 pediatric patients underwent an alloHSCT between 2001 and 2015 at five additional centers: Geneva University Hospital (Switzerland), University Medical Center Utrecht (Netherlands), Leiden University Medical Center (Netherlands), Robert Debré Hospital (France), and Alberta Children’s Hospital (Canada).\u003c/p\u003e\u003cp\u003ePatient characteristics for both the discovery and replication cohorts are described in detail in a previous study [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and are also presented in Supplementary Material (Item S1). Data on aGVHD were collected from medical records based on clinical signs, including skin rash, serum bilirubin levels, diarrhea, and upper gastrointestinal symptoms, following the 1994 Consensus Conference criteria [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Acute GVHD was diagnosed up to 180 days post-HSCT to account for late-onset cases, and only moderate to severe cases (grades II-IV) were included in the analysis. Prophylaxis for GVHD was administered to all patients, although data were unavailable for four patients in the replication cohort. Prophylactic regimens primarily involved calcineurin inhibitors, with or without methotrexate, mycophenolate mofetil, and/or corticosteroids, as detailed in Supplementary Material (Item S1).\u003c/p\u003e\u003cp\u003e \u003cb\u003eWhole-exome sequencing (WES)\u003c/b\u003e. WES was performed on patient DNA from the discovery cohort, as previously described [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Reads were aligned to the hg19 reference genome using BWA-MEM [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]; PICARD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] was used to mark PCR duplicates and collect sequencing quality control metrics; Bwakit implemented in BWA-MEM [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] was used to infer four-digit HLA alleles of the 6 major classes: \u003cem\u003eHLA-A, HLA-B, HLA-C, HLA-DQA1, HLA-DQB1\u003c/em\u003e and \u003cem\u003eHLA-DRB1\u003c/em\u003e. One hundred and ninety-seven HLA alleles were recovered from WES data. Only alleles with at least 5% frequency were further analyzed (n = 58) for an association with aGVHD. The analyses for associated HLA allele (\u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e) were then extended to the replication group. Additionally, \u003cem\u003eHLA-DPB1\u003c/em\u003e allele information was retrieved from the same sequencing dataset using a bioinformatics tool, HLA-HD [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e \u003cb\u003eAssociation study\u003c/b\u003e. For all association analyses, patients who developed aGVHD grades II-IV were classified as cases, and those without aGVHD were considered controls. Their association with HLA alleles was analyzed in SPSS (version 29, SPSS Inc, NY) using Fisher test and Kaplan-Meier (KM) 1- survival curves for cumulative aGVHD incidence, with genotype differences evaluated by the log-rank test. Univariate Cox regression analyses were conducted to derive hazard ratio (HR) with 95% confidence interval (CI) for significantly associated HLA alleles and multivariate Cox regression (using stepwise selection) was employed to evaluate the impact of these alleles in the presence of non-genetic covariates. Covariates included age, sex, diagnosis, type of conditioning regimen, busulfan exposure, stem cell source, HLA matching status/type of donor, population and the use of serotherapy. Stratified analyses were additionally done by established risk/confounding factors for aGVHD: donor type/matching status, recipient ethnicity, and sex differences. These factors were selected based on existing literature demonstrating their role in aGVHD outcomes. HLA matching significantly impacts aGVHD risk, with unrelated donors associated with higher incidence than matched siblings [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Caucasian recipients exhibit higher aGVHD rates Asians possibly due to genetic variability [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Male recipients, especially with female donors, face increased GVHD risk, influenced by immunological disparities [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. For the HLA positive subgroup, the analyses were restricted to at least two carriers.\u003c/p\u003e\u003cp\u003eOf the 58 HLA alleles analyzed, two were statistically significant and were genotyped in the replication cohort via allele-specific PCR and analyzed for an association with aGVHD II-IV as described above.\u003c/p\u003e\u003cp\u003eThe combined effect across the discovery and replication cohorts was evaluated using a meta-analysis conducted with the Mantel-Haenszel method, implemented in MedCalc software, under a fixed-effects model assumption [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e \u003cb\u003eAllele-Specific PCR.\u003c/b\u003e PCR assay for identification of \u003cem\u003eHLA DRB1*07:01\u003c/em\u003e was based on the analysis of SNP rs28724121, as previously described [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. PCR assay for identification of \u003cem\u003eHLA-B*15:01\u003c/em\u003e was done using a two-step PCR. The first PCR was based on the SNP rs4999717, common to several closely related alleles including \u003cem\u003eHLA-B*15:01, HLA-B*15:02, HLA-B*15:03, HLA-B*15:17\u003c/em\u003e and \u003cem\u003eHLA-B*15:18\u003c/em\u003e. The following forward primer GAGGCCGCGGGACCCGGCCA(G/\u003cb\u003eA\u003c/b\u003e) and reverse primer GATGTAATCCTTGCCGTCGT were used. If the first PCR was positive for the A allele, a second PCR was done where the presence of amplification of the C allele confirms the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e with the use of following forward and reverse primers, GCTGAATCCAATCCCATCTC(A/\u003cb\u003eC\u003c/b\u003e) and CCGCCTATGTTTTTCTCAGC, respectively.\u003c/p\u003e\u003cp\u003e \u003cb\u003eHLA-DBP1 Classification.\u003c/b\u003e The immunogenicity of \u003cem\u003eHLA-DPB1\u003c/em\u003e matching for each patient-donor pair was calculated through a web tool hosted on the IMGT/HLA Database website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ebi.ac.uk/ipd/imgt/hla/dpb.html\u003c/span\u003e\u003cspan address=\"http://www.ebi.ac.uk/ipd/imgt/hla/dpb.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. With the immunogenicity classification, it is possible to predict is the patient has a permissive mismatch or a non-permissive Host Versus Graft or Graft Versus Host mismatch. Because we did not have the genetic material or information of the donors, we adjusted this classification based on highest probability (Supplementary Material Item 2). In summary, we identified each patient-donor pair that were not likely to have non-permissive Graft Versus Host mismatches because they definitely had a permissive mismatch or a non-permissive Host Versus Graft mismatch, based on the immunogenicity of the patient (referred to as “permissive mismatches” relative to graft versus host). Then, we expected the rest of the patient-donor pairs to have a high probability of being non-permissive Graft Versus Host mismatches (referred to as “probable non-permissive mismatches”).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eHLA-B*15:01\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eHLA-DRB1*07:01\u003c/b\u003e \u003cb\u003eand aGVHD II-IV\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe association analysis between 58 HLA alleles derived from WES data of the discovery cohort revealed 4 HLA-loci significantly associated with aGVHD II-IV (Table\u0026nbsp;1): \u003cem\u003eHLA-B*15:01\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.009), \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.004), \u003cem\u003eHLA-DQA1*02:01\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.002) and \u003cem\u003eHLA-DRB1*01:01\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.006). Given that \u003cem\u003eHLA-DRB1*01:01\u003c/em\u003e is seen most often in diplotype with \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and that \u003cem\u003eHLA-DQA1*02:01\u003c/em\u003e is in linkage disequilibrium with \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, only \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e were retained for further analyses (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The association remained significant in multivariate model, (Supplementary Material Item 3), but was modified by the matching status and type of donor. Significant association with aGVHD II-IV was observed for an HLA-matched unrelated-donor group, for both \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e alleles (p\u0026thinsp;=\u0026thinsp;0.007, p\u0026thinsp;=\u0026thinsp;0.0009, respectively, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). No such association was noted for HLA-matched sibling-donors (Supplementary Material Item 4).\u003c/p\u003e \u003cp\u003eIn the discovery cohort, the stem cell sources were distributed as follows: 49.4% bone marrow, 48.3% cord blood, and 2.4% peripheral blood. Each of these sources, have distinct immunological characteristics and matching requirements that can influence the development of aGVHD [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Specifically, the grading of HLA matching differs between bone marrow and cord blood transplants, as cord blood tolerates a higher degree of HLA mismatch due to its immunologically na\u0026iuml;ve state [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. To confirm that the observed association between the HLA loci and aGVHD was not confounded by the stem cell source, we evaluated whether the association between HLA loci and aGVHD grades II-IV remained consistent in patients who received a bone marrow transplant. The results indicate that the association of \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e with aGVHD remained significant in patients who received a transplant from a matched unrelated donor. (Supplementary Material Item 5).\u003c/p\u003e \u003cp\u003e \u003cb\u003eHLA-DPB1\u003c/b\u003e \u003cb\u003eand aGVHD II-IV\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo get further insight into the identified association we further focused on \u003cem\u003eHLA-DPB1\u003c/em\u003e, a well-known locus implicated in the compatibility of an allogenic transplantation from unrelated donors, particularly in case of non-permissive mismatches [\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe analyzed the presence of permissive and probable non-permissive \u003cem\u003eHLA-DBP1\u003c/em\u003e mismatches in presence of \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In the discovery group, the presence of \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e in patients with a probable non-permissive \u003cem\u003eHLA-DBP1\u003c/em\u003e mismatch were significantly associated with a risk of aGVHD II-IV (p\u0026thinsp;=\u0026thinsp;0.008, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The same observation was made with \u003cem\u003eHLA-B*15:01\u003c/em\u003e (p\u0026thinsp;=\u0026thinsp;0.015, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Contrarily, when assessing the presence of these alleles in the subgroup of patients with permissive HLA-DBP1 mismatches, there was no significant association with aGVHD (p\u0026thinsp;=\u0026thinsp;0.163 and p\u0026thinsp;=\u0026thinsp;0.388, respectively, Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, d). This suggests that \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e might indicate the presence of probable non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatch. The limited number of cases did not allow for further stratification by the type of donor.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReplication in independent cohort\u003c/h2\u003e \u003cp\u003eThe analyses in the replication cohort did not show an association of \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e with aGVHD II-IV, whereas similar trend as in discovery cohort was seen for carriers of \u003cem\u003eHLA-B*15:01\u003c/em\u003e in unrelated matched donors (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Although the association was of borderline significance (p\u0026thinsp;=\u0026thinsp;0.158), it was significant in males (p\u0026thinsp;=\u0026thinsp;0.041) and Caucasians (p\u0026thinsp;=\u0026thinsp;0.036) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Comparable results were obtained in the unrelated unmatched donors of discovery cohort, where the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e was mostly confined to males and Caucasians (Supplementary Material Item 6). Multivariate analysis in the replication cohort did not yield additional insights or alter the significance of the observed associations.\u003c/p\u003e\u003cp\u003eGiven the similar behaviour of \u003cem\u003eHLA-B*15:01\u003c/em\u003e in discovery and replication cohorts, we also performed a meta-analysis The results showed that in the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e, patients receiving an HSCT from an HLA-matched unrelated donor have an overall increased risk to have aGVHD II-IV of almost 6 times (OR, 95% CI\u0026thinsp;=\u0026thinsp;5.9, 1.3\u0026ndash;27.3, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). The \u003cem\u003eHLA-DBP1\u003c/em\u003e information was not available for replication cohort and the association in relation to non-permissive \u003cem\u003eHLA-DBP1\u003c/em\u003e mismatches could not be addressed in this cohort.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we identified two novel HLA loci, \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, that are significantly associated with a higher risk of developing aGVHD grades II-IV, in pediatric patients undergoing an HSCT. Our findings are of particular relevance for patients with HLA-matched unrelated donors. The association with \u003cem\u003eHLA-B*15:01\u003c/em\u003e seem to be modulated by sex and population background, whereas associations of both HLA alleles were irrespective of stem cell source.\u003c/p\u003e \u003cp\u003eAlthough these loci were not previously related to aGVHD, they have been reported to be associated with other conditions. \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e is associated with an increased risk of cytomegalovirus reactivation following HSCT [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. A previous study addressing the role of HLA alleles in asparaginase hypersensitivity in children with acute lymphoblastic leukemia also identified an association with \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, driven by the haplotype that harbors both \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-DQB1*02:02\u003c/em\u003e [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, the association of \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e was not dependent on \u003cem\u003eHLA-DQB1*02:02\u003c/em\u003e, suggesting that \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e is acting on its own (Supplementary Material Item 7). In a meta-analysis done on an Asian Population, Grave\u0026rsquo;s Disease patients have been reported to have a significant decrease in \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e frequency [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In a Taiwanese population, it was reported that \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e allele was positively associated with psoriasis vulgaris [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Increased frequency of \u003cem\u003eHLA-DRB1*07\u003c/em\u003e was found in a Mexican population with severe ulcerative colitis [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In a recent study, individuals carrying \u003cem\u003eHLA-B*15:01\u003c/em\u003e were shown to be strongly associated with asymptomatic infection of SARS-CoV-2 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe importance of HLA mismatches in GVHD development have been largely documented. For instance, mismatches at \u003cem\u003eHLA-B\u003c/em\u003e and \u003cem\u003eHLA-DRB1\u003c/em\u003e have been reported to increase the risk of aGVHD II-IV, primarily because of their roles in presenting peptides to T cells, which can provoke strong alloreactive immune responses [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Our findings suggest that the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e and/or \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e in HLA-matched unrelated donors are associated with higher risk of aGVHD. Given that these alleles are matched between donors and recipients, their presence should not theoretically influence the risk of aGVHD. One of the possible explanations for these differences might be related to the non-permissive T-cell epitope mismatches of \u003cem\u003eHLA-DPB1\u003c/em\u003e, a locus well-known for its implication in GVHD [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatches are associated with stronger alloimmune responses due to the presentation of immunogenic peptides, which can trigger donor T cells and escalate the risk of GVHD [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Furthermore, studies have highlighted that specific \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatches can result in differential risks depending on their level of permissiveness, making this locus a critical factor in transplantation outcomes and donor selection [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. It has been reported that the risk of aGVHD after an unrelated-donor HSCT with matched \u003cem\u003eHLA-A, HLA-B, HLA-C, HLA-DRB1\u003c/em\u003e and \u003cem\u003eHLA-DQB1\u003c/em\u003e alleles is higher when there is a non-permissive T-cell epitope mismatch of \u003cem\u003eHLA-DPB1\u003c/em\u003e [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Our analyses indeed have shown that the association between \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e or \u003cem\u003eHLA-B*15:01\u003c/em\u003e with aGVHD II-IV was significant only in patients with probable non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatches. We could not address this effect among HLA-matched unrelated donors only due to the limited sample size. Based on an Allele Frequency Net Database website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://allelefrequencies.net/default.asp\u003c/span\u003e\u003cspan address=\"http://allelefrequencies.net/default.asp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), we estimated the frequency of non-permissive DPB1 alleles in \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e bearing haplotypes. There are at least 211 different haplotypes in 9 unique Caucasian populations from different regions with \u003cem\u003eHLA-B*15:01\u003c/em\u003e and different \u003cem\u003eHLA-DBP1\u003c/em\u003e allele combinations of which 33% are estimated as probable non-permissive \u003cem\u003eDPB1\u003c/em\u003e alleles. Among 448 different haplotypes in 8 unique Caucasian populations from different regions with \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, 36% have probable non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e alleles. There were only 8 different haplotypes in 4 unique Caucasian populations from different regions with both HLA alleles, but none of associated \u003cem\u003eHLA-DPB1\u003c/em\u003e alleles is estimated as probable non-permissive.\u003c/p\u003e \u003cp\u003eThe association between these two \u003cem\u003eHLA\u003c/em\u003e loci and \u003cem\u003eHLA-DPB1\u003c/em\u003e indicates a mechanistic link that could explain the increased GVHD risk observed, pointing to a potential synergistic effect with \u003cem\u003eHLA-DPB1\u003c/em\u003e. The molecular interaction between class I and class II HLA molecules influence the nature of the immune response [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In fact, the CD8\u0026thinsp;+\u0026thinsp;T-cells restricted by \u003cem\u003eHLA-B*15:01\u003c/em\u003e can influence the activation of CD4\u0026thinsp;+\u0026thinsp;helper T-cells that recognize peptides presented by non-permissive TCE mismatches of \u003cem\u003eHLA-DPB1\u003c/em\u003e, resulting in enhanced T-cell activation [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Moreover, \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e alleles can serve as markers for the presence of certain \u003cem\u003eHLA-DBP1\u003c/em\u003e alleles.\u003c/p\u003e \u003cp\u003eTo the best of our knowledge, there are currently no highly reliable biomarkers that exist to predict the onset or severity of aGVHD, as opposed to diagnostic biomarkers. Thus, predicting aGVHD risk remains an important challenge, and our findings suggest that pediatric patients with these \u003cem\u003eHLA\u003c/em\u003e loci who receive an HSCT from matched unrelated-donor may face a higher risk of developing aGVHD II-IV. This predictive relationship of \u003cem\u003eHLA-B*15:01\u003c/em\u003e and/or \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e with \u003cem\u003eHLA-DBP1\u003c/em\u003e could stem from the interplay of peptide presentation. Although further research into the haplotypes and functional roles of these loci are needed, these findings could influence clinical decisions in donor selection, as the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e and/or \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e might serve as a red flag suggesting closer monitoring. Also, these loci could be added into polygenic risk models to create more personalized approaches to GVHD prophylaxis and ultimately reduce the incidence of severe GVHD. Beyond \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, other studies have identified associations between GVHD and specific immunogenetic factors, such as mismatches in minor histocompatibility antigens, non-HLA immunogenetic variants (e.g., cytokine gene polymorphisms), and pathways involved in antigen processing and presentation [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Using WES study, we have also uncovered novel variants and loci outside the traditional HLA region that may contribute to GVHD risk [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Together, these findings emphasize the need for polygenic models that incorporate both HLA and non-HLA genetic factors to provide a more comprehensive risk assessment for GVHD and inform tailored therapeutic strategies.\u003c/p\u003e \u003cp\u003eWhile our findings provide valuable insights, some limitations should be considered. Firstly, the replication cohort of our study has heterogeneous patient characteristics, with patients were recruited from different hospitals across Canada and Europe. Future studies should be done to validate these findings in larger and more homogeneous cohorts. Secondly, the lack of donor DNA put a hinderance on the study of the \u003cem\u003eHLA-DPB1\u003c/em\u003e allele. As previously described, an assumption had to be made for the \u003cem\u003eHLA-DPB1\u003c/em\u003e allele of the donor and their immunogenicity, making the results highly probable but not definite.\u003c/p\u003e \u003cp\u003eIn conclusion, \u003cem\u003eHLA-B*15:01\u003c/em\u003e and \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e, particularly in combination with \u003cem\u003eHLA-DPB1\u003c/em\u003e, hold promise as predictive biomarkers, offering a potential new tool for improving transplant outcomes for patients with HLA-matched unrelated-donors. Further research is needed to validate these findings and translate them into clinical practice, potentially paving the way for more personalized and effective GVHD prevention strategies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available upon request. The request should be made to the data access committee composed of senior authors of this study: Dr. M. Krajinovic,
[email protected] ; Dr. H. Bittencourt,
[email protected] ; Dr. M. Ansari,
[email protected] , and President of Ethics committee at SJUHC, G. Cardinal,
[email protected] .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReported on Behalf of the Pediatric Disease Working Party of the European Society for Blood and Marrow Transplantation. The authors would like to thank all patients and their parents for the participation in the study, as well as all study collaborators for their valuable contribution and M.A. Rezgui for his technical assistance.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.A., H.B., and M.K. designed the study; D.S. supervised WES analyses; P.S.-O., P.T.-D. and P.B. contributed to bioinformatics analyses; M.A., T.N., R.G.M.B., J.-H. D., V.L., K.K., H.B., J.-J. B. and Y.T. contributed to patients\u0026rsquo; sample and data processing; C.M., and M.K. executed statistical analysis; V. M., Y. S. G. AND J.V. \u0026nbsp;contributed to interpretation of results; C. M. and V. G. performed the genotyping analysis; C. M. and M. K. drafted the manuscript and all authors revised it critically.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis investigation was supported by grants from the Swiss National Science Foundation (Grant No. 153389), CANSEARCH Foundation, and The Cole Foundation and the Foundation of Charles-Bruneau.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent was obtained from every patient or parent/legal guardian. The study was conducted in accordance with the Declaration of Helsinki and was approved by Research Ethics Board of SJUHC.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAdom, D., et al., \u003cem\u003eBiomarkers for Allogeneic HCT Outcomes.\u003c/em\u003e Front Immunol, 2020. \u003cstrong\u003e11\u003c/strong\u003e: p. 673.\u003c/li\u003e\n\u003cli\u003eNiederwieser, D., et al., \u003cem\u003eOne and a half million hematopoietic stem cell transplants: continuous and differential improvement in worldwide access with the use of non-identical family donors.\u003c/em\u003e Haematologica, 2022. \u003cstrong\u003e107\u003c/strong\u003e(5): p. 1045-1053.\u003c/li\u003e\n\u003cli\u003eHoltan, S.G., et al., \u003cem\u003eDisease progression, hospital readmissions, and clinical outcomes for patients with steroid-refractory acute graft-versus-host disease: A multicenter, retrospective study.\u003c/em\u003e Bone Marrow Transplantation, 2022. \u003cstrong\u003e57\u003c/strong\u003e(9): p. 1399-1404.\u003c/li\u003e\n\u003cli\u003eShaw, P.J., et al., \u003cem\u003eOutcomes of pediatric bone marrow transplantation for leukemia and myelodysplasia using matched sibling, mismatched related, or matched unrelated donors.\u003c/em\u003e Blood., 2010. \u003cstrong\u003e116\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003ePatterson, S.D., et al., \u003cem\u003eProspective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group.\u003c/em\u003e Pharmacogenomics, 2011. \u003cstrong\u003e12\u003c/strong\u003e(7): p. 939-51.\u003c/li\u003e\n\u003cli\u003eAlsultan, A., et al., \u003cem\u003eGVHD after unrelated cord blood transplant in children: characteristics, severity, risk factors and influence on outcome.\u003c/em\u003e Bone Marrow Transplant, 2011. \u003cstrong\u003e46\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eMichonneau, D., et al., \u003cem\u003eTreatment Patterns and Clinical Outcomes of Patients with Moderate to Severe Acute Graft-Versus-Host Disease: A Multicenter Chart Review Study.\u003c/em\u003e Hematology Reports, 2024. \u003cstrong\u003e16\u003c/strong\u003e(2): p. 283-294.\u003c/li\u003e\n\u003cli\u003eReshef, R., et al., \u003cem\u003eAcute GVHD Diagnosis and Adjudication in a Multicenter Trial: A Report From the BMT CTN 1202 Biorepository Study.\u003c/em\u003e J Clin Oncol, 2021. \u003cstrong\u003e39\u003c/strong\u003e(17): p. 1878-1887.\u003c/li\u003e\n\u003cli\u003eZeiser, R. and B.R. Blazar, \u003cem\u003eAcute graft-versus-host disease\u0026mdash;biologic process, prevention, and therapy.\u003c/em\u003e N Engl J Med, 2017. \u003cstrong\u003e377\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eHarris, A.C., et al., \u003cem\u003eInternational, Multicenter Standardization of Acute Graft-versus-Host Disease Clinical Data Collection: A Report from the Mount Sinai Acute GVHD International Consortium.\u003c/em\u003e Biol Blood Marrow Transplant, 2016. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 4-10.\u003c/li\u003e\n\u003cli\u003eCahn, J.Y., et al., \u003cem\u003eProspective evaluation of 2 acute graft-versus-host (GVHD) grading systems: a joint Soci\u0026eacute;t\u0026eacute; Fran\u0026ccedil;aise de Greffe de Mo\u0026euml;lle et Th\u0026eacute;rapie Cellulaire (SFGM-TC), Dana Farber Cancer Institute (DFCI), and International Bone Marrow Transplant Registry (IBMTR) prospective study.\u003c/em\u003e Blood, 2005. \u003cstrong\u003e106\u003c/strong\u003e(4): p. 1495-500.\u003c/li\u003e\n\u003cli\u003eAnsari, M., et al., \u003cem\u003eGSTA1 diplotypes affect busulfan clearance and toxicity in children undergoing allogeneic hematopoietic stem cell transplantation: a multicenter study.\u003c/em\u003e Oncotarget., 2017. \u003cstrong\u003e8\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eAnsari, M., et al., \u003cem\u003eGenetic susceptibility to hepatic sinusoidal obstruction syndrome in pediatric patients undergoing hematopoietic stem cell transplantation.\u003c/em\u003e Biol. Blood Marrow Transplant, 2020. \u003cstrong\u003e26\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eAnsari, M., et al., \u003cem\u003eGenetic susceptibility to acute graft versus host disease in pediatric patients undergoing HSCT.\u003c/em\u003e Bone Marrow Transplantation, 2021. \u003cstrong\u003e56\u003c/strong\u003e(11): p. 2697-2704.\u003c/li\u003e\n\u003cli\u003ePrzepiorka, D., et al., \u003cem\u003e1994 Consensus Conference on Acute GVHD Grading.\u003c/em\u003e Bone Marrow Transplant., 1995. \u003cstrong\u003e15\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eLi, H. and R. Durbin, \u003cem\u003eFast and accurate short read alignment with Burrows-Wheeler transform.\u003c/em\u003e Bioinformatics, 2009. \u003cstrong\u003e25\u003c/strong\u003e(14): p. 1754-60.\u003c/li\u003e\n\u003cli\u003e\u003cem\u003ePicard tools. \u003c/em\u003e. (2018). ; Available from: https://broadinstitute.github.io/picard/.\u003c/li\u003e\n\u003cli\u003eLi, H., \u003cem\u003eAligning sequence reads, clone sequences and assembly contigs with BWA-MEM.\u003c/em\u003e arXiv preprint arXiv:1303.3997, 2013.\u003c/li\u003e\n\u003cli\u003eKawaguchi, S., et al., \u003cem\u003eHLA-HD: An accurate HLA typing algorithm for next-generation sequencing data.\u003c/em\u003e Hum Mutat, 2017. \u003cstrong\u003e38\u003c/strong\u003e(7): p. 788-797.\u003c/li\u003e\n\u003cli\u003eZhang, M.J., et al., \u003cem\u003eComparison of outcomes after HLA-matched sibling and unrelated donor transplantation for children with high-risk acute lymphoblastic leukemia.\u003c/em\u003e Biol Blood Marrow Transplant, 2012. \u003cstrong\u003e18\u003c/strong\u003e(8): p. 1204-10.\u003c/li\u003e\n\u003cli\u003eMorishima, Y., et al., \u003cem\u003eSignificance of ethnicity in the risk of acute graft-versus-host disease and leukemia relapse after unrelated donor hematopoietic stem cell transplantation.\u003c/em\u003e Biol Blood Marrow Transplant, 2013. \u003cstrong\u003e19\u003c/strong\u003e(8): p. 1197-203.\u003c/li\u003e\n\u003cli\u003eKanda, J., et al., \u003cem\u003eGraft-versus-Host Disease after HLA-Matched Sibling Bone Marrow or Peripheral Blood Stem Cell Transplantation: Comparison of North American Caucasian and Japanese Populations.\u003c/em\u003e Biol Blood Marrow Transplant, 2016. \u003cstrong\u003e22\u003c/strong\u003e(4): p. 744-751.\u003c/li\u003e\n\u003cli\u003eKumar, A.J., et al., \u003cem\u003eGraft-versus-host disease in recipients of male unrelated donor compared with parous female sibling donor transplants.\u003c/em\u003e Blood Adv, 2018. \u003cstrong\u003e2\u003c/strong\u003e(9): p. 1022-1031.\u003c/li\u003e\n\u003cli\u003eLtd., M.S. \u003cem\u003eMedCalc \u0026ndash; Statistical Software for Biomedical Research\u003c/em\u003e. 2025; Available from: https://www.medcalc.org.\u003c/li\u003e\n\u003cli\u003eGagn\u0026eacute;, V., et al., \u003cem\u003eHLA alleles associated with asparaginase hypersensitivity in childhood ALL: a report from the DFCI Consortium.\u003c/em\u003e Pharmacogenomics, 2020. \u003cstrong\u003e21\u003c/strong\u003e(8): p. 541-547.\u003c/li\u003e\n\u003cli\u003eBaxter-Lowe, L.A., \u003cem\u003eThe changing landscape of HLA typing: Understanding how and when HLA typing data can be used with confidence from bench to bedside.\u003c/em\u003e Hum Immunol, 2021. \u003cstrong\u003e82\u003c/strong\u003e(7): p. 466-477.\u003c/li\u003e\n\u003cli\u003ePanch, S.R., et al., \u003cem\u003eSources of Hematopoietic Stem and Progenitor Cells and Methods to Optimize Yields for Clinical Cell Therapy.\u003c/em\u003e Biology of Blood and Marrow Transplantation, 2017. \u003cstrong\u003e23\u003c/strong\u003e(8): p. 1241-1249.\u003c/li\u003e\n\u003cli\u003eSpellman, S.R., \u003cem\u003eHematology 2022\u0026mdash;what is complete HLA match in 2022?\u003c/em\u003e Hematology, 2022. \u003cstrong\u003e2022\u003c/strong\u003e(1): p. 83-89.\u003c/li\u003e\n\u003cli\u003ePetersdorf, E.W., et al., \u003cem\u003eHigh HLA-DP Expression and Graft-versus-Host Disease.\u003c/em\u003e N Engl J Med, 2015. \u003cstrong\u003e373\u003c/strong\u003e(7): p. 599-609.\u003c/li\u003e\n\u003cli\u003eCrivello, P., et al., \u003cem\u003eFunctional distance between recipient and donor HLA-DPB1 determines nonpermissive mismatches in unrelated HCT.\u003c/em\u003e Blood, 2016. \u003cstrong\u003e128\u003c/strong\u003e(1): p. 120-9.\u003c/li\u003e\n\u003cli\u003eWalz, J.S., \u003cem\u003eThe immunopeptidome guides permissive HLA mismatch.\u003c/em\u003e Blood, 2021. \u003cstrong\u003e137\u003c/strong\u003e(7): p. 864-865.\u003c/li\u003e\n\u003cli\u003eChen, Y., et al., \u003cem\u003eRelationship between HLA alleles and cytomegalovirus infection after allogeneic hematopoietic stem cell transplant.\u003c/em\u003e Blood, 2001. \u003cstrong\u003e98\u003c/strong\u003e(2): p. 500-500.\u003c/li\u003e\n\u003cli\u003eLi, W., et al., \u003cem\u003eAssociation Between HLA-DRB1 Alleles and Graves\u0026apos; Disease in Asian Populations: A Meta-Analysis.\u003c/em\u003e Horm Metab Res, 2024. \u003cstrong\u003e56\u003c/strong\u003e(12): p. 859-868.\u003c/li\u003e\n\u003cli\u003eJee, S.H., et al., \u003cem\u003eHLA-DRB1*0701 and DRB1*1401 are associated with genetic susceptibility to psoriasis vulgaris in a Taiwanese population.\u003c/em\u003e Br J Dermatol, 1998. \u003cstrong\u003e139\u003c/strong\u003e(6): p. 978-83.\u003c/li\u003e\n\u003cli\u003eYamamoto-Furusho, J.K., et al., \u003cem\u003eAssociation of the HLA-DRB1*0701 allele with perinuclear anti-neutrophil cytoplasmatic antibodies in Mexican patients with severe ulcerative colitis.\u003c/em\u003e World J Gastroenterol, 2006. \u003cstrong\u003e12\u003c/strong\u003e(10): p. 1617-20.\u003c/li\u003e\n\u003cli\u003eAugusto, D.G., et al., \u003cem\u003eA common allele of HLA is associated with asymptomatic SARS-CoV-2 infection.\u003c/em\u003e Nature, 2023. \u003cstrong\u003e620\u003c/strong\u003e(7972): p. 128-136.\u003c/li\u003e\n\u003cli\u003eZou, J., et al., \u003cem\u003eMolecular disparity in human leukocyte antigens is associated with outcomes in haploidentical stem cell transplantation.\u003c/em\u003e Blood Advances, 2020. \u003cstrong\u003e4\u003c/strong\u003e(15): p. 3474-3485.\u003c/li\u003e\n\u003cli\u003eShaw, B.E., et al., \u003cem\u003eThe importance of HLA-DPB1 in unrelated donor hematopoietic cell transplantation.\u003c/em\u003e Blood, 2007. \u003cstrong\u003e110\u003c/strong\u003e(13): p. 4560-4566.\u003c/li\u003e\n\u003cli\u003eYao, Y., et al., \u003cem\u003eHLA Class II Genes HLA-DRB1, HLA-DPB1, and HLA-DQB1 Are Associated With the Antibody Response to Inactivated Japanese Encephalitis Vaccine.\u003c/em\u003e Front Immunol, 2019. \u003cstrong\u003e10\u003c/strong\u003e: p. 428.\u003c/li\u003e\n\u003cli\u003eFuchs, E.J., et al., \u003cem\u003eImproving Donor Selection for Haploidentical Stem Cell Transplantation with Post-Transplant Cyclophosphamide through Selective HLA-Mis/Matching.\u003c/em\u003e Blood, 2020. \u003cstrong\u003e136\u003c/strong\u003e(Supplement 1): p. 24-26.\u003c/li\u003e\n\u003cli\u003eVi\u0026eacute;, H., J. Gaschet, and N. Milpied, \u003cem\u003ePermissive, nonpermissive HLA-DPB1 epitope disparities and the specificity of T cells infiltrating the skin during acute graft-versus-host disease.\u003c/em\u003e Blood, 2011. \u003cstrong\u003e117\u003c/strong\u003e(21): p. 5779-5781.\u003c/li\u003e\n\u003cli\u003eFleischhauer, K., et al., \u003cem\u003eEffect of T-cell-epitope matching at HLA-DPB1 in recipients of unrelated-donor haemopoietic-cell transplantation: a retrospective study.\u003c/em\u003e The Lancet Oncology, 2012. \u003cstrong\u003e13\u003c/strong\u003e(4): p. 366-374.\u003c/li\u003e\n\u003cli\u003eArrieta-Bola\u0026ntilde;os, E., et al., \u003cem\u003eA core group of structurally similar HLA-DPB1 alleles drives permissiveness after hematopoietic cell transplantation.\u003c/em\u003e Blood, 2022. \u003cstrong\u003e140\u003c/strong\u003e(6): p. 659-663.\u003c/li\u003e\n\u003cli\u003eOran, B., et al., \u003cem\u003eEffect of nonpermissive HLA-DPB1 mismatches after unrelated allogeneic transplantation with in vivo T-cell depletion.\u003c/em\u003e Blood, 2018. \u003cstrong\u003e131\u003c/strong\u003e(11): p. 1248-1257.\u003c/li\u003e\n\u003cli\u003eSajulga, R., et al., \u003cem\u003eAssessment of HLA-DPB1 genetic variation using an HLA-DP tool and its implications in clinical transplantation.\u003c/em\u003e Blood Advances, 2023. \u003cstrong\u003e7\u003c/strong\u003e(17): p. 4809-4821.\u003c/li\u003e\n\u003cli\u003eRizvi, S.M., et al., \u003cem\u003eDistinct Assembly Profiles of HLA-B Molecules.\u003c/em\u003e The Journal of Immunology, 2014. \u003cstrong\u003e192\u003c/strong\u003e(11): p. 4967-4976.\u003c/li\u003e\n\u003cli\u003eMorishima, S., et al., \u003cem\u003eEvolutionary basis of HLA-DPB1 alleles affects acute GVHD in unrelated donor stem cell transplantation.\u003c/em\u003e Blood, 2018. \u003cstrong\u003e131\u003c/strong\u003e(7): p. 808-817.\u003c/li\u003e\n\u003cli\u003eFlowers, M.E.D., et al., \u003cem\u003eComparative analysis of risk factors for acute graft-versus-host disease and for chronic graft-versus-host disease according to National Institutes of Health consensus criteria.\u003c/em\u003e Blood, 2011. \u003cstrong\u003e117\u003c/strong\u003e(11): p. 3214-3219.\u003c/li\u003e\n\u003cli\u003eShahzad, M., et al., \u003cem\u003eFactors Associated with Acute and Chronic Graft-Versus-Host Disease after Matched Unrelated Donor Hematopoietic Cell Transplantation Using Posttransplant Cyclophosphamide-Based GvHD Prophylaxis.\u003c/em\u003e Blood, 2024. \u003cstrong\u003e144\u003c/strong\u003e(Supplement 1): p. 2147-2147.\u003c/li\u003e\n\u003cli\u003eShreders, A., et al., \u003cem\u003eUsing Whole Exome Sequencing to Identify Genetic Variation and Polymorphisms Associated with Graft Versus Host Disease in Allogeneic Stem Cell Transplant Recipients.\u003c/em\u003e Blood, 2015. \u003cstrong\u003e126\u003c/strong\u003e(23): p. 5414-5414.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bone-marrow-transplantation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"bmt","sideBox":"Learn more about [Bone Marrow Transplantation](http://www.nature.com/bmt/)","snPcode":"41409","submissionUrl":"https://mts-bmt.nature.com/cgi-bin/main.plex","title":"Bone Marrow Transplantation","twitterHandle":"@bmtjournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6821862/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6821862/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGraft Versus Host Disease (GVHD) is a common complication of allogeneic hematopoietic stem cell transplantation (HSCT). Previous studies suggest that genes coding for different components of the immune system, like human leukocyte antigen (HLA), may contribute to the development of GVHD. This study evaluates associations between patients\u0026rsquo; HLA alleles and higher grades of acute (a) GVHD to identify potential marker of this HSCT complication. The HSCT pediatric patients recruited were distributed in discovery (n\u0026thinsp;=\u0026thinsp;87) and replication (n\u0026thinsp;=\u0026thinsp;154) cohorts. The genotypes were obtained through whole exome sequencing (WES) for discovery cohort and by allele specific PCR for associated alleles for replication cohort. Fifty-eight HLA alleles with carrier frequency above 5% were identified from WES data and analyzed with aGVHD grades II-IV. Two HLA alleles, \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e and \u003cem\u003eHLA-B*15:01\u003c/em\u003e, were associated with higher aGVHD risk, (p\u0026thinsp;=\u0026thinsp;0.004 and p\u0026thinsp;=\u0026thinsp;0.009, respectively). Stratifications according to the donor type revealed positive associations limited to HLA-matched unrelated donors (p\u0026thinsp;=\u0026thinsp;0.007 and p\u0026thinsp;=\u0026thinsp;0.0009, respectively). Furthermore, carriers of either HLA allele were more likely to have non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatches (p\u0026thinsp;=\u0026thinsp;0.008 and p\u0026thinsp;=\u0026thinsp;0.015, respectively). Overall, these findings could influence clinical decisions in donor selection, as the presence of \u003cem\u003eHLA-B*15:01\u003c/em\u003e and/or \u003cem\u003eHLA-DRB1*07:01\u003c/em\u003e might suggest the presence of a non-permissive \u003cem\u003eHLA-DPB1\u003c/em\u003e mismatch.\u003c/p\u003e","manuscriptTitle":"Roles of HLA-DRB107 :01 and HLA-B15 :01 in the risk of acute Graft Versus Host Disease in pediatric patients undergoing HSCT","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-25 10:27:11","doi":"10.21203/rs.3.rs-6821862/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-09-03T15:02:13+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-08-13T11:17:14+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-28T11:08:58+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-14T13:36:11+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-07T08:08:17+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-06-19T08:57:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-05T11:08:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-04T15:05:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"Bone Marrow Transplantation","date":"2025-06-04T15:05:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bone-marrow-transplantation","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"bmt","sideBox":"Learn more about [Bone Marrow Transplantation](http://www.nature.com/bmt/)","snPcode":"41409","submissionUrl":"https://mts-bmt.nature.com/cgi-bin/main.plex","title":"Bone Marrow Transplantation","twitterHandle":"@bmtjournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6dd4b2da-8d17-4c34-b920-c3c4c2127d61","owner":[],"postedDate":"June 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":50285461,"name":"Health sciences/Risk factors"},{"id":50285462,"name":"Health sciences/Medical research/Genetics research"},{"id":50285463,"name":"Biological sciences/Genetics/Clinical genetics/Genetic testing"}],"tags":[],"updatedAt":"2026-02-04T12:02:28+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-25 10:27:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6821862","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6821862","identity":"rs-6821862","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.