The dual actions of host miRNA-16a in restricting bovine coronavirus (BCoV) replication through targeting the host cell Furin and enhancing the host immune response

The dual actions of host miRNA-16a in restricting bovine coronavirus (BCoV) replication through targeting the host cell Furin and enhancing the host immune response | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The dual actions of host miRNA-16a in restricting bovine coronavirus (BCoV) replication through targeting the host cell Furin and enhancing the host immune response Abid Ullah Shah, Maged Gomaa Hemida This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4498403/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The roles of host cell miRNAs have not been well studied in the context of BCoV replication and immune regulation. The main aim of this study was to identify miRNA candidates that regulate essential host genes involved in BCoV replication, tissue tropism, and immune regulation. To achieve these goals, we used two isolates of BCoV (enteric and respiratory) to infect bovine endothelial cells (BECs) and Madine Darby Bovine Kidney (MDBK) cells. This is in addition to the ex vivo model using peripheral bovine blood mononuclear cells (PBMCs). We determined the miRNA expression profiles of these cells after BCoV infection. The expression of miR-16a is differentially altered during BCoV infection. Our data show that miRNA-16a is a significantly downregulated miRNA in both in vitro and ex vivo models. We confirmed the miRNA-16a expression profile by qRT‒PCR. Overexpression of pre-miRNA-16a in the BEC and MDBK cell lines markedly inhibited BCoV infection, as determined by the viral genome copy numbers measured by qRT‒PCR, viral protein expression (S and N) measured by Western blot, and virus infectivity using a plaque assay. Our bioinformatic prediction showed that Furin is a potential target of miRNA-16a. We compared the Furin protein expression level in pre-miRNA-16a-transfected/BCoV-infected cells to that in pre-miRNA-scrambled-transfected cells. Our qRT‒PCR and Western blot data revealed marked inhibition of Furin expression at the mRNA level and at the protein level, respectively. BCoV-S protein expression was markedly inhibited at both the mRNA and protein levels. To further confirm the impact of the downregulation of the Furin enzyme on the replication of BCoV, we transfected cells with specific Furin-siRNAs parallel to the scrambled siRNA. Marked inhibition of BCoV replication was observed in the Furin-siRNA-treated group. To further validate Furin as a novel target for miRNA-16a, we cloned the 3'UTR of bovine Furin carrying the seed region of miRNA-16a in a dual luciferase vector. Our data showed that luciferase activity in pre-miRNA-16a-transfected cells decreased by more than 50% compared to that in cells transfected with the construct carrying the mutated Furin seed region. Our data confirmed that miRNA-16a inhibits BCoV replication by targeting the host cell line Furin and the BCoV-S glycoprotein. It also enhances the host immune response, which contributes to the inhibition of viral replication. To our knowledge, this is the first study to confirm that Furin is a valid target of miRNA-16a. Our findings highlight the clinical applications of host miRNA-16a as a potential miRNA-based vaccine/antiviral therapy. BCoV enteric respiratory tropism spike nucleocapsid gene regulation Furin IL6 cytokine expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Bovine coronavirus (BCoV) was recently classified under the order Nidovirales in the family Coronaviridae, subfamily Orthocoronavirinae, genus Betacoronavirus , and subgenus Embecovirus ( 1 ). Both BCoV and severe acute respiratory syndrome coronavirus (SARS-CoV)-1 and − 2 belong to the genus Betacoronavirus. These viruses share some common characteristics at the phenotypic and genotypic levels. Although BCoV was reported several decades ago, many aspects of viral replication and virus/host interactions have not yet been explored. This contrasts with SARS-CoV-2, the cause of the COVID-19 pandemic; intensive studies have been carried out and revealed many novel aspects of the SARS-CoV-2/host interaction. Viral entry is a crucial step in the coronavirus replication cycle. Angiotensinogen converting enzyme-2 (ACE2) has been proven to be the functional receptor for SARS-CoV-2 ( 2 ). Transmembrane protease serine 2 (TMPRSS2) plays essential roles in SARS-CoV-2 attachment and entry into host cells through cleavage of the viral spike glycoprotein at specific sites. S protein cleavage activates BCoV infection in host cells and contributes to virus entry into host cells ( 3 ). The roles of neuropilin-1 (NRP-1) in SARS-CoV-2 entry into cells have recently been studied ( 4 ). NRP-1 binds to the cleaved substrate of the host cell Furin, which enhances virus replication and plays an essential role in viral immune evasion ( 4 ). However, the roles of Furin, ACE2, TMPRRS2, and NRP-1 in BCoV replication have not yet been studied. The BCoV genome is a single molecule of positive sense RNA (ssRNA, +Ve). The BCoV genome has the typical genome structure and organization of most coronaviruses. The genome is flanked by two untranslated regions at the 5' and 3' ends. The 5' two-thirds of the genome consists of a large gene called gene-1, which is composed of two overlapping open reading frames (ORFs) with a ribosomal frameshift. Gene-1 of BCoV is further processed into 16 nonstructural proteins (NSP1-16). The 3' one-third of the BCoV genome is occupied by five major structural proteins (hemagglutinin esterase (HE), spike glycoprotein (S), the envelope (E), and the nucleocapsid protein (N)) interspersed with other nonstructural proteins ( 5 ). BCoV infection causes several clinical syndromes in affected cattle, including calf diarrhea and winter dysentery, and it also contributes to the development of the bovine respiratory disease complex, along with other bacterial pathogens ( 6 ). Most coronaviruses require initial cleavage steps by some host cell proteases, particularly serine proteases, to initiate active infection in the target host. Furin cleavage of the SARS-CoV-2 spike protein is a prerequisite for viral infection in target hosts ( 7 ). Viral tropism heavily depends on the availability of specific cellular receptors that help the virus enter host cells and hijack the cellular machinery to favor viral protein synthesis instead of cellular proteins ( 8 ). Other factors may also contribute to this tissue tropism, such as the presence of some auxiliary receptors and the presence of some transcription and translation factors ( 9 ). BCoV exhibits dual tissue tropism in affected cattle (enteric and respiratory) ( 10 ). The mechanisms that fine-tune this dual tissue tropism have not been well studied. Host cell microRNAs (miRNAs) are small RNAs. molecules (21–25 nucleotides in length) that play important roles in gene regulation at the translation level. miRNA candidates usually bind to certain regions in the 3'UTR of target genes, leading to translation inhibition or repression ( 11 ). There is an important region in the structure of each miRNA called the seed region, which is usually located at positions 2–8 nucleotides at the 5' end of the miRNA ( 12 ). The mechanism of action of each miRNA molecule is mainly governed by the degree of complementarity between the miRNA seed region and the complementary region in each mRNA ( 13 ). Some D.N.A. viruses, especially herpes viruses, encode viral miRNAs ( 14 ). In contrast, RNA viruses do not usually end their own miRNAs. However, host cell miRNAs play important roles in both D.N.A. and RNA viral replication, tropism, and immune regulation/evasion ( 8 ). Little is known about the role of host cell miRNAs in the molecular biology of BCoV. We recently identified some potential host cell miRNAs that may play essential roles in the molecular pathogenesis of BCoV and could partially explain this virus's dual tropism phenomenon ( 15 ). It has been shown that miRNA-16a is involved in many processes, including the cell cycle and tumor formation. miRNA-16 also acts as a diagnostic marker, is involved in gene regulation, and acts as a potential therapeutic target for hepatitis C virus (HCV) infection in humans ( 16 , 17 ). However, the roles of miRNA-16a in BCoV replication immune regulation/evasion have not yet been studied. Our data showed that miRNA-16a expression is differentially altered during BCoV/Ent/Resp isolate infection. The main goals of the current study were to confirm the differential expression of miRNA-16a in the context of BCoV infection, to study the impacts of miRNA-16a overexpression on BCoV replication and to study the mechanism of action of miRNA-16a in the fine-tuning of BCoV replication and immune regulation. Materials and Methods 3.1. Viruses and Cell Lines: Bovine pulmonary artery endothelial cells (BECs), ATCC® CRL­1733™) were obtained from the ATCC. The BEC. The cells were tested for the absence of BVDV. The BEC. The cells were cultured in F12 media (ATCC, 30-2004) supplemented with 10% horse serum (H.S.) (Gibco; Ref. No. 26050-088), 1% 10,000 µg/mL streptomycin and 10,000 units/mL penicillin antibiotics (Gibco; Ref. No. 15140-122). Madine Darby Bovine Kidney (MDBK) cells were kindly provided by Dr. Udeni B. R. Balasuriya, Louisiana State University). The MDBK cells were cultured in Minimum Essential Medium Eagle media (Sigma‒Aldrich, Cat. No. M0200-500ML) supplemented with 10% horse serum and 1% streptomycin and penicillin antibiotics. The cells were incubated at 37°C in 5% CO 2 for subsequent culture. Human embryonic kidney 293 (HEK-293) cells were obtained from the ATCC (Catalog # CRL-3216™) and used in the dual luciferase assay as described below (section 3.10). Two bovine coronavirus (BCoV) isolates were used; the enteric isolate 'Mebus' ( 18 ) was obtained from B.E.I. resources (B.E.I. Resources, NIAID, N.I.H.: Bovine Coronavirus (BCoV), Mebus, NR-445). The respiratory isolate of BCoV was kindly provided by Dr. Aspen Workman (Animal Health Genomics Research Unit, USDA, A.R.S., U.S. Meat Animal Research) ( 19 ). 3.2. Next-generation sequencing (NGS) and host cell miRNA expression profiles during BCoV replication. The BECs were infected independently with either BCoV enteric or BCoV respiratory isolates at a multiplicity of infection (MOI = 1). The infected cells were observed under an inverted microscope daily for up to 4 days post-infection (4 dpi). We monitored the infected cells for the development of any cytopathic effects (C.P.E.) for up to five days post-infection (5 dpi). Compared to the sham (phosphate-buffered saline; PBS)-infected cells, cells infected with BCoVs showed some morphological changes, such as rounding and detachment from the confluent monolayer sheet. We collected cell culture supernatants from all groups of infected cells, including the sham-infected group. We extracted the total miRNAs using the miRNeasy Micro Kit (Qiagen: Cat. No. 217084) per the manufacturer's instructions. The total miRNAs were submitted to L.C. Sciences (L.C. Sciences, L.L.C., 2575 West Belfort Street, Houston, TX 77054, USA) for the reporting of the miRNA expression profiles in various treated groups of cells. Briefly, all the extracted RNA was used for library preparation following Illumina's TruSeq small RNA sample preparation protocols (Illumina, San Diego, CA, U.S.A.). Quality control analysis and quantification of the D.N.A. library were performed using an Agilent Technologies 2100 Bioanalyzer High Sensitivity D.N.A. Chip. Single-end sequencing of 50 bp fragments was performed on an Illumina HiSeq 2500 sequencing system following the manufacturer's recommended protocols. Differential expression of miRNAs based on normalized deep-sequencing counts was analyzed using various statistical tests, including Fisher’s exact test, the chi-squared 2X2 test, the chi-squared nXn test, Student's t test, or ANOVA, depending on the experimental design. We used the Protein Analysis Through Evolutionary Relationships (PANTHER) classification version 9.0 to describe the function and properties of host genes and their related pathways with differential expression. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and heatmaps used in this study were designed using an online data analysis and visualization platform ( https://www.bioinformatics.com.cn/en ). 3.3. Determination of the miRNA expression profiles following BCoV/Ent or BCoV/Rep isolate infection We tested MDBK, BECs, and PBMCs to confirm the miRNA expression profiles obtained from the NGS data. We infected each group of cells with either the BCoV/Ent or BCoV/Resp isolates parallel to the sham (PBS)-infected cells. Following the manufacturer’s instructions, total miRNAs were isolated using a Pure Link miRNA isolation kit (Invitrogen; REF: K157001). We used a Nanodrop OneC (Thermo Fisher Scientific) to determine the quality and concentration of the extracted total RNA from all treated groups of cells. The complementary D.N.A. (cDNA) and the quantitative reverse transcriptase-polymerase chain reaction (qRT‒PCR) were performed using the All-in-One miRNA qRT‒PCR Detection Kit 2.0 (GeneCopoeia; Cat. No. QP115) following the manufacturer’s instructions. All the primers for miRNAs were designed using sRNAPrimerDB ( 20 ). The relative expression of miRNAs was normalized to that of the endogenous reference U6 according to the 2 −ΔΔCt method ( 21 ). All the miRNA primers used in this study are listed in Table 1 . Table 1 List of the oligonucleotides used for the amplification of miRNA expression profiles. Bovine miRNA Sense Primers (5' to 3') Source bta-miRNA-16a-F AACCGGTAGCAGCACGTAAATAT This Study bta-miR-Uni Rev-R CAGTGCAGGGTCCGAGGT This Study bta-U6-F GCTTCGGCAGCACATATACTAAAAT This Study bta-U6-R CGCTTCACGAATTTGCGTGTCAT 3.4. Host mRNA Extraction, amplification, and Quantification Total RNA was isolated from MDBK cells, BECs, and PBMCs and from infected and control cells. We used TRIzol LS Reagent (Invitrogen; REF: 10296010) to isolate total RNA from these groups of cells. The RNA concentrations were analyzed with a NanoDrop OneC (Thermo Fisher Scientific). According to the manufacturer's instructions, total RNA was transcribed into cDNA using a high-capacity reverse transcription kit (Applied Biosystems; Lot: 2902953). Real-time PCR was performed using Power-Up SYBR Green Master Mix (Applied Biosystems; Lot: 2843446) in QuantStudio3 (Applied Biosystems). We used the online primer software Primer3 ( 22 ) to design the oligonucleotides used to amplify the host genes and other oligonucleotides used to amplify the partial BCoV-S and N genes. The relative gene and BCoV/S and BCoV/N gene expression levels were normalized to that of β-actin according to the 2 −ΔΔCt protocol described earlier ( 21 ). The viral and host gene oligonucleotide sequences are listed in Table 2 . Table 2 List of the oligonucleotides used for the host gene and cytokine expression profiling. Bovine miRNA Sense Primers (5' to 3') Source I.F.N.-a-F AGGTTCACAGAGTCACCCAC This Study I.F.N.-a-R AGACCCTTCTCAGTTGTTGC IFN-β-F TGTTTCTCCACCACAGCTCT This Study IFN-β-R TTGCTTCATCTCCTCAGGCA IFN-γ-F TCCGGCCTAACTCTCTCCTA This Study IFN-γ-R GCCCACCCTTAGCTACATCT β-actin-F CAAGTACCCCATTGAGCACG This Study β-actin-R GTCATCTTCTCACGGTTGGC IL-10-F TGCTGGATGACTTTAAGGG This Study IL-10-R AGGGCAGAAAGCGATGACA TNF-a-F TAACAAGCCGGTAGCCCACG This Study TNF-a-R GCAAGGGCTCTTGATGGCAGA TGF-β-F TTCTTCAACACGTCCGAGCTC This Study TGF-β-R AGCGCCAGGAATTGTTGCTAT IL-6-F TCTGGGTTCAATCAGGCGAT This Study IL-6-R GTCAGTGTTTGTGGCTGGAG ACE2-F GCTGTCGGGGAAATCATGTC This Study ACE2-R TCTCTCGCTTCATCTCCCAC Furin-F CGAGAAGAACCACCCAGACT This Study Furin-R CTACGCCACAGACACCATTG NRP1-F CCAGAAGCCAGAGGAGTACG This Study NRP1-R GCCTTTTCCGATTTCACCCT TMPRSS2-F CCTTCTTAGCAGCCCAGAGT This Study TMPRSS2-R CATCTTCAAGGGAGGCCAGA BCoV-F CTGGAAGTTGGTGGAGTT ( 23 ) BCoV-R ATTATCGGCCTAACATACATC 3.5. In silico miRNA target gene prediction We used an online miRNA prediction tool (TargetScan 8.0) ( 24 ) to predict and identify the target genes of some candidate bovine miRNAs (bta-miRNAs). The selection criteria for the target genes included those genes showing a significant differential expression among cells infected with BCoV/Ent/BCoV/Rep or sham-treated cells, the fold changes in the expression of the target gene in the infected group of cells compared to that in the sham-infected group, and the roles of these DEGs in the molecular pathogenesis and replication of other coronaviruses. Multiple sequence comparisons of the miR-16a target site were also reported using TargetScan prediction tools. The potential binding sites of bta-miRNA-16a in the BCoV genome were predicted using three online miRNA target prediction tools, namely, RNA22 v2 ( https://cm.jefferson.edu/rna22/ ), miRanda ( 25 ), and psRNA ( 26 ). The targeted site selection was based on the minimum free energy and the complementarity between the miRNA seed region and the viral gene binding sites (nucleotides 2–8 on candidate miRNAs). The presence of at least six conserved complementary nucleotides between the candidate miRNA seed region and the target location in BCoV is a prerequisite for identifying potential target prediction sites. 3.6. Isolation of PBMCs, BCoV infection, and miRNA extraction protocols Bovine whole blood was obtained from Lampire Biological Laboratories (LAMPIRE® Biological Labs, Inc.). Briefly, blood was aseptically withdrawn from apparently healthy animals and subjected to quality control to ensure freedom from other pathogens and bacteria. The collected blood was mixed with 2% ethylenediaminetetraacetic acid ferric sodium salt (Millipore-Sigma, Catalog no: E6760). The blood was processed using Histopaque-1077 (Sigma; Lot. No. RNBL7068) following the manufacturer's instructions. PBMCs were isolated from the buffy coat through gradient centrifugation. The isolated PBMCs were cultured in RPMI-1640 (ATCC, 30-2001) supplemented with 10% horse serum and 1% streptomycin and penicillin antibiotics and incubated at 37°C in 5% CO 2 . After 24 hours, the PBMCs were infected with (MOI of BCoV/Ent or Resp) for two hours, followed by washing three times with sterile phosphate-buffered saline (PBS) and incubation at 37°C in 5% CO 2 . The PBMCs were harvested after 72 hpi and used in subsequent experiments. The miRNAs were extracted from the PBMCs as described above (section 3.4 ). 3.7. Transfection of miRNA mimics (pri-miRNAs) and small interfering RNAs (siRNAs) The bta-miRNA-16a mimic sequence "UAGCAGCACGUAAAUAUUGGUG" and the mirVana miRNA mimic negative control (scrambled miRNA) were purchased from Ambion, Inc. siRNA targeting the BCoV spike glycoprotein sense sequence "CUGCUAAGAUAUAUGGUAUUU", siRNA targeting the bovine Furin sense sequence "GCACAGAGAACGACGUGGAUU", and si-GENOME nontargeting siRNA (scrambled siRNA) were obtained from Dharmacon™. All miRNAs and siRNAs were transfected using Lipofectamine RNAi-MAX (Invitrogen; Ref. No. 13778-075) as described previously ( 27 ). The target cells (50% confluence) were transfected for 24 hrs of subculturing with the corresponding miRNA/siRNA molecules and then infected with BCoV/Ent, BCoV/Rep, or a sham for 48 hrs after the initial transfection. As described earlier, cells that were transfected and infected were incubated for 48–72 hours post-infection (hpi). The cell culture supernatants were collected and stored at -80°C for further processing, while the adherent cells were collected and processed for Western blot analysis as previously described ( 8 , 28 , 29 ). 3.8. BCoV infection protocol and the viral plaque assay The collected cell culture supernatants from different groups of treated cells were subjected to three cycles of freezing and thawing and used for the titration of BCoV infectivity by the plaque assay. The cell culture supernatants were incubated with TPCK Trypsin (Thermo Fisher Scientific; REF: 20233) as described elsewhere ( 30 , 31 ). An equal volume of ten µg/ml TPCK trypsin was added to each cell culture supernatant collected from variously treated cells (miRNA or siRNA treated and infected with either BCoV/Ent or BCoV/Resp independently). The cell culture supernatants containing BCoV or a sham-trypsin mixture were incubated for 30 minutes at 37°C. MDBK cells or human rectal tumor-18 (HRT-18) cells were grown in 6-well plates (1 × 10 6 ) and inoculated with 10-fold serially diluted BCoV cell culture supernatants. After 1 h of incubation, the supernatant was aspirated, and the cell monolayer was covered with 3 ml of 1.5% Sekam ME Agarose (Lonza; Cat. No. 50011), 2× EMEM (quality Biological; Cat. No. 115-073-101) supplemented with 1% penicillin streptomycin (Gibco; REF: 15140-122) and one µg/ml TPCK trypsin. The plate was incubated at 37°C and supplied with 5% CO 2 for 72 days. After 48 hrs of incubation, the cells were fixed with 4% paraformaldehyde (Thermo Fisher Scientific) overnight and stained with 1% crystal violet. The plaques were counted, and the BCoV infectivity titers per group of treated cells were calculated using the Reed and Muench method ( 32 ). 3.9. Western blot analysis The MDBK and BEC cells harvested from the various treatment groups were washed with cold PBS and then lysed with Pierce radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific; REF: 89901), 1% 0.5 M EDTA solution, and 1% Halt Protease & Phosphatase inhibitor (Thermo Fisher Scientific) for 5 min on ice. The collected protein samples were electrophoresed on a 10% SDS‒polyacrylamide gel (SDS‒PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Cat. No. 1620177). After blocking with 5% bovine serum albumin (BSA) in Tris-buffered saline (T.B.S.) buffer containing 0.05% Tween-20 (TBST), the PVDF membranes were incubated with the appropriate primary antibodies, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies in blocking solution. After three washes with TBST, immunoreactive bands were detected by film exposure after the addition of enhanced chemiluminescence (ECL) substrate (Bio-Rad catalog #1705060). All western blot bands were visualized with a GelDoc Go Imaging System (Bio-Rad Laboratories, Inc.) and analyzed with ImageJ software (San Diego, US). Bovine β-actin was used to normalize the relative expression levels of proteins. The primary antibodies were used to detect the expression levels of the BCoV-nucleocapsid mouse anti-bovine monoclonal (clone: FIPV3-70; cat. no. MA1-82189), BCoV-spike rabbit anti-bovine polyclonal (cat. no. PA5-117562), and β-actin rabbit anti-bovine polyclonal (cat. no. PA1-46296) antibodies were purchased from Invitrogen. Furin rabbit anti-bovine polyclonal (Cat. No. ARP45328_P050), ACE2 rabbit anti-bovine polyclonal (Cat. No. ARP53751_P050), TMPRSS2 rabbit anti-bovine polyclonal (Cat. No. ARP46628_P050), and anti-NRP1 rabbit anti-bovine polyclonal (Cat. No. ARP59101_P050) were purchased from Aviva Systems Biology. The corresponding secondary antibodies for each protein used, including horseradish peroxidase (H.R.P.)-conjugated IgG (H + L), goat anti-rabbit (REF: 31460), and goat anti-mouse (REF: 31430), were obtained from Invitrogen. The western blot band density was measured using ImageJ software ( 33 ). The mean band density of each protein was normalized by dividing its value by the mean band density of the housekeeping gene (B-actin) for each sample separately ( 33 ). 3.10. Cloning of the 3'UTR of bovine Furin and the mutated seed region of bta-miRNA-16a in the dual luciferase expression vector and dual luciferase assay The wild-type (WT) and mutant (Mut) binding sites of bta-miRNA-16a within the 3'UTR of bovine Furin were synthesized by a commercial provider (GenScript USA Inc.). Briefly, the WT Furin-3'UTR construct region spanning the binding region of bta-miRNA-16a was annealed and inserted between the SacI and XhoI regions of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Catalog number: E1330). Mutations within the bta-miRNA16a WT construct were generated by PCR-based site-directed mutagenesis. The binding region of Furin with bta-miRNA-16a was mutated from "5’-TGCTGCT-3'" to "5’-GATGATC-3'" according to the manufacturer's instructions. Both constructs were confirmed by restriction enzyme digestion and sequencing (S1 Fig). According to the manufacturer's instructions, the dual luciferase assay was conducted using the Pierce Renilla-Firefly Luciferase Dual Assay Kit (Thermo Scientific; Ref. No. 16185). To determine the expression levels of Furin in bta-miRNA-16a-transfected MDBK and HEK 293T cells, we plated the cells into 24-well plates and co-/transfected these cells with 100 ng of bta-miRNA-16a mimic and 100 ng of either pmiR-GLO-Furin-WT or pmiR-GLO-Furin-Mut plasmids using Lipofectamine 3000 (Invitrogen Catalog # L3000001) transfection reagent. An empty plasmid (pmiR-GLO) transfected with bta-miRNA-16a and pmiR-GLO-Furin-WT transfected with scrambled miRNA were used as negative controls. All experiments were repeated three independent times. 3.11. Statistical analysis All the reported results in this study are displayed as the means ± S.D.s and were analyzed with GraphPad Prism v9. One-way analysis of variance (ANOVA) with Tukey's or Dunnett's test was performed among multiple groups. Student's t test was used for paired comparisons among the samples. P values < 0.05 were considered to indicate statistical significance. Statistical significance in the figures is indicated as follows: * p < 0.05, ** p < 0.01, *** p < 0.001, *** p < 0.0001, and ns, not significant. The data were combined from at least three independent experiments unless otherwise stated. Results 4.1. Bovine Coronavirus (BCoV) Infection Induces Differential Display of Host Cell mRNA and miRNA Expression Profiles. Madine Darby Bovine Kidney (MDBK) and Bovine Vascular Endothelial (BEC) cells were infected with bovine coronavirus enterica (BCoV/Ent) and bovine coronavirus Resp (BCoV/Resp) at a multiplicity of infection (MOI) of 1. Cytopathic effects (C.P.E.) and morphological changes were observed in the infected cells at 72 hours post-infection (hpi) (Fig. 1A, 1B). Morphological observations of the BCoV-infected cells revealed more prominent CPE in the BCoV/Ent isolate-infected groups than in the BCoV/Resp isolate-infected groups, especially in the MDBK cells (Fig. 1A). The q-RT‒PCR results demonstrated that the BCoV/Ent and BCoV/Resp isolates were successfully infected and propagated on both MDBK and BEC cells (Fig. 1C, 1D). The magnitude of the BCoV genomic viral load was greater in the BCoV/Ent-infected groups than in the BCoV/Resp-infected groups (Fig. 1C, 1D). KEGG pathway enrichment analysis of the NGS data revealed significant virus-related pathways involved in the response to BCoV/Ent and BCoV/Resp infection (Fig. 1E, 1F). KEGG pathway enrichment analysis of the BCoV/Ent-infected group revealed significant differences in gene expression between the human cytomegalovirus (hCMV)-infected group and the hepatitis B-infected group (Fig. 1E). KEGG pathway enrichment analysis revealed that the coronavirus COVID-19 pathway had the greatest effect on the BCoV/Resp-infected group, followed by the hCMV and hepatitis B pathways (Fig. 1F). NGS revealed more differentially expressed host genes in the BCoV/Resp group (Fig. 1E). At the same time, miRNA expression patterns were consistent across both the BCoV/Ent and BCoV/Resp groups (Fig. 1F). These results highlight distinct infection patterns between BCoV/Ent and BCoV/Resp isolates in MDBK and BEC cells. Differential expression of host genes involved in various viral infections indicates a broad immune response. 4. 2. bta-miRNA-16a is differentially expressed in target cells during BCoV Ent/Resp infection. We analyzed the data obtained from the NGS experiments of the BCoV-infected cells to identify the potential miRNAs showing differential expression in the BCoV/Ent- and BCoV/Resp-infected groups (Fig. 2A). Our results showed that bta-miRNA-16a was downregulated in the BCoV/Ent group and upregulated in the BCoV/Resp group compared to the sham-infected group (Fig. 2A). In BCoV-infected MDBK cells, bta-miRNA-16a was significantly upregulated in the BCoV/Resp group, while no significant expression of bta-miRNA-16a was observed in the BCoV/Ent group (Fig. 2B). In BCoV-infected BECs, bta-miRNA-16a was downregulated up to 1.3-fold in the BCoV/Ent group and upregulated up to 1.74-fold in the BCoV/Resp group (Fig. 2C). Bovine PBMCs showed significant downregulation of bta-miRNA-16a (2.8-fold) in the BCoV/Ent-infected group, but no substantial changes in beta-miRNA-16a expression were observed in the BCoV/Resp group (Fig. 2D). These results demonstrated consistent expression patterns between the NGS and qRT‒PCR analyses, validating the differential expression pattern of bta-miRNA-16a in the BCoV/Ent- and BCoV/Resp-infected groups. 4. 3. The bta-miRNA-16a restricts BCoV replication. In silico analysis revealed that bta-miRNA-16a has multiple targeting sites across the BCoV genome, including one target in ORF1b and two other targets within the BCoV-spike glycoprotein (Table 3 ). To further validate this prediction, bta-miRNA-16a was independently transfected into MDBK and BEC cells, which were subsequently infected with BCoV/Ent/Resp in parallel with the scrambled miRNA (miRNA-Scr). qRT‒PCR analysis revealed significant upregulation of bta-miRNA-16a in the miRNA-16a-transfected group compared to the miRNA-Scr group in the MDBK and BEC cells (Fig. 3B, 3C). Our data showed that bta-miRNA-16a expression was downregulated after BCoV infection in nontransfected cells (Fig. 3B, 3C). Our results also revealed marked inhibition of BCoV genome expression in the bta-miRNA-16a-transfected groups compared to the miRNA-Scr-transfected MDBK and BEC groups (Fig. 3D, 3E). The viral plaque assay revealed up to 1.24-fold inhibition of BCoV infectivity in the bta-miRNA-16a-transfected group of cells (Fig. 3F). At the protein level, western blot analysis revealed significant inhibition of the BCoV-Nucleocapsid (BCoV-N) and BCoV-Spike (BCoV-S) proteins after bta-miRNA-16a transfection and BCoV infection in MDBK cells (Fig. 3G, 3H, and 3I). BECs showed marked inhibition of BCoV-N and BCoV-S protein expression (Fig. 3J, 3K, and 3L). These findings suggest that bta-miRNA-16a targets the spike protein of BCoV, playing a crucial role in restricting BCoV replication. Table 3 Online prediction of host bta-miRNA-16a targeting the BCoV genome at multiple locations Bovine miRNA BCoV Target Genes (Position) Predicted Consequential Pairing of miRNA (Top) and Target Region (Bottom) RNAv22 (folding energy) miRanda (Score) psRNA (Score) miR-16a ORF1b (13721) 3’GTGGTTATAAATGCACGACGAT ||||: ||:| ||||||| 5’TCGCAATGATTGCATGCTGCTT N/A 171 4.0 Spike (24762) 3’GTGGTTATAAATGCACGACGAT :|||||| |||||||| 5’TAATAATATT–GATGCTGCTA -14.40 160 N/A Spike (24928) 3’GTGGTTATAAATGCACGACGAT :|::| |||||| |||||||| 5’TATTATAATTTACCTGCTGCTA -17.90 160 3.5 The nucleotides highlighted in red represent the binding sites of bta-miRNA-16 with the corresponding target sites in the BCoV genome sequence. N/A is not applicable. 4. 4. The bovine Furin gene is a novel target for the host bta-miRNA-16a. To further evaluate the mechanism of action of bta-miRNA-16a-based inhibition of BCoV replication, in silico prediction was conducted between bta-miRNA-16a and several potential target host genes involved in BCoV infection. The binding region of Furin is conserved across different mammalian species, including humans and mice (Fig. 4A). The online bioinformatics tool "TargetScan" revealed that bta-miRNA-16a could target the 3'UTR of the bovine host cell Furin (Fig. 4B). Therefore, to examine the effect of bta-miRNA-16a on the expression levels of the host Furin at the mRNA and protein levels, bta-miRNA-16a was transfected into both MDBK and BEC cells, and the inhibition of host cellular Furin was observed. The mRNA of host cellular Furin was downregulated by up to 70% in the bta-miRNA-16a-transfected groups compared to the miRNA-Scr-transfected groups of MDBK cells (Fig. 4C). The protein level of Furin was downregulated by approximately 30% in the bta-miRNA-16a-transfected groups compared to the miR-Scr-transfected group in MDBK cells (Fig. 4D, 4E). In the BECs, up to 50% downregulation of the host furin protein was observed in the miRNA-16a-transfected groups (Fig. 4G, 4H). However, furin mRNA was not significantly downregulated in the miRNA-Scr-transfected BECs (Fig. 4F). To validate Furin as a potential novel target of bta-miRNA-16a, a dual-luciferase reporter plasmid containing the 3'UTR of Furin containing the binding region of bta-miRNA-16a was constructed (Fig. 4I). The Furin mutant was generated by site-directed mutagenesis of the bta-miRNA-16a binding region (Fig. 4I). The successful insertion of the 3'UTR of Furin and the mutant construct was validated by double digestion with the XhoI and SacI restriction enzymes, followed by gel-based PCR and nucleotide sequencing (Fig S1 A–S1D). The wild-type and mutant pmirGLO luciferase constructs were co-transfected with miR-16a or scrambled miRNA into HEK293 cells. The dual-luciferase assay revealed that co-transfection of wild-type Furin with miRNA-16a significantly reduced the relative luciferase activity by more than 50% compared to that in cells co-transfected with miRNA-Scr and wild-type Furin or bta-miRNA-16a co-transfected with mutated Furin (Fig. 4J). Overall, these results confirmed that bta-miRNA-16a can effectively target and significantly downregulate host cellular Furin. 4. 5. Applying siRNA targeting the BCoV-Spike Glycoprotein and the Host Furin Inhibits BCoV Replication at the Gene and Protein Expression Levels To confirm the effect of bta-miRNA-16a, which targets the BCoV-S protein and the cellular host cell Furin, on BCoV replication, we designed two sets of siRNAs. The first siRNA targets the bta-miRNA-16a target site within the BCoV/S glycoprotein. The second siRNA targeted bta-miRNA-16a in the 3'UTR of the host cell Furin. Bovine cells were transfected with siRNAs, followed by independent infection with BCoV/Ent or BCoV/Resp isolates. Samples were collected after 72 hpi for subsequent analysis (Fig. 5A). MDBK cells were transfected with different concentrations of siRNAs (50 ng or 100 ng). The results revealed a gradual reduction in the protein level of the bovine host Furin with increasing siRNA-Furin concentration (Fig. 5B, 5C). Similarly, the BCoV-spike protein exhibited a similar decrease in expression with increasing siRNA-spike concentration (Fig. 5D, 5E), confirming the efficacy of siRNAs in suppressing the production of BCoV-S and the host Furin. The mRNA expression level of the host cell Furin was also significantly lower in the Furin-siRNA-treated groups than in the Sc-siRNA-treated groups for both the MDBK and BEC strains. cells (Fig. 5F, 5G). Following the silencing of Furin and spike, we examined their impact on BCoV replication. The results revealed approximately 58% (≈ 2.39-fold) inhibition of BCoV at the genomic level in the siRNA-Furin-transfected MDBK cell group (Fig. 5H). In BECs, the inhibitory effects of the applied siRNAs were even more pronounced, with approximately 75% (≈ 4.26-fold) inhibition at the genomic level of BCoV (Fig. 5I). The inhibition of BCoV replication was particularly prominent in the BCoV/Ent-infected groups. Silencing of the BCoV-S glycoprotein resulted in approximately 61% (≈ 2.61-fold) inhibition of BCoV/Ent and approximately 74% (≈ 3.85-fold) inhibition of BCoV/Resp in BEC-treated cells (Fig. 5K). 4. 6. The application of BCoV-S glycoprotein siRNA and host cell-furin inhibited BCoV infectivity in host cells. A viral plaque assay was conducted to evaluate the impacts of siRNA-Furin and siRNA-BCoV-spike glycoproteins on the infectivity of the BCoV particles. Following transfection with siRNA-Furin and siRNA-BCoV-spike, MDBK cells were infected with BCoV, and cell lysates were analyzed to assess BCoV inhibition at the posttranscriptional level. The results showed an approximately 1.9-fold decrease in the infectivity level of the BCoV enteric isolate after silencing the host Furin (Fig. 6A). Silencing the BCoV spike protein in MDBK cells resulted in an approximately 1.47-fold decrease in BCoV infectivity (Fig. 6B). In MDBK-treated cells, Furin protein expression in the host decreased by approximately 50% after silencing the host Furin and by approximately 42% after silencing the BCoV spike glycoprotein (Fig. 6C, 6D). The results revealed approximately 2.5-fold inhibition of the BCoV spike protein in the siRNA-Furin group and approximately 1.38-fold inhibition in the siRNA-spike-transfected group compared to the scrambled group (Fig. 6C, 6E). In the host Furin-silenced group of cells, the BCoV nucleocapsid protein was inhibited approximately 1.79-fold and 1.97-fold in the BCoV/Ent- and BCoV/Resp-infected groups, respectively (Fig. 6C, 6F). Silencing of the BCoV spike protein inhibited the BCoV nucleocapsid protein by approximately 1.24-fold and 1.31-fold in the BCoV/Ent- and BCoV/Resp-infected groups, respectively (Fig. 6C, 6F). Notably, the downregulation of spike, nucleocapsid, and Furin was consistent in the control and BCoV-infected groups, indicating that siRNA-spike and siRNA-Furin inhibit protein production at the posttranscriptional level, independent of BCoV infection. 4. 7. The bta-miRA-16a modulates the expression levels of several essential coronavirus replication-related proteins (ACE2, NPR1, TMPRSS2) during BCoV replication. Herein, we evaluated the possible effect of bta-miRNA-16a on other host cell surface receptors involved in infections caused by other coronaviruses, particularly severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). MDBK cells were transfected with miRNA-Scr and bta-miRNA-16a, and the mRNA and protein expression levels of several selected host cell proteins were monitored (angiotensin-converting enzyme 2 (ACE2), transmembrane protease, serine 2 (TMPRSS2), and neuropilin-1 (NRP1)). The results revealed that ACE2 protein expression was inhibited by approximately 22% in the bta-miRNA-16a-transfected group compared to the miRNA-Scr-transfected group (Fig. 7A, 7C). In the bta-miRNA-16a-transfected group, the ACE2 mRNA was downregulated by up to 50% after BCoV infection (Fig. 7B). The host NRP1, mRNA, and protein expression markedly increased after BCoV infection in the miRNA-Scr-transfected cells but decreased in the bta-miRNA-16a-transfected cells, particularly after BCoV infection (Fig. 7A, 7D, 7E). The mRNA of TMPRSS2 was also downregulated after BCoV infection in the bta-miRNA-16a-transfected group of cells (Fig. 7F); however, no significant changes in protein expression levels between the miRNA-Scr- and bta-miRNA-16a-transfected groups were observed (Fig. 7A, 7G). 4. 8. Inhibition of host Furin expression through bta-miRNA-16 targeting potentially activates other alternative pathways to rescue host cells from BCoV infection. To further explore the roles of the host cell Furin in BCoV infection, two siRNAs were used to inhibit BCoV regulation by targeting the BCoV-S glycoproteins and the bta-miRNA-16 target sites within the 3'UTR of the host cell Furin. We independently transfected these two siRNAs into bovine cells and investigated the mechanism underlying the effects of bovine ACE2, TMPRSS2, and NRP1 during BCoV/Ent/Resp isolate infection. siRNA-BCoV-S and siRNA-Furin were transfected into MDBK cells, and the mRNA and protein expression levels of the host ACE2, TMPRSS2, and NRP1 were assessed using qRT‒PCR and Western blotting with the relevant antibodies, respectively. TMPRSS2 expression did not significantly change in the siRNA-Furin- or siRNA-BCoV-S-transfected cells (Fig. 8A, 8B, 8C). The host ACE2 mRNA and protein expression levels were significantly downregulated after siRNA-Furin transfection (Fig. 8A, 8D, 8E). ACE2 protein expression was also downregulated in the siRNA-spike-transfected group but only after BCoV infection (Fig. 8A, 8D, 8E). NRP1 mRNA and protein expression were similarly downregulated in the siRNA-Furin-transfected group but were downregulated only after BCoV infection in the siRNA-spike-transfected group (Fig. 8A, 8F, 8G). The mRNA expression of both ACE2 and NRP1 decreased after BCoV infection in the siRNA-BCoV-S-transfected group, suggesting their involvement in BCoV infection. These findings mirror the outcomes of bta-miRNA-16a transfection, suggesting a direct correlation between ACE2 and NRP1 expression and host Furin expression. In contrast, TMPRSS2 appears to operate independently of the host Furin upon BCoV infection. 4. 9. bta-miRNA-16 overexpression enhances cytokine gene expression in the context of BCoV infection. We investigated the impact of bta-miRNA-16a on the expression levels of host cell cytokines during BCoV infection. MDBK cells were transfected with miR-16a, siRNA-Furin, and siRNA-spike, and the mRNA expression of IFN-α, IFN-β, IFN-γ, IL-6 and IL-10 was assessed by qRT‒PCR using the designed oligonucleotides listed in Table 2 . The results showed significant upregulation of IFN-α, IFN-β, and IFN-γ in the bta-miRNA-16a-transfected group of cells compared to the miRNA-Scr-transfected group (Fig. 9A, 9B, 9C). The mRNA expression of host IL-6 and IL-10 was upregulated in the bta-miRNA-16a-transfected group, particularly post-BCoV/Ent infection (Fig. 9D, 9E). Moreover, IFN-α, IFN-β, and IFN-γ expression was downregulated in the siRNA-Furin- and siRNA-spike-transfected cells (Fig. 9F, 9G, 9H). Although the expression levels of IL-6 and IL-10 were upregulated in the siRNA-Furin and siRNA-BCoV-S groups following BCoV/Ent infection, the overall expression levels were lower than those in the siRNA-Scr-transfected group of cells (Fig. 9I, 9J). Discussion BCoV is an endemic viral pathogen in cattle populations worldwide, including in the USA. ( 34 ). The virus has dual respiratory/enteric tissue tropism ( 6 ). The mechanisms governing this dual tropism have not yet been well studied. The presence of viral receptors and other host cell proteases may partially explain this dual tropism; however, many aspects of the BCoV/host interaction, including their tissue tropism, have not yet been studied. However, the availability of viral receptors and some other host enzymes are not the sole agents that govern the success of viral replication or fully explain viral tropism. MicroRNAs are small RNA molecules that regulate host genes at the posttranslational level. Previous studies have shown that host miRNAs regulate the gene expression of many host proteins during many viral infections, including SARS-CoV-2. Several host cell miRNAs, including miRNA-(155, 221, and 146a), can act as biological markers for SARS-CoV-2 infection; they also play essential roles in regulating inflammatory responses during SARS-CoV-2 infection in humans ( 35 , 36 ). However, the role of host cell miRNAs has not been extensively studied in the context of BCoV infection. The main aim of this study was to determine the roles of some host miRNAs in BCoV replication, tissue tropism, and immune regulation/evasion. Our recent in silico prediction and bioinformatics search studies revealed that several host miRNAs could play essential roles in the context of BCoV replication and at least in part explain the dual tropism of BCoV infection ( 37 ). In this study, we focused on the function of beta-miRNA-16a, which shows some differential expression profiles during the replication of either enteric or respiratory isolates of BCoV. The miRNA/coronavirus interaction revealed some insights into the roles of these small RNA molecules in fine-tuning virus replication and immune regulation. It was predicted that the ability of hsa-miRNA-miR-8066 to target the SARS-CoV-2 nucleocapsid (N) protein leads to the inhibition of viral replication ( 38 ). Other studies have shown that at least seven host miRNAs (hsa-miRNA-(15a, 298, 497, 508, 1909, and 3130)) target the SARS-CoV-2-S glycoprotein at various locations, leading to substantial inhibition of virus replication ( 39 ). The candidates of the host miRNA-16 family are involved in many cellular processes, including cell cycle arrest, tumor research, and immune regulation, particularly the TGFβ pathway, and they are also used as diagnostic and prognostic markers for cancer research ( 40 , 41 , 42 , 43 , 44 , 45 ). Recent studies have shown that host miRNA-16-2-3p could be an excellent prognostic marker for SARS-CoV-2 infection in humans ( 46 ). However, the roles of bta-miRNA-16a in BCoV replication and immune regulation have not yet been studied. Most coronaviruses, including Betacoronaviruses, use host cell serine protease-2 (Furin) to cleave the spike glycoprotein at the PRRAR motif ( 47 ). Furin/CoV/S targeting plays an important role in CoV tissue tropism and molecular pathogenesis ( 48 ). Cleavage of the SARS-CoV-2 S glycoprotein is an essential step in virus replication. Transmembrane serine protease 2 (TMPRSS2) cleaves SARS-CoV-2-S, and another enzyme called Furin (another serine protease-2) is responsible for the proteolysis of the spike glycoprotein into the S1 and S2 domains ( 49 ). These two simultaneous cleavage events are essential for the replication of most coronaviruses, particularly during the entry of the virus into host cells. To further confirm and consolidate this phenomenon, other researchers have shown that deleting Furin cleavage sites from SARS-CoV-2-S substantially decreases virus replication and impacts downstream viral pathogenesis and tissue tropism ( 50 , 51 ). Our data revealed differential expression of bta-miRNA-16a in BCoV/Ent- and BCoV/Resp-infected MDBK and BEC cells (Fig. 2A-2D). There was a marked downregulation of the bta-miRNA-16a expression profile, especially in the case of BCoV/Ent-infected cells. Thus, we believe that the host responded to BCoV/Ent infection by downregulating bta-miRNA16a, which targets the 3’UTR of the host cell Furin. This bta-miRNA-16a targeting Furin inhibited BCoV replication at the genome copy number level, as measured by qRT‒PCR; at the viral protein level, including the BCoV/S and BCoV/N proteins; and at the virus infectivity level, as shown by plaque assays (Fig. 3D‒3 L). These data are very consistent with SARS-CoV-2 loss of Furin cleavage sites, which led to marked inhibition of SARS-CoV-2 replication ( 50 ). Several approaches, including bioinformatics, western blot, and dual luciferase assays, have been used to validate several genes as targets for candidate miRNAs, including the use of a dual luciferase assay on a potential gene 3’UTR construct carrying the seed region of the target miRNA. The comparison between the luciferase activity of the mutated 3’UTR construct of the miRNA target gene and that of the wild-type construct carrying the seed region of the same miRNA candidate was used extensively as a benchmark for miRNA/gene target validation ( 8 , 28 , 29 ). Our bioinformatic analysis of bta-miRNA-16a revealed that the seed region of this miRNA is highly conserved among the Furin 3’UTRs of several species of animals, including humans and bovine species (Fig. 4A). Our results showed that Furin protein expression was lower in MDBK cells and in BECs transfected with bta-miRNA-16 than in those transfected with scrambled miRNA (Fig. 4C-4G). The dual luciferase assay results showed marked inhibition of luciferase activity in cells transfected with the bta-miRNA-16a 3’UTR wild-type construct (Fig. 4J). Thus, Furin is considered a novel target of bta-miRNA-16a. Our data clearly showed that infection with both BCoV/Ent and BCoV/Resp inhibited interferon (α, β, and λ) production (Fig. 9A-9C). However, the overexpression of bta-miRNA-16a enhanced cytokine gene expression (Fig. 9A-9C). Consistently, it was previously shown that the BCoV-N protein inhibits IFN-β production via the RIG-I-like receptor (RLR) pathway ( 52 ). This confirms our findings about the dual actions of bta-miRNA-16a in the inhibition of BCoV infection and the enhancement of the host immune response to counteract viral infection. One of the approaches to confirm the action of certain miRNAs on their target genes is to use siRNAs to inhibit the same miRNA target region within these genes. To confirm the ability of bta-miRNA-16a to target the host cell Furin and the BCoV-S glycoprotein, we designed two independent siRNAs to target the indicated regions. Our plaque assay data showed that the application of siRNA-Furin and siRNA-S substantially inhibited BCoV replication in MDBK and BEC cells in terms of genome copy number, protein (S and N) expression, and virus infectivity (Figs. 5, 6). Our data are very much consistent with other research on other coronaviruses (CoVs), particularly SARS-CoV-2. The application of siRNAs targeting the SARS-CoV-2 S glycoprotein significantly inhibited virus replication ( 53 ). Similarly, using Furin inhibitors led to marked inhibition of SARS-CoV-2, which is considered a promising antiviral therapy for SARS-CoV-2 infection in humans ( 54 , 55 ). In addition to host ACE2, several alternative host surface receptors have been suggested to promote coronavirus infection in host cells. The alternative receptors for ACE2 in coronavirus infection include neuropilin-1 (NRP1) ( 4 , 56 ) and CD147, a transmembrane glycoprotein expressed in epithelial and immune cells ( 57 , 58 ). In most coronaviruses, including SARS-CoV-2, the spike protein undergoes two proteolytic cleavage steps after binding to ACE2. The first cleavage occurred at the S1-S2 boundary and was cleaved by the host cell Furin. Virus entry still requires a second cleavage by host cell proteases at the S2’ region, which is mostly performed by TMPRSS2 ( 2 ). If the host cell has a low level of TMPRSS2 or if the virus-ACE2 complex does not meet TMPRSS2, the complex is taken into the cell by clathrin-mediated endocytosis into the endo-lysosomes, where the S2 site is cleaved by cathepsins ( 59 , 60 ). In this study, we showed that host Furin inhibition by bta-miR-16a or by siRNA-Furin downregulates ACE2 and NRP1 mRNA and protein expression (Figs. 7, 8). However, no effect on TMPRSS2 expression was detected at the genomic or protein level (Fig. 7F, 7G, 8B, 8C). These findings suggest that bta-miR-16a downregulates the expression of the bovine host Furin, potentially inhibiting host ACE2 and NRP1 expression levels. Conversely, TMPRSS2 may compensate for these inhibitory effects of bta-miRNA-16a on Furin through an alternative regulatory mechanism to rescue BCoV infection in host cells following Furin and ACE2 inhibition. IL6 plays key roles in the regulation of the replication of some CoVs, particularly SARS-CoV-2, and in the modulation of the immune response ( 61 ). SARS-CoV-2 infection triggers robust IL6 production, which induces a cytokine storm ( 62 ). Similarly, BCoV infection, particularly infection with the BCoV/Ent isolate, upregulated the expression of IL6 (Fig. 9D). Furthermore, bta-miNRA-16a treatment increased IL6 expression in cells transfected with bta-miRNA-16a and infected with the BCoV-Ent isolate compared to that in the Scr-miRNA-transfected cells and infected with the BCoV/Ent isolate (Fig. 9D). These findings demonstrate that bta-miRNA-16a overexpression significantly activates the host cytokine response. Moreover, the prevalence of BCoV/Ent infection leads to elevated expression of host cytokines and interferons. Previous studies have shown that the miRNA-16 family is involved in cell cycle control, cell survival, and apoptosis pathways ( 43 ). This miRNA also controls the balance between cell survival and apoptosis. Our data show that bta-miRNA-16a enhances cell survival in transfected cells infected with either BCoV/Ent or BCoV/Resp compared to that in cells infected with the Scr-miRNA mimics (Fig. S2 A-S2D). These data could also be supported by the marked activation of host cytokine gene expression, as shown in section 4.4. Thus, the high stimulation of cytokines and the limitation of the CPE observed in the bta-miRNA-16a-transfected group of cells infected with BCoV contributed to the marked inhibition of virus replication. Consistent with these findings, cells treated with siRNA-BCoV-S showed less CPE than did the same type of cells transfected with the miRNA-Scr mimics (Fig. S2 A-S2D and Fig. S3 ). In summary, bta-miRNA-16a plays dual roles in the restriction of BCoV replication through targeting the spike glycoprotein and the host cell Furin. This bta-miRNA-16a/viral/host gene targeting inhibited BCoV replication. It also stimulated the production of some host cytokines, which contributed substantially to cell survival in the bta-miRNA-16-transfected cells compared to the Scr-miRNA-transfected cells (Fig. 10). Based on our findings in this study, we concluded that bta-miRNA-16a could be a promising diagnostic marker for BCoV infection. This study also highlights the potential antiviral therapeutic potential of bta-miNRA-16a and its feasibility in designing novel miRNA-based vaccines against BCoV in the future. Previously, it was reported that miR-29a and miR-378b enhance the host DNA-sensing pathway in the presence of CpG motifs and can be used as adjuvants for vaccines ( 63 ). Similarly, this study revealed that bta-miRNA-16a targets the host Furin and enhances interferon production. This highlights the importance of bta-miRNA-16a as a potential therapeutic avenue for BCoV infection in cattle. Declarations Acknowledgments We thank Drs. Udeni B. R. Balasuriya and Mariano Carossino, Louisiana State University, for kindly providing the Madine Darby Bovine Kidney (MDBK) and the human rectal tumor-18 (HRT-18) cells used in this study. We also thank Dr. Aspen Workman from the Animal Health Genomics Research Unit, USDA, A.R.S., U.S. Meat Animal Research, for kindly providing the bovine coronavirus respiratory isolate used in this study. Author Contributions M.G.H. conceptualized and designed the whole study, carried out some laboratory experiments, oversaw the entire research data analysis, wrote the manuscript, and submitted the manuscript. A.U.S. carried out the experiments and bioinformatic prediction, analyzed the data, and participated in writing the manuscript. All authors have read and agreed to the submitted version of the manuscript. Funding This study was funded by a seed grant from Long Island University (Grant no: 36524). Conflicts of interest The authors declare no conflicts of interest. Data availability statement All the data are available upon request from the corresponding author. References List IMS. https://talk.ictvonline.org/files/master-species-lists/m/msl/9601/download Accessed on 6 Apr 2020. 2019. Jackson CB, Farzan M, Chen B, Choe H. Mechanisms of SARS-CoV-2 entry into cells. Nat Rev Mol Cell Biol. 2022;23(1):3-20. Matsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, et al. Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells. Proc Natl Acad Sci U S A. 2020;117(13):7001-3. Cantuti-Castelvetri L, Ojha R, Pedro LD, Djannatian M, Franz J, Kuivanen S, et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science. 2020;370(6518):856-60. Suzuki T, Otake Y, Uchimoto S, Hasebe A, Goto Y. Genomic Characterization and Phylogenetic Classification of Bovine Coronaviruses Through Whole Genome Sequence Analysis. Viruses. 2020;12(2). Vlasova AN, Saif LJ. Bovine Coronavirus and the Associated Diseases. Front Vet Sci. 2021;8:643220. Peacock TP, Goldhill DH, Zhou J, Baillon L, Frise R, Swann OC, et al. The furin cleavage site in the SARS-CoV-2 spike protein is required for transmission in ferrets. Nat Microbiol. 2021;6(7):899-909. Hemida MG, Ye X, Thair S, Yang D. Exploiting the therapeutic potential of microRNAs in viral diseases: expectations and limitations. Mol Diagn Ther. 2010;14(5):271-82. Zheng M. Cellular Tropism of SARS-CoV-2 across Human Tissues and Age-related Expression of ACE2 and TMPRSS2 in Immune-inflammatory Stromal Cells. Aging Dis. 2021;12(3):718-25. Hodnik JJ, Jezek J, Staric J. Coronaviruses in cattle. Trop Anim Health Prod. 2020;52(6):2809-16. Shang R, Lee S, Senavirathne G, Lai EC. microRNAs in action: biogenesis, function and regulation. Nat Rev Genet. 2023;24(12):816-33. Parker JS, Roe SM, Barford D. Molecular mechanism of target RNA transcript recognition by Argonaute-guide complexes. Cold Spring Harb Symp Quant Biol. 2006;71:45-50. Kehl T, Backes C, Kern F, Fehlmann T, Ludwig N, Meese E, et al. About miRNAs, miRNA seeds, target genes and target pathways. Oncotarget. 2017;8(63):107167-75. Gouzouasis V, Tastsoglou S, Giannakakis A, Hatzigeorgiou AG. Virus-Derived Small RNAs and microRNAs in Health and Disease. Annu Rev Biomed Data Sci. 2023;6:275-98. Shah A, Hemida, MG. The Potential Roles of Host Cell miRNAs in Fine-Tuning Bovine Coronavirus (BCoV) Molecular Pathogenesis, Tissue Tropism, and Immune Regulation. Microorganisms. 2024;15(5). El Hawary AT, Nabil F, El Hendawy R, Mahrous HKA, AbdelHamid GA, Amer M. Serum microRNA-16 as a potential biomarker for HCV-induced hepato-cellular carcinoma in Egyptian patients. Egypt J Immunol. 2024;31(2):102-11. Yoneyama H, Morishita A, Iwama H, Fujita K, Masaki T, Tani J, et al. Identification of microRNA associated with the elimination of hepatitis C virus genotype 1b by direct-acting antiviral therapies. J Gastroenterol Hepatol. 2021;36(4):1126-35. McNulty MS, Bryson DG, Allan GM, Logan EF. Coronavirus infection of the bovine respiratory tract. Vet Microbiol. 1984;9(5):425-34. Workman AM, McDaneld TG, Harhay GP, Das S, Loy JD, Hause BM. Recent Emergence of Bovine Coronavirus Variants with Mutations in the Hemagglutinin-Esterase Receptor Binding Domain in U.S. Cattle. Viruses. 2022;14(10). Xie S, Zhu Q, Qu W, Xu Z, Liu X, Li X, et al. sRNAPrimerDB: comprehensive primer design and search web service for small noncoding RNAs. Bioinformatics. 2019;35(9):1566-72. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402-8. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365-86. Decaro N, Elia G, Campolo M, Desario C, Mari V, Radogna A, et al. Detection of bovine coronavirus using a TaqMan-based real-time RT‒PCR assay. J Virol Methods. 2008;151(2):167-71. McGeary SE, Lin KS, Shi CY, Pham TM, Bisaria N, Kelley GM, et al. The biochemical basis of microRNA targeting efficacy. Science. 2019;366(6472). Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. MicroRNA targets in Drosophila. Genome Biol. 2003;5(1):R1. Sridhar J, Sowmiya G, Sekar K, Rafi ZA. PsRNA: a computing engine for the comparative identification of putative small RNA locations within intergenic regions. Genomics Proteomics Bioinformatics. 2010;8(2):127-34. Hemida MG, Ye X, Zhang HM, Hanson PJ, Liu Z, McManus BM, et al. MicroRNA-203 enhances coxsackievirus B3 replication through targeting zinc finger protein-148. Cell Mol Life Sci. 2013;70(2):277-91. Ye X, Hemida MG, Qiu Y, Hanson PJ, Zhang HM, Yang D. MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/beta-catenin signaling pathways. Cell Mol Life Sci. 2013;70(23):4631-44. Ye X, Zhang HM, Qiu Y, Hanson PJ, Hemida MG, Wei W, et al. Coxsackievirus-induced miR-21 disrupts cardiomyocyte interactions via the downregulation of intercalated disk components. PLoS Pathog. 2014;10(4):e1004070. Kim Y, Jang G, Lee D, Kim N, Seon JW, Kim YH, et al. Trypsin enhances SARS-CoV-2 infection by facilitating viral entry. Arch Virol. 2022;167(2):441-58. Shin J, Choe S, Park GN, Song S, Kim KS, An BH, et al. Isolation and Genetic Characterization of a Bovine Coronavirus KBR-1 Strain from Calf Feces in South Korea. Viruses. 2022;14(11). Reed LJ, Muench H. A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12. American Journal of Epidemiology. 1938;27(3):493-7. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671-5. Zhu Q, Li B, Sun D. Advances in Bovine Coronavirus Epidemiology. Viruses. 2022;14(5). Gaytan-Pacheco N, Ibanez-Salazar A, Herrera-Van Oostdam AS, Oropeza-Valdez JJ, Magana-Aquino M, Adrian Lopez J, et al. miR-146a, miR-221, and miR-155 are Involved in Inflammatory Immune Response in Severe COVID-19 Patients. Diagnostics (Basel). 2022;13(1). Haroun RA, Osman WH, Amin RE, Hassan AK, Abo-Shanab WS, Eessa AM. Circulating plasma miR-155 is a potential biomarker for the detection of SARS-CoV-2 infection. Pathology. 2022;54(1):104-10. Hemida AUSaMG. The Potential Roles of Host Cell miRNAs in Fine-Tuning BovineCoronavirus (BCoV) Molecular Pathogenesis, Tissue Tropism, and Immune Regulation. Microorganisms. 2024;12(5). Slenter DN, Kutmon M, Hanspers K, Riutta A, Windsor J, Nunes N, et al. WikiPathways: a multifaceted pathway database bridging metabolomics to other omics research. Nucleic Acids Res. 2018;46(D1):D661-D7. Vaddadi K, Gandikota C, Huang C, Liang Y, Liu L. Cellular microRNAs target SARS-CoV-2 spike protein and restrict viral replication. Am J Physiol Cell Physiol. 2023;325(2):C420-C8. Cui J. MiR-16 family as potential diagnostic biomarkers for cancer: a systematic review and meta-analysis. Int J Clin Exp Med. 2015;8(2):1703-14. Jin W, Chen F, Wang K, Song Y, Fei X, Wu B. miR-15a/miR-16 cluster inhibits invasion of prostate cancer cells by suppressing TGF-beta signaling pathway. Biomed Pharmacother. 2018;104:637-44. Johansson K, Gagnon JD, Zhou SK, Fassett MS, Schroeder AW, Kageyama R, et al. An essential role for miR-15/16 in Treg suppression and restriction of proliferation. Cell Rep. 2023;42(10):113298. Liu Q, Fu H, Sun F, Zhang H, Tie Y, Zhu J, et al. miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008;36(16):5391-404. Tao Z, Xu S, Ruan H, Wang T, Song W, Qian L, et al. MiR-195/-16 Family Enhances Radiotherapy via T-Cell Activation in the Tumor Microenvironment by Blocking the PD-L1 Immune Checkpoint. Cell Physiol Biochem. 2018;48(2):801-14. Yang L, Yang S, Ren C, Liu S, Zhang X, Sui A. Deciphering the roles of miR-16-5p in malignant solid tumors. Biomed Pharmacother. 2022;148:112703. Hassan NE, Moselhy WA, Eldomany EB, Kholef EFM. Evaluation of miRNA-16-2-3P, miRNA-618 levels and their diagnostic and prognostic value in the regulation of immune response during SARS Cov-2 infection. Immunogenetics. 2023;75(4):403-10. Liu X, Wu Q, Zhang Z. Global Diversification and Distribution of Coronaviruses With Furin Cleavage Sites. Front Microbiol. 2021;12:649314. Millet JK, Whittaker GR. Host cell proteases: Critical determinants of coronavirus tropism and pathogenesis. Virus Res. 2015;202:120-34. Ayyubova G, Gychka SG, Nikolaienko SI, Alghenaim FA, Teramoto T, Shults NV, et al. The Role of Furin in the Pathogenesis of COVID-19-Associated Neurological Disorders. Life (Basel). 2024;14(2). Johnson BA, Xie X, Bailey AL, Kalveram B, Lokugamage KG, Muruato A, et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature. 2021;591(7849):293-9. Johnson BA, Xie X, Kalveram B, Lokugamage KG, Muruato A, Zou J, et al. Furin Cleavage Site Is Key to SARS-CoV-2 Pathogenesis. bioRxiv. 2020. Xiangbo Z, Zhaofang Y, Jinjing G, Zhuandi G, Suocheng W. Bovine coronavirus nucleocapsid suppresses IFN-beta production by inhibiting RIG-I-like receptors pathway in host cells. Arch Microbiol. 2022;204(8):536. Wu CJ, Huang HW, Liu CY, Hong CF, Chan YL. Inhibition of SARS-CoV replication by siRNA. Antiviral Res. 2005;65(1):45-8. Devi KP, Pourkarim MR, Thijssen M, Sureda A, Khayatkashani M, Cismaru CA, et al. A perspective on the applications of furin inhibitors for the treatment of SARS-CoV-2. Pharmacol Rep. 2022;74(2):425-30. Schutz D, Ruiz-Blanco YB, Munch J, Kirchhoff F, Sanchez-Garcia E, Muller JA. Peptide and peptide-based inhibitors of SARS-CoV-2 entry. Adv Drug Deliv Rev. 2020;167:47-65. Daly JL, Simonetti B, Klein K, Chen KE, Williamson MK, Anton-Plagaro C, et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science. 2020;370(6518):861-5. Chen Z, Mi L, Xu J, Yu J, Wang X, Jiang J, et al. Function of HAb18G/CD147 in invasion of host cells by severe acute respiratory syndrome coronavirus. J Infect Dis. 2005;191(5):755-60. Wang K, Chen W, Zhang Z, Deng Y, Lian JQ, Du P, et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells. Signal Transduct Target Ther. 2020;5(1):283. Simmons G, Gosalia DN, Rennekamp AJ, Reeves JD, Diamond SL, Bates P. Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry. Proc Natl Acad Sci U S A. 2005;102(33):11876-81. Bosch BJ, Bartelink W, Rottier PJ. Cathepsin L functionally cleaves the severe acute respiratory syndrome coronavirus class I fusion protein upstream of rather than adjacent to the fusion peptide. J Virol. 2008;82(17):8887-90. Gubernatorova EO, Gorshkova EA, Polinova AI, Drutskaya MS. IL-6: Relevance for immunopathology of SARS-CoV-2. Cytokine Growth Factor Rev. 2020;53:13-24. Zhang J, Wu H, Yao X, Zhang D, Zhou Y, Fu B, et al. Pyroptotic macrophages stimulate the SARS-CoV-2-associated cytokine storm. Cell Mol Immunol. 2021;18(5):1305-7. Shah AU, Cao Y, Siddique N, Lin J, Yang Q. miR29a and miR378b Influence CpG-Stimulated Dendritic Cells and Regulate cGAS/STING Pathway. Vaccines (Basel). 2019;7(4). Additional Declarations No competing interests reported. Supplementary Files S1Fig.tif Fig S1: Design, construction, and confirmation of the pmiR-GLO dual-luciferase reporter plasmids containing either the wild-type or mutated Furin-3'UTR (A) Design of the pmirGLO plasmid with wild-type Furin inserted at the XhoI and SacI restriction sites. (B) Confirmation of the plasmid construct via restriction enzyme digestion by agarose gel electrophoresis. (Furin-WT: double digested with XhoI and SacI ; empty pmiR-GLO vector; marker). (C) Design of the pmiR-GLO plasmid with mutant Furin through site-directed mutagenesis and insertion into the XhoI and SacI restriction sites of the pmiR-GLO dual-luciferase reporter vector. (B) Confirmation of the mutant construct via agarose gel electrophoresis. (Furin-Mut: double digested with XhoI and SacI ; empty pmiR-GLO vector; marker). Approximately 200-1000 ng of plasmid was digested at 37°C for 30-60 minutes and analyzed through a 1% agarose gel. S2Fig.tif Fig S2: Morphology of bovine cells transfected with either the Sc-miRNA or the bta-miRNA-16a and then infected with either BCoV/Ent or BCoV/Resp isolates. (A) Results of the morphological examination of MDBK cells transfected with Scr miRNA as the relevant control and the bta-miRNA-16a-, BCoV enteric (Ent)-, and BCoV respiratory (Resp)-infected groups. (B) Morphological examination of MDBK cells in the bta-miRNA-16a-, BCoV/Ent-, and BCoV/Resp-infected groups. (C) Results of the morphological examination of BECstransfected with Scr-miRNA or bta-miRNA-16a in the BCoV/Ent- and BCoV/Resp-infected groups. (D) Results of the morphological examination of BECstransfected with bta-miR-16a or the Scr-miRNA control, BCoV/Ent, or BCoV/Resp-infected group. The bta-miR-16a was transfected for 24 hours, followed by 48-72 hours post-infection with BCoV. All the images were captured at 10x magnification. S3Fig.tif Fig S3: Morphology of MDBK and BECs transfected with Scr-siRNA, siRNA-Furin, or siRNA-BCoV-S glycoprotein. (A) Morphological observation of MDBK cells transfected with Scr-siRNA in the control (sham) group and infected with either entericBCoV (Ent) or respiratoryBCoV (Resp) isolates. (B) Morphological observation of MDBK cells transfected with siRNA-Furin and then infected with either BCoV/Ent or BCoV/Resp. (C) Morphological observation of MDBK cells transfected with siRNA-BCoV-Spike and then infected with either enteric BCoV or respiratory BCoV. (D)Morphological observation of BECstransfected with the Scr-siRNA, BCoV/Ent or BCoV/Resp isolates. (E) Morphological observation of BECs transfected with siRNA-Furin and then infected with either the BCoV/Ent or BCoV/Resp isolates. (F) Morphological observation of BECs transfected with the siRNA-BCoV-Spike and then infected with either the BCoV/Ent or BCoV/Resp isolates. Cells were transfected withsiRNA-Furin orsiRNA-BCoV-Spike for 24 hours, followed by 48-72 hours post-infection with BCoV. All the images were taken at 10x magnification. SupplementaryWBandGelFigures.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4498403","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":313101617,"identity":"f78c3dc3-3fad-4d21-84c1-7a70e1c7e49a","order_by":0,"name":"Abid Ullah Shah","email":"","orcid":"","institution":"Long Island University","correspondingAuthor":false,"prefix":"","firstName":"Abid","middleName":"Ullah","lastName":"Shah","suffix":""},{"id":313101618,"identity":"28db68d1-930e-4649-9614-361516d493f5","order_by":1,"name":"Maged Gomaa Hemida","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYLACHoYDDAzMDAYMHwokQHwD4rUwzjAgSQtQJTMPRDF+Lbrtxy8+eMNwR063nXnjZxsDi8QG9uZtEvi0mJ3JKTacw/DM2OwwW7F0joFEYgPPsTL8Wg7kpEnzMBxO3HaYxwCiRSLHDL+W82/SfwO11AO1GP+2AGmRf0NAy430Y8xALQlmh3nMpBnAtvAQ0vKGWXKOwWHDbYfZyix7DCSM23jSii3wOyz94Yc3FYflzc4f3nzjR0WdbD/74Y038GkBRooBakSw4VcOAuwPCKsZBaNgFIyCkQ0Av2BINpM4KL0AAAAASUVORK5CYII=","orcid":"","institution":"Long Island University","correspondingAuthor":true,"prefix":"","firstName":"Maged","middleName":"Gomaa","lastName":"Hemida","suffix":""}],"badges":[],"createdAt":"2024-05-29 16:25:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4498403/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4498403/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58386343,"identity":"f07ec440-e128-463b-bbc7-b072886e6289","added_by":"auto","created_at":"2024-06-14 18:44:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":9523382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe host cell miRNA expression profiles during bovine coronavirus(BCoV) replication.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Morphological observation of control (sham) MDBK cells showingcytopathic effects(C.P.E.) at 72 hours post-infection (hpi) with BCoV enteric (BCoV/Ent) and respiratory (BCoV/Resp) isolates(10x magnification).\u003cstrong\u003e (B)\u003c/strong\u003e Morphological observation of BECs: Cl, C.P.E. at 72 hpi with BCoV/Ent and BCoV/Resp isolates (10x magnification). \u003cstrong\u003e(C) \u003c/strong\u003eqRT‒PCR analysis of the BCoV genomic viral load in MDBK cells. \u003cstrong\u003e(D)\u003c/strong\u003e qRT‒PCRanalysis of the BCoV genomic viral load in BECs. \u003cstrong\u003e(E)\u003c/strong\u003e KEGG pathway analysis of next-generation sequencing (NGS) data indicating differentially expressed host cellular pathways during infection with the BCoV/Ent isolate and \u003cstrong\u003e(F)\u003c/strong\u003eduring infection with the BCoV/Resp isolate. \u003cstrong\u003e(G)\u003c/strong\u003e NGS data indicating the number of DEGs in the BCoV/Ent- and BCoV/Resp-infected groups. \u003cstrong\u003e(H)\u003c/strong\u003e NGS data illustrating the number of differentially expressed miRNAs in the BCoV/Ent- and BCoV/Resp-infected groups.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/ce02a018ee12fa851896d50d.png"},{"id":58384690,"identity":"fb2628a4-4010-4768-92b5-b165a4c7e273","added_by":"auto","created_at":"2024-06-14 18:36:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":871168,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBovine miRNA expression profile during BCoV/Ent or BCoV/Resp infection in bovine cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Heatmap showing the differentially expressed miRNAs in the sham-, BCoV/Ent-, and BCoV/Resp-infected groups of cells based on NGS data analysis. \u003cstrong\u003e(B)\u003c/strong\u003e qRT‒PCRdata showing the expression levels of bovine miR-16a in MDBK cells. \u003cstrong\u003e(C\u003c/strong\u003e) qRT‒PCR data showing the expression levels of bovine miR-16a in BECs. \u003cstrong\u003e(D\u003c/strong\u003e) qRT‒PCR data showing the expression levels of bovine miR-16a in PBMCs isolated from bovine blood. The heatmap was generatedusing https://www.bioinformatics.com.cn/en, a free online data analysis and visualization platform.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/c90384ffeb3569f2aaf57eee.png"},{"id":58384691,"identity":"4fc76ad8-7f82-47ed-8156-86da321a525f","added_by":"auto","created_at":"2024-06-14 18:36:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2517604,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBovine miR-16a overexpression markedly inhibits BCoV replication and virus infectivity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Schematic representation of miR-16a transfection and BCoV infection experiments. Transfection of miR-Sc and miR-16a into MDBK and BEC cells, followed by infection with BCoV enteric and respiratory isolates for 48 to 72 hours, and subsequent sample collection for further analysis. \u003cstrong\u003e(B)\u003c/strong\u003e miR-16a expression in MDBK cells: qRT‒PCR data showing the expression pattern of bovine miR-16a in scrambled and miR-16a-transfected MDBK cells. \u003cstrong\u003e(C) \u003c/strong\u003emiR-16a expression in BECs. cells: qRT‒PCR analysis showing the expression pattern of bovine miR-16a in scrambled-and miR-16a-transfected BECs. \u003cstrong\u003e(D)\u003c/strong\u003e BCoV genomic level in MDBK cells: qRT‒PCRanalysis demonstrating the genome level of BCoV in scrambled-and miR-16a-transfected MDBK cells. \u003cstrong\u003e(E)\u003c/strong\u003e BCoV genomic level in BECs: qRT‒PCR analysis illustrating the genome level of BCoV in scrambled- and miR-16a-transfected BECs. \u003cstrong\u003e(F)\u003c/strong\u003e BCoV enteric infectivity level in MDBK cells: Viral plaque assay indicating the infectivity level of the BCoV enteric isolate in scrambled-and miR-16a-transfected MDBK cells. \u003cstrong\u003e(G)\u003c/strong\u003e Protein expression in MDBK cells: Western blot analysis of BCoV-nucleocapsid (BCoV-N) and BCoV-spike (BCoV-S) in MDBK cells transfected with scrambled ormiR-16a. \u003cstrong\u003e(H)\u003c/strong\u003e Western blot band density of the BCoV-N protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(I)\u003c/strong\u003e Western blot band density of the BCoV-S protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(J)\u003c/strong\u003e BCoV protein expression in BECs: BECs. Cells were transfected with miRNA-Sc and bta-miRNA-16a, and western blot analysis was used to assess theprotein expression of BCoV-N and BCoV-S. \u003cstrong\u003e(K)\u003c/strong\u003e Western blot band density of BCoV-N protein normalized to that of b-actin in BECs. \u003cstrong\u003e(L)\u003c/strong\u003e Western blot band density of BCoV-S protein normalized to that of b-actin in BECs.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/9062da6a428ca15547cadb77.png"},{"id":58384693,"identity":"a369abd3-c810-4fa5-964e-63ebeea1075b","added_by":"auto","created_at":"2024-06-14 18:36:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3779755,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe host cell line Furin as a novel target for bta-miRNA-16a and the impact of this targeting on BCoV replication.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Multiple sequence alignment showing that the bta-miRNA-16a/Furin binding region is conserved among eight species, including humans, mice, and bovines. \u003cstrong\u003e(B)\u003c/strong\u003e In silico prediction of bta-miRNA-16a targeting the 3' UTR of the host cell Furin. The context ++ score percentile represents the binding energy of the miRNA with the target gene. \u003cstrong\u003e(C)\u003c/strong\u003e MDBK cells were transfected with either miR-Scr or miR-16a, followed by BCoV/Ent or BCoV/Resp infection. After 72 hours, the samples were subjected to qRT‒PCR. Data analysis was used to assess the mRNA expression level of host Furin in both the Sc-miRNA- and miR-16a-transfected groups of cells. \u003cstrong\u003e(D)\u003c/strong\u003eWestern blot analysis of host Furin protein expression in MDBK cells in the miR-Scr- and miR-16a-transfected groups. \u003cstrong\u003e(E)\u003c/strong\u003eWestern blot band density of Furin protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(F)\u003c/strong\u003e BECswere transfected with scrambled and miR-16a, followed by BCoV enteric and respiratory isolateinfection. After 72 hours, samples were collected for qRT‒PCR analysis to assess the mRNA expression level of the host Furin in both the scrambled- and miR-16a-transfected groups. \u003cstrong\u003e(G)\u003c/strong\u003eWestern blot analysis of host Furin protein expression in the scrambled- and miR-16a-transfected groups of BECs. \u003cstrong\u003e(H)\u003c/strong\u003eWestern blot band density of Furin protein normalized to that of b-actin in BECs. \u003cstrong\u003e(I)\u003c/strong\u003eDiagram of luciferase reporter plasmids. A fragment of the 3'UTR of Furin wild-type (W.T.) carrying the miR-16a binding site (indicated in blue) was inserted into the \u003cem\u003eXhoI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003erestriction enzyme sites of the pmirGLOluciferase vector. The seed region of Furin was mutated by site-directed mutagenesis to produce the mutant (M.U.T.) Furin (indicated in red). \u003cstrong\u003e(J)\u003c/strong\u003e The results of the dual-luciferase reporter assay. H.E.K. cells were transfected with different combinations of the Furin 3'UTR (W.T.) or mutant (Mut) plasmid or vector only (pmir-GLo) with miR-16a and miR-Scr, as indicated. The dual luciferase assay was conducted, and the relative luciferase activity was calculated using red firefly luciferase signals as a normalization control for the green Renilla luciferase signals.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/bcab92267f75a8d6123120b9.png"},{"id":58384696,"identity":"632f41e7-a5f6-4760-9012-bc5e44c362f5","added_by":"auto","created_at":"2024-06-14 18:36:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2033606,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe impacts of silencing the host Furin and BCoV-S glycoproteins on BCoV replication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Scheme of the siRNA transfection experiment: The process of transfecting scrambled, siRNA-Furin, and siRNA-BCoV-S glycoproteins into MDBK and BEC cells was illustrated, followed by infection with BCoV/Ent or BCoV/Resp isolates for 48 to 72 hours and subsequent sample collection for further analysis. \u003cstrong\u003e(B)\u003c/strong\u003e MDBK cells were transfected with 50 ng or 100 ng of Furin siRNA, followed by western blot analysis ofFurin protein expression. \u003cstrong\u003e(C)\u003c/strong\u003e Western blot band density of Furin protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(D)\u003c/strong\u003e MDBK cells were transfected with 50 ng or 100 ng of siRNA-S, followed by western blot analysis of BCoV spike protein expression. \u003cstrong\u003e(E)\u003c/strong\u003e Western blot band density of the BCoV spike protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(F)\u003c/strong\u003e qRT‒PCRanalysis showing Furin expression in scrambled- and siRNA-Furin-transfected MDBK cells \u003cstrong\u003e(G)\u003c/strong\u003eand BECs. \u003cstrong\u003e(H)\u003c/strong\u003e qRT‒PCRanalysis showing the genomic level of BCoV in scrambled-and siRNA-Furin-transfected MDBK cells \u003cstrong\u003e(I)\u003c/strong\u003e and BECs. \u003cstrong\u003e(J)\u003c/strong\u003e qRT‒PCRanalysis showing thegenome level of BCoV in scrambled-and siRNA-BCoV-Spike-transfected MDBK cells \u003cstrong\u003e(K)\u003c/strong\u003e and BECs.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/b49134ab8b21992913777461.png"},{"id":58387483,"identity":"6ed39f5e-40a0-4105-a9ef-6eea94e3e093","added_by":"auto","created_at":"2024-06-14 18:52:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2277321,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing of the host cell Furin and BCoV-S glycoprotein negatively impacted BCoV infectivity in cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e BCoV/Ent or BCoV/Resp viral particle infectivity is inhibited in cells transfected with siRNA-Spike or (B) siRNA-Furin, as measured by the viral plaque assay. The plaque-forming units (PFUs) were used to determine the viraltiter in each virus-infected group. \u003cstrong\u003e(C)\u003c/strong\u003e MDBK cells were transfected with scrambled siRNA (Scr-siRNA), siRNA-Furin, orsiRNA-Spike, followed by infection withBCoV/Ent or BCoV/Resp. Cells were lysed after 72 hpi, and western blot analysis was performed to observe the protein expression of BCoV-S, BCoV-N, and host Furin proteins. \u003cstrong\u003e(D)\u003c/strong\u003eWestern blot band density of the Furin protein, \u003cstrong\u003e(E)\u003c/strong\u003eBCoV spikeprotein, and \u003cstrong\u003e(F) \u003c/strong\u003eBCoV-N protein was normalized to that of b-actin in MDBK cells.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/f71b5b5ec1f48b7e9a1a04c2.png"},{"id":58387484,"identity":"2e946f20-fcae-4828-b287-9e76cd62ccc3","added_by":"auto","created_at":"2024-06-14 18:52:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1659517,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe impact of host miR-16a overexpression on several selected SARS-CoV-2 replication-related proteins (ACE2, NRP1, and TMPRSS2).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e MDBK cells were transfected with either Scr-miRNA or bta-miR-16a, followed by BCoV/Ent or BCoV/Resp infection. Both the cell culture supernatants and the cell lysates were collected at 72 hpi for qRT‒PCR and western blot analysis of host ACE2, NRP1, TMPRSS2, and b-actin. \u003cstrong\u003e(B)\u003c/strong\u003e Results of the qRT‒PCR analysis of host ACE2 mRNA expression in the Scr-miRNA-and bta-miRNA-16a-transfected groups. \u003cstrong\u003e(C)\u003c/strong\u003e Western blot band density of the ACE2 protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(D)\u003c/strong\u003e Results of qRT‒PCRanalysis of host NRP1 mRNA expression levels in various groups of cells. \u003cstrong\u003e(E)\u003c/strong\u003eWestern blot band density of the NRP1 protein normalized to that of b-actin in MDBK cells. \u003cstrong\u003e(F)\u003c/strong\u003e Results of the qRT‒PCR analysis of host TMPRSS2 mRNA expression levels. \u003cstrong\u003e(E)\u003c/strong\u003e Western blot band density of the TMPRSS2 protein normalized to that of b-actin in MDBK cells.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/2caf02d43dc392e719f7b286.png"},{"id":58386349,"identity":"3a204402-5da2-448a-b957-f6ff4f0b6f3b","added_by":"auto","created_at":"2024-06-14 18:44:22","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1966110,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing of the host cell Furin and BCoV-S glycoproteins impacted the expression levels of several SARS-CoV replication-related proteins atthe mRNA and protein levels, which further impacted BCoV/Ent/BCoV/Resp replication.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e MDBK cells were transfected with Scr-siRNA control, siRNA-Furin, or siRNA-Spike, followed by infection with either BCoV/Ent or BCoV/Resp. Cell lysates were collected after 72 hpi and subjected to Western blot analysis to assess the protein expression of bovine ACE2, NRP1, TMPRSS2, and bovine b-actin proteins. \u003cstrong\u003e(B)\u003c/strong\u003e Results of the qRT‒PCR analysis of bovine TMPRSS2 mRNA expression in siRNA-Scrambled-, siRNA-Furin-, or siRNA-BCoV-spike-transfected MDBK cells. \u003cstrong\u003e(C)\u003c/strong\u003e Western blot band density of the TMPRSS2 protein normalized to that of b-actin. \u003cstrong\u003e(D)\u003c/strong\u003e Results of the qRT‒PCRanalysis of bovine ACE2 mRNA expression. \u003cstrong\u003e(E)\u003c/strong\u003e Western blot band density of the ACE2 protein normalized to that of b-actin. \u003cstrong\u003e(F)\u003c/strong\u003e Results of the qRT‒PCR analysis of bovine NRP1 mRNA expression. \u003cstrong\u003e(G)\u003c/strong\u003e Western blot band density of the NRP1 protein normalized to that of b-actin.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/4d7a5990fd098771b6b0d6be.png"},{"id":58384698,"identity":"90b92fbc-2093-4f15-bf34-308e0d0cf033","added_by":"auto","created_at":"2024-06-14 18:36:22","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2412948,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eActivation of the host cell cytokine-like Strome upon miR-16a overexpression during BCoV infection.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMDBK cells were transfected with either Scr-miRNA orbta-miRNA-16a, followed by infection with BCoV/Ent or BCoV/Resp. The results. Results of the qRT‒PCR analysis to quantify the mRNA expression of \u003cstrong\u003e(A)\u003c/strong\u003e IFN-a; \u003cstrong\u003e(B)\u003c/strong\u003e IFN-b; \u003cstrong\u003e(C)\u003c/strong\u003e IFN-g; \u003cstrong\u003e(D)\u003c/strong\u003e IL-6; \u003cstrong\u003e(E)\u003c/strong\u003e and IL-10. \u003cstrong\u003e(F)\u003c/strong\u003e MDBK cells were transfected with Scr-siRNA control, siRNA-Furin, orsiRNA-BCoV-Spike, followed by BCoV/Ent or BCoV/Resp infection. qRT‒PCR analysis of the mRNA expression levels of IFN-a, \u003cstrong\u003e(G)\u003c/strong\u003e IFN-b, \u003cstrong\u003e(H)\u003c/strong\u003e IFN-g, \u003cstrong\u003e(I)\u003c/strong\u003e IL-6, \u003cstrong\u003e(J)\u003c/strong\u003e and IL-10.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/5340a832bf73e21045cf1c60.png"},{"id":58384704,"identity":"1c9134cc-c234-4e48-a17e-168ade2569ef","added_by":"auto","created_at":"2024-06-14 18:36:22","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":947302,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe proposed model of the mechanism of the dual actions of the host cell bta-miR-16a in restricting BCoV replication through targeting the BCoV-S glycoprotein and the host cell Furin and enhancing cytokine expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Schematic representation of the BCoV-Spike protein, highlighting the S1 and S2 subunits and Furin cleavage site (S1/S2). bta-miR-16a targets two regions within the S1 subunit, indicated in red (starting positions 24762 and 24928). \u003cstrong\u003e(B)\u003c/strong\u003e Schematic diagram of bovine Furin showing the bta-miRNA-16a target sites in the 3’UTR; red indicates the starting nucleotides of the seed region of bta-miRNA-16a (starting position 793). \u003cstrong\u003e(C)\u003c/strong\u003e Illustration of bovine cells transfected with miRNA scrambled (miRNA-Scr) followed by BCoV infection. The BCoV viral genome is released into the cytoplasm of infected cells, after which viral replication and the production of nested sets of sg mRNAs are initiated. BCoV infection markedly inhibited the expression ofsome host cytokines (IFN-a, IFN-b, IFN-g, IL-6, and IL-10) but enhanced BCoV production. \u003cstrong\u003e(D)\u003c/strong\u003eIllustration of bovine cells transfected with bta-miR-16a followed by infection with BCoV. The bta-miR-16a targetshost Furin at the cell surface,reducing BCoV activation byabolishing spike glycoprotein cleavage. The overexpression of bta-miRNA-16 also markedly inhibitedBCoV-S expression,which ultimately reduced the production of other viral proteins, particularly BCoV-N. bta-miRNA-16a, which targets BCoV-S and the host Furin, markedly inhibited the production of new viral progeny. Moreover, this targeting resulted in a marked increase in the expression of some host cell cytokines, especially IFN-a, IFN-b, IFN-g, IL-6, and IL-10, which led to further inhibition of viral progeny release.\u003c/p\u003e","description":"","filename":"Fig10.png","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/4b38a5062cc33f63ea7bf309.png"},{"id":61965846,"identity":"ad962c32-647a-4844-92c6-f064ca690c0a","added_by":"auto","created_at":"2024-08-07 15:30:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":33298929,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/cf3bb55e-0f18-4f0a-b68f-977f61643eb0.pdf"},{"id":58386344,"identity":"6e7dedba-70f6-4832-8a01-d554e711e2af","added_by":"auto","created_at":"2024-06-14 18:44:22","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7351180,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig S1: Design, construction, and confirmation of the pmiR-GLO dual-luciferase reporter plasmids containing either the wild-type or mutated Furin-3'UTR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Design of the pmirGLO plasmid with wild-type Furin inserted at the \u003cem\u003eXhoI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e restriction sites. \u003cstrong\u003e(B)\u003c/strong\u003e Confirmation of the plasmid construct via restriction enzyme digestion by agarose gel electrophoresis. (Furin-WT: double digested with \u003cem\u003eXhoI\u003c/em\u003eand \u003cem\u003eSacI\u003c/em\u003e; empty pmiR-GLO vector; marker). \u003cstrong\u003e(C)\u003c/strong\u003e Design of the pmiR-GLO plasmid with mutant Furin through site-directed mutagenesis and insertion into the \u003cem\u003eXhoI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003erestriction sites of the pmiR-GLO dual-luciferase reporter vector. \u003cstrong\u003e(B)\u003c/strong\u003e Confirmation of the mutant construct via agarose gel electrophoresis. (Furin-Mut: double digested with \u003cem\u003eXhoI\u003c/em\u003eand \u003cem\u003eSacI\u003c/em\u003e; empty pmiR-GLO vector; marker). Approximately 200-1000 ng of plasmid was digested at 37°C for 30-60 minutes and analyzed through a 1% agarose gel.\u003c/p\u003e","description":"","filename":"S1Fig.tif","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/ed2040a85bf73d63a56b1944.tif"},{"id":58386348,"identity":"474d21b3-9881-4c80-8ec4-5a5b17788f88","added_by":"auto","created_at":"2024-06-14 18:44:22","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":20500880,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig S2: Morphology of bovine cells transfected with either the Sc-miRNA or the bta-miRNA-16a and then infected with either BCoV/Ent or BCoV/Resp isolates.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Results of the morphological examination of MDBK cells transfected with Scr miRNA as the relevant control and the bta-miRNA-16a-, BCoV enteric (Ent)-, and BCoV respiratory (Resp)-infected groups.\u003cstrong\u003e (B)\u003c/strong\u003e Morphological examination of MDBK cells in the bta-miRNA-16a-, BCoV/Ent-, and BCoV/Resp-infected groups.\u003cstrong\u003e (C)\u003c/strong\u003e Results of the morphological examination of BECstransfected with Scr-miRNA or bta-miRNA-16a in the BCoV/Ent- and BCoV/Resp-infected groups. \u003cstrong\u003e(D)\u003c/strong\u003e Results of the morphological examination of BECstransfected with bta-miR-16a or the Scr-miRNA control, BCoV/Ent, or BCoV/Resp-infected group. The bta-miR-16a was transfected for 24 hours, followed by 48-72 hours post-infection with BCoV. All the images were captured at 10x magnification.\u003c/p\u003e","description":"","filename":"S2Fig.tif","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/f2060399c511b896ab0bf5dc.tif"},{"id":58386346,"identity":"b82987ed-03bf-438b-9d96-1f89a6f3895d","added_by":"auto","created_at":"2024-06-14 18:44:22","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":18157857,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig S3: Morphology of MDBK and BECs transfected with Scr-siRNA, siRNA-Furin, or siRNA-BCoV-S glycoprotein.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Morphological observation of MDBK cells transfected with Scr-siRNA in the control (sham) group and infected with either entericBCoV (Ent) or respiratoryBCoV (Resp) isolates.\u003cstrong\u003e (B)\u003c/strong\u003e Morphological observation of MDBK cells transfected with siRNA-Furin and then infected with either BCoV/Ent or BCoV/Resp. \u003cstrong\u003e(C)\u003c/strong\u003e Morphological observation of MDBK cells transfected with siRNA-BCoV-Spike and then infected with either enteric BCoV or respiratory BCoV.\u003cstrong\u003e (D)\u003c/strong\u003eMorphological observation of BECstransfected with the Scr-siRNA, BCoV/Ent or BCoV/Resp isolates.\u003cstrong\u003e (E)\u003c/strong\u003e Morphological observation of BECs transfected with siRNA-Furin and then infected with either the BCoV/Ent or BCoV/Resp isolates.\u003cstrong\u003e (F)\u003c/strong\u003e Morphological observation of BECs transfected with the siRNA-BCoV-Spike and then infected with either the BCoV/Ent or BCoV/Resp isolates. Cells were transfected withsiRNA-Furin orsiRNA-BCoV-Spike for 24 hours, followed by 48-72 hours post-infection with BCoV. All the images were taken at 10x magnification.\u003c/p\u003e","description":"","filename":"S3Fig.tif","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/10dce8b66d80a89ce18fce07.tif"},{"id":58384701,"identity":"5067bc5e-317d-454c-b566-6d6d59ea7c68","added_by":"auto","created_at":"2024-06-14 18:36:22","extension":"zip","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3047269,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryWBandGelFigures.zip","url":"https://assets-eu.researchsquare.com/files/rs-4498403/v1/b453e5b9a19fc65edc1a74dc.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"The dual actions of host miRNA-16a in restricting bovine coronavirus (BCoV) replication through targeting the host cell Furin and enhancing the host immune response","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBovine coronavirus (BCoV) was recently classified under the order \u003cem\u003eNidovirales\u003c/em\u003e in the family \u003cem\u003eCoronaviridae, subfamily Orthocoronavirinae, genus Betacoronavirus\u003c/em\u003e, and subgenus Embecovirus (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Both BCoV and severe acute respiratory syndrome coronavirus (SARS-CoV)-1 and \u0026minus;\u0026thinsp;2 belong to the genus Betacoronavirus. These viruses share some common characteristics at the phenotypic and genotypic levels. Although BCoV was reported several decades ago, many aspects of viral replication and virus/host interactions have not yet been explored. This contrasts with SARS-CoV-2, the cause of the COVID-19 pandemic; intensive studies have been carried out and revealed many novel aspects of the SARS-CoV-2/host interaction. Viral entry is a crucial step in the coronavirus replication cycle. Angiotensinogen converting enzyme-2 (ACE2) has been proven to be the functional receptor for SARS-CoV-2 (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Transmembrane protease serine 2 (TMPRSS2) plays essential roles in SARS-CoV-2 attachment and entry into host cells through cleavage of the viral spike glycoprotein at specific sites. S protein cleavage activates BCoV infection in host cells and contributes to virus entry into host cells (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The roles of neuropilin-1 (NRP-1) in SARS-CoV-2 entry into cells have recently been studied (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). NRP-1 binds to the cleaved substrate of the host cell Furin, which enhances virus replication and plays an essential role in viral immune evasion (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). However, the roles of Furin, ACE2, TMPRRS2, and NRP-1 in BCoV replication have not yet been studied. The BCoV genome is a single molecule of positive sense RNA (ssRNA, +Ve). The BCoV genome has the typical genome structure and organization of most coronaviruses. The genome is flanked by two untranslated regions at the 5' and 3' ends. The 5' two-thirds of the genome consists of a large gene called gene-1, which is composed of two overlapping open reading frames (ORFs) with a ribosomal frameshift. Gene-1 of BCoV is further processed into 16 nonstructural proteins (NSP1-16). The 3' one-third of the BCoV genome is occupied by five major structural proteins (hemagglutinin esterase (HE), spike glycoprotein (S), the envelope (E), and the nucleocapsid protein (N)) interspersed with other nonstructural proteins (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). BCoV infection causes several clinical syndromes in affected cattle, including calf diarrhea and winter dysentery, and it also contributes to the development of the bovine respiratory disease complex, along with other bacterial pathogens (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Most coronaviruses require initial cleavage steps by some host cell proteases, particularly serine proteases, to initiate active infection in the target host. Furin cleavage of the SARS-CoV-2 spike protein is a prerequisite for viral infection in target hosts (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Viral tropism heavily depends on the availability of specific cellular receptors that help the virus enter host cells and hijack the cellular machinery to favor viral protein synthesis instead of cellular proteins (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Other factors may also contribute to this tissue tropism, such as the presence of some auxiliary receptors and the presence of some transcription and translation factors (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). BCoV exhibits dual tissue tropism in affected cattle (enteric and respiratory) (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). The mechanisms that fine-tune this dual tissue tropism have not been well studied. Host cell microRNAs (miRNAs) are small RNAs. molecules (21\u0026ndash;25 nucleotides in length) that play important roles in gene regulation at the translation level. miRNA candidates usually bind to certain regions in the 3'UTR of target genes, leading to translation inhibition or repression (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). There is an important region in the structure of each miRNA called the seed region, which is usually located at positions 2\u0026ndash;8 nucleotides at the 5' end of the miRNA (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The mechanism of action of each miRNA molecule is mainly governed by the degree of complementarity between the miRNA seed region and the complementary region in each mRNA (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Some D.N.A. viruses, especially herpes viruses, encode viral miRNAs (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). In contrast, RNA viruses do not usually end their own miRNAs. However, host cell miRNAs play important roles in both D.N.A. and RNA viral replication, tropism, and immune regulation/evasion (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Little is known about the role of host cell miRNAs in the molecular biology of BCoV. We recently identified some potential host cell miRNAs that may play essential roles in the molecular pathogenesis of BCoV and could partially explain this virus's dual tropism phenomenon (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). It has been shown that miRNA-16a is involved in many processes, including the cell cycle and tumor formation. miRNA-16 also acts as a diagnostic marker, is involved in gene regulation, and acts as a potential therapeutic target for hepatitis C virus (HCV) infection in humans (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). However, the roles of miRNA-16a in BCoV replication immune regulation/evasion have not yet been studied. Our data showed that miRNA-16a expression is differentially altered during BCoV/Ent/Resp isolate infection. The main goals of the current study were to confirm the differential expression of miRNA-16a in the context of BCoV infection, to study the impacts of miRNA-16a overexpression on BCoV replication and to study the mechanism of action of miRNA-16a in the fine-tuning of BCoV replication and immune regulation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Viruses and Cell Lines:\u003c/h2\u003e \u003cp\u003eBovine pulmonary artery endothelial cells (BECs), ATCC\u0026reg; CRL\u0026shy;1733\u0026trade;) were obtained from the ATCC. The BEC. The cells were tested for the absence of BVDV. The BEC. The cells were cultured in F12 media (ATCC, 30-2004) supplemented with 10% horse serum (H.S.) (Gibco; Ref. No. 26050-088), 1% 10,000 \u0026micro;g/mL streptomycin and 10,000 units/mL penicillin antibiotics (Gibco; Ref. No. 15140-122). Madine Darby Bovine Kidney (MDBK) cells were kindly provided by Dr. Udeni B. R. Balasuriya, Louisiana State University). The MDBK cells were cultured in Minimum Essential Medium Eagle media (Sigma‒Aldrich, Cat. No. M0200-500ML) supplemented with 10% horse serum and 1% streptomycin and penicillin antibiotics. The cells were incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e for subsequent culture. Human embryonic kidney 293 (HEK-293) cells were obtained from the ATCC (Catalog # CRL-3216\u0026trade;) and used in the dual luciferase assay as described below (section 3.10). Two bovine coronavirus (BCoV) isolates were used; the enteric isolate 'Mebus' (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) was obtained from B.E.I. resources (B.E.I. Resources, NIAID, N.I.H.: Bovine Coronavirus (BCoV), Mebus, NR-445). The respiratory isolate of BCoV was kindly provided by Dr. Aspen Workman (Animal Health Genomics Research Unit, USDA, A.R.S., U.S. Meat Animal Research) (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Next-generation sequencing (NGS) and host cell miRNA expression profiles during BCoV replication.\u003c/h2\u003e \u003cp\u003eThe BECs were infected independently with either BCoV enteric or BCoV respiratory isolates at a multiplicity of infection (MOI\u0026thinsp;=\u0026thinsp;1). The infected cells were observed under an inverted microscope daily for up to 4 days post-infection (4 dpi). We monitored the infected cells for the development of any cytopathic effects (C.P.E.) for up to five days post-infection (5 dpi). Compared to the sham (phosphate-buffered saline; PBS)-infected cells, cells infected with BCoVs showed some morphological changes, such as rounding and detachment from the confluent monolayer sheet. We collected cell culture supernatants from all groups of infected cells, including the sham-infected group. We extracted the total miRNAs using the miRNeasy Micro Kit (Qiagen: Cat. No. 217084) per the manufacturer's instructions. The total miRNAs were submitted to L.C. Sciences (L.C. Sciences, L.L.C., 2575 West Belfort Street, Houston, TX 77054, USA) for the reporting of the miRNA expression profiles in various treated groups of cells. Briefly, all the extracted RNA was used for library preparation following Illumina's TruSeq small RNA sample preparation protocols (Illumina, San Diego, CA, U.S.A.). Quality control analysis and quantification of the D.N.A. library were performed using an Agilent Technologies 2100 Bioanalyzer High Sensitivity D.N.A. Chip. Single-end sequencing of 50 bp fragments was performed on an Illumina HiSeq 2500 sequencing system following the manufacturer's recommended protocols. Differential expression of miRNAs based on normalized deep-sequencing counts was analyzed using various statistical tests, including Fisher\u0026rsquo;s exact test, the chi-squared 2X2 test, the chi-squared nXn test, Student's t test, or ANOVA, depending on the experimental design. We used the Protein Analysis Through Evolutionary Relationships (PANTHER) classification version 9.0 to describe the function and properties of host genes and their related pathways with differential expression. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and heatmaps used in this study were designed using an online data analysis and visualization platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.bioinformatics.com.cn/en\u003c/span\u003e\u003cspan address=\"https://www.bioinformatics.com.cn/en\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Determination of the miRNA expression profiles following BCoV/Ent or BCoV/Rep isolate infection\u003c/h2\u003e \u003cp\u003eWe tested MDBK, BECs, and PBMCs to confirm the miRNA expression profiles obtained from the NGS data. We infected each group of cells with either the BCoV/Ent or BCoV/Resp isolates parallel to the sham (PBS)-infected cells. Following the manufacturer\u0026rsquo;s instructions, total miRNAs were isolated using a Pure Link miRNA isolation kit (Invitrogen; REF: K157001). We used a Nanodrop OneC (Thermo Fisher Scientific) to determine the quality and concentration of the extracted total RNA from all treated groups of cells. The complementary D.N.A. (cDNA) and the quantitative reverse transcriptase-polymerase chain reaction (qRT‒PCR) were performed using the All-in-One miRNA qRT‒PCR Detection Kit 2.0 (GeneCopoeia; Cat. No. QP115) following the manufacturer\u0026rsquo;s instructions. All the primers for miRNAs were designed using sRNAPrimerDB (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The relative expression of miRNAs was normalized to that of the endogenous reference U6 according to the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). All the miRNA primers used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of the oligonucleotides used for the amplification of miRNA expression profiles.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBovine miRNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense Primers (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ebta-miRNA-16a-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACCGGTAGCAGCACGTAAATAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ebta-miR-Uni Rev-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGTGCAGGGTCCGAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ebta-U6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTCGGCAGCACATATACTAAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ebta-U6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCTTCACGAATTTGCGTGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Host mRNA Extraction, amplification, and Quantification\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from MDBK cells, BECs, and PBMCs and from infected and control cells. We used TRIzol LS Reagent (Invitrogen; REF: 10296010) to isolate total RNA from these groups of cells. The RNA concentrations were analyzed with a NanoDrop OneC (Thermo Fisher Scientific). According to the manufacturer's instructions, total RNA was transcribed into cDNA using a high-capacity reverse transcription kit (Applied Biosystems; Lot: 2902953). Real-time PCR was performed using Power-Up SYBR Green Master Mix (Applied Biosystems; Lot: 2843446) in QuantStudio3 (Applied Biosystems). We used the online primer software Primer3 (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e) to design the oligonucleotides used to amplify the host genes and other oligonucleotides used to amplify the partial BCoV-S and N genes. The relative gene and BCoV/S and BCoV/N gene expression levels were normalized to that of β-actin according to the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e protocol described earlier (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). The viral and host gene oligonucleotide sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of the oligonucleotides used for the host gene and cytokine expression profiling.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBovine miRNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSense Primers (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eI.F.N.-a-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTTCACAGAGTCACCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eI.F.N.-a-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACCCTTCTCAGTTGTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-β-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTTCTCCACCACAGCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-β-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGCTTCATCTCCTCAGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-γ-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCGGCCTAACTCTCTCCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIFN-γ-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCACCCTTAGCTACATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGTACCCCATTGAGCACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCATCTTCTCACGGTTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTGGATGACTTTAAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGCAGAAAGCGATGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-a-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAACAAGCCGGTAGCCCACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-a-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAGGGCTCTTGATGGCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCTTCAACACGTCCGAGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCGCCAGGAATTGTTGCTAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGGGTTCAATCAGGCGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCAGTGTTTGTGGCTGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACE2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGTCGGGGAAATCATGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eACE2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTCTCGCTTCATCTCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFurin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGAGAAGAACCACCCAGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFurin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTACGCCACAGACACCATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRP1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGAAGCCAGAGGAGTACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNRP1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTTTTCCGATTTCACCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTMPRSS2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTCTTAGCAGCCCAGAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eThis Study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTMPRSS2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCTTCAAGGGAGGCCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBCoV-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGAAGTTGGTGGAGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBCoV-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTATCGGCCTAACATACATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e3.5. In silico miRNA target gene prediction\u003c/h2\u003e \u003cp\u003eWe used an online miRNA prediction tool (TargetScan 8.0) (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e) to predict and identify the target genes of some candidate bovine miRNAs (bta-miRNAs). The selection criteria for the target genes included those genes showing a significant differential expression among cells infected with BCoV/Ent/BCoV/Rep or sham-treated cells, the fold changes in the expression of the target gene in the infected group of cells compared to that in the sham-infected group, and the roles of these DEGs in the molecular pathogenesis and replication of other coronaviruses. Multiple sequence comparisons of the miR-16a target site were also reported using TargetScan prediction tools. The potential binding sites of bta-miRNA-16a in the BCoV genome were predicted using three online miRNA target prediction tools, namely, RNA22 v2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cm.jefferson.edu/rna22/\u003c/span\u003e\u003cspan address=\"https://cm.jefferson.edu/rna22/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), miRanda (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e), and psRNA (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). The targeted site selection was based on the minimum free energy and the complementarity between the miRNA seed region and the viral gene binding sites (nucleotides 2\u0026ndash;8 on candidate miRNAs). The presence of at least six conserved complementary nucleotides between the candidate miRNA seed region and the target location in BCoV is a prerequisite for identifying potential target prediction sites.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Isolation of PBMCs, BCoV infection, and miRNA extraction protocols\u003c/h2\u003e \u003cp\u003eBovine whole blood was obtained from Lampire Biological Laboratories (LAMPIRE\u0026reg; Biological Labs, Inc.). Briefly, blood was aseptically withdrawn from apparently healthy animals and subjected to quality control to ensure freedom from other pathogens and bacteria. The collected blood was mixed with 2% ethylenediaminetetraacetic acid ferric sodium salt (Millipore-Sigma, Catalog no: E6760). The blood was processed using Histopaque-1077 (Sigma; Lot. No. RNBL7068) following the manufacturer's instructions. PBMCs were isolated from the buffy coat through gradient centrifugation. The isolated PBMCs were cultured in RPMI-1640 (ATCC, 30-2001) supplemented with 10% horse serum and 1% streptomycin and penicillin antibiotics and incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. After 24 hours, the PBMCs were infected with (MOI of BCoV/Ent or Resp) for two hours, followed by washing three times with sterile phosphate-buffered saline (PBS) and incubation at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. The PBMCs were harvested after 72 hpi and used in subsequent experiments. The miRNAs were extracted from the PBMCs as described above (section \u003cspan refid=\"Sec6\" class=\"InternalRef\"\u003e3.4\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Transfection of miRNA mimics (pri-miRNAs) and small interfering RNAs (siRNAs)\u003c/h2\u003e \u003cp\u003eThe bta-miRNA-16a mimic sequence \"UAGCAGCACGUAAAUAUUGGUG\" and the mirVana miRNA mimic negative control (scrambled miRNA) were purchased from Ambion, Inc. siRNA targeting the BCoV spike glycoprotein sense sequence \"CUGCUAAGAUAUAUGGUAUUU\", siRNA targeting the bovine Furin sense sequence \"GCACAGAGAACGACGUGGAUU\", and si-GENOME nontargeting siRNA (scrambled siRNA) were obtained from Dharmacon\u0026trade;. All miRNAs and siRNAs were transfected using Lipofectamine RNAi-MAX (Invitrogen; Ref. No. 13778-075) as described previously (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). The target cells (50% confluence) were transfected for 24 hrs of subculturing with the corresponding miRNA/siRNA molecules and then infected with BCoV/Ent, BCoV/Rep, or a sham for 48 hrs after the initial transfection. As described earlier, cells that were transfected and infected were incubated for 48\u0026ndash;72 hours post-infection (hpi). The cell culture supernatants were collected and stored at -80\u0026deg;C for further processing, while the adherent cells were collected and processed for Western blot analysis as previously described (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.8. BCoV infection protocol and the viral plaque assay\u003c/h2\u003e \u003cp\u003eThe collected cell culture supernatants from different groups of treated cells were subjected to three cycles of freezing and thawing and used for the titration of BCoV infectivity by the plaque assay. The cell culture supernatants were incubated with TPCK Trypsin (Thermo Fisher Scientific; REF: 20233) as described elsewhere (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). An equal volume of ten \u0026micro;g/ml TPCK trypsin was added to each cell culture supernatant collected from variously treated cells (miRNA or siRNA treated and infected with either BCoV/Ent or BCoV/Resp independently). The cell culture supernatants containing BCoV or a sham-trypsin mixture were incubated for 30 minutes at 37\u0026deg;C. MDBK cells or human rectal tumor-18 (HRT-18) cells were grown in 6-well plates (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e) and inoculated with 10-fold serially diluted BCoV cell culture supernatants. After 1 h of incubation, the supernatant was aspirated, and the cell monolayer was covered with 3 ml of 1.5% Sekam ME Agarose (Lonza; Cat. No. 50011), 2\u0026times; EMEM (quality Biological; Cat. No. 115-073-101) supplemented with 1% penicillin streptomycin (Gibco; REF: 15140-122) and one \u0026micro;g/ml TPCK trypsin. The plate was incubated at 37\u0026deg;C and supplied with 5% CO\u003csub\u003e2\u003c/sub\u003e for 72 days. After 48 hrs of incubation, the cells were fixed with 4% paraformaldehyde (Thermo Fisher Scientific) overnight and stained with 1% crystal violet. The plaques were counted, and the BCoV infectivity titers per group of treated cells were calculated using the Reed and Muench method (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Western blot analysis\u003c/h2\u003e \u003cp\u003eThe MDBK and BEC cells harvested from the various treatment groups were washed with cold PBS and then lysed with Pierce radioimmunoprecipitation assay (RIPA) lysis buffer (Thermo Fisher Scientific; REF: 89901), 1% 0.5 M EDTA solution, and 1% Halt Protease \u0026amp; Phosphatase inhibitor (Thermo Fisher Scientific) for 5 min on ice. The collected protein samples were electrophoresed on a 10% SDS‒polyacrylamide gel (SDS‒PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, Cat. No. 1620177). After blocking with 5% bovine serum albumin (BSA) in Tris-buffered saline (T.B.S.) buffer containing 0.05% Tween-20 (TBST), the PVDF membranes were incubated with the appropriate primary antibodies, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies in blocking solution. After three washes with TBST, immunoreactive bands were detected by film exposure after the addition of enhanced chemiluminescence (ECL) substrate (Bio-Rad catalog #1705060). All western blot bands were visualized with a GelDoc Go Imaging System (Bio-Rad Laboratories, Inc.) and analyzed with ImageJ software (San Diego, US). Bovine β-actin was used to normalize the relative expression levels of proteins. The primary antibodies were used to detect the expression levels of the BCoV-nucleocapsid mouse anti-bovine monoclonal (clone: FIPV3-70; cat. no. MA1-82189), BCoV-spike rabbit anti-bovine polyclonal (cat. no. PA5-117562), and β-actin rabbit anti-bovine polyclonal (cat. no. PA1-46296) antibodies were purchased from Invitrogen. Furin rabbit anti-bovine polyclonal (Cat. No. ARP45328_P050), ACE2 rabbit anti-bovine polyclonal (Cat. No. ARP53751_P050), TMPRSS2 rabbit anti-bovine polyclonal (Cat. No. ARP46628_P050), and anti-NRP1 rabbit anti-bovine polyclonal (Cat. No. ARP59101_P050) were purchased from Aviva Systems Biology. The corresponding secondary antibodies for each protein used, including horseradish peroxidase (H.R.P.)-conjugated IgG (H\u0026thinsp;+\u0026thinsp;L), goat anti-rabbit (REF: 31460), and goat anti-mouse (REF: 31430), were obtained from Invitrogen. The western blot band density was measured using ImageJ software (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The mean band density of each protein was normalized by dividing its value by the mean band density of the housekeeping gene (B-actin) for each sample separately (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003e3.10. Cloning of the 3'UTR of bovine Furin and the mutated seed region of bta-miRNA-16a in the dual luciferase expression vector and dual luciferase assay\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe wild-type (WT) and mutant (Mut) binding sites of bta-miRNA-16a within the 3'UTR of bovine Furin were synthesized by a commercial provider (GenScript USA Inc.). Briefly, the WT Furin-3'UTR construct region spanning the binding region of bta-miRNA-16a was annealed and inserted between the \u003cem\u003eSacI\u003c/em\u003e and \u003cem\u003eXhoI\u003c/em\u003e regions of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Catalog number: E1330). Mutations within the bta-miRNA16a WT construct were generated by PCR-based site-directed mutagenesis. The binding region of Furin with bta-miRNA-16a was mutated from \"5\u0026rsquo;-TGCTGCT-3'\" to \"5\u0026rsquo;-GATGATC-3'\" according to the manufacturer's instructions. Both constructs were confirmed by restriction enzyme digestion and sequencing (S1 Fig). According to the manufacturer's instructions, the dual luciferase assay was conducted using the Pierce Renilla-Firefly Luciferase Dual Assay Kit (Thermo Scientific; Ref. No. 16185). To determine the expression levels of Furin in bta-miRNA-16a-transfected MDBK and HEK 293T cells, we plated the cells into 24-well plates and co-/transfected these cells with 100 ng of bta-miRNA-16a mimic and 100 ng of either pmiR-GLO-Furin-WT or pmiR-GLO-Furin-Mut plasmids using Lipofectamine 3000 (Invitrogen Catalog # L3000001) transfection reagent. An empty plasmid (pmiR-GLO) transfected with bta-miRNA-16a and pmiR-GLO-Furin-WT transfected with scrambled miRNA were used as negative controls. All experiments were repeated three independent times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.11. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll the reported results in this study are displayed as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;S.D.s and were analyzed with GraphPad Prism v9. One-way analysis of variance (ANOVA) with Tukey's or Dunnett's test was performed among multiple groups. Student's t test was used for paired comparisons among the samples. P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered to indicate statistical significance. Statistical significance in the figures is indicated as follows: * p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, *** p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, and ns, not significant. The data were combined from at least three independent experiments unless otherwise stated.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Bovine Coronavirus (BCoV) Infection Induces Differential Display of Host Cell mRNA and miRNA Expression Profiles.\u003c/h2\u003e \u003cp\u003eMadine Darby Bovine Kidney (MDBK) and Bovine Vascular Endothelial (BEC) cells were infected with bovine coronavirus enterica (BCoV/Ent) and bovine coronavirus Resp (BCoV/Resp) at a multiplicity of infection (MOI) of 1. Cytopathic effects (C.P.E.) and morphological changes were observed in the infected cells at 72 hours post-infection (hpi) (Fig.\u0026nbsp;1A, 1B). Morphological observations of the BCoV-infected cells revealed more prominent CPE in the BCoV/Ent isolate-infected groups than in the BCoV/Resp isolate-infected groups, especially in the MDBK cells (Fig.\u0026nbsp;1A). The q-RT‒PCR results demonstrated that the BCoV/Ent and BCoV/Resp isolates were successfully infected and propagated on both MDBK and BEC cells (Fig.\u0026nbsp;1C, 1D). The magnitude of the BCoV genomic viral load was greater in the BCoV/Ent-infected groups than in the BCoV/Resp-infected groups (Fig.\u0026nbsp;1C, 1D). KEGG pathway enrichment analysis of the NGS data revealed significant virus-related pathways involved in the response to BCoV/Ent and BCoV/Resp infection (Fig.\u0026nbsp;1E, 1F). KEGG pathway enrichment analysis of the BCoV/Ent-infected group revealed significant differences in gene expression between the human cytomegalovirus (hCMV)-infected group and the hepatitis B-infected group (Fig.\u0026nbsp;1E). KEGG pathway enrichment analysis revealed that the coronavirus COVID-19 pathway had the greatest effect on the BCoV/Resp-infected group, followed by the hCMV and hepatitis B pathways (Fig.\u0026nbsp;1F). NGS revealed more differentially expressed host genes in the BCoV/Resp group (Fig.\u0026nbsp;1E). At the same time, miRNA expression patterns were consistent across both the BCoV/Ent and BCoV/Resp groups (Fig.\u0026nbsp;1F). These results highlight distinct infection patterns between BCoV/Ent and BCoV/Resp isolates in MDBK and BEC cells. Differential expression of host genes involved in various viral infections indicates a broad immune response.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e4. 2. bta-miRNA-16a is differentially expressed in target cells during BCoV Ent/Resp infection.\u003c/h3\u003e\n\u003cp\u003eWe analyzed the data obtained from the NGS experiments of the BCoV-infected cells to identify the potential miRNAs showing differential expression in the BCoV/Ent- and BCoV/Resp-infected groups (Fig.\u0026nbsp;2A). Our results showed that bta-miRNA-16a was downregulated in the BCoV/Ent group and upregulated in the BCoV/Resp group compared to the sham-infected group (Fig.\u0026nbsp;2A). In BCoV-infected MDBK cells, bta-miRNA-16a was significantly upregulated in the BCoV/Resp group, while no significant expression of bta-miRNA-16a was observed in the BCoV/Ent group (Fig.\u0026nbsp;2B). In BCoV-infected BECs, bta-miRNA-16a was downregulated up to 1.3-fold in the BCoV/Ent group and upregulated up to 1.74-fold in the BCoV/Resp group (Fig.\u0026nbsp;2C). Bovine PBMCs showed significant downregulation of bta-miRNA-16a (2.8-fold) in the BCoV/Ent-infected group, but no substantial changes in beta-miRNA-16a expression were observed in the BCoV/Resp group (Fig.\u0026nbsp;2D). These results demonstrated consistent expression patterns between the NGS and qRT‒PCR analyses, validating the differential expression pattern of bta-miRNA-16a in the BCoV/Ent- and BCoV/Resp-infected groups.\u003c/p\u003e\n\u003ch3\u003e4. 3. The bta-miRNA-16a restricts BCoV replication.\u003c/h3\u003e\n\u003cp\u003eIn silico analysis revealed that bta-miRNA-16a has multiple targeting sites across the BCoV genome, including one target in ORF1b and two other targets within the BCoV-spike glycoprotein (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). To further validate this prediction, bta-miRNA-16a was independently transfected into MDBK and BEC cells, which were subsequently infected with BCoV/Ent/Resp in parallel with the scrambled miRNA (miRNA-Scr). qRT‒PCR analysis revealed significant upregulation of bta-miRNA-16a in the miRNA-16a-transfected group compared to the miRNA-Scr group in the MDBK and BEC cells (Fig.\u0026nbsp;3B, 3C). Our data showed that bta-miRNA-16a expression was downregulated after BCoV infection in nontransfected cells (Fig.\u0026nbsp;3B, 3C). Our results also revealed marked inhibition of BCoV genome expression in the bta-miRNA-16a-transfected groups compared to the miRNA-Scr-transfected MDBK and BEC groups (Fig.\u0026nbsp;3D, 3E). The viral plaque assay revealed up to 1.24-fold inhibition of BCoV infectivity in the bta-miRNA-16a-transfected group of cells (Fig.\u0026nbsp;3F). At the protein level, western blot analysis revealed significant inhibition of the BCoV-Nucleocapsid (BCoV-N) and BCoV-Spike (BCoV-S) proteins after bta-miRNA-16a transfection and BCoV infection in MDBK cells (Fig.\u0026nbsp;3G, 3H, and 3I). BECs showed marked inhibition of BCoV-N and BCoV-S protein expression (Fig.\u0026nbsp;3J, 3K, and 3L). These findings suggest that bta-miRNA-16a targets the spike protein of BCoV, playing a crucial role in restricting BCoV replication.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOnline prediction of host bta-miRNA-16a targeting the BCoV genome at multiple locations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBovine miRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBCoV Target Genes\u003c/p\u003e \u003cp\u003e(Position)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePredicted Consequential Pairing of\u003c/p\u003e \u003cp\u003emiRNA (Top) and Target Region (Bottom)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRNAv22\u003c/p\u003e \u003cp\u003e(folding energy)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003emiRanda\u003c/p\u003e \u003cp\u003e(Score)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003epsRNA\u003c/p\u003e \u003cp\u003e(Score)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003emiR-16a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eORF1b\u003c/p\u003e \u003cp\u003e(13721)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;GTGGTTATAAATGCACGACGAT\u003c/p\u003e \u003cp\u003e ||||: ||:| |||||||\u003c/p\u003e \u003cp\u003e5\u0026rsquo;TCGCAATGATTGCATGCTGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpike\u003c/p\u003e \u003cp\u003e(24762)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;GTGGTTATAAATGCACGACGAT\u003c/p\u003e \u003cp\u003e :|||||| ||||||||\u003c/p\u003e \u003cp\u003e5\u0026rsquo;TAATAATATT\u0026ndash;GATGCTGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-14.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e160\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eN/A\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSpike\u003c/p\u003e \u003cp\u003e(24928)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u0026rsquo;GTGGTTATAAATGCACGACGAT\u003c/p\u003e \u003cp\u003e :|::| |||||| ||||||||\u003c/p\u003e \u003cp\u003e5\u0026rsquo;TATTATAATTTACCTGCTGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-17.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e160\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe nucleotides highlighted in red represent the binding sites of bta-miRNA-16 with the corresponding target sites in the BCoV genome sequence. N/A is not applicable.\u003c/p\u003e\n\u003ch3\u003e4. 4. The bovine Furin gene is a novel target for the host bta-miRNA-16a.\u003c/h3\u003e\n\u003cp\u003eTo further evaluate the mechanism of action of bta-miRNA-16a-based inhibition of BCoV replication, in silico prediction was conducted between bta-miRNA-16a and several potential target host genes involved in BCoV infection. The binding region of Furin is conserved across different mammalian species, including humans and mice (Fig.\u0026nbsp;4A). The online bioinformatics tool \"TargetScan\" revealed that bta-miRNA-16a could target the 3'UTR of the bovine host cell Furin (Fig.\u0026nbsp;4B). Therefore, to examine the effect of bta-miRNA-16a on the expression levels of the host Furin at the mRNA and protein levels, bta-miRNA-16a was transfected into both MDBK and BEC cells, and the inhibition of host cellular Furin was observed. The mRNA of host cellular Furin was downregulated by up to 70% in the bta-miRNA-16a-transfected groups compared to the miRNA-Scr-transfected groups of MDBK cells (Fig.\u0026nbsp;4C). The protein level of Furin was downregulated by approximately 30% in the bta-miRNA-16a-transfected groups compared to the miR-Scr-transfected group in MDBK cells (Fig.\u0026nbsp;4D, 4E). In the BECs, up to 50% downregulation of the host furin protein was observed in the miRNA-16a-transfected groups (Fig.\u0026nbsp;4G, 4H). However, furin mRNA was not significantly downregulated in the miRNA-Scr-transfected BECs (Fig.\u0026nbsp;4F). To validate Furin as a potential novel target of bta-miRNA-16a, a dual-luciferase reporter plasmid containing the 3'UTR of Furin containing the binding region of bta-miRNA-16a was constructed (Fig.\u0026nbsp;4I). The Furin mutant was generated by site-directed mutagenesis of the bta-miRNA-16a binding region (Fig.\u0026nbsp;4I). The successful insertion of the 3'UTR of Furin and the mutant construct was validated by double digestion with the \u003cem\u003eXhoI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e restriction enzymes, followed by gel-based PCR and nucleotide sequencing (Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA\u0026ndash;S1D). The wild-type and mutant pmirGLO luciferase constructs were co-transfected with miR-16a or scrambled miRNA into HEK293 cells. The dual-luciferase assay revealed that co-transfection of wild-type Furin with miRNA-16a significantly reduced the relative luciferase activity by more than 50% compared to that in cells co-transfected with miRNA-Scr and wild-type Furin or bta-miRNA-16a co-transfected with mutated Furin (Fig.\u0026nbsp;4J). Overall, these results confirmed that bta-miRNA-16a can effectively target and significantly downregulate host cellular Furin.\u003c/p\u003e \u003cp\u003e \u003cb\u003e4. 5. Applying siRNA targeting the BCoV-Spike Glycoprotein and the Host Furin Inhibits BCoV Replication at the Gene and Protein Expression Levels\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo confirm the effect of bta-miRNA-16a, which targets the BCoV-S protein and the cellular host cell Furin, on BCoV replication, we designed two sets of siRNAs. The first siRNA targets the bta-miRNA-16a target site within the BCoV/S glycoprotein. The second siRNA targeted bta-miRNA-16a in the 3'UTR of the host cell Furin. Bovine cells were transfected with siRNAs, followed by independent infection with BCoV/Ent or BCoV/Resp isolates. Samples were collected after 72 hpi for subsequent analysis (Fig.\u0026nbsp;5A). MDBK cells were transfected with different concentrations of siRNAs (50 ng or 100 ng). The results revealed a gradual reduction in the protein level of the bovine host Furin with increasing siRNA-Furin concentration (Fig.\u0026nbsp;5B, 5C). Similarly, the BCoV-spike protein exhibited a similar decrease in expression with increasing siRNA-spike concentration (Fig.\u0026nbsp;5D, 5E), confirming the efficacy of siRNAs in suppressing the production of BCoV-S and the host Furin. The mRNA expression level of the host cell Furin was also significantly lower in the Furin-siRNA-treated groups than in the Sc-siRNA-treated groups for both the MDBK and BEC strains. cells (Fig.\u0026nbsp;5F, 5G). Following the silencing of Furin and spike, we examined their impact on BCoV replication. The results revealed approximately 58% (\u0026asymp;\u0026thinsp;2.39-fold) inhibition of BCoV at the genomic level in the siRNA-Furin-transfected MDBK cell group (Fig.\u0026nbsp;5H). In BECs, the inhibitory effects of the applied siRNAs were even more pronounced, with approximately 75% (\u0026asymp;\u0026thinsp;4.26-fold) inhibition at the genomic level of BCoV (Fig.\u0026nbsp;5I). The inhibition of BCoV replication was particularly prominent in the BCoV/Ent-infected groups. Silencing of the BCoV-S glycoprotein resulted in approximately 61% (\u0026asymp;\u0026thinsp;2.61-fold) inhibition of BCoV/Ent and approximately 74% (\u0026asymp;\u0026thinsp;3.85-fold) inhibition of BCoV/Resp in BEC-treated cells (Fig.\u0026nbsp;5K).\u003c/p\u003e \u003cp\u003e \u003cb\u003e4. 6. The application of BCoV-S glycoprotein siRNA and host cell-furin inhibited BCoV infectivity in host cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA viral plaque assay was conducted to evaluate the impacts of siRNA-Furin and siRNA-BCoV-spike glycoproteins on the infectivity of the BCoV particles. Following transfection with siRNA-Furin and siRNA-BCoV-spike, MDBK cells were infected with BCoV, and cell lysates were analyzed to assess BCoV inhibition at the posttranscriptional level. The results showed an approximately 1.9-fold decrease in the infectivity level of the BCoV enteric isolate after silencing the host Furin (Fig.\u0026nbsp;6A). Silencing the BCoV spike protein in MDBK cells resulted in an approximately 1.47-fold decrease in BCoV infectivity (Fig.\u0026nbsp;6B). In MDBK-treated cells, Furin protein expression in the host decreased by approximately 50% after silencing the host Furin and by approximately 42% after silencing the BCoV spike glycoprotein (Fig.\u0026nbsp;6C, 6D). The results revealed approximately 2.5-fold inhibition of the BCoV spike protein in the siRNA-Furin group and approximately 1.38-fold inhibition in the siRNA-spike-transfected group compared to the scrambled group (Fig.\u0026nbsp;6C, 6E). In the host Furin-silenced group of cells, the BCoV nucleocapsid protein was inhibited approximately 1.79-fold and 1.97-fold in the BCoV/Ent- and BCoV/Resp-infected groups, respectively (Fig.\u0026nbsp;6C, 6F). Silencing of the BCoV spike protein inhibited the BCoV nucleocapsid protein by approximately 1.24-fold and 1.31-fold in the BCoV/Ent- and BCoV/Resp-infected groups, respectively (Fig.\u0026nbsp;6C, 6F). Notably, the downregulation of spike, nucleocapsid, and Furin was consistent in the control and BCoV-infected groups, indicating that siRNA-spike and siRNA-Furin inhibit protein production at the posttranscriptional level, independent of BCoV infection.\u003c/p\u003e \u003cp\u003e \u003cb\u003e4. 7. The bta-miRA-16a modulates the expression levels of several essential coronavirus replication-related proteins (ACE2, NPR1, TMPRSS2) during BCoV replication.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eHerein, we evaluated the possible effect of bta-miRNA-16a on other host cell surface receptors involved in infections caused by other coronaviruses, particularly severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). MDBK cells were transfected with miRNA-Scr and bta-miRNA-16a, and the mRNA and protein expression levels of several selected host cell proteins were monitored (angiotensin-converting enzyme 2 (ACE2), transmembrane protease, serine 2 (TMPRSS2), and neuropilin-1 (NRP1)). The results revealed that ACE2 protein expression was inhibited by approximately 22% in the bta-miRNA-16a-transfected group compared to the miRNA-Scr-transfected group (Fig.\u0026nbsp;7A, 7C). In the bta-miRNA-16a-transfected group, the ACE2 mRNA was downregulated by up to 50% after BCoV infection (Fig.\u0026nbsp;7B). The host NRP1, mRNA, and protein expression markedly increased after BCoV infection in the miRNA-Scr-transfected cells but decreased in the bta-miRNA-16a-transfected cells, particularly after BCoV infection (Fig.\u0026nbsp;7A, 7D, 7E). The mRNA of TMPRSS2 was also downregulated after BCoV infection in the bta-miRNA-16a-transfected group of cells (Fig.\u0026nbsp;7F); however, no significant changes in protein expression levels between the miRNA-Scr- and bta-miRNA-16a-transfected groups were observed (Fig.\u0026nbsp;7A, 7G).\u003c/p\u003e \u003cp\u003e \u003cb\u003e4. 8. Inhibition of host Furin expression through bta-miRNA-16 targeting potentially activates other alternative pathways to rescue host cells from BCoV infection.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further explore the roles of the host cell Furin in BCoV infection, two siRNAs were used to inhibit BCoV regulation by targeting the BCoV-S glycoproteins and the bta-miRNA-16 target sites within the 3'UTR of the host cell Furin. We independently transfected these two siRNAs into bovine cells and investigated the mechanism underlying the effects of bovine ACE2, TMPRSS2, and NRP1 during BCoV/Ent/Resp isolate infection. siRNA-BCoV-S and siRNA-Furin were transfected into MDBK cells, and the mRNA and protein expression levels of the host ACE2, TMPRSS2, and NRP1 were assessed using qRT‒PCR and Western blotting with the relevant antibodies, respectively. TMPRSS2 expression did not significantly change in the siRNA-Furin- or siRNA-BCoV-S-transfected cells (Fig.\u0026nbsp;8A, 8B, 8C). The host ACE2 mRNA and protein expression levels were significantly downregulated after siRNA-Furin transfection (Fig.\u0026nbsp;8A, 8D, 8E). ACE2 protein expression was also downregulated in the siRNA-spike-transfected group but only after BCoV infection (Fig.\u0026nbsp;8A, 8D, 8E). NRP1 mRNA and protein expression were similarly downregulated in the siRNA-Furin-transfected group but were downregulated only after BCoV infection in the siRNA-spike-transfected group (Fig.\u0026nbsp;8A, 8F, 8G). The mRNA expression of both ACE2 and NRP1 decreased after BCoV infection in the siRNA-BCoV-S-transfected group, suggesting their involvement in BCoV infection. These findings mirror the outcomes of bta-miRNA-16a transfection, suggesting a direct correlation between ACE2 and NRP1 expression and host Furin expression. In contrast, TMPRSS2 appears to operate independently of the host Furin upon BCoV infection.\u003c/p\u003e\n\u003ch3\u003e4. 9. bta-miRNA-16 overexpression enhances cytokine gene expression in the context of BCoV infection.\u003c/h3\u003e\n\u003cp\u003eWe investigated the impact of bta-miRNA-16a on the expression levels of host cell cytokines during BCoV infection. MDBK cells were transfected with miR-16a, siRNA-Furin, and siRNA-spike, and the mRNA expression of IFN-α, IFN-β, IFN-γ, IL-6 and IL-10 was assessed by qRT‒PCR using the designed oligonucleotides listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The results showed significant upregulation of IFN-α, IFN-β, and IFN-γ in the bta-miRNA-16a-transfected group of cells compared to the miRNA-Scr-transfected group (Fig.\u0026nbsp;9A, 9B, 9C). The mRNA expression of host IL-6 and IL-10 was upregulated in the bta-miRNA-16a-transfected group, particularly post-BCoV/Ent infection (Fig.\u0026nbsp;9D, 9E). Moreover, IFN-α, IFN-β, and IFN-γ expression was downregulated in the siRNA-Furin- and siRNA-spike-transfected cells (Fig.\u0026nbsp;9F, 9G, 9H). Although the expression levels of IL-6 and IL-10 were upregulated in the siRNA-Furin and siRNA-BCoV-S groups following BCoV/Ent infection, the overall expression levels were lower than those in the siRNA-Scr-transfected group of cells (Fig.\u0026nbsp;9I, 9J).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBCoV is an endemic viral pathogen in cattle populations worldwide, including in the USA. (\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e). The virus has dual respiratory/enteric tissue tropism (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e). The mechanisms governing this dual tropism have not yet been well studied. The presence of viral receptors and other host cell proteases may partially explain this dual tropism; however, many aspects of the BCoV/host interaction, including their tissue tropism, have not yet been studied. However, the availability of viral receptors and some other host enzymes are not the sole agents that govern the success of viral replication or fully explain viral tropism. MicroRNAs are small RNA molecules that regulate host genes at the posttranslational level. Previous studies have shown that host miRNAs regulate the gene expression of many host proteins during many viral infections, including SARS-CoV-2. Several host cell miRNAs, including miRNA-(155, 221, and 146a), can act as biological markers for SARS-CoV-2 infection; they also play essential roles in regulating inflammatory responses during SARS-CoV-2 infection in humans (\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e). However, the role of host cell miRNAs has not been extensively studied in the context of BCoV infection. The main aim of this study was to determine the roles of some host miRNAs in BCoV replication, tissue tropism, and immune regulation/evasion. Our recent in silico prediction and bioinformatics search studies revealed that several host miRNAs could play essential roles in the context of BCoV replication and at least in part explain the dual tropism of BCoV infection (\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e). In this study, we focused on the function of beta-miRNA-16a, which shows some differential expression profiles during the replication of either enteric or respiratory isolates of BCoV.\u003c/p\u003e\n\u003cp\u003eThe miRNA/coronavirus interaction revealed some insights into the roles of these small RNA molecules in fine-tuning virus replication and immune regulation. It was predicted that the ability of hsa-miRNA-miR-8066 to target the SARS-CoV-2 nucleocapsid (N) protein leads to the inhibition of viral replication (\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e). Other studies have shown that at least seven host miRNAs (hsa-miRNA-(15a, 298, 497, 508, 1909, and 3130)) target the SARS-CoV-2-S glycoprotein at various locations, leading to substantial inhibition of virus replication (\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e). The candidates of the host miRNA-16 family are involved in many cellular processes, including cell cycle arrest, tumor research, and immune regulation, particularly the TGF\u0026beta; pathway, and they are also used as diagnostic and prognostic markers for cancer research (\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e). Recent studies have shown that host miRNA-16-2-3p could be an excellent prognostic marker for SARS-CoV-2 infection in humans (\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e). However, the roles of bta-miRNA-16a in BCoV replication and immune regulation have not yet been studied.\u003c/p\u003e\n\u003cp\u003eMost coronaviruses, including Betacoronaviruses, use host cell serine protease-2 (Furin) to cleave the spike glycoprotein at the PRRAR motif (\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e). Furin/CoV/S targeting plays an important role in CoV tissue tropism and molecular pathogenesis (\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e). Cleavage of the SARS-CoV-2 S glycoprotein is an essential step in virus replication. Transmembrane serine protease 2 (TMPRSS2) cleaves SARS-CoV-2-S, and another enzyme called Furin (another serine protease-2) is responsible for the proteolysis of the spike glycoprotein into the S1 and S2 domains (\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e). These two simultaneous cleavage events are essential for the replication of most coronaviruses, particularly during the entry of the virus into host cells. To further confirm and consolidate this phenomenon, other researchers have shown that deleting Furin cleavage sites from SARS-CoV-2-S substantially decreases virus replication and impacts downstream viral pathogenesis and tissue tropism (\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e). Our data revealed differential expression of bta-miRNA-16a in BCoV/Ent- and BCoV/Resp-infected MDBK and BEC cells (Fig.\u0026nbsp;2A-2D). There was a marked downregulation of the bta-miRNA-16a expression profile, especially in the case of BCoV/Ent-infected cells. Thus, we believe that the host responded to BCoV/Ent infection by downregulating bta-miRNA16a, which targets the 3\u0026rsquo;UTR of the host cell Furin. This bta-miRNA-16a targeting Furin inhibited BCoV replication at the genome copy number level, as measured by qRT‒PCR; at the viral protein level, including the BCoV/S and BCoV/N proteins; and at the virus infectivity level, as shown by plaque assays (Fig.\u0026nbsp;3D‒3 L). These data are very consistent with SARS-CoV-2 loss of Furin cleavage sites, which led to marked inhibition of SARS-CoV-2 replication (\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eSeveral approaches, including bioinformatics, western blot, and dual luciferase assays, have been used to validate several genes as targets for candidate miRNAs, including the use of a dual luciferase assay on a potential gene 3\u0026rsquo;UTR construct carrying the seed region of the target miRNA. The comparison between the luciferase activity of the mutated 3\u0026rsquo;UTR construct of the miRNA target gene and that of the wild-type construct carrying the seed region of the same miRNA candidate was used extensively as a benchmark for miRNA/gene target validation (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e). Our bioinformatic analysis of bta-miRNA-16a revealed that the seed region of this miRNA is highly conserved among the Furin 3\u0026rsquo;UTRs of several species of animals, including humans and bovine species (Fig.\u0026nbsp;4A). Our results showed that Furin protein expression was lower in MDBK cells and in BECs transfected with bta-miRNA-16 than in those transfected with scrambled miRNA (Fig.\u0026nbsp;4C-4G). The dual luciferase assay results showed marked inhibition of luciferase activity in cells transfected with the bta-miRNA-16a 3\u0026rsquo;UTR wild-type construct (Fig.\u0026nbsp;4J). Thus, Furin is considered a novel target of bta-miRNA-16a.\u003c/p\u003e\n\u003cp\u003eOur data clearly showed that infection with both BCoV/Ent and BCoV/Resp inhibited interferon (\u0026alpha;, \u0026beta;, and \u0026lambda;) production (Fig.\u0026nbsp;9A-9C). However, the overexpression of bta-miRNA-16a enhanced cytokine gene expression (Fig.\u0026nbsp;9A-9C). Consistently, it was previously shown that the BCoV-N protein inhibits IFN-\u0026beta; production via the RIG-I-like receptor (RLR) pathway (\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e). This confirms our findings about the dual actions of bta-miRNA-16a in the inhibition of BCoV infection and the enhancement of the host immune response to counteract viral infection.\u003c/p\u003e\n\u003cp\u003eOne of the approaches to confirm the action of certain miRNAs on their target genes is to use siRNAs to inhibit the same miRNA target region within these genes. To confirm the ability of bta-miRNA-16a to target the host cell Furin and the BCoV-S glycoprotein, we designed two independent siRNAs to target the indicated regions. Our plaque assay data showed that the application of siRNA-Furin and siRNA-S substantially inhibited BCoV replication in MDBK and BEC cells in terms of genome copy number, protein (S and N) expression, and virus infectivity (Figs.\u0026nbsp;5, 6). Our data are very much consistent with other research on other coronaviruses (CoVs), particularly SARS-CoV-2. The application of siRNAs targeting the SARS-CoV-2 S glycoprotein significantly inhibited virus replication (\u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e). Similarly, using Furin inhibitors led to marked inhibition of SARS-CoV-2, which is considered a promising antiviral therapy for SARS-CoV-2 infection in humans (\u003cspan class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e55\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eIn addition to host ACE2, several alternative host surface receptors have been suggested to promote coronavirus infection in host cells. The alternative receptors for ACE2 in coronavirus infection include neuropilin-1 (NRP1) (\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e56\u003c/span\u003e) and CD147, a transmembrane glycoprotein expressed in epithelial and immune cells (\u003cspan class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e58\u003c/span\u003e). In most coronaviruses, including SARS-CoV-2, the spike protein undergoes two proteolytic cleavage steps after binding to ACE2. The first cleavage occurred at the S1-S2 boundary and was cleaved by the host cell Furin. Virus entry still requires a second cleavage by host cell proteases at the S2\u0026rsquo; region, which is mostly performed by TMPRSS2 (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e). If the host cell has a low level of TMPRSS2 or if the virus-ACE2 complex does not meet TMPRSS2, the complex is taken into the cell by clathrin-mediated endocytosis into the endo-lysosomes, where the S2 site is cleaved by cathepsins (\u003cspan class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e60\u003c/span\u003e). In this study, we showed that host Furin inhibition by bta-miR-16a or by siRNA-Furin downregulates ACE2 and NRP1 mRNA and protein expression (Figs.\u0026nbsp;7, 8). However, no effect on TMPRSS2 expression was detected at the genomic or protein level (Fig.\u0026nbsp;7F, 7G, 8B, 8C). These findings suggest that bta-miR-16a downregulates the expression of the bovine host Furin, potentially inhibiting host ACE2 and NRP1 expression levels. Conversely, TMPRSS2 may compensate for these inhibitory effects of bta-miRNA-16a on Furin through an alternative regulatory mechanism to rescue BCoV infection in host cells following Furin and ACE2 inhibition.\u003c/p\u003e\n\u003cp\u003eIL6 plays key roles in the regulation of the replication of some CoVs, particularly SARS-CoV-2, and in the modulation of the immune response (\u003cspan class=\"CitationRef\"\u003e61\u003c/span\u003e). SARS-CoV-2 infection triggers robust IL6 production, which induces a cytokine storm (\u003cspan class=\"CitationRef\"\u003e62\u003c/span\u003e). Similarly, BCoV infection, particularly infection with the BCoV/Ent isolate, upregulated the expression of IL6 (Fig.\u0026nbsp;9D). Furthermore, bta-miNRA-16a treatment increased IL6 expression in cells transfected with bta-miRNA-16a and infected with the BCoV-Ent isolate compared to that in the Scr-miRNA-transfected cells and infected with the BCoV/Ent isolate (Fig.\u0026nbsp;9D). These findings demonstrate that bta-miRNA-16a overexpression significantly activates the host cytokine response. Moreover, the prevalence of BCoV/Ent infection leads to elevated expression of host cytokines and interferons.\u003c/p\u003e\n\u003cp\u003ePrevious studies have shown that the miRNA-16 family is involved in cell cycle control, cell survival, and apoptosis pathways (\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e). This miRNA also controls the balance between cell survival and apoptosis. Our data show that bta-miRNA-16a enhances cell survival in transfected cells infected with either BCoV/Ent or BCoV/Resp compared to that in cells infected with the Scr-miRNA mimics (Fig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003eA-S2D). These data could also be supported by the marked activation of host cytokine gene expression, as shown in section 4.4. Thus, the high stimulation of cytokines and the limitation of the CPE observed in the bta-miRNA-16a-transfected group of cells infected with BCoV contributed to the marked inhibition of virus replication. Consistent with these findings, cells treated with siRNA-BCoV-S showed less CPE than did the same type of cells transfected with the miRNA-Scr mimics (Fig. \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003eA-S2D and Fig. \u003cspan class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eIn summary, bta-miRNA-16a plays dual roles in the restriction of BCoV replication through targeting the spike glycoprotein and the host cell Furin. This bta-miRNA-16a/viral/host gene targeting inhibited BCoV replication. It also stimulated the production of some host cytokines, which contributed substantially to cell survival in the bta-miRNA-16-transfected cells compared to the Scr-miRNA-transfected cells (Fig.\u0026nbsp;10).\u003c/p\u003e\n\u003cp\u003eBased on our findings in this study, we concluded that bta-miRNA-16a could be a promising diagnostic marker for BCoV infection. This study also highlights the potential antiviral therapeutic potential of bta-miNRA-16a and its feasibility in designing novel miRNA-based vaccines against BCoV in the future. Previously, it was reported that miR-29a and miR-378b enhance the host DNA-sensing pathway in the presence of CpG motifs and can be used as adjuvants for vaccines (\u003cspan class=\"CitationRef\"\u003e63\u003c/span\u003e). Similarly, this study revealed that bta-miRNA-16a targets the host Furin and enhances interferon production. This highlights the importance of bta-miRNA-16a as a potential therapeutic avenue for BCoV infection in cattle.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\n\u003cp\u003eWe thank Drs. Udeni B. R. Balasuriya and Mariano Carossino, Louisiana State University, for kindly providing the Madine Darby Bovine Kidney (MDBK) and the\u0026nbsp;human\u0026nbsp;rectal tumor-18 (HRT-18) cells used in this study. We also thank Dr. Aspen Workman from\u0026nbsp;the\u0026nbsp;Animal Health Genomics Research Unit, USDA, A.R.S., U.S. Meat Animal Research, for kindly providing the\u0026nbsp;bovine coronavirus respiratory\u0026nbsp;isolate used in this study.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.G.H. conceptualized and designed the whole study, carried out some laboratory experiments, oversaw the entire research data analysis, wrote the manuscript, and submitted the manuscript.\u003c/p\u003e\n\u003cp\u003eA.U.S. carried out the experiments and bioinformatic prediction, analyzed the data, and participated in writing the manuscript. All authors have read and agreed to the submitted version of the manuscript.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by a seed grant from Long Island University (Grant no: 36524).\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eConflicts of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003einterest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data are available upon request from the corresponding author.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eList IMS. https://talk.ictvonline.org/files/master-species-lists/m/msl/9601/download Accessed on 6 Apr 2020. 2019.\u003c/li\u003e\n\u003cli\u003eJackson CB, Farzan M, Chen B, Choe H. Mechanisms of SARS-CoV-2 entry into cells. Nat Rev Mol Cell Biol. 2022;23(1):3-20.\u003c/li\u003e\n\u003cli\u003eMatsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, et al. Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells. Proc Natl Acad Sci U S A. 2020;117(13):7001-3.\u003c/li\u003e\n\u003cli\u003eCantuti-Castelvetri L, Ojha R, Pedro LD, Djannatian M, Franz J, Kuivanen S, et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science. 2020;370(6518):856-60.\u003c/li\u003e\n\u003cli\u003eSuzuki T, Otake Y, Uchimoto S, Hasebe A, Goto Y. Genomic Characterization and Phylogenetic Classification of Bovine Coronaviruses Through Whole Genome Sequence Analysis. Viruses. 2020;12(2).\u003c/li\u003e\n\u003cli\u003eVlasova AN, Saif LJ. Bovine Coronavirus and the Associated Diseases. Front Vet Sci. 2021;8:643220.\u003c/li\u003e\n\u003cli\u003ePeacock TP, Goldhill DH, Zhou J, Baillon L, Frise R, Swann OC, et al. The furin cleavage site in the SARS-CoV-2 spike protein is required for transmission in ferrets. Nat Microbiol. 2021;6(7):899-909.\u003c/li\u003e\n\u003cli\u003eHemida MG, Ye X, Thair S, Yang D. Exploiting the therapeutic potential of microRNAs in viral diseases: expectations and limitations. Mol Diagn Ther. 2010;14(5):271-82.\u003c/li\u003e\n\u003cli\u003eZheng M. Cellular Tropism of SARS-CoV-2 across Human Tissues and Age-related Expression of ACE2 and TMPRSS2 in Immune-inflammatory Stromal Cells. Aging Dis. 2021;12(3):718-25.\u003c/li\u003e\n\u003cli\u003eHodnik JJ, Jezek J, Staric J. Coronaviruses in cattle. Trop Anim Health Prod. 2020;52(6):2809-16.\u003c/li\u003e\n\u003cli\u003eShang R, Lee S, Senavirathne G, Lai EC. microRNAs in action: biogenesis, function and regulation. Nat Rev Genet. 2023;24(12):816-33.\u003c/li\u003e\n\u003cli\u003eParker JS, Roe SM, Barford D. Molecular mechanism of target RNA transcript recognition by Argonaute-guide complexes. Cold Spring Harb Symp Quant Biol. 2006;71:45-50.\u003c/li\u003e\n\u003cli\u003eKehl T, Backes C, Kern F, Fehlmann T, Ludwig N, Meese E, et al. About miRNAs, miRNA seeds, target genes and target pathways. Oncotarget. 2017;8(63):107167-75.\u003c/li\u003e\n\u003cli\u003eGouzouasis V, Tastsoglou S, Giannakakis A, Hatzigeorgiou AG. Virus-Derived Small RNAs and microRNAs in Health and Disease. Annu Rev Biomed Data Sci. 2023;6:275-98.\u003c/li\u003e\n\u003cli\u003eShah A, Hemida, MG. The Potential Roles of Host Cell miRNAs in Fine-Tuning Bovine Coronavirus (BCoV) Molecular Pathogenesis, Tissue Tropism, and Immune Regulation. Microorganisms. 2024;15(5).\u003c/li\u003e\n\u003cli\u003eEl Hawary AT, Nabil F, El Hendawy R, Mahrous HKA, AbdelHamid GA, Amer M. Serum microRNA-16 as a potential biomarker for HCV-induced hepato-cellular carcinoma in Egyptian patients. Egypt J Immunol. 2024;31(2):102-11.\u003c/li\u003e\n\u003cli\u003eYoneyama H, Morishita A, Iwama H, Fujita K, Masaki T, Tani J, et al. Identification of microRNA associated with the elimination of hepatitis C virus genotype 1b by direct-acting antiviral therapies. J Gastroenterol Hepatol. 2021;36(4):1126-35.\u003c/li\u003e\n\u003cli\u003eMcNulty MS, Bryson DG, Allan GM, Logan EF. Coronavirus infection of the bovine respiratory tract. Vet Microbiol. 1984;9(5):425-34.\u003c/li\u003e\n\u003cli\u003eWorkman AM, McDaneld TG, Harhay GP, Das S, Loy JD, Hause BM. Recent Emergence of Bovine Coronavirus Variants with Mutations in the Hemagglutinin-Esterase Receptor Binding Domain in U.S. Cattle. Viruses. 2022;14(10).\u003c/li\u003e\n\u003cli\u003eXie S, Zhu Q, Qu W, Xu Z, Liu X, Li X, et al. sRNAPrimerDB: comprehensive primer design and search web service for small noncoding RNAs. Bioinformatics. 2019;35(9):1566-72.\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402-8.\u003c/li\u003e\n\u003cli\u003eRozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365-86.\u003c/li\u003e\n\u003cli\u003eDecaro N, Elia G, Campolo M, Desario C, Mari V, Radogna A, et al. Detection of bovine coronavirus using a TaqMan-based real-time RT‒PCR assay. J Virol Methods. 2008;151(2):167-71.\u003c/li\u003e\n\u003cli\u003eMcGeary SE, Lin KS, Shi CY, Pham TM, Bisaria N, Kelley GM, et al. The biochemical basis of microRNA targeting efficacy. Science. 2019;366(6472).\u003c/li\u003e\n\u003cli\u003eEnright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. MicroRNA targets in Drosophila. Genome Biol. 2003;5(1):R1.\u003c/li\u003e\n\u003cli\u003eSridhar J, Sowmiya G, Sekar K, Rafi ZA. PsRNA: a computing engine for the comparative identification of putative small RNA locations within intergenic regions. Genomics Proteomics Bioinformatics. 2010;8(2):127-34.\u003c/li\u003e\n\u003cli\u003eHemida MG, Ye X, Zhang HM, Hanson PJ, Liu Z, McManus BM, et al. MicroRNA-203 enhances coxsackievirus B3 replication through targeting zinc finger protein-148. Cell Mol Life Sci. 2013;70(2):277-91.\u003c/li\u003e\n\u003cli\u003eYe X, Hemida MG, Qiu Y, Hanson PJ, Zhang HM, Yang D. MiR-126 promotes coxsackievirus replication by mediating cross-talk of ERK1/2 and Wnt/beta-catenin signaling pathways. Cell Mol Life Sci. 2013;70(23):4631-44.\u003c/li\u003e\n\u003cli\u003eYe X, Zhang HM, Qiu Y, Hanson PJ, Hemida MG, Wei W, et al. Coxsackievirus-induced miR-21 disrupts cardiomyocyte interactions via the downregulation of intercalated disk components. PLoS Pathog. 2014;10(4):e1004070.\u003c/li\u003e\n\u003cli\u003eKim Y, Jang G, Lee D, Kim N, Seon JW, Kim YH, et al. Trypsin enhances SARS-CoV-2 infection by facilitating viral entry. Arch Virol. 2022;167(2):441-58.\u003c/li\u003e\n\u003cli\u003eShin J, Choe S, Park GN, Song S, Kim KS, An BH, et al. Isolation and Genetic Characterization of a Bovine Coronavirus KBR-1 Strain from Calf Feces in South Korea. Viruses. 2022;14(11).\u003c/li\u003e\n\u003cli\u003eReed LJ, Muench H. A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12. American Journal of Epidemiology. 1938;27(3):493-7.\u003c/li\u003e\n\u003cli\u003eSchneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9(7):671-5.\u003c/li\u003e\n\u003cli\u003eZhu Q, Li B, Sun D. Advances in Bovine Coronavirus Epidemiology. Viruses. 2022;14(5).\u003c/li\u003e\n\u003cli\u003eGaytan-Pacheco N, Ibanez-Salazar A, Herrera-Van Oostdam AS, Oropeza-Valdez JJ, Magana-Aquino M, Adrian Lopez J, et al. miR-146a, miR-221, and miR-155 are Involved in Inflammatory Immune Response in Severe COVID-19 Patients. Diagnostics (Basel). 2022;13(1).\u003c/li\u003e\n\u003cli\u003eHaroun RA, Osman WH, Amin RE, Hassan AK, Abo-Shanab WS, Eessa AM. Circulating plasma miR-155 is a potential biomarker for the detection of SARS-CoV-2 infection. Pathology. 2022;54(1):104-10.\u003c/li\u003e\n\u003cli\u003eHemida AUSaMG. The Potential Roles of Host Cell miRNAs in Fine-Tuning BovineCoronavirus (BCoV) Molecular Pathogenesis, Tissue Tropism, and Immune Regulation. Microorganisms. 2024;12(5).\u003c/li\u003e\n\u003cli\u003eSlenter DN, Kutmon M, Hanspers K, Riutta A, Windsor J, Nunes N, et al. WikiPathways: a multifaceted pathway database bridging metabolomics to other omics research. Nucleic Acids Res. 2018;46(D1):D661-D7.\u003c/li\u003e\n\u003cli\u003eVaddadi K, Gandikota C, Huang C, Liang Y, Liu L. Cellular microRNAs target SARS-CoV-2 spike protein and restrict viral replication. Am J Physiol Cell Physiol. 2023;325(2):C420-C8.\u003c/li\u003e\n\u003cli\u003eCui J. MiR-16 family as potential diagnostic biomarkers for cancer: a systematic review and meta-analysis. Int J Clin Exp Med. 2015;8(2):1703-14.\u003c/li\u003e\n\u003cli\u003eJin W, Chen F, Wang K, Song Y, Fei X, Wu B. miR-15a/miR-16 cluster inhibits invasion of prostate cancer cells by suppressing TGF-beta signaling pathway. Biomed Pharmacother. 2018;104:637-44.\u003c/li\u003e\n\u003cli\u003eJohansson K, Gagnon JD, Zhou SK, Fassett MS, Schroeder AW, Kageyama R, et al. An essential role for miR-15/16 in Treg suppression and restriction of proliferation. Cell Rep. 2023;42(10):113298.\u003c/li\u003e\n\u003cli\u003eLiu Q, Fu H, Sun F, Zhang H, Tie Y, Zhu J, et al. miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008;36(16):5391-404.\u003c/li\u003e\n\u003cli\u003eTao Z, Xu S, Ruan H, Wang T, Song W, Qian L, et al. MiR-195/-16 Family Enhances Radiotherapy via T-Cell Activation in the Tumor Microenvironment by Blocking the PD-L1 Immune Checkpoint. Cell Physiol Biochem. 2018;48(2):801-14.\u003c/li\u003e\n\u003cli\u003eYang L, Yang S, Ren C, Liu S, Zhang X, Sui A. Deciphering the roles of miR-16-5p in malignant solid tumors. Biomed Pharmacother. 2022;148:112703.\u003c/li\u003e\n\u003cli\u003eHassan NE, Moselhy WA, Eldomany EB, Kholef EFM. Evaluation of miRNA-16-2-3P, miRNA-618 levels and their diagnostic and prognostic value in the regulation of immune response during SARS Cov-2 infection. Immunogenetics. 2023;75(4):403-10.\u003c/li\u003e\n\u003cli\u003eLiu X, Wu Q, Zhang Z. Global Diversification and Distribution of Coronaviruses With Furin Cleavage Sites. Front Microbiol. 2021;12:649314.\u003c/li\u003e\n\u003cli\u003eMillet JK, Whittaker GR. Host cell proteases: Critical determinants of coronavirus tropism and pathogenesis. Virus Res. 2015;202:120-34.\u003c/li\u003e\n\u003cli\u003eAyyubova G, Gychka SG, Nikolaienko SI, Alghenaim FA, Teramoto T, Shults NV, et al. The Role of Furin in the Pathogenesis of COVID-19-Associated Neurological Disorders. Life (Basel). 2024;14(2).\u003c/li\u003e\n\u003cli\u003eJohnson BA, Xie X, Bailey AL, Kalveram B, Lokugamage KG, Muruato A, et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature. 2021;591(7849):293-9.\u003c/li\u003e\n\u003cli\u003eJohnson BA, Xie X, Kalveram B, Lokugamage KG, Muruato A, Zou J, et al. Furin Cleavage Site Is Key to SARS-CoV-2 Pathogenesis. bioRxiv. 2020.\u003c/li\u003e\n\u003cli\u003eXiangbo Z, Zhaofang Y, Jinjing G, Zhuandi G, Suocheng W. Bovine coronavirus nucleocapsid suppresses IFN-beta production by inhibiting RIG-I-like receptors pathway in host cells. Arch Microbiol. 2022;204(8):536.\u003c/li\u003e\n\u003cli\u003eWu CJ, Huang HW, Liu CY, Hong CF, Chan YL. Inhibition of SARS-CoV replication by siRNA. Antiviral Res. 2005;65(1):45-8.\u003c/li\u003e\n\u003cli\u003eDevi KP, Pourkarim MR, Thijssen M, Sureda A, Khayatkashani M, Cismaru CA, et al. A perspective on the applications of furin inhibitors for the treatment of SARS-CoV-2. Pharmacol Rep. 2022;74(2):425-30.\u003c/li\u003e\n\u003cli\u003eSchutz D, Ruiz-Blanco YB, Munch J, Kirchhoff F, Sanchez-Garcia E, Muller JA. Peptide and peptide-based inhibitors of SARS-CoV-2 entry. Adv Drug Deliv Rev. 2020;167:47-65.\u003c/li\u003e\n\u003cli\u003eDaly JL, Simonetti B, Klein K, Chen KE, Williamson MK, Anton-Plagaro C, et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science. 2020;370(6518):861-5.\u003c/li\u003e\n\u003cli\u003eChen Z, Mi L, Xu J, Yu J, Wang X, Jiang J, et al. Function of HAb18G/CD147 in invasion of host cells by severe acute respiratory syndrome coronavirus. J Infect Dis. 2005;191(5):755-60.\u003c/li\u003e\n\u003cli\u003eWang K, Chen W, Zhang Z, Deng Y, Lian JQ, Du P, et al. CD147-spike protein is a novel route for SARS-CoV-2 infection to host cells. Signal Transduct Target Ther. 2020;5(1):283.\u003c/li\u003e\n\u003cli\u003eSimmons G, Gosalia DN, Rennekamp AJ, Reeves JD, Diamond SL, Bates P. Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry. Proc Natl Acad Sci U S A. 2005;102(33):11876-81.\u003c/li\u003e\n\u003cli\u003eBosch BJ, Bartelink W, Rottier PJ. Cathepsin L functionally cleaves the severe acute respiratory syndrome coronavirus class I fusion protein upstream of rather than adjacent to the fusion peptide. J Virol. 2008;82(17):8887-90.\u003c/li\u003e\n\u003cli\u003eGubernatorova EO, Gorshkova EA, Polinova AI, Drutskaya MS. IL-6: Relevance for immunopathology of SARS-CoV-2. Cytokine Growth Factor Rev. 2020;53:13-24.\u003c/li\u003e\n\u003cli\u003eZhang J, Wu H, Yao X, Zhang D, Zhou Y, Fu B, et al. Pyroptotic macrophages stimulate the SARS-CoV-2-associated cytokine storm. Cell Mol Immunol. 2021;18(5):1305-7.\u003c/li\u003e\n\u003cli\u003eShah AU, Cao Y, Siddique N, Lin J, Yang Q. miR29a and miR378b Influence CpG-Stimulated Dendritic Cells and Regulate cGAS/STING Pathway. Vaccines (Basel). 2019;7(4).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"BCoV, enteric, respiratory, tropism, spike, nucleocapsid, gene regulation, Furin, IL6, cytokine expression","lastPublishedDoi":"10.21203/rs.3.rs-4498403/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4498403/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe roles of host cell miRNAs have not been well studied in the context of BCoV replication and immune regulation. The main aim of this study was to identify miRNA candidates that regulate essential host genes involved in BCoV replication, tissue tropism, and immune regulation. To achieve these goals, we used two isolates of BCoV (enteric and respiratory) to infect bovine endothelial cells (BECs) and Madine Darby Bovine Kidney (MDBK) cells. This is in addition to the ex vivo model using peripheral bovine blood mononuclear cells (PBMCs). We determined the miRNA expression profiles of these cells after BCoV infection. The expression of miR-16a is differentially altered during BCoV infection. Our data show that miRNA-16a is a significantly downregulated miRNA in both in vitro and \u003cem\u003eex vivo\u003c/em\u003e models. We confirmed the miRNA-16a expression profile by qRT‒PCR. Overexpression of pre-miRNA-16a in the BEC and MDBK cell lines markedly inhibited BCoV infection, as determined by the viral genome copy numbers measured by qRT‒PCR, viral protein expression (S and N) measured by Western blot, and virus infectivity using a plaque assay. Our bioinformatic prediction showed that Furin is a potential target of miRNA-16a. We compared the Furin protein expression level in pre-miRNA-16a-transfected/BCoV-infected cells to that in pre-miRNA-scrambled-transfected cells. Our qRT‒PCR and Western blot data revealed marked inhibition of Furin expression at the mRNA level and at the protein level, respectively. BCoV-S protein expression was markedly inhibited at both the mRNA and protein levels. To further confirm the impact of the downregulation of the Furin enzyme on the replication of BCoV, we transfected cells with specific Furin-siRNAs parallel to the scrambled siRNA. Marked inhibition of BCoV replication was observed in the Furin-siRNA-treated group. To further validate Furin as a novel target for miRNA-16a, we cloned the 3'UTR of bovine Furin carrying the seed region of miRNA-16a in a dual luciferase vector. Our data showed that luciferase activity in pre-miRNA-16a-transfected cells decreased by more than 50% compared to that in cells transfected with the construct carrying the mutated Furin seed region. Our data confirmed that miRNA-16a inhibits BCoV replication by targeting the host cell line Furin and the BCoV-S glycoprotein. It also enhances the host immune response, which contributes to the inhibition of viral replication. To our knowledge, this is the first study to confirm that Furin is a valid target of miRNA-16a. Our findings highlight the clinical applications of host miRNA-16a as a potential miRNA-based vaccine/antiviral therapy.\u003c/p\u003e","manuscriptTitle":"The dual actions of host miRNA-16a in restricting bovine coronavirus (BCoV) replication through targeting the host cell Furin and enhancing the host immune response","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-14 18:36:17","doi":"10.21203/rs.3.rs-4498403/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2260894c-6663-4032-af85-bde7ababb699","owner":[],"postedDate":"June 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-17T05:36:12+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-14 18:36:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4498403","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4498403","identity":"rs-4498403","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}