Mechanisms and Clinical Significance of Bile Acid Metabolism Reprogramming in Hepatocellular Carcinoma Immunotherapy Response

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background Hepatocellular carcinoma (HCC) constitutes the foremost cause of cancer-related mortality globally, and patients exhibit significant variations in their response to immunotherapy. Recent research has shown that elevated bile acids (BAs) are closely associated with HCC. Methods We collected surgical tumor samples from six HCC patients and categorized them into recurrence (FA, n = 3) and disease-free survival (WA,n = 3) groups based on one-year postoperative follow-up. Using liquid chromatography-tandem mass spectrometry (LC-MS/MS), we quantified 36 BAs in tumor tissues. Additionally, we analyzed bile acid synthetase gene expression using The Cancer Genome Atlas (TCGA) data, and explored the regulatory role of chenodeoxycholic acid (CDCA) on macrophage polarization. Results The findings revealed that tumors from patients with favorable treatment response and long-term disease-free survival contained higher levels of primary BAs, whereas recurrent patients showed elevated secondary BAs. Additionally, we found that patients with higher expression of the bile acid synthase gene CYP27A1 had significantly prolonged survival, and this gene could serve as an independent predictor for treatment outcomes. Correlation analysis revealed that high expression of bile acid synthase is associated with weakened. Experiments demonstrated that BAs can influence the functional state of macrophages. Conclusion These findings indicate that the metabolic of BAs is closely linked to the immunotherapy response in HCC. It provides novel targets for metabolic-based therapeutic strategies, with CYP27A1 serving as a potential predictive biomarker.
Full text 78,256 characters · extracted from preprint-html · click to expand
Mechanisms and Clinical Significance of Bile Acid Metabolism Reprogramming in Hepatocellular Carcinoma Immunotherapy Response | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mechanisms and Clinical Significance of Bile Acid Metabolism Reprogramming in Hepatocellular Carcinoma Immunotherapy Response Tianmin Zhou, Ruixin Wang, Hao Wei, Wenli Liu, Yingqun Xiao, Qingmei Zhong, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8649754/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Hepatocellular carcinoma (HCC) constitutes the foremost cause of cancer-related mortality globally, and patients exhibit significant variations in their response to immunotherapy. Recent research has shown that elevated bile acids (BAs) are closely associated with HCC. Methods We collected surgical tumor samples from six HCC patients and categorized them into recurrence (FA, n = 3) and disease-free survival (WA,n = 3) groups based on one-year postoperative follow-up. Using liquid chromatography-tandem mass spectrometry (LC-MS/MS), we quantified 36 BAs in tumor tissues. Additionally, we analyzed bile acid synthetase gene expression using The Cancer Genome Atlas (TCGA) data, and explored the regulatory role of chenodeoxycholic acid (CDCA) on macrophage polarization. Results The findings revealed that tumors from patients with favorable treatment response and long-term disease-free survival contained higher levels of primary BAs, whereas recurrent patients showed elevated secondary BAs. Additionally, we found that patients with higher expression of the bile acid synthase gene CYP27A1 had significantly prolonged survival, and this gene could serve as an independent predictor for treatment outcomes. Correlation analysis revealed that high expression of bile acid synthase is associated with weakened. Experiments demonstrated that BAs can influence the functional state of macrophages. Conclusion These findings indicate that the metabolic of BAs is closely linked to the immunotherapy response in HCC. It provides novel targets for metabolic-based therapeutic strategies, with CYP27A1 serving as a potential predictive biomarker. Health sciences/Biomarkers Biological sciences/Cancer Health sciences/Oncology Hepatocellular carcinoma bile acids immunotherapy CYP27A1 macrophage polarization CDCA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Hepatocellular carcinoma (HCC) is a highly lethal malignant tumor with continuously rising incidence and mortality rates worldwide( 1 ). The pathogenesis of HCC is complex, involving multiple genetic and environmental factors, with metabolic reprogramming recognized as one of its hallmark features( 2 ). Despite advancements in diagnosis and treatment, the five-year survival rate for HCC patients remains unsatisfactory because of the tumor's high heterogeneity and drug resistance( 3 ). Consequently, there is an urgent need to identify novel biomarkers to improve disease prognosis and therapeutic outcomes. The liver is the primary organ for bile acid metabolism, converting cholesterol into primary bile acids(BAs), mainly cholic acid (CA) and chenodeoxycholic acid (CDCA). On the one hand, the classical pathway regulated by CYP7A1 is responsible for the synthesis of CA and CDCA. On the other hand, the alternative pathway mediated by CYP7B1 and CYP27A1 produces only CDCA( 4 ). In chronic liver diseases such as cirrhosis, the activity of CYP7A1, the key enzyme in the classical pathway, is significantly reduced. Under these conditions, the alternative pathway becomes enhanced to compensate for the insufficient BAs and maintain basic fat absorption functions( 5 , 6 ). However, BAs not only participate in lipid metabolism, but also influence the tumor microenvironment by modulating immune cell functions. Crucially, HCC tissues often exhibit elevated levels of BAs, and animal models with intrahepatic retention of BAs through either unchecked BA synthesis or defects in BA export develop liver cancer spontaneously, suggesting the direct involvement of BAs in liver cancer( 7 , 8 ). This indicates that BAs play a pivotal role in liver metabolism and the development of HCC. Current research primarily focuses on bile acid metabolic pathways in HCC and their effects on the tumor microenvironment( 9 ). However, there are seldom studies that investigate the relationship between BAs and patient response to immunotherapy( 10 , 11 ). Also it remains unclear whether or how BAs contributes to immune suppression, particularly in HCC patients. Therefore, a comprehensive analysis of the association between BAs and immune response in HCC patients may provide new theoretical foundations for disease prognosis evaluation. This study employed liquid chromatography-tandem mass spectrometry (LC-MS/MS) technology to quantitatively analyze BAs in surgical specimens from HCC patients who received therapy with monoclonal antibody. We compared the differences in BAs between the recurrence group and the disease-free survival group. It showed the potential association between bile acid metabolism and immunotherapy efficacy. Additionally, we utilized transcriptomic data from the TCGA database to analyze the expression patterns of key bile acid synthase genes in HCC, and investigated their correlations with immune-related genes. This research will provide crucial evidence to understand the role of BAs in HCC progression and their potential biomarker value, laying the foundation for future personalized treatment strategies. Materials and Methods Patients and Samples This study included two independent cohorts of HCC patients. Cohort 1: We collected surgical tumor tissue specimens from 6 HCC patients treated with PD-1/PD-L1 inhibitor monotherapy at [Institution Name]. Based on one-year postoperative follow-up results, the patients were divided into a recurrence group (FA, n = 3) and a disease-free survival group (WA, n = 3). Cohort 2: This study compiled data from 96 HCC patients, pathologically confirmed at Nanchang Ninth Hospital between 2008 and 2018. The cohort comprised 82 males and 14 females, ranging in age from 27 to 70 years, with a mean age of 47 ± 9.8 years. We collected tumor tissues and paired adjacent non-tumor tissues from 94 HCC patients to construct tissue microarrays. Ethics Statement This research was reviewed and approved by the Medical Ethics Committee of the Infectious Diseases Hospital of Nanchang University ([2022] Ethical Approval No. ( 13 )). All experiments adhered to the regulations and guidelines of Nanchang University. All participants provided their written informed consent to participate in this study. Bile Acid Metabolite Analysis Quantitative analysis of 36 bile acid metabolites in tumor tissues was performed using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Bioinformatics Analysis The LIHC dataset was obtained from the TCGA database, including 371 tumor tissue samples and 50 adjacent normal tissue samples. Differential gene expression analysis was performed using the R package "TCGAplot" with Student's t-test, and the significance threshold was set at p < 0.05. Based on data from 340 HCC patients with complete pathological staging information in the TCGA database, the patients were divided into an early-stage group (Stage I, n = 170) and an intermediate-to-advanced stage group (Stage II–IV, n = 170). The log(CYP7B1/CYP7A1) ratio was calculated for each patient using the expression values of CYP7B1 and CYP7A1, and the Mann-Whitney U test was employed to compare differences between groups. Immunohistochemical Validation We collected tumor tissues and paired adjacent non-tumor tissues from 94 HCC patients to construct tissue microarrays. Immunohistochemical staining was performed using rabbit anti-human CYP7A1 polyclonal antibody (PA5-100892, 1:100 dilution) and mouse anti-human CYP27A1 monoclonal antibody (ab126785, 1:200 dilution), following the standard ABC method. An experienced pathologist conducted semi-quantitative analysis by using QuPath software. We evaluated protein expression intensity using mean integrated optical density (mean IOD). Student's t-test was employed with the significance threshold set at p < 0.05. Immunoreactivity Analysis We utilized the TCGAplot package to integrate transcriptome data from the TCGA LIHC database. And we employed Pearson correlation analysis to evaluate the expression correlation between four bile acid synthase genes (CYP7A1, CYP7B1, CYP8B1, CYP27A1) and immune-related genes. The analysis included: ( 1 ) 38 chemokine genes; ( 2 ) 17 chemokine receptor genes; ( 3 ) 43 immune stimulators; ( 4 ) 23 immune checkpoint genes (PDCD1, CTLA4, LAG3, etc.). Clinical Efficacy Predictive Value Assessment We obtained data from 253 patients with intermediate-to-advanced HCC who received atezolizumab plus bevacizumab treatment in the IMbrave150 clinical trial (NCT03434379) from the https://cide.ccr.cancer.govdatabase . Patients were divided into high- and low-expression groups based on the median expression levels of four genes. We employed the Kaplan-Meier method to plot survival curves and used the log-rank test to compare differences in overall survival (OS) between groups. The independent predictive value of gene expression was evaluated using the Cox proportional hazards model. In vitro functional experiments Murine macrophage (RAW264.7) cells were provided by Shanghai FuHeng Biology Co. (Shanghai, China). Raw 264.7 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum at 37°C in a 5% CO₂ incubator. The cells were divided into four experimental groups: Control, LPS stimulation (100 ng/mL), CDCA treatment (50 µmol/L), and LPS plus CDCA co-treatment. Following 24-hour treatment, total RNA was extracted, and the expression changes of M1/M2 polarization markers were detected by qRT-PCR. Results Relationship Between Bile Acid Metabolism Profile and Immunotherapy Response We collected surgical tumor tissue samples from 6 HCC patients who received PD-1/PD-L1 inhibitor monotherapy. Based on the 1-year postoperative follow-up, the patients were divided into the recurrence group (FA, n = 3) and the disease-free survival group (WA). Quantitative analysis of 36 BAs in tumor tissues were quantified using LC-MS/MS technology. Results showed that multiple primary BAs, including GCDCA, CDCA-3Gln, GCA, TCDCA, and TCA, were significantly elevated in the WA group. In contrast, multiple secondary BAs, such as LCA-3S, GLCA-3S, DCA-3-O-S and TLCA-3S, showed an increasing trend in the FA group(Fig. 1 ). However, possibly due to the limited sample size, the above results lacked statistical significance. These findings suggest that bile acid homeostasis may have a potential association with immunotherapy response, indicating that we should consider the dynamic changes of BA metabolism during the treatment process. Abnormal Expression of Bile Acid Synthetases in HCC Using TCGA data, we identified significant differences in the expression of four key bile acid synthase genes between neoplastic HCC and non-HCC liver tissues. Among them, CYP27A1, CYP7B1, and CYP8B1 were downregulated in tumor tissues, while CYP7A1 showed an upward trend (Fig. 2 a). Further analysis revealed that the log(CYP7B1/CYP7A1) ratio was significantly higher in the intermediate-advanced stage (stages II-IV) group than in the early-stage (stage I) group (Fig. 2 b). This indicates a shift from the classical pathway to the alternative pathway in HCC. Immunohistochemistry confirmed different expression of CYP7A1 and CYP27A1 in HCC tissues. The average expression level of CYP7A1 was 0.19 ± 0.04 in both cancerous and adjacent tissues(Fig. 2 c). The average expression of CYP27A1 in cancerous tissues was 0.07 ± 0.2, significantly lower than in adjacent tissues, consistent with the bioinformatics analysis results(Fig. 2 c). Correlation between Bile Acid Synthetases and the Immune Microenvironment Subsequently, we conducted an immune correlation analysis on these four genes in Fig. 3 . The results indicated that high expression of bile acid synthase is associated with weakened immune suppression signals. Specifically, these four genes showed negative correlations with most immune stimulators, chemokines, chemokine receptors, and immune checkpoint molecules. Notably, CYP27A1 exhibited significant negative correlations with HAVCR2 (TIM-3) and CD274 (PD-L1). High expression of bile acid synthase, particularly CYP27A1, was negatively correlated with tumor-promoting immune cells such as memory B cells, Tregs, and M0 macrophages, but positively correlated with anti-tumor M1 macrophages. Predictive Value of Bile Acid Synthetases for Immunotherapy Efficacy As depicted as Fig. 4 , survival analysis revealed that high bile acid synthase expression significantly prolonged overall survival. Cox analysis indicated that high CYP27A1 expression was an independent protective factor, and it was the best one among the four genes for predicting the efficacy of atezolizumab combined with bevacizumab. Regulatory Role of CDCA in Macrophage Polarization To further investigate how CYP27A1 influences the immune microenvironment, we analyzed the effect of the key metabolite - chenodeoxycholic acid (CDCA) - on macrophage polarization. The primer sequences used in RT-PCR are listed in Table 1 . RT-PCR results demonstrated that regarding M2-type markers: compared with the control group, CD206 expression was significantly decreased in the LPS group but increased in the CDCA group; IL-10 levels significantly declined after LPS treatment, while CDCA restored its expression; Arg-1 expression was significantly higher in both the CDCA group and LPS+CDCA group than in the control group (Fig. 5 a). Regarding M1-type markers: CD86 expression was significantly elevated in the CDCA group; TNF-α showed a marked increase in the CDCA group and further rose in the LPS+CDCA group; iNOS expression in the LPS+CDCA group was significantly higher than in the CDCA group. Our results demonstrate that CDCA exhibits a dual regulatory effect on macrophages. It not only promotes the expression of M2 macrophage markers such as CD206, IL-10, and Arg-1, but also enhances the expression of M1 markers including CD86, TNF-α, and iNOS (Fig. 5 b). This indicates that CDCA can regulate macrophage polarization toward a mixed phenotype in vitro, having both M1 and M2 characteristics. Table 1 .Primer Sequences for Macrophage M1/M2 Typing Markers Macrophage Subtype Gene Name Primer Type Sequence M1 Marker TNFα Forward Primer (F) GGTGCCTATGTCTCAGCCTCTT M1 Marker TNFα Reverse Primer (R) GCCATAGAACTGATGAGAGGGAG M1 Marker CD86 Forward Primer (F) ACGTATTGGAAGGAGATTACAGCT M1 marker CD86 Reverse Primer (R) TCTGTCAGCGTTACTATCCCGC M1 Marker iNOS Forward Primer (F) GAGACAGGGAAGTCTGAAGCAC M1 marker iN OS Reverse Primer (R) CCAGCAGTAGTTGCTCCTCTTC M2 marker CD206 Forward Primer (F) GTTCACCTGGAGTGATGGTTCTC M2 marker CD206 Reverse Primer (R) AGGACATGCCAGGGTCACCTTT M2 marker Arg1 Forward Primer (F) CATTGGCTTGCGAGACGTAGAC M2 marker Arg1 Reverse Primer (R) GCTGAAGGTCTCTTCCATCACC M2 marker IL-10 Forward Primer (F) CGGGAAGACAATAACTGCACCC M2 marker IL-10 Reverse Primer (R) CGGTTAGCAGTATGTTGTCCAGC Discussion Although significant progress has been made in immunotherapy for HCC, clinical heterogeneity remains a major challenge. We integrated targeted metabolomics analysis of clinical samples and bioinformatics analysis of TCGA database. This study for the first time systematically revealed the bile acid metabolic balance in tumor tissues and the expression patterns of key synthases, which associated with the response and long-term prognosis to atezolizumab plus bevacizumab therapy. We characterized and compared BAs in patient liver biopsies from neoplastic HCC and non-HCC liver tissues. Results showed that, in WA group, primary BAs - taurocholic acid (TCA) and glycocholic acid (GC) - were significantly elevated in HCC liver samples. However, in FA group, secondary BAs -deoxycholic acid (DCA) accumulated. CYP27A1 is a key number in the alternative BAs synthesis pathway, and its high expression has been identified as an independent factor associated with prolonged survival. These results suggest that BAs synthases constitute a "metabolic determinant" together, which influences the efficacy of immunotherapy. Within this network, different synthases coordinately regulate the composition and proportion of bile acids, collectively shaping the characteristics of the tumor immune microenvironment. This study observed that enrichment of primary BAs was associated with efficient immune response, while accumulation of secondary BAs correlated with treatment resistance. This BA profile showed good agreement with existing research on the gut microbiota regulation of anti-tumor immunity in liver cancer. Multiple studies have demonstrated that primary BAs can directly enhance the functions of CD8 + T cells by activating TGR5, as well as promote their infiltration into tumor sites( 12 ). In contrast, secondary BAs can activate FXR, induce Treg cell expansion and M2 macrophage polarization, thereby shaping an immunosuppressive microenvironment( 13 ). Therefore, the markedly distinct BA profiles between the WA and FA groups likely directly contributed to the differences in the tumor immune microenvironment. This may potentially unravel resistance and response mechanisms to immune checkpoint inhibitors. Notably, the significant change of the CYP7B1/CYP7A1 ratio suggests a shift from the classical pathway to the alternative pathway in HCC. This phenomenon may be associated with tumor microenvironment adaptation. As the key number of the alternative pathway, CYP27A1 expression may reflect the liver's capacity to maintain BA homeostasis. Although tumors with high CYP27A1 expression exhibit characteristics of "cold tumors", with insufficient immune cell infiltration, their bile acid metabolic network remains relatively intact( 14 ). Therefore, the possibility of accumulating secondary BAs is lower, which possesses immunosuppressive effects. This microenvironment creates essential condition for immune checkpoint inhibitors to exert their effects, indirectly supporting anti-tumor immunity. Furthermore, survival analysis revealed that CYP27A1 showed the highest risk score among the four synthases. It indicates that CYP27A1 has the most significant predictive value for treatment efficacy. This finding suggests that CYP27A1 may not merely be a metabolic enzyme of the alternative pathway, but rather a key node connecting metabolism and immunity. TRIM24 has been studied in other tumorsA study found that higher expression of CYP27A1 is associated with a higher grade of breast cancer and lower circulating cholesterol levels, but these changes were not related to prognosis. Inhibiting cholesterol conversion to 27-hydroxycholesterol via CYP27A1 has been suggested to prevent breast cancer tumor progression( 15 ). From the clinical translation perspective, our study hold dual significance. Firstly, the bile acid profile (e.g., primary/secondary BAs ratio) and CYP27A1 expression levels show promise as novel biomarkers, predicting the efficacy of combination immunotherapy. These can be achieved through non-invasive or minimally invasive monitoring via liquid biopsy or tissue biopsy, complementing existing indicators such as PD-L1 expression or tumor mutational burden. Secondly, our research provides insights for developing new combination therapeutic strategies. Targeted modulation of bile acid metabolism can theoretically produce synergistic effects with existing immunotherapy regimens. There have been early clinical trials exploring the feasibility of such combination strategies, such as using FXR antagonists to block secondary bile acids or intervening in gut microbiota to optimize bile acid composition. Certainly, this study has several limitations. The primary one lies in the relatively small clinical sample size, which may affect statistical power. Secondly, the study revealed correlations but did not conduct in-depth research on the molecular mechanisms by which bile acids regulate immune cells. Moreover, there is a lack of in vivo experiments to validate whether targeting CYP27A1 can enhance the efficacy of immunotherapy. In addition, inter-individual variations among patients, such as dietary habits, liver function grading, and history of antibiotic use, may all influence bile acid metabolism. These confounding factors require stricter control in subsequent studies. Based on the above, we propose that future research should focus on the following directions: First, we should conduct in-depth mechanistic studies to elucidate the regulatory effects and signaling pathways of BAs on immune cell functions. Secondly, single-cell transcriptomics and spatial metabolomics should be combined to understand bile acid metabolism in relation to the spatial distribution and interactions of immune cells. Third, design and evaluate the combined effect of modulating bile acid metabolism with immunotherapy. Through these efforts, we aim to transform the ancient hepatic physiological process of bile acid metabolism into novel targets and strategies for improving the efficacy of HCC immunotherapy, ultimately benefiting patients. Declarations Funding This research was funded by the General Science and Technology Projects of Jiangxi Provincial Health Commission, grant number 202211521.This research was funded by the Science and Technology Plan Project of Nanchang, grant number 2022-KJZC-015. Author Contribution T.Z. and X.W. conducted a comprehensive analysis and interpretation of the patient data pertaining to anatomopathological aspects, and were responsible for the initial draft of the article. H.W. performed the bioinformatic analysis; W.L and Q.Z. contributed to the literature review; K.J. carried out the cell experiments; Y.X., J.L,P.Z. and D.L. participated in manuscript revision, initial drafting, and research supervision; W.W. and S.H.contributed to pathological diagnosis and clinical data collection. All authors have read and approved the final manuscript. Data Availability Data utilized in this work were generated and analyzed by the current study and are also publicly available. The TCGA-LIHC dataset can be accessed via TCGA (https://portal.gdc.cancer.gov) . References Dong, Y. et al. Hepatocellular carcinoma in the non-cirrhotic liver. Clin. Hemorheol Microcirc . 80 , 423–436. 10.3233/ch-211309 (2022). Li, C. et al. 6-Phosphogluconolactonase Promotes Hepatocellular Carcinogenesis by Activating Pentose Phosphate Pathway. Front. Cell. Dev. Biol. 9 , 753196. 10.3389/fcell.2021.753196 (2021). Starzl, T. E. The long reach of liver transplantation. Exp. Clin. Transpl. 11 , 87–92. 10.6002/ect.2013.ecte2 (2013). Collins, S. L., Stine, J. G., Bisanz, J. E., Okafor, C. D. & Patterson, A. D. Bile acids and the gut microbiota: metabolic interactions and impacts on disease. Nat. Rev. Microbiol. 21 , 236–247. 10.1038/s41579-022-00805-x (2023). Scheimann, A. O. et al. Mutations in bile salt export pump (ABCB11) in two children with progressive familial intrahepatic cholestasis and cholangiocarcinoma. J. Pediatr. 150 , 556–559. 10.1016/j.jpeds.2007.02.030 (2007). Yang, F. et al. Spontaneous development of liver tumors in the absence of the bile acid receptor farnesoid X receptor. Cancer Res. 67 , 863–867. 10.1158/0008-5472.Can-06-1078 (2007). Bernstein, H., Bernstein, C., Payne, C. M., Dvorakova, K. & Garewal, H. Bile acids as carcinogens in human gastrointestinal cancers. Mutat. Res. 589 , 47–65. 10.1016/j.mrrev.2004.08.001 (2005). Anakk, S. et al. Bile acids activate YAP to promote liver carcinogenesis. Cell. Rep. 5 , 1060–1069. 10.1016/j.celrep.2013.10.030 (2013). Mai, H. et al. Implications of Stemness Features in 1059 Hepatocellular Carcinoma Patients from Five Cohorts: Prognosis, Treatment Response, and Identification of Potential Compounds. Cancers (Basel). 14. (2022). 10.3390/cancers14030563 Varanasi, S. K. et al. Bile acid synthesis impedes tumor-specific T cell responses during liver cancer. Science 387 , 192–201. 10.1126/science.adl4100 (2025). Ma, C. et al. Gut microbiome-mediated bile acid metabolism regulates liver cancer via NKT cells. Science 360 10.1126/science.aan5931 (2018). Ding, L. et al. Vertical sleeve gastrectomy activates GPBAR-1/TGR5 to sustain weight loss, improve fatty liver, and remit insulin resistance in mice. Hepatology 64 , 760–773. 10.1002/hep.28689 (2016). Ma, J. et al. Gut microbiota remodeling reverses aging-associated inflammation and dysregulation of systemic bile acid homeostasis in mice sex-specifically. Gut Microbes . 11 , 1450–1474. 10.1080/19490976.2020.1763770 (2020). Wu, F. et al. Single-cell profiling of tumor heterogeneity and the microenvironment in advanced non-small cell lung cancer. Nat. Commun. 12 , 2540. 10.1038/s41467-021-22801-0 (2021). Inasu, M. et al. High CYP27A1 expression is a biomarker of favorable prognosis in premenopausal patients with estrogen receptor positive primary breast cancer. NPJ Breast Cancer . 7 , 127. 10.1038/s41523-021-00333-6 (2021). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8649754","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":591579212,"identity":"776c7b31-f23f-4659-b9cc-3c3816a2c5b5","order_by":0,"name":"Tianmin Zhou","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Tianmin","middleName":"","lastName":"Zhou","suffix":""},{"id":591579213,"identity":"7f906c1f-8774-4fe5-9f03-b46b9ab3bcea","order_by":1,"name":"Ruixin Wang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Ruixin","middleName":"","lastName":"Wang","suffix":""},{"id":591579214,"identity":"6a2a657f-a610-48ff-8fe5-11c4024ddde2","order_by":2,"name":"Hao Wei","email":"","orcid":"","institution":"Nanjing Jinling Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Wei","suffix":""},{"id":591579215,"identity":"07c81008-8b36-4589-9f09-f64cbf4593a0","order_by":3,"name":"Wenli Liu","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Wenli","middleName":"","lastName":"Liu","suffix":""},{"id":591579216,"identity":"e84a1b60-3cda-46f2-ad99-a4bd7b045c56","order_by":4,"name":"Yingqun Xiao","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Yingqun","middleName":"","lastName":"Xiao","suffix":""},{"id":591579217,"identity":"856784d9-0511-4c64-9067-9fae2f8d7e50","order_by":5,"name":"Qingmei Zhong","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Qingmei","middleName":"","lastName":"Zhong","suffix":""},{"id":591579218,"identity":"6b05dffa-f51d-4bea-8f89-a3a7531ba343","order_by":6,"name":"Zhuoqi Liu","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Zhuoqi","middleName":"","lastName":"Liu","suffix":""},{"id":591579219,"identity":"4f3994da-ecd3-48f8-a41c-c4d99fcce05a","order_by":7,"name":"Daya Luo","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Daya","middleName":"","lastName":"Luo","suffix":""},{"id":591579221,"identity":"473254de-8b2c-48e1-879e-8594610557d5","order_by":8,"name":"Kunpeng Jiang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Kunpeng","middleName":"","lastName":"Jiang","suffix":""},{"id":591579223,"identity":"59a167f1-038b-43f9-9e8d-54ab130496e4","order_by":9,"name":"Ping Zhang","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Ping","middleName":"","lastName":"Zhang","suffix":""},{"id":591579224,"identity":"418e078a-5881-4638-a31c-cfa2d1ae9d74","order_by":10,"name":"Wu Wang","email":"","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Wu","middleName":"","lastName":"Wang","suffix":""},{"id":591579227,"identity":"a9e2fa78-6dc5-495c-a758-039be4ae5e78","order_by":11,"name":"Shanshan Huang","email":"","orcid":"","institution":"Nanchang University","correspondingAuthor":false,"prefix":"","firstName":"Shanshan","middleName":"","lastName":"Huang","suffix":""},{"id":591579230,"identity":"26a7d354-15f0-4616-8220-4735a54791fb","order_by":12,"name":"Jun Lu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACPhBRYcDAwMbefPBBQkUNYS1sIOIMUAsfz7FkgwdnjhGrBYjlJHLMJB+2MBOhRSL54Y0DBffk2IBaKhIb2Bj427sTCGhJM7Y4YFBszMbzrOxG4g4ZBokzZzcQ0JLDJv3BICGxjT15243EM2wMBhK5hLVIHDBIqG9jSDArSGxjJl5LAhtHihkDcVp4noH8kmDYBgxkiYQzx3gI+oWfHRRifxLk5dubD378UVEjx9/ei18LCEggc3gIKsfQMgpGwSgYBaMAAwAAwUxEb6Ez0owAAAAASUVORK5CYII=","orcid":"","institution":"Infectious Diseases Hospital Affiliated to Nanchang University","correspondingAuthor":true,"prefix":"","firstName":"Jun","middleName":"","lastName":"Lu","suffix":""}],"badges":[],"createdAt":"2026-01-20 13:46:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8649754/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8649754/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102861656,"identity":"3c1d4654-062c-499e-80a8-5aaae0228570","added_by":"auto","created_at":"2026-02-17 16:12:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":61421,"visible":true,"origin":"","legend":"\u003cp\u003eBile acid metabolite profile and treatment response\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBile acid metabolite levels in immunotherapy response groups (FA,n=3;WA,n=3).\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/6fe2e629d8652caf1bd7f8b9.png"},{"id":102963320,"identity":"0b229465-ef45-45fd-a928-8b96763877ec","added_by":"auto","created_at":"2026-02-19 04:15:26","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":119244,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profile of primary bile acid synthases in hepatocellular carcinoma\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Expression levels of CYP7A1, CYP7B1, CYP8B1, and CYP27A1 in HCC tissues versus adjacent non-tumor tissues from TCGA data. \u003cstrong\u003eb\u003c/strong\u003e Box plot showing log₂(CYP7B1/CYP7A1) ratios between different pathological stage groups from the TCGA database. \u003cstrong\u003ec \u003c/strong\u003eBox plot showing the expression levels of CYP7B1 and CYP7A1 in tumors and matched adjacent non-cancerous tissue.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/467cb6cae635a31d28f6a844.png"},{"id":102963166,"identity":"1333e1d7-1723-476b-8da5-551fe2eda875","added_by":"auto","created_at":"2026-02-19 04:14:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":54181,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation between primary bile acid synthases and the immune microenvironment\u003c/p\u003e\n\u003cp\u003eThe heatmap displaying correlations between primary BA synthase genes (CYP7A1, CYP27A1, CYP7B1, CYP8B1) and various immune-related molecules (encompassing immune stimulatory factors, chemokines and their receptors, and immune checkpoint genes).\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/4ca2cba02e195b13923b10f3.png"},{"id":102963303,"identity":"59442b7a-6ad0-46c5-bc1d-f12aa557b1a5","added_by":"auto","created_at":"2026-02-19 04:15:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":195310,"visible":true,"origin":"","legend":"\u003cp\u003ePredictive value of bile acid synthases for treatment efficacy\u003c/p\u003e\n\u003cp\u003eThe association between the expression levels of CYP7A1, CYP27A1, CYP8B1, and CYP7B1 genes and overall survival in patients.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/5ca3ed8953a2592990ca3078.png"},{"id":102963911,"identity":"63b95053-d3e6-40dc-8186-b62da18fa4e0","added_by":"auto","created_at":"2026-02-19 04:20:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":50626,"visible":true,"origin":"","legend":"\u003cp\u003eRegulation of Macrophage Polarization by CDCA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Statistical analysis of RT-PCR for M2 macrophage markers. \u003cstrong\u003eb \u003c/strong\u003eStatistical analysis of RT-PCR for M1 macrophage markers.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/b8b666d0bdbbbb3c5303d6e7.png"},{"id":106753777,"identity":"96c5fa32-1b07-4151-b991-ab2dfd62e361","added_by":"auto","created_at":"2026-04-13 07:28:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1287123,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8649754/v1/8cee333e-741a-4d5b-abc4-7693546c3bdd.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanisms and Clinical Significance of Bile Acid Metabolism Reprogramming in Hepatocellular Carcinoma Immunotherapy Response","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHepatocellular carcinoma (HCC) is a highly lethal malignant tumor with continuously rising incidence and mortality rates worldwide(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The pathogenesis of HCC is complex, involving multiple genetic and environmental factors, with metabolic reprogramming recognized as one of its hallmark features(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Despite advancements in diagnosis and treatment, the five-year survival rate for HCC patients remains unsatisfactory because of the tumor's high heterogeneity and drug resistance(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Consequently, there is an urgent need to identify novel biomarkers to improve disease prognosis and therapeutic outcomes.\u003c/p\u003e \u003cp\u003eThe liver is the primary organ for bile acid metabolism, converting cholesterol into primary bile acids(BAs), mainly cholic acid (CA) and chenodeoxycholic acid (CDCA). On the one hand, the classical pathway regulated by CYP7A1 is responsible for the synthesis of CA and CDCA. On the other hand, the alternative pathway mediated by CYP7B1 and CYP27A1 produces only CDCA(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In chronic liver diseases such as cirrhosis, the activity of CYP7A1, the key enzyme in the classical pathway, is significantly reduced. Under these conditions, the alternative pathway becomes enhanced to compensate for the insufficient BAs and maintain basic fat absorption functions(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). However, BAs not only participate in lipid metabolism, but also influence the tumor microenvironment by modulating immune cell functions. Crucially, HCC tissues often exhibit elevated levels of BAs, and animal models with intrahepatic retention of BAs through either unchecked BA synthesis or defects in BA export develop liver cancer spontaneously, suggesting the direct involvement of BAs in liver cancer(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). This indicates that BAs play a pivotal role in liver metabolism and the development of HCC.\u003c/p\u003e \u003cp\u003eCurrent research primarily focuses on bile acid metabolic pathways in HCC and their effects on the tumor microenvironment(\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). However, there are seldom studies that investigate the relationship between BAs and patient response to immunotherapy(\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Also it remains unclear whether or how BAs contributes to immune suppression, particularly in HCC patients. Therefore, a comprehensive analysis of the association between BAs and immune response in HCC patients may provide new theoretical foundations for disease prognosis evaluation.\u003c/p\u003e \u003cp\u003eThis study employed liquid chromatography-tandem mass spectrometry (LC-MS/MS) technology to quantitatively analyze BAs in surgical specimens from HCC patients who received therapy with monoclonal antibody. We compared the differences in BAs between the recurrence group and the disease-free survival group. It showed the potential association between bile acid metabolism and immunotherapy efficacy. Additionally, we utilized transcriptomic data from the TCGA database to analyze the expression patterns of key bile acid synthase genes in HCC, and investigated their correlations with immune-related genes. This research will provide crucial evidence to understand the role of BAs in HCC progression and their potential biomarker value, laying the foundation for future personalized treatment strategies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients and Samples\u003c/h2\u003e \u003cp\u003eThis study included two independent cohorts of HCC patients.\u003c/p\u003e \u003cp\u003eCohort 1: We collected surgical tumor tissue specimens from 6 HCC patients treated with PD-1/PD-L1 inhibitor monotherapy at [Institution Name]. Based on one-year postoperative follow-up results, the patients were divided into a recurrence group (FA, n\u0026thinsp;=\u0026thinsp;3) and a disease-free survival group (WA, n\u0026thinsp;=\u0026thinsp;3).\u003c/p\u003e \u003cp\u003eCohort 2: This study compiled data from 96 HCC patients, pathologically confirmed at Nanchang Ninth Hospital between 2008 and 2018. The cohort comprised 82 males and 14 females, ranging in age from 27 to 70 years, with a mean age of 47\u0026thinsp;\u0026plusmn;\u0026thinsp;9.8 years. We collected tumor tissues and paired adjacent non-tumor tissues from 94 HCC patients to construct tissue microarrays.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEthics Statement\u003c/h3\u003e\n\u003cp\u003e This research was reviewed and approved by the Medical Ethics Committee of the Infectious Diseases Hospital of Nanchang University ([2022] Ethical Approval No. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e)). All experiments adhered to the regulations and guidelines of Nanchang University. All participants provided their written informed consent to participate in this study.\u003c/p\u003e\n\u003ch3\u003eBile Acid Metabolite Analysis\u003c/h3\u003e\n\u003cp\u003eQuantitative analysis of 36 bile acid metabolites in tumor tissues was performed using liquid chromatography-tandem mass spectrometry (LC-MS/MS).\u003c/p\u003e\n\u003ch3\u003eBioinformatics Analysis\u003c/h3\u003e\n\u003cp\u003eThe LIHC dataset was obtained from the TCGA database, including 371 tumor tissue samples and 50 adjacent normal tissue samples. Differential gene expression analysis was performed using the R package \"TCGAplot\" with Student's t-test, and the significance threshold was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Based on data from 340 HCC patients with complete pathological staging information in the TCGA database, the patients were divided into an early-stage group (Stage I, n\u0026thinsp;=\u0026thinsp;170) and an intermediate-to-advanced stage group (Stage II\u0026ndash;IV, n\u0026thinsp;=\u0026thinsp;170). The log(CYP7B1/CYP7A1) ratio was calculated for each patient using the expression values of CYP7B1 and CYP7A1, and the Mann-Whitney U test was employed to compare differences between groups.\u003c/p\u003e\n\u003ch3\u003eImmunohistochemical Validation\u003c/h3\u003e\n\u003cp\u003eWe collected tumor tissues and paired adjacent non-tumor tissues from 94 HCC patients to construct tissue microarrays. Immunohistochemical staining was performed using rabbit anti-human CYP7A1 polyclonal antibody (PA5-100892, 1:100 dilution) and mouse anti-human CYP27A1 monoclonal antibody (ab126785, 1:200 dilution), following the standard ABC method. An experienced pathologist conducted semi-quantitative analysis by using QuPath software. We evaluated protein expression intensity using mean integrated optical density (mean IOD). Student's t-test was employed with the significance threshold set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunoreactivity Analysis\u003c/h2\u003e \u003cp\u003eWe utilized the TCGAplot package to integrate transcriptome data from the TCGA LIHC database. And we employed Pearson correlation analysis to evaluate the expression correlation between four bile acid synthase genes (CYP7A1, CYP7B1, CYP8B1, CYP27A1) and immune-related genes. The analysis included: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) 38 chemokine genes; (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) 17 chemokine receptor genes; (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) 43 immune stimulators; (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) 23 immune checkpoint genes (PDCD1, CTLA4, LAG3, etc.).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eClinical Efficacy Predictive Value Assessment\u003c/h3\u003e\n\u003cp\u003eWe obtained data from 253 patients with intermediate-to-advanced HCC who received atezolizumab plus bevacizumab treatment in the IMbrave150 clinical trial (NCT03434379) from the \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cide.ccr.cancer.govdatabase\u003c/span\u003e\u003cspan address=\"https://cide.ccr.cancer.govdatabase\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Patients were divided into high- and low-expression groups based on the median expression levels of four genes. We employed the Kaplan-Meier method to plot survival curves and used the log-rank test to compare differences in overall survival (OS) between groups. The independent predictive value of gene expression was evaluated using the Cox proportional hazards model.\u003c/p\u003e\n\u003ch3\u003eIn vitro functional experiments\u003c/h3\u003e\n\u003cp\u003eMurine macrophage (RAW264.7) cells were provided by Shanghai FuHeng Biology Co. (Shanghai, China). Raw 264.7 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum at 37\u0026deg;C in a 5% CO₂ incubator. The cells were divided into four experimental groups: Control, LPS stimulation (100 ng/mL), CDCA treatment (50 \u0026micro;mol/L), and LPS plus CDCA co-treatment. Following 24-hour treatment, total RNA was extracted, and the expression changes of M1/M2 polarization markers were detected by qRT-PCR.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eRelationship Between Bile Acid Metabolism Profile and Immunotherapy Response\u003c/p\u003e\n\u003cp\u003eWe collected surgical tumor tissue samples from 6 HCC patients who received PD-1/PD-L1 inhibitor monotherapy. Based on the 1-year postoperative follow-up, the patients were divided into the recurrence group (FA, n\u0026thinsp;=\u0026thinsp;3) and the disease-free survival group (WA). Quantitative analysis of 36 BAs in tumor tissues were quantified using LC-MS/MS technology. Results showed that multiple primary BAs, including GCDCA, CDCA-3Gln, GCA, TCDCA, and TCA, were significantly elevated in the WA group. In contrast, multiple secondary BAs, such as LCA-3S, GLCA-3S, DCA-3-O-S and TLCA-3S, showed an increasing trend in the FA group(Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). However, possibly due to the limited sample size, the above results lacked statistical significance. These findings suggest that bile acid homeostasis may have a potential association with immunotherapy response, indicating that we should consider the dynamic changes of BA metabolism during the treatment process.\u003c/p\u003e\n\u003cp\u003eAbnormal Expression of Bile Acid Synthetases in HCC\u003c/p\u003e\n\u003cp\u003eUsing TCGA data, we identified significant differences in the expression of four key bile acid synthase genes between neoplastic HCC and non-HCC liver tissues. Among them, CYP27A1, CYP7B1, and CYP8B1 were downregulated in tumor tissues, while CYP7A1 showed an upward trend (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). Further analysis revealed that the log(CYP7B1/CYP7A1) ratio was significantly higher in the intermediate-advanced stage (stages II-IV) group than in the early-stage (stage I) group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb). This indicates a shift from the classical pathway to the alternative pathway in HCC. Immunohistochemistry confirmed different expression of CYP7A1 and CYP27A1 in HCC tissues. The average expression level of CYP7A1 was 0.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 in both cancerous and adjacent tissues(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec). The average expression of CYP27A1 in cancerous tissues was 0.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2, significantly lower than in adjacent tissues, consistent with the bioinformatics analysis results(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\n\u003cp\u003eCorrelation between Bile Acid Synthetases and the Immune Microenvironment\u003c/p\u003e\n\u003cp\u003eSubsequently, we conducted an immune correlation analysis on these four genes in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. The results indicated that high expression of bile acid synthase is associated with weakened immune suppression signals. Specifically, these four genes showed negative correlations with most immune stimulators, chemokines, chemokine receptors, and immune checkpoint molecules. Notably, CYP27A1 exhibited significant negative correlations with HAVCR2 (TIM-3) and CD274 (PD-L1). High expression of bile acid synthase, particularly CYP27A1, was negatively correlated with tumor-promoting immune cells such as memory B cells, Tregs, and M0 macrophages, but positively correlated with anti-tumor M1 macrophages.\u003c/p\u003e\n\u003cp\u003ePredictive Value of Bile Acid Synthetases for Immunotherapy Efficacy\u003c/p\u003e\n\u003cp\u003eAs depicted as Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, survival analysis revealed that high bile acid synthase expression significantly prolonged overall survival. Cox analysis indicated that high CYP27A1 expression was an independent protective factor, and it was the best one among the four genes for predicting the efficacy of atezolizumab combined with bevacizumab.\u003c/p\u003e\n\u003cp\u003eRegulatory Role of CDCA in Macrophage Polarization\u003c/p\u003e\n\u003cp\u003eTo further investigate how CYP27A1 influences the immune microenvironment, we analyzed the effect of the key metabolite - chenodeoxycholic acid (CDCA) - on macrophage polarization. The primer sequences used in RT-PCR are listed in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. RT-PCR results demonstrated that regarding M2-type markers: compared with the control group, CD206 expression was significantly decreased in the LPS group but increased in the CDCA group; IL-10 levels significantly declined after LPS treatment, while CDCA restored its expression; Arg-1 expression was significantly higher in both the CDCA group and LPS+CDCA group than in the control group (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). Regarding M1-type markers: CD86 expression was significantly elevated in the CDCA group; TNF-\u0026alpha; showed a marked increase in the CDCA group and further rose in the LPS+CDCA group; iNOS expression in the LPS+CDCA group was significantly higher than in the CDCA group. Our results demonstrate that CDCA exhibits a dual regulatory effect on macrophages. It not only promotes the expression of M2 macrophage markers such as CD206, IL-10, and Arg-1, but also enhances the expression of M1 markers including CD86, TNF-\u0026alpha;, and iNOS (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb). This indicates that CDCA can regulate macrophage polarization toward a mixed phenotype in vitro, having both M1 and M2 characteristics.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e.Primer Sequences for Macrophage M1/M2 Typing Markers\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMacrophage Subtype\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene Name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer Type\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 Marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTNF\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTGCCTATGTCTCAGCCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 Marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTNF\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCATAGAACTGATGAGAGGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 Marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACGTATTGGAAGGAGATTACAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCTGTCAGCGTTACTATCCCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 Marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eiNOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGACAGGGAAGTCTGAAGCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM1 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eiN OS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCAGCAGTAGTTGCTCCTCTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD206\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTTCACCTGGAGTGATGGTTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCD206\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGACATGCCAGGGTCACCTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eArg1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATTGGCTTGCGAGACGTAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eArg1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCTGAAGGTCTCTTCCATCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward Primer (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGGAAGACAATAACTGCACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eM2 marker\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse Primer (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGTTAGCAGTATGTTGTCCAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough significant progress has been made in immunotherapy for HCC, clinical heterogeneity remains a major challenge. We integrated targeted metabolomics analysis of clinical samples and bioinformatics analysis of TCGA database. This study for the first time systematically revealed the bile acid metabolic balance in tumor tissues and the expression patterns of key synthases, which associated with the response and long-term prognosis to atezolizumab plus bevacizumab therapy. We characterized and compared BAs in patient liver biopsies from neoplastic HCC and non-HCC liver tissues. Results showed that, in WA group, primary BAs - taurocholic acid (TCA) and glycocholic acid (GC) - were significantly elevated in HCC liver samples. However, in FA group, secondary BAs -deoxycholic acid (DCA) accumulated. CYP27A1 is a key number in the alternative BAs synthesis pathway, and its high expression has been identified as an independent factor associated with prolonged survival. These results suggest that BAs synthases constitute a \"metabolic determinant\" together, which influences the efficacy of immunotherapy. Within this network, different synthases coordinately regulate the composition and proportion of bile acids, collectively shaping the characteristics of the tumor immune microenvironment.\u003c/p\u003e \u003cp\u003eThis study observed that enrichment of primary BAs was associated with efficient immune response, while accumulation of secondary BAs correlated with treatment resistance. This BA profile showed good agreement with existing research on the gut microbiota regulation of anti-tumor immunity in liver cancer. Multiple studies have demonstrated that primary BAs can directly enhance the functions of CD8\u0026thinsp;+\u0026thinsp;T cells by activating TGR5, as well as promote their infiltration into tumor sites(\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). In contrast, secondary BAs can activate FXR, induce Treg cell expansion and M2 macrophage polarization, thereby shaping an immunosuppressive microenvironment(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Therefore, the markedly distinct BA profiles between the WA and FA groups likely directly contributed to the differences in the tumor immune microenvironment. This may potentially unravel resistance and response mechanisms to immune checkpoint inhibitors.\u003c/p\u003e \u003cp\u003eNotably, the significant change of the CYP7B1/CYP7A1 ratio suggests a shift from the classical pathway to the alternative pathway in HCC. This phenomenon may be associated with tumor microenvironment adaptation. As the key number of the alternative pathway, CYP27A1 expression may reflect the liver's capacity to maintain BA homeostasis. Although tumors with high CYP27A1 expression exhibit characteristics of \"cold tumors\", with insufficient immune cell infiltration, their bile acid metabolic network remains relatively intact(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Therefore, the possibility of accumulating secondary BAs is lower, which possesses immunosuppressive effects. This microenvironment creates essential condition for immune checkpoint inhibitors to exert their effects, indirectly supporting anti-tumor immunity.\u003c/p\u003e \u003cp\u003eFurthermore, survival analysis revealed that CYP27A1 showed the highest risk score among the four synthases. It indicates that CYP27A1 has the most significant predictive value for treatment efficacy. This finding suggests that CYP27A1 may not merely be a metabolic enzyme of the alternative pathway, but rather a key node connecting metabolism and immunity. TRIM24 has been studied in other tumorsA study found that higher expression of CYP27A1 is associated with a higher grade of breast cancer and lower circulating cholesterol levels, but these changes were not related to prognosis. Inhibiting cholesterol conversion to 27-hydroxycholesterol via CYP27A1 has been suggested to prevent breast cancer tumor progression(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFrom the clinical translation perspective, our study hold dual significance. Firstly, the bile acid profile (e.g., primary/secondary BAs ratio) and CYP27A1 expression levels show promise as novel biomarkers, predicting the efficacy of combination immunotherapy. These can be achieved through non-invasive or minimally invasive monitoring via liquid biopsy or tissue biopsy, complementing existing indicators such as PD-L1 expression or tumor mutational burden. Secondly, our research provides insights for developing new combination therapeutic strategies. Targeted modulation of bile acid metabolism can theoretically produce synergistic effects with existing immunotherapy regimens. There have been early clinical trials exploring the feasibility of such combination strategies, such as using FXR antagonists to block secondary bile acids or intervening in gut microbiota to optimize bile acid composition.\u003c/p\u003e \u003cp\u003eCertainly, this study has several limitations. The primary one lies in the relatively small clinical sample size, which may affect statistical power. Secondly, the study revealed correlations but did not conduct in-depth research on the molecular mechanisms by which bile acids regulate immune cells. Moreover, there is a lack of in vivo experiments to validate whether targeting CYP27A1 can enhance the efficacy of immunotherapy. In addition, inter-individual variations among patients, such as dietary habits, liver function grading, and history of antibiotic use, may all influence bile acid metabolism. These confounding factors require stricter control in subsequent studies.\u003c/p\u003e \u003cp\u003eBased on the above, we propose that future research should focus on the following directions: First, we should conduct in-depth mechanistic studies to elucidate the regulatory effects and signaling pathways of BAs on immune cell functions. Secondly, single-cell transcriptomics and spatial metabolomics should be combined to understand bile acid metabolism in relation to the spatial distribution and interactions of immune cells. Third, design and evaluate the combined effect of modulating bile acid metabolism with immunotherapy. Through these efforts, we aim to transform the ancient hepatic physiological process of bile acid metabolism into novel targets and strategies for improving the efficacy of HCC immunotherapy, ultimately benefiting patients.\u003c/p\u003e "},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by the General Science and Technology Projects of Jiangxi Provincial Health Commission, grant number 202211521.This research was funded by the Science and Technology Plan Project of Nanchang, grant number 2022-KJZC-015.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eT.Z. and X.W. conducted a comprehensive analysis and interpretation of the patient data pertaining to anatomopathological aspects, and were responsible for the initial draft of the article. H.W. performed the bioinformatic analysis; W.L and Q.Z. contributed to the literature review; K.J. carried out the cell experiments; Y.X., J.L,P.Z. and D.L. participated in manuscript revision, initial drafting, and research supervision; W.W. and S.H.contributed to pathological diagnosis and clinical data collection. All authors have read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData utilized in this work were generated and analyzed by the current study and are also publicly available. The TCGA-LIHC dataset can be accessed via TCGA (https://portal.gdc.cancer.gov) .\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDong, Y. et al. Hepatocellular carcinoma in the non-cirrhotic liver. \u003cem\u003eClin. Hemorheol Microcirc\u003c/em\u003e. \u003cb\u003e80\u003c/b\u003e, 423\u0026ndash;436. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3233/ch-211309\u003c/span\u003e\u003cspan address=\"10.3233/ch-211309\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, C. et al. 6-Phosphogluconolactonase Promotes Hepatocellular Carcinogenesis by Activating Pentose Phosphate Pathway. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 753196. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fcell.2021.753196\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2021.753196\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStarzl, T. E. The long reach of liver transplantation. \u003cem\u003eExp. Clin. Transpl.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 87\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.6002/ect.2013.ecte2\u003c/span\u003e\u003cspan address=\"10.6002/ect.2013.ecte2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollins, S. L., Stine, J. G., Bisanz, J. E., Okafor, C. D. \u0026amp; Patterson, A. D. Bile acids and the gut microbiota: metabolic interactions and impacts on disease. \u003cem\u003eNat. Rev. Microbiol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 236\u0026ndash;247. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41579-022-00805-x\u003c/span\u003e\u003cspan address=\"10.1038/s41579-022-00805-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScheimann, A. O. et al. Mutations in bile salt export pump (ABCB11) in two children with progressive familial intrahepatic cholestasis and cholangiocarcinoma. \u003cem\u003eJ. Pediatr.\u003c/em\u003e \u003cb\u003e150\u003c/b\u003e, 556\u0026ndash;559. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jpeds.2007.02.030\u003c/span\u003e\u003cspan address=\"10.1016/j.jpeds.2007.02.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, F. et al. Spontaneous development of liver tumors in the absence of the bile acid receptor farnesoid X receptor. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cb\u003e67\u003c/b\u003e, 863\u0026ndash;867. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.Can-06-1078\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.Can-06-1078\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBernstein, H., Bernstein, C., Payne, C. M., Dvorakova, K. \u0026amp; Garewal, H. Bile acids as carcinogens in human gastrointestinal cancers. \u003cem\u003eMutat. Res.\u003c/em\u003e \u003cb\u003e589\u003c/b\u003e, 47\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mrrev.2004.08.001\u003c/span\u003e\u003cspan address=\"10.1016/j.mrrev.2004.08.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnakk, S. et al. Bile acids activate YAP to promote liver carcinogenesis. \u003cem\u003eCell. Rep.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 1060\u0026ndash;1069. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2013.10.030\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2013.10.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMai, H. et al. Implications of Stemness Features in 1059 Hepatocellular Carcinoma Patients from Five Cohorts: Prognosis, Treatment Response, and Identification of Potential Compounds. Cancers (Basel). 14. (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cancers14030563\u003c/span\u003e\u003cspan address=\"10.3390/cancers14030563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaranasi, S. K. et al. Bile acid synthesis impedes tumor-specific T cell responses during liver cancer. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e387\u003c/b\u003e, 192\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.adl4100\u003c/span\u003e\u003cspan address=\"10.1126/science.adl4100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, C. et al. Gut microbiome-mediated bile acid metabolism regulates liver cancer via NKT cells. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e360\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.aan5931\u003c/span\u003e\u003cspan address=\"10.1126/science.aan5931\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDing, L. et al. Vertical sleeve gastrectomy activates GPBAR-1/TGR5 to sustain weight loss, improve fatty liver, and remit insulin resistance in mice. \u003cem\u003eHepatology\u003c/em\u003e \u003cb\u003e64\u003c/b\u003e, 760\u0026ndash;773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/hep.28689\u003c/span\u003e\u003cspan address=\"10.1002/hep.28689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, J. et al. Gut microbiota remodeling reverses aging-associated inflammation and dysregulation of systemic bile acid homeostasis in mice sex-specifically. \u003cem\u003eGut Microbes\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, 1450\u0026ndash;1474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/19490976.2020.1763770\u003c/span\u003e\u003cspan address=\"10.1080/19490976.2020.1763770\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, F. et al. Single-cell profiling of tumor heterogeneity and the microenvironment in advanced non-small cell lung cancer. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 2540. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-021-22801-0\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-22801-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInasu, M. et al. High CYP27A1 expression is a biomarker of favorable prognosis in premenopausal patients with estrogen receptor positive primary breast cancer. \u003cem\u003eNPJ Breast Cancer\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e, 127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41523-021-00333-6\u003c/span\u003e\u003cspan address=\"10.1038/s41523-021-00333-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hepatocellular carcinoma, bile acids, immunotherapy, CYP27A1, macrophage polarization, CDCA","lastPublishedDoi":"10.21203/rs.3.rs-8649754/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8649754/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eHepatocellular carcinoma (HCC) constitutes the foremost cause of cancer-related mortality globally, and patients exhibit significant variations in their response to immunotherapy. Recent research has shown that elevated bile acids (BAs) are closely associated with HCC.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe collected surgical tumor samples from six HCC patients and categorized them into recurrence (FA, n\u0026thinsp;=\u0026thinsp;3) and disease-free survival (WA,n\u0026thinsp;=\u0026thinsp;3) groups based on one-year postoperative follow-up. Using liquid chromatography-tandem mass spectrometry (LC-MS/MS), we quantified 36 BAs in tumor tissues. Additionally, we analyzed bile acid synthetase gene expression using The Cancer Genome Atlas (TCGA) data, and explored the regulatory role of chenodeoxycholic acid (CDCA) on macrophage polarization.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe findings revealed that tumors from patients with favorable treatment response and long-term disease-free survival contained higher levels of primary BAs, whereas recurrent patients showed elevated secondary BAs. Additionally, we found that patients with higher expression of the bile acid synthase gene CYP27A1 had significantly prolonged survival, and this gene could serve as an independent predictor for treatment outcomes. Correlation analysis revealed that high expression of bile acid synthase is associated with weakened. Experiments demonstrated that BAs can influence the functional state of macrophages.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThese findings indicate that the metabolic of BAs is closely linked to the immunotherapy response in HCC. It provides novel targets for metabolic-based therapeutic strategies, with CYP27A1 serving as a potential predictive biomarker.\u003c/p\u003e","manuscriptTitle":"Mechanisms and Clinical Significance of Bile Acid Metabolism Reprogramming in Hepatocellular Carcinoma Immunotherapy Response","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-17 16:12:28","doi":"10.21203/rs.3.rs-8649754/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"22ba1e92-aed5-4ad3-a2a4-ebabda7d6099","owner":[],"postedDate":"February 17th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":62951521,"name":"Health sciences/Biomarkers"},{"id":62951522,"name":"Biological sciences/Cancer"},{"id":62951523,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2026-04-13T07:27:49+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-17 16:12:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8649754","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8649754","identity":"rs-8649754","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-29T02:00:03.542394+00:00
License: CC-BY-4.0