Influence of IgG+ serum on Zika Virus infection response in a model of neural precursor cells

Influence of IgG+ serum on Zika Virus infection response in a model of neural precursor cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Influence of IgG+ serum on Zika Virus infection response in a model of neural precursor cells Ismael Plentz, Douglas Pazzin, Thales Previato, Fernanda Wagner, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4277717/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The high frequency of Zika virus (ZIKV) infection prompted the World Health Organization (WHO) to declare it an emerging threat in 2016. Presently, countries in South America continue to report a significant number of Zika virus cases. Zika virus infection has been associated with neurological diseases. This article explores the impact of ZIKV infection on IgG + Zika-reactive conditions using a neurosphere model. Methods Neurospheres derived from Wistar rats were exposed to Zika virus and IgG + Zika-reactive conditions. The study assessed the area, irregularity rate, and relative gene expression of NOTCH-1, HES-1, and HEY-1, as well as the expression of GCSF and IL-10. Results The irregularity rate of ZIKV neurospheres decreased at its lowest concentration; however, our morphology analysis was insufficient to fully elucidate the impact of ZIKV on neurospheres. Interestingly, IgG + serum exhibited neuroprotective effects against subsequent Zika virus exposure, restoring NOTCH-1 and HES-1 expression levels to normal. HEY-1 expression remained unaffected by Zika virus exposure but decreased with IgG + serum. Surprisingly, levels of the anti-inflammatory markers GCSF and IL-10 showed no significant changes. Conclusions These findings highlight the complex interplay between ZIKV infection, immune response, and neurodevelopmental processes. Further research is necessary to elucidate the precise mechanisms underlying these observations and explore potential therapeutic interventions. Zika virus Neurospheres IgG + serum neural precursor cells Figures Figure 1 Figure 2 Figure 3 1. Background The Zika virus is a flavivirus transmitted by arthropods of the genus Aedes spp. These mosquitoes, known for transmitting diseases, are found on all continents, increasing the risk of global transmission of the virus [ 1 ]. Infections caused by Zika virus (ZIKV) are typically asymptomatic or result in mild discomfort, characterized mainly by fever, conjunctivitis, joint pain, and related rashes. More serious or fatal cases are rare. However, the close association of the virus with an increased incidence of neurological diseases, such as Guillain-Barré syndrome and congenital neurological malformations—especially microcephaly—in areas endemic to ZIKV infection, has piqued the interest of the global scientific community. This concern prompted the WHO to declare a state of international emergency in 2016 [ 2 ] [ 3 ]. According to the Brazilian Ministry of Health in 2023, there were 14,453 reported cases of Zika infection in the first half of the year. Among these cases, 1,294 involved infected pregnant women, with 787 occurring during the first and second gestational semesters [ 4 ], which are the periods associated with the highest risk for serious fetal sequelae [ 5 ]. The main fetal outcomes observed after gestational Zika virus infection include fetal death, microcephaly, cerebral calcifications (parenchymal, periventricular, thalamic, and basal ganglia), ventriculomegaly, hydranencephaly, growth retardation, and neuropsychomotor development issues such as ocular changes, hydrops fetalis, and hearing deficits [ 6 ]. Brain tissue analysis of Wistar rat pups infected with ZIKV revealed morphological damage, alterations in the blood-brain barrier, and evidence of neuroinflammation, even in individuals without microcephaly [ 7 ]. Moreover, the cultivation of neurospheres indicates that ZIKV infection disrupts the circadian cycle in the Central Nervous System (CNS), resulting in an imbalance in brain homeostasis [ 8 ]. This article evaluates the effects of prior ZIKV infection versus re-exposure to the virus during in vitro neurodevelopment, considering the extensive impact of ZIKV on the CNS Mammalian embryonic neurodevelopment relies on the proliferation, migration, and differentiation of neuroepithelial cells, encompassing both neural and multipotent progenitor cells. Neurospheres, clusters of neural stem cells (NSCs), and progenitor cells serve as an in vitro model of embryonic neurogenesis. This model partially mimics embryonic development, allowing for the generation of brain-like structures for studying the potential molecular and structural changes induced by exposure to environmental agents [ 9 ]. 2. Methods Four neonate Wistar rats aged 1–2 days were used to obtain neural progenitor cells. Additionally, serum from pregnant women with IgG reactive to ZIKV (IgG+) and IgG/IgM not reactive to flavivirus infections was utilized. All participants were informed about the experimental procedures and signed consent forms. The ZIKV strain used was Brazilian ZIKV strain 17, previously isolated from a 33-year-old patient exhibiting clinical features suggestive of ZIKV infection in 2016. 2.1 Neurosphere Acquisition Neurospheres were obtained from subventricular zone progenitor cell (SZPC) cultures. Wistar rats were euthanized by decapitation, and their heads were aseptically treated with 70% alcohol. The brain was exposed through an incision and extracted. Subsequently, it was washed with PBS, and the subventricular zone (SZ) was isolated. The SZs were macerated and incubated with 1x trypsin at 36°C for 5 minutes. Next, an inactivation medium (DMEM F12 with 20% FBS) was added. The macerated material was then centrifuged at 400 x g for 5 minutes, the supernatant was discarded, and the cells were resuspended in preparation medium (E8/DMEM F12 in a 1:2 ratio) supplemented with 100 U/ml penicillin/streptomycin, 2ng/mL of EGF, and 1ng/mL of FGF. Subsequently, 2mL of the suspension was added to each well of a non-adherent 24-well plate and incubated at 36°C in 5% CO2. Each well was supplemented with 50µL of supplementation medium (8µL of EGF + 4µL of FGF per 1mL of DMEM F12, plus 80ng of EGF and 40ng of FGF). After 7–10 days, the neurospheres became visibly identifiable. 2.2 IgG + Exposure Neurospheres with a diameter of ≥ 100µm were selected and transferred to an adherent 24-well plate, where they were exposed to each specific experimental group. For each treatment, the neurospheres were exposed to IgG + serum for 2 hours at 36°C in a 5% CO2 incubator. ZIKV concentrations were set at 5 x 107 PFU/mL for 0.1, 0.01, and 0.001 MOI for 24 hours at 36°C in a 5% CO2 incubator. After exposure to viral particles, the medium was replaced with a preparation medium. Each ZIKV exposure treatment group followed this procedure. 2.3 Morphology Evaluation The neurospheres were assessed for their morphology immediately upon acquisition (day 10) and after exposure to treatment for 0, 24, 48, and 72 hours. The integrity of their cell membrane was measured by assessing their initial roughness and post-treatment changes. Additionally, alterations in shape were evaluated by comparing the distance between the most internal and external points of the neurosphere's perimeter. All analyses were conducted using the image analysis software Image Pro Plus 7. 2.4 Gene Expression Gene expression was analyzed using the qRT-PCR technique and assessed through relative expression. Total RNA was extracted using the SV Total RNA Isolation System (Promega, Madison, Wisconsin, USA). This RNA was then converted into cDNA using the GoScript™ Reverse Transcription Mix with Oligo(dT) (Promega). Real-time PCR was conducted using the PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, Massachusetts, USA). The samples were amplified starting from an initial amount of 20ng of cDNA. Assays were performed on individual plates for each target gene, using GAPDH as an endogenous control. The target genes analyzed were NOTCH-1, HES-1, and HEY-1. All steps followed the protocols provided by each manufacturer. The primer sets used are listed in Table 1 . Table 1 List of all primers used for qRT-PCR assays, demonstrating their targets, sequence, and temperature for Melt Curve. Target Forward/Reverse Sequence T°C Melting NOTCH-1 Forward CACCCACATTCCAGAGGCAT 52 NOTCH-1 Reverse GAGCACTGGAAAGGACTCCC 54 HES-1 Forward TCCTTGGTCCTGGAATAGCG 52 HES-1 Reverse CTTTGGTTTGTCCGGTGTCG 52 HEY-1 Forward CCATGAAGAGAGCTCACCCG 54 HEY-1 Reverse GAAGGCTGAAGTGAGCCACG 54 GAPDH Forward TGTGTCCGTCGTGGATCTGA 52 GAPDH Reverse CCTGCTTCACCACCTTCTTGA 54 2.5 Protein Quantification The protein quantification was assessed using a Luminex® immunoassay for GCSF and IL-10 in the supernatant of cultures from each treatment after 2 hours of exposure to ZIKV. Magnetic beads corresponding to each marker were added to a 96-well plate, followed by the addition of 50 µL of each sample and each dilution point of the standard curve. The plate was then placed on a shaker at 500 rpm for 2 hours. Afterward, the plate was washed with wash buffer, and the detection antibody was added. The plate was shaken again at 500 rpm for 30 minutes, and then 50 µL of streptavidin was added. Subsequently, the plate was washed with wash buffer and read on a Luminex MAGPIx equipment. 2.6 Statistical Analysis Morphology evaluation, gene expression, and protein quantification data were analyzed using GraphPad Prism 6. For morphology evaluation, one-way ANOVA followed by Tukey's post-hoc test was performed. For gene expression analysis, the 2^-ΔΔCt relative quantification method was employed, with subsequent analyses using the endogenous control GAPDH gene and one-way analysis of variance test (SPSS Software, Inc.) with the Bonferroni post-test. 3. Results 3.1. Morphology Evaluation No changes in neurospheres total area or spherical shape were observed when exposed to ZIKV at MOI 0.1, 0.01, or 0.001. However, a significant decrease in neurospheres total area was noted when pre-exposed to patient serum IgG + and then exposed to the most concentrated dilution of the virus, MOI 0.1 (group IgG+/ZIKV MOI 0.1 at 24 hours post-exposure, p = 0.0246). However, this change was not sustained in the subsequent post-exposure periods. The analysis of neurospheres considered the percentage of irregularity in their edges. In this parameter, groups exposed to the highest virus titer (ZIKV MOI 0.1 and IgG/ZIKV MOI 0.1 groups) tended to greater irregularity in their neurospheres. However, the IgG+/ZIKV group exposed to a less concentrated ZIKV (MOI 0.001) showed a significant decrease in the irregularity rate at 0 and 24 hours post-exposure (p = 0.012 and p = 0.003, respectively; Fig. 1 ). 3.2. Gene Expression Exposure of neurospheres to ZIKV at MOI 0.1 led to an increase in NOTCH expression in both analyzed periods. Immediately after 24 hours of exposure to the virus (time 0 h), NOTCH expression increased by 6.36-fold, showing statistically significant differences between the control and IgG+/ZIKV groups (p = 0.037 and p = 0.017, respectively; Fig. 2 A). After 72 hours of culture, the significant increase in NOTCH-1 expression continued, reaching 11.63-fold (p = 0.0007 vs. Control Group and p = 0.0014 vs. IgG+/ZIKV Group; Fig. 2 A). Previous exposure of neurospheres to IgG + serum for ZIKV attenuated the increase in NOTCH-1 expression in cells subsequently exposed to the virus strain at time 0 h, with this group showing only a 1.95-fold increase compared to the control and a 4.68-fold reduction compared to the group exposed only to ZIKV. In the analysis after 72 hours, there was an increase in the expression of the NOTCH-1 gene in the group exposed to ZIKV by 11.63-fold and a reduction in expression in the group previously exposed to serum by 5.44 times compared to the group exposed only to ZIKV. This suggests a proportional reduction in NOTCH-1 expression mediated by previous exposure to serum at times 0 and 72 hours. The group treated only with IgG + serum for ZIKV showed stability in NOTCH expression at time 0 h; however, after 72 hours of culture, there was a 4.01-fold increase in NOTCH expression compared to the control. Neurospheres exposed to ZIKV at MOI 0.01 demonstrated little change in NOTCH-1 expression in the immediate analysis after 24 hours of exposure. At 24 hours of ZIKV exposure at MOI 0.1, there was a 2.08-fold reduction in HES-1 gene expression. Neurospheres previously exposed to IgG + serum also exhibited reduced HES-1 expression by 3.15-fold, while those exposed only to serum showed a 5.36-fold reduction (p = 0.0393, Fig. 2 B). Within 72 hours post-Zika exposure, the group exposed solely to the virus strain demonstrated a persistent 6.11-fold reduction (p = 0.0216 vs. Control, p = 0.0017 vs. IgG+/ZIKV, and p = 0.002 vs. IgG+). Conversely, groups exposed to IgG + for ZIKV showed increased HES-1 gene expression, with a 2.54-fold increase in the IgG+/ZIKV group compared to the control and a 5.69-fold increase compared to time zero. The group exposed solely to IgG + serum for ZIKV exhibited a 4.01-fold increase compared to the control and a 9.37-fold increase compared to the same group at time zero (p = 0.004). For the MOI 0.01 group, the pattern of HES-1 expression changes mirrored that of the MOI 0.1 group, with significant reductions observed post-exposure in the IgG+/ZIKV group and in the IgG + group compared to the control (p = 0.026 and p = 0.015, respectively). After 72 hours of ZIKV exposure, the group exposed solely to the virus maintained HES-1 expression levels similar to those at time zero, while the groups exposed to ZIKV with IgG + serum exhibited increased gene expression (4.56-fold for IgG+/ZIKV and 4.01-fold for the Serum-only group compared to the control), with statistically significant differences compared to the same groups at the earlier time point. Exposure of neurospheres to ZIKV at MOI 0.001 at time zero resulted in a 10.16-fold reduction (p = 0.002) in HES-1 gene expression for the ZIKV group and a 28.05-fold reduction for the group previously exposed to IgG + serum compared to the control group (p < 0.0001), and a 5.36-fold reduction for the group exposed only to IgG + serum for ZIKV (p < 0.0001). After 72 hours of ZIKV exposure, no differences were evident in HES-1 gene expression levels. Temporal analysis revealed statistically significant differences for the IgG+/ZIKV (p < 0.0001) and IgG + only (p < 0.0087) groups (Fig. 2 B). At MOI 0.1, the highest virus concentration did not alter the expression of the HEY-1 gene immediately after exposure. However, exposure of neurospheres to IgG + ZIKV-reactive serum resulted in an 8.54-fold reduction in HEY-1 expression for the group exposed solely to IgG + serum (p = 0.025 vs. Control group and p = 0.0018 vs. ZIKV group) and a 4.79-fold reduction for the group also exposed to ZIKV (p = 0.0011 vs Control group and p = 0.046 vs ZIKV group). After 72 hours of virus exposure, there was a 2.7-fold increase in HEY-1 gene expression for the group exposed solely to the ZIKV strain (p = 0.016 vs IgG+) and a 3.59-fold increase for the group previously exposed to IgG + serum (IgG+/ZIKV) compared to the group exposed solely to IgG + serum (p = 0.0074 vs IgG+). In a temporal analysis, the IgG+/ZIKV group increased HEY-1 gene expression 8.38-fold from time zero to 72 hours (p = 0.0026). The group exposed solely to IgG + serum maintained negative HEY-1 expression values (3.54 times less expressed) compared to the control. At MOI 0.01, there was a slight change in HEY-1 gene expression for the ZIKV and IgG+/ZIKV groups. However, the group exposed solely to IgG + serum exhibited an 8.54-fold reduction in gene expression at time zero (p = 0.0012 vs Control, p = 0.0007 vs ZIKV, and p = 0.0037 vs IgG+/ZIKV). Similarly to MOI 0.1, at 72 hours, the change in HEY-1 expression in the three experimental groups was very similar, with an increase in expression in the ZIKV and IgG+/ZIKV groups and a reduction in the IgG + group (p = 0.0089 vs ZIKV and p = 0.024 vs IgG+/ZIKV). Similarly to other dilutions, exposure of the groups to an MOI of 0.001 of ZIKV resulted in a 7.06-fold and 8.54-fold reduction in the expression of the HEY-1 gene in the IgG+/ZIKV and IgG + groups, respectively, at time zero, both with statistically significant differences compared to the control (p = 0.0012 and p = 0.0004, respectively) and the group exposed solely to ZIKV (p = 0.0004 and p = 0.0001, respectively). At 72 hours, there was an increase in gene expression in the group exposed to the virus (3.49 times) and the IgG+/ZIKV group (2.84 times). The IgG + group maintained a reduction in HEY-1 expression of 3.54 times less expressed (p = 0.0406 vs Control group, p = 0.0030 vs ZIKV, and p = 0.0056 vs IgG+/ZIKV). In temporal analysis, there was an increase in HEY-1 expression of 10.55 times for the IgG+/ZIKV group (p = 0.0003) and 5 times for the group exposed solely to IgG+ (p = 0.0243) (Fig. 2 C). 3.3. GCSF and IL-10 Expression In ZIKV MOI 0.1, there was an increase in GCSF levels in the culture supernatant immediately after exposure to IgG + serum (IgG + group/ZIKV and IgG + group). Analysis after 72 hours of exposure showed little variation in GCSF levels in the ZIKV and IgG+/ZIKV groups, with a reduction observed in the group exposed solely to IgG + serum. Exposure to Zika did not seem to influence GCSF levels at MOI 0.01 in the analysis at time zero, while a slight increase in GCSF levels was observed in the supernatant of the Serum group. After 72 hours, there was a reduction in GCSF levels in the group exposed solely to Serum. For cells exposed to MOI 0.001, there was little variation in the presence of this protein in the supernatant at the time zero analysis. The results at 72 hours post-exposure show a reduction in GCSF levels detected for all three groups analyzed (Fig. 3 ). There was a slight reduction in IL-10 levels in groups exposed to IgG + serum for ZIKV virus at MOI 0.1 titer. Similarly, for the group exposed to MOI 0.01, there was also a small reduction in IL-10 expression, particularly noticeable in neurospheres exposed to IgG + serum. The higher dilution of the virus also resulted in a reduction in IL-10 levels for the group exposed solely to the virus strain, approaching the lowest expression levels found for the other concentrations in the IgG+/ZIKV and IgG + groups (Fig. 3 ). 4. Discussion This study aimed to assess the risk of damage from the anti-ZIKV antibody complex in neurosphere cultures obtained from the SVZ of neonatal rats. To simulate a re-exposure to ZIKV, neurospheres were pre-exposed to IgG serum reactive to ZIKV and then incubated with the virus for 24 hours. Recent studies suggest that ZIKV has the potential to alter the morphology of neurospheres and brain organoids, leading to changes in phenotype and a size reduction, indicating increased precursor cell death. However, the methodology employed in this study for the morphological evaluation of neurospheres may not have been sufficiently sensitive to demonstrate the impact of ZIKV on neurosphere morphology. The protocol used for obtaining neurospheres displayed morphological variability, both in terms of total area and sphere phenotype, showing irregularity even before exposure to IgG + serum or ZIKV. However, IgG + serum for ZIKV appeared to exhibit a protective potential on the cells, resulting in a significant decrease in neurosphere irregularity when exposed to lower virus titration (MOI 0.001). The expression of the NOTCH protein is crucial for various fundamental roles within an organism. Insufficiency or absence of NOTCH expression can contribute to a range of diseases, including neuronal disorders. Genes such as NOTCH-1, along with NOTCH-3, play pivotal roles in neuronal cell differentiation and the formation of structures like the dentate gyrus [ 10 ]. Furthermore, maintaining regular expression of the NOTCH-1 gene is essential for promoting nerve cell growth, as this protein plays a significant role in the development of the central nervous system [ 11 ]. In our findings, we observed that ZIKV infection can increase NOTCH-1 expression as early as 24 hours post-infection (p.i.), and this elevated expression persists until the last time point analyzed (72 hours p.i.). This effect could be attributed to the intrinsic nature of these cells, which rely on tightly regulated developmental pathways for their growth. ZIKV infection appears to interfere with the maintenance and proliferation of stem cells, often altering genes associated with development, particularly NOTCH [ 11 ]. Abnormal expression of NOTCH-1 has been linked to various pathologies, including bicuspid aortic valve, astrocytic hypertrophy, and Alzheimer's disease [ 12 , 13 , 14 ]. In our study, we observed a significant alteration in NOTCH-1 expression, with levels being elevated compared to those in the control group. It is conceivable that under the influence of ZIKV, these cells initiated a premature differentiation process, leading to increased NOTCH-1 expression levels. This phenomenon could potentially contribute to the depletion of progenitor cells [ 15 ]. Our findings align with recent literature indicating that ZIKV has a preference for infecting neural progenitor cells (NPCs), resulting in increased NOTCH-1 expression and disruption of the viability and growth of these cells [ 16 ]. Moreover, recent studies have demonstrated that ZIKV promotes the degradation of the Numb protein, which serves as an inhibitor of Notch signaling [ 17 ]. Therefore, this mechanism may contribute to the observed increase in NOTCH-1 expression induced by ZIKV infection. Our results indicate a decrease in HES-1 expression levels at time 0h for groups that underwent any intervention, whether exposed to IgG + serum, ZIKV, or both (ZIKV group, IgG+/ZIKV group, or IgG+), highlighting the high heterogeneity of this gene expression. HES-1 serves as a fundamental transcriptional repressor in cell proliferation and differentiation during embryogenesis [ 18 ]. Studies emphasize the significance of HES-1 expression in young cells, as reduced expression levels of this gene during gestation or shortly after birth can lead to severe neurological defects in rodents, potentially resulting in death [ 19 ]. Additionally, other studies have demonstrated that low levels of HES-1 expression in mice caused hypoplasia of certain organs due to the depletion of precursor cells [ 20 ], underscoring the importance of maintaining regular levels of HES-1 in precursor cells However, at 72 hours post-exposure to ZIKV, HES-1 expression levels appeared to be normalized in the IgG + and IgG+/ZIKV groups compared to the control group. Only the ZIKV group showed a persistent decrease in HES-1 expression at higher virus titers (MOI 0.1 and 0.01). Thus, ZIKV appears to directly influence decreasing the expression levels of this gene, while conversely, IgG + serum for ZIKV could modulate expression levels, returning to normal levels over time post-exposure to ZIKV. Considering that HES-1 participates in the proper control of embryonic neurogenesis and neural tube formation, IgG + reactive to ZIKV could play a neuroprotective role by inhibiting the downregulation of this gene upon re-exposure to ZIKV. Subsequently, when we evaluated the expression levels of the HEY-1 gene, which is also implicated in embryonic development outcomes and neurogenesis, it does not seem to be affected by exposure to ZIKV at any of the viral titrations. Surprisingly, only the neurosphere group exposed to IgG + for ZIKV showed a persistent decrease in HEY-1 expression levels. Acutely, a decrease in gene expression levels was also observed in the group that was previously exposed to IgG + serum and subsequently incubated with ZIKV only at time 0 h, with levels normalized at 72 h after virus exposure. The anti-inflammatory activity in neurospheres previously immunized with IgG + serum for ZIKV and subsequently exposed to the virus, based on levels of GCSF and IL-10. GCSF, with receptors widely distributed in the central nervous system, exhibits a multimodal neuroprotective effect, including anti-apoptotic activity in neurons [ 21 , 22 , 23 ], stimulation of endogenous neurogenesis [ 24 ], regeneration and repair of vascularization, and stimulation of angiogenesis [ 25 ], along with an anti-inflammatory effect [ 26 ]. Similarly, IL-10 plays crucial roles in maintaining tissue homeostasis by restricting excessive inflammatory responses, positively regulating innate immunity, and promoting tissue repair mechanisms [ 27 , 28 ]. However, the changes in GCSF or IL-10 levels observed in our study were not significant for any of the experimental groups. 5. Conclusions In conclusion, while ZIKV IgG + serum appeared to have a minimal protective effect, evidenced by a reduction in the irregularity rate of ZIKV neurospheres at its lowest concentration, our morphology analysis was insufficient to fully elucidate the impact of ZIKV on neurospheres. However, NOTCH-1 expression significantly increased at the highest virus concentration when neurospheres were exposed to ZIKV. Conversely, IgG + serum for ZIKV demonstrated significant neuroprotective effects against subsequent ZIKV exposure, with NOTCH-1 levels showing minimal differences compared to the control group. Furthermore, the HES-1 gene exhibited sensitivity to changes in the cellular microenvironment, as evidenced by reduced expression in neurospheres across all experimental groups at 0 hours post-exposure. However, compared to the control group, HES-1 expression levels were normalized after 72 hours of exposure to ZIKV in the IgG + serum group. Additionally, IgG + serum led to reduced HEY-1 expression over time. Interestingly, there were no significant changes in the levels of GCSF or IL-10 in neurospheres previously exposed to IgG + serum for ZIKV and subsequently to ZIKV, or in those exposed only to the virus. Abbreviations CNS Central Nervous System IgG+ IgG reactive to ZIKV NPC Neural progenitor cell NSC Neural stem cell SZ Subventricular zone SZPC Subventricular zone progenitor cell WHO World Health Organization ZIKV Zika virus Declarations Authors' contributions: Conceptualization, da Costa, J., Plentz, I. and Marinowic, D.; methodology, Plentz, I.; software, Plentz, I.; validation, Marinowic, D.; investigation, Plentz, I.; resources, da Costa, J. and Marinowic, D.; data curation, Plentz, I.; writing—original draft preparation, Pazzin, D., Previato, T., Gonçalvez, J., Boff, M., Fernandes, L. and Wagner, F.; writing—review and editing, Pazzin, D., Previato, T., Gonçalvez, J., Boff, M., Fernandes, L. and Wagner, F.; supervision, Marinowic, D. and da Costa, J.; project administration, Marinowic, D. and da Costa, J.; funding acquisition, Marinowic, D. and da Costa, J. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding Ethics approval and consent to participate: The animal study protocol was approved by the Ethics Committee on the Use of Animals (ECUA) of PUCRS (protocol code 002 and date of approval 2019). Informed consent was obtained from all subjects involved in the study regarding the IgG serum acquisition. Competing interests: All the listed authors declare no conflicts of interest. Availability of data and materials: The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Acknowledgments: We acknowledge all the members of the professional body and students who made the execution and publication of this article possible. References Bogoch II, Brady OJ, Kraemer MUG, German M, Creatore MI, Kulkarni MA, et al. Anticipating the international spread of Zika virus from Brazil. Lancet Lond Engl. 2016;387:335–6. Gulland A. Zika virus is a global public health emergency, declares WHO. BMJ. 2016;352:i657. Nunes ML, Carlini CR, Marinowic D, Neto FK, Fiori HH, Scotta MC, et al. Microcephaly and Zika virus: a clinical and epidemiological analysis of the current outbreak in Brazil. J Pediatr (Rio J). 2016;92:230–40. TabNet Win32 3.2. Zika Vírus - Notificações registradas no Sistema de Informação de Agravos de Notificação - Brasil. http://tabnet.datasus.gov.br/cgi/deftohtm.exe?sinannet/cnv/zikabr.def . Accessed 26 Feb 2024. Dasgupta S, Reagan-Steiner S, Goodenough D, Russell K, Tanner M, Lewis L, et al. Patterns in Zika Virus Testing and Infection, by Report of Symptoms and Pregnancy Status - United States, January 3-March 5, 2016. MMWR Morb Mortal Wkly Rep. 2016;65:395–9. Besnard M, Lastere S, Teissier A, Cao-Lormeau V, Musso D. Evidence of perinatal transmission of Zika virus, French Polynesia, December 2013 and February 2014. Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull. 2014;19:20751. Dos Santos AS, da Costa MG, Faustino AM, de Almeida W, Danilevicz CK, Peres AM, et al. Neuroinflammation, blood-brain barrier dysfunction, hippocampal atrophy and delayed neurodevelopment: Contributions for a rat model of congenital Zika syndrome. Exp Neurol. 2024;374:114699. de Lima Cavalcanti TYV, Lima MC, Bargi-Souza P, Franca RFO, Peliciari-Garcia RA. Zika Virus Infection Alters the Circadian Clock Expression in Human Neuronal Monolayer and Neurosphere Cultures. Cell Mol Neurobiol. 2023;44:10. Cugola FR, Fernandes IR, Russo FB, Freitas BC, Dias JLM, Guimarães KP, et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 2016;534:267–71. Sibbe M, Förster E, Basak O, Taylor V, Frotscher M. Reelin and Notch1 cooperate in the development of the dentate gyrus. J Neurosci Off J Soc Neurosci. 2009;29:8578–85. Hai L, Zhang C, Li T, Zhou X, Liu B, Li S, et al. Notch1 is a prognostic factor that is distinctly activated in the classical and proneural subtype of glioblastoma and that promotes glioma cell survival via the NF-κB(p65) pathway. Cell Death Dis. 2018;9:158. McKellar SH, Tester DJ, Yagubyan M, Majumdar R, Ackerman MJ, Sundt TM. Novel NOTCH1 mutations in patients with bicuspid aortic valve disease and thoracic aortic aneurysms. J Thorac Cardiovasc Surg. 2007;134:290–6. Ishikura N, Clever JL, Bouzamondo-Bernstein E, Samayoa E, Prusiner SB, Huang EJ, et al. Notch-1 activation and dendritic atrophy in prion disease. Proc Natl Acad Sci U S A. 2005;102:886–91. Nagarsheth MH, Viehman A, Lippa SM, Lippa CF. Notch-1 immunoexpression is increased in Alzheimer’s and Pick’s disease. J Neurol Sci. 2006;244:111–6. Gabriel E, Ramani A, Karow U, Gottardo M, Natarajan K, Gooi LM, et al. Recent Zika Virus Isolates Induce Premature Differentiation of Neural Progenitors in Human Brain Organoids. Cell Stem Cell. 2017;20:397–e4065. Ferraris P, Cochet M, Hamel R, Gladwyn-Ng I, Alfano C, Diop F, et al. Zika virus differentially infects human neural progenitor cells according to their state of differentiation and dysregulates neurogenesis through the Notch pathway. Emerg Microbes Infect. 2019;8:1003–16. He J, Yang L, Chang P, Yang S, Wang Y, Lin S, et al. Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis. Viruses. 2023;15:1258. Kageyama R, Ohtsuka T, Kobayashi T. The Hes gene family: repressors and oscillators that orchestrate embryogenesis. Dev Camb Engl. 2007;134:1243–51. Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F. Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995;9:3136–48. Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, et al. Control of endodermal endocrine development by Hes-1. Nat Genet. 2000;24:36–44. Jung K-H, Chu K, Lee S-T, Kang L, Kim SU, Kim M, et al. G-CSF protects human cerebral hybrid neurons against in vitro ischemia. Neurosci Lett. 2006;394:168–73. Schäbitz W-R, Kollmar R, Schwaninger M, Juettler E, Bardutzky J, Schölzke MN, et al. Neuroprotective effect of granulocyte colony-stimulating factor after focal cerebral ischemia. Stroke. 2003;34:745–51. Schneider A, Krüger C, Steigleder T, Weber D, Pitzer C, Laage R, et al. The hematopoietic factor G-CSF is a neuronal ligand that counteracts programmed cell death and drives neurogenesis. J Clin Invest. 2005;115:2083–98. Schneider A, Kuhn H-G, Schäbitz W-R. A role for G-CSF (granulocyte-colony stimulating factor) in the central nervous system. Cell Cycle Georget Tex. 2005;4:1753–7. Lee S-T, Chu K, Jung K-H, Ko S-Y, Kim E-H, Sinn DI, et al. Granulocyte colony-stimulating factor enhances angiogenesis after focal cerebral ischemia. Brain Res. 2005;1058:120–8. Hartung T. Anti-inflammatory effects of granulocyte colony-stimulating factor. Curr Opin Hematol. 1998;5:221–5. Saraiva M, Vieira P, O’Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217:e20190418. Wang X, Wong K, Ouyang W, Rutz S, Targeting. IL-10 Family Cytokines for the Treatment of Human Diseases. Cold Spring Harb Perspect Biol. 2019;11:a028548. Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.jpeg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4277717","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":292609868,"identity":"8cdffa1a-d30b-4358-93b6-8c7710ad3295","order_by":0,"name":"Ismael Plentz","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Ismael","middleName":"","lastName":"Plentz","suffix":""},{"id":292609870,"identity":"0cfe69d1-82cb-48c7-9c9b-d14ec0365071","order_by":1,"name":"Douglas Pazzin","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Douglas","middleName":"","lastName":"Pazzin","suffix":""},{"id":292609871,"identity":"eb3f1895-978a-4192-89ab-36cf873b17cc","order_by":2,"name":"Thales Previato","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Thales","middleName":"","lastName":"Previato","suffix":""},{"id":292609873,"identity":"281c646f-e383-4d1a-bacb-86feda3edb81","order_by":3,"name":"Fernanda Wagner","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Fernanda","middleName":"","lastName":"Wagner","suffix":""},{"id":292609874,"identity":"6cef10b3-d3d7-46a9-b273-fa65c3ae1898","order_by":4,"name":"Marina Boff","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Marina","middleName":"","lastName":"Boff","suffix":""},{"id":292609875,"identity":"9e89b1b7-6c46-4229-8134-d91cfee6c910","order_by":5,"name":"Larissa Fernandes","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Larissa","middleName":"","lastName":"Fernandes","suffix":""},{"id":292609876,"identity":"d34178d8-b131-4df9-bf43-9df1e2c6adb8","order_by":6,"name":"João Gonçalvez","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"João","middleName":"","lastName":"Gonçalvez","suffix":""},{"id":292609877,"identity":"fa42f4c9-7af7-48e9-8ac1-b6880652565c","order_by":7,"name":"Daniel Marinowic","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYDCCAyBUAGIxNgAJCQZ+qEQCfi0GSFokG4jQwgDRAgUGBwho4Tt+9uCBDwYM0fyzD7c9+NhmIW98u8fwc8UfhjzzBuxaJM/kJRycYcCQO+NcYrvhzDYJw213zhhLnm1jKJY5gF2LwYEcg8M8QC0NZxjbpHm3SSSY3cgxY2xsYEicgcNhBuffGBz+A9QyH6bFeAZQS8MfPFpuAG0Bej93A0yLgQRICxtuLZI33hgc7DGQyN0I1CI585+E4Yw7x4olG9skiiVwhdj5HOMPPypscuedYX8m8eFMnTz/7OaNHxv+2OTh0gIFEhhsAhpwax8Fo2AUjIJRAAQA8qldWFP3OZYAAAAASUVORK5CYII=","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":true,"prefix":"","firstName":"Daniel","middleName":"","lastName":"Marinowic","suffix":""},{"id":292609878,"identity":"a53d4d10-bc1b-46ab-848b-2bec71d8d85a","order_by":8,"name":"Jaderson Costa","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul (PUCRS)","correspondingAuthor":false,"prefix":"","firstName":"Jaderson","middleName":"","lastName":"Costa","suffix":""}],"badges":[],"createdAt":"2024-04-16 18:14:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4277717/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4277717/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55380558,"identity":"ed18016b-bdb9-4a30-949a-0b77d3532a58","added_by":"auto","created_at":"2024-04-26 13:46:37","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":166959,"visible":true,"origin":"","legend":"\u003cp\u003eArea and irregularity rate of neurospheres after ZIKV exposure. A) Total area of neurospheres for different interventions in all evaluated periods, pre and post\u003cstrong\u003e-\u003c/strong\u003eexposure to ZIKV. * p \u0026lt; 0.05 pre-exposure vs. 24 h post-exposure for IgG+/ZIKV MOI 0.1. B) Neurosphere irregularity rate for the different interventions in all periods evaluated, pre and post exposure to ZIKV. * p \u0026lt; 0.05 Pre-exposure vs. 0 h post-exposure and ** p \u0026lt; 0.01 Pre-exposure vs. 24 h for IgG+/ZIKV MOI 0.001.\u003c/p\u003e","description":"","filename":"Figure1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4277717/v1/979e3f01dc39c7e48a796a23.jpeg"},{"id":55380560,"identity":"265fc9ec-d0e9-4952-986a-9b2ed87e0d5a","added_by":"auto","created_at":"2024-04-26 13:46:37","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":213888,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of gene expression after ZIKV exposure. A) NOTCH-1 gene expression in neurospheres previously exposed to IgG+ ZIKV-reactive and after incubated with 3 different titers of ZIKV, MOI 0.1, 0.01 and 0.001. * p \u0026lt; 0.5 and *** p \u0026lt; 0.001 vs. Control, ## p \u0026lt; 0.01 vs. IgG+/ZIKV and $$ p \u0026lt; 0.01 vs. IgG+. B) Analysis of HES-1 gene expression for neurospheres exposed to different groups using 3 ZIKV titrations. * p \u0026lt; 0.5, ** p \u0026lt; 0.01 and *** p \u0026lt; 0.001 vs. Control, ## p \u0026lt; 0.01 and ### p \u0026lt; 0.001 vs. IgG+/ZIKV and $ $ p \u0026lt; 0.01 and $ $ $ p \u0026lt; 0.001 vs. IgG+ and ++ p \u0026lt; 0.01 for longitudinal analysis. C) HEY-1 gene expression in neurospheres exposed to different groups using 3 Zika virus titrations. * p \u0026lt; 0.5, ** p \u0026lt; 0.01 and *** p \u0026lt; 0.001 vs. Control, # p \u0026lt; 0.05 and ### p \u0026lt; 0.001 vs. IgG+/ZIKV and $ p \u0026lt; 0.05, $ $ p \u0026lt; 0.01 and $ $ $ p \u0026lt; 0.001 vs. IgG+, + p \u0026lt; 0.05 and ++ p \u0026lt; 0.01 for longitudinal analysis.\u003c/p\u003e","description":"","filename":"Figure2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4277717/v1/2743125c9c224fe9895dea52.jpeg"},{"id":55380559,"identity":"b9c25f7d-7f2f-42e4-b15a-d3fbdb33a8c6","added_by":"auto","created_at":"2024-04-26 13:46:37","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":79388,"visible":true,"origin":"","legend":"\u003cp\u003eProtein levels measured in the culture supernatant. GCSF and IL-10 levels measured in the supernatant of neurospheres exposed to different interventions and in the 3 dilutions of ZIKV.\u003c/p\u003e","description":"","filename":"Figure3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4277717/v1/d861f943c526b33f56118b70.jpeg"},{"id":73360665,"identity":"a60deec4-daad-42df-ad8e-88669fa952ec","added_by":"auto","created_at":"2025-01-09 08:47:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1063714,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4277717/v1/7e221786-887e-4079-8d0a-d550305c4593.pdf"},{"id":55380561,"identity":"f8aa416a-1263-449f-ba49-24344a995619","added_by":"auto","created_at":"2024-04-26 13:46:37","extension":"jpeg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":137708,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4277717/v1/62f36cab4ca8ff4844bd1935.jpeg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Influence of IgG+ serum on Zika Virus infection response in a model of neural precursor cells","fulltext":[{"header":"1. Background","content":"\u003cp\u003eThe Zika virus is a flavivirus transmitted by arthropods of the genus \u003cem\u003eAedes\u003c/em\u003e spp. These mosquitoes, known for transmitting diseases, are found on all continents, increasing the risk of global transmission of the virus [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Infections caused by Zika virus (ZIKV) are typically asymptomatic or result in mild discomfort, characterized mainly by fever, conjunctivitis, joint pain, and related rashes. More serious or fatal cases are rare. However, the close association of the virus with an increased incidence of neurological diseases, such as Guillain-Barr\u0026eacute; syndrome and congenital neurological malformations\u0026mdash;especially microcephaly\u0026mdash;in areas endemic to ZIKV infection, has piqued the interest of the global scientific community. This concern prompted the WHO to declare a state of international emergency in 2016 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. According to the Brazilian Ministry of Health in 2023, there were 14,453 reported cases of Zika infection in the first half of the year. Among these cases, 1,294 involved infected pregnant women, with 787 occurring during the first and second gestational semesters [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], which are the periods associated with the highest risk for serious fetal sequelae [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe main fetal outcomes observed after gestational Zika virus infection include fetal death, microcephaly, cerebral calcifications (parenchymal, periventricular, thalamic, and basal ganglia), ventriculomegaly, hydranencephaly, growth retardation, and neuropsychomotor development issues such as ocular changes, hydrops fetalis, and hearing deficits [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Brain tissue analysis of Wistar rat pups infected with ZIKV revealed morphological damage, alterations in the blood-brain barrier, and evidence of neuroinflammation, even in individuals without microcephaly [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Moreover, the cultivation of neurospheres indicates that ZIKV infection disrupts the circadian cycle in the Central Nervous System (CNS), resulting in an imbalance in brain homeostasis [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This article evaluates the effects of prior ZIKV infection versus re-exposure to the virus during in vitro neurodevelopment, considering the extensive impact of ZIKV on the CNS\u003c/p\u003e \u003cp\u003eMammalian embryonic neurodevelopment relies on the proliferation, migration, and differentiation of neuroepithelial cells, encompassing both neural and multipotent progenitor cells. Neurospheres, clusters of neural stem cells (NSCs), and progenitor cells serve as an in vitro model of embryonic neurogenesis. This model partially mimics embryonic development, allowing for the generation of brain-like structures for studying the potential molecular and structural changes induced by exposure to environmental agents [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003eFour neonate Wistar rats aged 1\u0026ndash;2 days were used to obtain neural progenitor cells. Additionally, serum from pregnant women with IgG reactive to ZIKV (IgG+) and IgG/IgM not reactive to flavivirus infections was utilized. All participants were informed about the experimental procedures and signed consent forms. The ZIKV strain used was Brazilian ZIKV strain 17, previously isolated from a 33-year-old patient exhibiting clinical features suggestive of ZIKV infection in 2016.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Neurosphere Acquisition\u003c/h2\u003e \u003cp\u003eNeurospheres were obtained from subventricular zone progenitor cell (SZPC) cultures. Wistar rats were euthanized by decapitation, and their heads were aseptically treated with 70% alcohol. The brain was exposed through an incision and extracted. Subsequently, it was washed with PBS, and the subventricular zone (SZ) was isolated.\u003c/p\u003e \u003cp\u003eThe SZs were macerated and incubated with 1x trypsin at 36\u0026deg;C for 5 minutes. Next, an inactivation medium (DMEM F12 with 20% FBS) was added. The macerated material was then centrifuged at 400 x g for 5 minutes, the supernatant was discarded, and the cells were resuspended in preparation medium (E8/DMEM F12 in a 1:2 ratio) supplemented with 100 U/ml penicillin/streptomycin, 2ng/mL of EGF, and 1ng/mL of FGF.\u003c/p\u003e \u003cp\u003eSubsequently, 2mL of the suspension was added to each well of a non-adherent 24-well plate and incubated at 36\u0026deg;C in 5% CO2. Each well was supplemented with 50\u0026micro;L of supplementation medium (8\u0026micro;L of EGF\u0026thinsp;+\u0026thinsp;4\u0026micro;L of FGF per 1mL of DMEM F12, plus 80ng of EGF and 40ng of FGF). After 7\u0026ndash;10 days, the neurospheres became visibly identifiable.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 IgG\u0026thinsp;+\u0026thinsp;Exposure\u003c/h2\u003e \u003cp\u003eNeurospheres with a diameter of \u0026ge;\u0026thinsp;100\u0026micro;m were selected and transferred to an adherent 24-well plate, where they were exposed to each specific experimental group.\u003c/p\u003e \u003cp\u003eFor each treatment, the neurospheres were exposed to IgG\u0026thinsp;+\u0026thinsp;serum for 2 hours at 36\u0026deg;C in a 5% CO2 incubator. ZIKV concentrations were set at 5 x 107 PFU/mL for 0.1, 0.01, and 0.001 MOI for 24 hours at 36\u0026deg;C in a 5% CO2 incubator. After exposure to viral particles, the medium was replaced with a preparation medium. Each ZIKV exposure treatment group followed this procedure.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Morphology Evaluation\u003c/h2\u003e \u003cp\u003eThe neurospheres were assessed for their morphology immediately upon acquisition (day 10) and after exposure to treatment for 0, 24, 48, and 72 hours. The integrity of their cell membrane was measured by assessing their initial roughness and post-treatment changes. Additionally, alterations in shape were evaluated by comparing the distance between the most internal and external points of the neurosphere's perimeter. All analyses were conducted using the image analysis software Image Pro Plus 7.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Gene Expression\u003c/h2\u003e \u003cp\u003eGene expression was analyzed using the qRT-PCR technique and assessed through relative expression. Total RNA was extracted using the SV Total RNA Isolation System (Promega, Madison, Wisconsin, USA). This RNA was then converted into cDNA using the GoScript\u0026trade; Reverse Transcription Mix with Oligo(dT) (Promega). Real-time PCR was conducted using the PowerUp\u0026trade; SYBR\u0026trade; Green Master Mix (Thermo Fisher Scientific, Massachusetts, USA). The samples were amplified starting from an initial amount of 20ng of cDNA. Assays were performed on individual plates for each target gene, using GAPDH as an endogenous control. The target genes analyzed were NOTCH-1, HES-1, and HEY-1. All steps followed the protocols provided by each manufacturer. The primer sets used are listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of all primers used for qRT-PCR assays, demonstrating their targets, sequence, and temperature for Melt Curve.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward/Reverse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT\u0026deg;C Melting\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOTCH-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCCACATTCCAGAGGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOTCH-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCACTGGAAAGGACTCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHES-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTTGGTCCTGGAATAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHES-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTTGGTTTGTCCGGTGTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHEY-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATGAAGAGAGCTCACCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHEY-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGCTGAAGTGAGCCACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGTCCGTCGTGGATCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGCTTCACCACCTTCTTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Protein Quantification\u003c/h2\u003e \u003cp\u003eThe protein quantification was assessed using a Luminex\u0026reg; immunoassay for GCSF and IL-10 in the supernatant of cultures from each treatment after 2 hours of exposure to ZIKV. Magnetic beads corresponding to each marker were added to a 96-well plate, followed by the addition of 50 \u0026micro;L of each sample and each dilution point of the standard curve. The plate was then placed on a shaker at 500 rpm for 2 hours.\u003c/p\u003e \u003cp\u003eAfterward, the plate was washed with wash buffer, and the detection antibody was added. The plate was shaken again at 500 rpm for 30 minutes, and then 50 \u0026micro;L of streptavidin was added. Subsequently, the plate was washed with wash buffer and read on a Luminex MAGPIx equipment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Statistical Analysis\u003c/h2\u003e \u003cp\u003eMorphology evaluation, gene expression, and protein quantification data were analyzed using GraphPad Prism 6. For morphology evaluation, one-way ANOVA followed by Tukey's post-hoc test was performed.\u003c/p\u003e \u003cp\u003eFor gene expression analysis, the 2^-ΔΔCt relative quantification method was employed, with subsequent analyses using the endogenous control GAPDH gene and one-way analysis of variance test (SPSS Software, Inc.) with the Bonferroni post-test.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Morphology Evaluation\u003c/h2\u003e \u003cp\u003eNo changes in neurospheres total area or spherical shape were observed when exposed to ZIKV at MOI 0.1, 0.01, or 0.001. However, a significant decrease in neurospheres total area was noted when pre-exposed to patient serum IgG\u0026thinsp;+\u0026thinsp;and then exposed to the most concentrated dilution of the virus, MOI 0.1 (group IgG+/ZIKV MOI 0.1 at 24 hours post-exposure, p\u0026thinsp;=\u0026thinsp;0.0246). However, this change was not sustained in the subsequent post-exposure periods. The analysis of neurospheres considered the percentage of irregularity in their edges. In this parameter, groups exposed to the highest virus titer (ZIKV MOI 0.1 and IgG/ZIKV MOI 0.1 groups) tended to greater irregularity in their neurospheres. However, the IgG+/ZIKV group exposed to a less concentrated ZIKV (MOI 0.001) showed a significant decrease in the irregularity rate at 0 and 24 hours post-exposure (p\u0026thinsp;=\u0026thinsp;0.012 and p\u0026thinsp;=\u0026thinsp;0.003, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Gene Expression\u003c/h2\u003e \u003cp\u003eExposure of neurospheres to ZIKV at MOI 0.1 led to an increase in NOTCH expression in both analyzed periods. Immediately after 24 hours of exposure to the virus (time 0 h), NOTCH expression increased by 6.36-fold, showing statistically significant differences between the control and IgG+/ZIKV groups (p\u0026thinsp;=\u0026thinsp;0.037 and p\u0026thinsp;=\u0026thinsp;0.017, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). After 72 hours of culture, the significant increase in NOTCH-1 expression continued, reaching 11.63-fold (p\u0026thinsp;=\u0026thinsp;0.0007 vs. Control Group and p\u0026thinsp;=\u0026thinsp;0.0014 vs. IgG+/ZIKV Group; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003ePrevious exposure of neurospheres to IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV attenuated the increase in NOTCH-1 expression in cells subsequently exposed to the virus strain at time 0 h, with this group showing only a 1.95-fold increase compared to the control and a 4.68-fold reduction compared to the group exposed only to ZIKV. In the analysis after 72 hours, there was an increase in the expression of the NOTCH-1 gene in the group exposed to ZIKV by 11.63-fold and a reduction in expression in the group previously exposed to serum by 5.44 times compared to the group exposed only to ZIKV. This suggests a proportional reduction in NOTCH-1 expression mediated by previous exposure to serum at times 0 and 72 hours. The group treated only with IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV showed stability in NOTCH expression at time 0 h; however, after 72 hours of culture, there was a 4.01-fold increase in NOTCH expression compared to the control. Neurospheres exposed to ZIKV at MOI 0.01 demonstrated little change in NOTCH-1 expression in the immediate analysis after 24 hours of exposure.\u003c/p\u003e \u003cp\u003eAt 24 hours of ZIKV exposure at MOI 0.1, there was a 2.08-fold reduction in HES-1 gene expression. Neurospheres previously exposed to IgG\u0026thinsp;+\u0026thinsp;serum also exhibited reduced HES-1 expression by 3.15-fold, while those exposed only to serum showed a 5.36-fold reduction (p\u0026thinsp;=\u0026thinsp;0.0393, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Within 72 hours post-Zika exposure, the group exposed solely to the virus strain demonstrated a persistent 6.11-fold reduction (p\u0026thinsp;=\u0026thinsp;0.0216 vs. Control, p\u0026thinsp;=\u0026thinsp;0.0017 vs. IgG+/ZIKV, and p\u0026thinsp;=\u0026thinsp;0.002 vs. IgG+). Conversely, groups exposed to IgG\u0026thinsp;+\u0026thinsp;for ZIKV showed increased HES-1 gene expression, with a 2.54-fold increase in the IgG+/ZIKV group compared to the control and a 5.69-fold increase compared to time zero. The group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV exhibited a 4.01-fold increase compared to the control and a 9.37-fold increase compared to the same group at time zero (p\u0026thinsp;=\u0026thinsp;0.004). For the MOI 0.01 group, the pattern of HES-1 expression changes mirrored that of the MOI 0.1 group, with significant reductions observed post-exposure in the IgG+/ZIKV group and in the IgG\u0026thinsp;+\u0026thinsp;group compared to the control (p\u0026thinsp;=\u0026thinsp;0.026 and p\u0026thinsp;=\u0026thinsp;0.015, respectively). After 72 hours of ZIKV exposure, the group exposed solely to the virus maintained HES-1 expression levels similar to those at time zero, while the groups exposed to ZIKV with IgG\u0026thinsp;+\u0026thinsp;serum exhibited increased gene expression (4.56-fold for IgG+/ZIKV and 4.01-fold for the Serum-only group compared to the control), with statistically significant differences compared to the same groups at the earlier time point. Exposure of neurospheres to ZIKV at MOI 0.001 at time zero resulted in a 10.16-fold reduction (p\u0026thinsp;=\u0026thinsp;0.002) in HES-1 gene expression for the ZIKV group and a 28.05-fold reduction for the group previously exposed to IgG\u0026thinsp;+\u0026thinsp;serum compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and a 5.36-fold reduction for the group exposed only to IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). After 72 hours of ZIKV exposure, no differences were evident in HES-1 gene expression levels. Temporal analysis revealed statistically significant differences for the IgG+/ZIKV (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and IgG\u0026thinsp;+\u0026thinsp;only (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0087) groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAt MOI 0.1, the highest virus concentration did not alter the expression of the HEY-1 gene immediately after exposure. However, exposure of neurospheres to IgG\u0026thinsp;+\u0026thinsp;ZIKV-reactive serum resulted in an 8.54-fold reduction in HEY-1 expression for the group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum (p\u0026thinsp;=\u0026thinsp;0.025 vs. Control group and p\u0026thinsp;=\u0026thinsp;0.0018 vs. ZIKV group) and a 4.79-fold reduction for the group also exposed to ZIKV (p\u0026thinsp;=\u0026thinsp;0.0011 vs Control group and p\u0026thinsp;=\u0026thinsp;0.046 vs ZIKV group). After 72 hours of virus exposure, there was a 2.7-fold increase in HEY-1 gene expression for the group exposed solely to the ZIKV strain (p\u0026thinsp;=\u0026thinsp;0.016 vs IgG+) and a 3.59-fold increase for the group previously exposed to IgG\u0026thinsp;+\u0026thinsp;serum (IgG+/ZIKV) compared to the group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum (p\u0026thinsp;=\u0026thinsp;0.0074 vs IgG+). In a temporal analysis, the IgG+/ZIKV group increased HEY-1 gene expression 8.38-fold from time zero to 72 hours (p\u0026thinsp;=\u0026thinsp;0.0026). The group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum maintained negative HEY-1 expression values (3.54 times less expressed) compared to the control. At MOI 0.01, there was a slight change in HEY-1 gene expression for the ZIKV and IgG+/ZIKV groups. However, the group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum exhibited an 8.54-fold reduction in gene expression at time zero (p\u0026thinsp;=\u0026thinsp;0.0012 vs Control, p\u0026thinsp;=\u0026thinsp;0.0007 vs ZIKV, and p\u0026thinsp;=\u0026thinsp;0.0037 vs IgG+/ZIKV). Similarly to MOI 0.1, at 72 hours, the change in HEY-1 expression in the three experimental groups was very similar, with an increase in expression in the ZIKV and IgG+/ZIKV groups and a reduction in the IgG\u0026thinsp;+\u0026thinsp;group (p\u0026thinsp;=\u0026thinsp;0.0089 vs ZIKV and p\u0026thinsp;=\u0026thinsp;0.024 vs IgG+/ZIKV).\u003c/p\u003e \u003cp\u003eSimilarly to other dilutions, exposure of the groups to an MOI of 0.001 of ZIKV resulted in a 7.06-fold and 8.54-fold reduction in the expression of the HEY-1 gene in the IgG+/ZIKV and IgG\u0026thinsp;+\u0026thinsp;groups, respectively, at time zero, both with statistically significant differences compared to the control (p\u0026thinsp;=\u0026thinsp;0.0012 and p\u0026thinsp;=\u0026thinsp;0.0004, respectively) and the group exposed solely to ZIKV (p\u0026thinsp;=\u0026thinsp;0.0004 and p\u0026thinsp;=\u0026thinsp;0.0001, respectively). At 72 hours, there was an increase in gene expression in the group exposed to the virus (3.49 times) and the IgG+/ZIKV group (2.84 times). The IgG\u0026thinsp;+\u0026thinsp;group maintained a reduction in HEY-1 expression of 3.54 times less expressed (p\u0026thinsp;=\u0026thinsp;0.0406 vs Control group, p\u0026thinsp;=\u0026thinsp;0.0030 vs ZIKV, and p\u0026thinsp;=\u0026thinsp;0.0056 vs IgG+/ZIKV). In temporal analysis, there was an increase in HEY-1 expression of 10.55 times for the IgG+/ZIKV group (p\u0026thinsp;=\u0026thinsp;0.0003) and 5 times for the group exposed solely to IgG+ (p\u0026thinsp;=\u0026thinsp;0.0243) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.3. GCSF and IL-10 Expression\u003c/h2\u003e \u003cp\u003eIn ZIKV MOI 0.1, there was an increase in GCSF levels in the culture supernatant immediately after exposure to IgG\u0026thinsp;+\u0026thinsp;serum (IgG\u0026thinsp;+\u0026thinsp;group/ZIKV and IgG\u0026thinsp;+\u0026thinsp;group). Analysis after 72 hours of exposure showed little variation in GCSF levels in the ZIKV and IgG+/ZIKV groups, with a reduction observed in the group exposed solely to IgG\u0026thinsp;+\u0026thinsp;serum. Exposure to Zika did not seem to influence GCSF levels at MOI 0.01 in the analysis at time zero, while a slight increase in GCSF levels was observed in the supernatant of the Serum group. After 72 hours, there was a reduction in GCSF levels in the group exposed solely to Serum. For cells exposed to MOI 0.001, there was little variation in the presence of this protein in the supernatant at the time zero analysis. The results at 72 hours post-exposure show a reduction in GCSF levels detected for all three groups analyzed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere was a slight reduction in IL-10 levels in groups exposed to IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV virus at MOI 0.1 titer. Similarly, for the group exposed to MOI 0.01, there was also a small reduction in IL-10 expression, particularly noticeable in neurospheres exposed to IgG\u0026thinsp;+\u0026thinsp;serum. The higher dilution of the virus also resulted in a reduction in IL-10 levels for the group exposed solely to the virus strain, approaching the lowest expression levels found for the other concentrations in the IgG+/ZIKV and IgG\u0026thinsp;+\u0026thinsp;groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study aimed to assess the risk of damage from the anti-ZIKV antibody complex in neurosphere cultures obtained from the SVZ of neonatal rats. To simulate a re-exposure to ZIKV, neurospheres were pre-exposed to IgG serum reactive to ZIKV and then incubated with the virus for 24 hours.\u003c/p\u003e \u003cp\u003eRecent studies suggest that ZIKV has the potential to alter the morphology of neurospheres and brain organoids, leading to changes in phenotype and a size reduction, indicating increased precursor cell death. However, the methodology employed in this study for the morphological evaluation of neurospheres may not have been sufficiently sensitive to demonstrate the impact of ZIKV on neurosphere morphology.\u003c/p\u003e \u003cp\u003eThe protocol used for obtaining neurospheres displayed morphological variability, both in terms of total area and sphere phenotype, showing irregularity even before exposure to IgG\u0026thinsp;+\u0026thinsp;serum or ZIKV. However, IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV appeared to exhibit a protective potential on the cells, resulting in a significant decrease in neurosphere irregularity when exposed to lower virus titration (MOI 0.001).\u003c/p\u003e \u003cp\u003eThe expression of the NOTCH protein is crucial for various fundamental roles within an organism. Insufficiency or absence of NOTCH expression can contribute to a range of diseases, including neuronal disorders. Genes such as NOTCH-1, along with NOTCH-3, play pivotal roles in neuronal cell differentiation and the formation of structures like the dentate gyrus [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Furthermore, maintaining regular expression of the NOTCH-1 gene is essential for promoting nerve cell growth, as this protein plays a significant role in the development of the central nervous system [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn our findings, we observed that ZIKV infection can increase NOTCH-1 expression as early as 24 hours post-infection (p.i.), and this elevated expression persists until the last time point analyzed (72 hours p.i.). This effect could be attributed to the intrinsic nature of these cells, which rely on tightly regulated developmental pathways for their growth. ZIKV infection appears to interfere with the maintenance and proliferation of stem cells, often altering genes associated with development, particularly NOTCH [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Abnormal expression of NOTCH-1 has been linked to various pathologies, including bicuspid aortic valve, astrocytic hypertrophy, and Alzheimer's disease [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In our study, we observed a significant alteration in NOTCH-1 expression, with levels being elevated compared to those in the control group. It is conceivable that under the influence of ZIKV, these cells initiated a premature differentiation process, leading to increased NOTCH-1 expression levels. This phenomenon could potentially contribute to the depletion of progenitor cells [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur findings align with recent literature indicating that ZIKV has a preference for infecting neural progenitor cells (NPCs), resulting in increased NOTCH-1 expression and disruption of the viability and growth of these cells [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, recent studies have demonstrated that ZIKV promotes the degradation of the Numb protein, which serves as an inhibitor of Notch signaling [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Therefore, this mechanism may contribute to the observed increase in NOTCH-1 expression induced by ZIKV infection.\u003c/p\u003e \u003cp\u003eOur results indicate a decrease in HES-1 expression levels at time 0h for groups that underwent any intervention, whether exposed to IgG\u0026thinsp;+\u0026thinsp;serum, ZIKV, or both (ZIKV group, IgG+/ZIKV group, or IgG+), highlighting the high heterogeneity of this gene expression. HES-1 serves as a fundamental transcriptional repressor in cell proliferation and differentiation during embryogenesis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Studies emphasize the significance of HES-1 expression in young cells, as reduced expression levels of this gene during gestation or shortly after birth can lead to severe neurological defects in rodents, potentially resulting in death [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Additionally, other studies have demonstrated that low levels of HES-1 expression in mice caused hypoplasia of certain organs due to the depletion of precursor cells [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], underscoring the importance of maintaining regular levels of HES-1 in precursor cells\u003c/p\u003e \u003cp\u003eHowever, at 72 hours post-exposure to ZIKV, HES-1 expression levels appeared to be normalized in the IgG\u0026thinsp;+\u0026thinsp;and IgG+/ZIKV groups compared to the control group. Only the ZIKV group showed a persistent decrease in HES-1 expression at higher virus titers (MOI 0.1 and 0.01). Thus, ZIKV appears to directly influence decreasing the expression levels of this gene, while conversely, IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV could modulate expression levels, returning to normal levels over time post-exposure to ZIKV. Considering that HES-1 participates in the proper control of embryonic neurogenesis and neural tube formation, IgG\u0026thinsp;+\u0026thinsp;reactive to ZIKV could play a neuroprotective role by inhibiting the downregulation of this gene upon re-exposure to ZIKV.\u003c/p\u003e \u003cp\u003eSubsequently, when we evaluated the expression levels of the HEY-1 gene, which is also implicated in embryonic development outcomes and neurogenesis, it does not seem to be affected by exposure to ZIKV at any of the viral titrations. Surprisingly, only the neurosphere group exposed to IgG\u0026thinsp;+\u0026thinsp;for ZIKV showed a persistent decrease in HEY-1 expression levels. Acutely, a decrease in gene expression levels was also observed in the group that was previously exposed to IgG\u0026thinsp;+\u0026thinsp;serum and subsequently incubated with ZIKV only at time 0 h, with levels normalized at 72 h after virus exposure.\u003c/p\u003e \u003cp\u003eThe anti-inflammatory activity in neurospheres previously immunized with IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV and subsequently exposed to the virus, based on levels of GCSF and IL-10. GCSF, with receptors widely distributed in the central nervous system, exhibits a multimodal neuroprotective effect, including anti-apoptotic activity in neurons [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], stimulation of endogenous neurogenesis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], regeneration and repair of vascularization, and stimulation of angiogenesis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], along with an anti-inflammatory effect [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Similarly, IL-10 plays crucial roles in maintaining tissue homeostasis by restricting excessive inflammatory responses, positively regulating innate immunity, and promoting tissue repair mechanisms [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, the changes in GCSF or IL-10 levels observed in our study were not significant for any of the experimental groups.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn conclusion, while ZIKV IgG\u0026thinsp;+\u0026thinsp;serum appeared to have a minimal protective effect, evidenced by a reduction in the irregularity rate of ZIKV neurospheres at its lowest concentration, our morphology analysis was insufficient to fully elucidate the impact of ZIKV on neurospheres. However, NOTCH-1 expression significantly increased at the highest virus concentration when neurospheres were exposed to ZIKV. Conversely, IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV demonstrated significant neuroprotective effects against subsequent ZIKV exposure, with NOTCH-1 levels showing minimal differences compared to the control group.\u003c/p\u003e \u003cp\u003eFurthermore, the HES-1 gene exhibited sensitivity to changes in the cellular microenvironment, as evidenced by reduced expression in neurospheres across all experimental groups at 0 hours post-exposure. However, compared to the control group, HES-1 expression levels were normalized after 72 hours of exposure to ZIKV in the IgG\u0026thinsp;+\u0026thinsp;serum group.\u003c/p\u003e \u003cp\u003eAdditionally, IgG\u0026thinsp;+\u0026thinsp;serum led to reduced HEY-1 expression over time. Interestingly, there were no significant changes in the levels of GCSF or IL-10 in neurospheres previously exposed to IgG\u0026thinsp;+\u0026thinsp;serum for ZIKV and subsequently to ZIKV, or in those exposed only to the virus.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCNS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCentral Nervous System\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIgG+\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIgG reactive to ZIKV\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNPC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNeural progenitor cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNSC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNeural stem cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSZ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSubventricular zone\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSZPC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSubventricular zone progenitor cell\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWHO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWorld Health Organization\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eZIKV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eZika virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions:\u003c/strong\u003e Conceptualization, da Costa, J., Plentz, I. and Marinowic, D.; methodology, Plentz, I.; software, Plentz, I.; validation, Marinowic, D.; investigation, Plentz, I.; resources, da Costa, J. and Marinowic, D.; data curation, Plentz, I.; writing\u0026mdash;original draft preparation, Pazzin, D., Previato, T., Gon\u0026ccedil;alvez, J., Boff, M., Fernandes, L. and Wagner, F.; writing\u0026mdash;review and editing, Pazzin, D., Previato, T., Gon\u0026ccedil;alvez, J., Boff, M., Fernandes, L. and Wagner, F.; supervision, Marinowic, D. and da Costa, J.; project administration, Marinowic, D. and da Costa, J.; funding acquisition, Marinowic, D. and da Costa, J. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This research received no external funding\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u0026nbsp;\u003c/strong\u003eThe animal study protocol was approved by the Ethics Committee on the Use of Animals (ECUA) of PUCRS (protocol code 002 and date of approval 2019).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eInformed consent was obtained from all subjects involved in the study regarding the IgG serum acquisition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e All the listed authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003e The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We acknowledge all the members of the professional body and students who made the execution and publication of this article possible.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBogoch II, Brady OJ, Kraemer MUG, German M, Creatore MI, Kulkarni MA, et al. Anticipating the international spread of Zika virus from Brazil. Lancet Lond Engl. 2016;387:335\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGulland A. Zika virus is a global public health emergency, declares WHO. BMJ. 2016;352:i657.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNunes ML, Carlini CR, Marinowic D, Neto FK, Fiori HH, Scotta MC, et al. Microcephaly and Zika virus: a clinical and epidemiological analysis of the current outbreak in Brazil. J Pediatr (Rio J). 2016;92:230\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTabNet Win32 3.2. Zika V\u0026iacute;rus - Notifica\u0026ccedil;\u0026otilde;es registradas no Sistema de Informa\u0026ccedil;\u0026atilde;o de Agravos de Notifica\u0026ccedil;\u0026atilde;o - Brasil. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tabnet.datasus.gov.br/cgi/deftohtm.exe?sinannet/cnv/zikabr.def\u003c/span\u003e\u003cspan address=\"http://tabnet.datasus.gov.br/cgi/deftohtm.exe?sinannet/cnv/zikabr.def\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 26 Feb 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDasgupta S, Reagan-Steiner S, Goodenough D, Russell K, Tanner M, Lewis L, et al. Patterns in Zika Virus Testing and Infection, by Report of Symptoms and Pregnancy Status - United States, January 3-March 5, 2016. MMWR Morb Mortal Wkly Rep. 2016;65:395\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBesnard M, Lastere S, Teissier A, Cao-Lormeau V, Musso D. Evidence of perinatal transmission of Zika virus, French Polynesia, December 2013 and February 2014. Euro Surveill Bull Eur Sur Mal Transm Eur Commun Dis Bull. 2014;19:20751.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDos Santos AS, da Costa MG, Faustino AM, de Almeida W, Danilevicz CK, Peres AM, et al. Neuroinflammation, blood-brain barrier dysfunction, hippocampal atrophy and delayed neurodevelopment: Contributions for a rat model of congenital Zika syndrome. Exp Neurol. 2024;374:114699.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Lima Cavalcanti TYV, Lima MC, Bargi-Souza P, Franca RFO, Peliciari-Garcia RA. Zika Virus Infection Alters the Circadian Clock Expression in Human Neuronal Monolayer and Neurosphere Cultures. Cell Mol Neurobiol. 2023;44:10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCugola FR, Fernandes IR, Russo FB, Freitas BC, Dias JLM, Guimar\u0026atilde;es KP, et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 2016;534:267\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSibbe M, F\u0026ouml;rster E, Basak O, Taylor V, Frotscher M. Reelin and Notch1 cooperate in the development of the dentate gyrus. J Neurosci Off J Soc Neurosci. 2009;29:8578\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHai L, Zhang C, Li T, Zhou X, Liu B, Li S, et al. Notch1 is a prognostic factor that is distinctly activated in the classical and proneural subtype of glioblastoma and that promotes glioma cell survival via the NF-κB(p65) pathway. Cell Death Dis. 2018;9:158.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcKellar SH, Tester DJ, Yagubyan M, Majumdar R, Ackerman MJ, Sundt TM. Novel NOTCH1 mutations in patients with bicuspid aortic valve disease and thoracic aortic aneurysms. J Thorac Cardiovasc Surg. 2007;134:290\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshikura N, Clever JL, Bouzamondo-Bernstein E, Samayoa E, Prusiner SB, Huang EJ, et al. Notch-1 activation and dendritic atrophy in prion disease. Proc Natl Acad Sci U S A. 2005;102:886\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagarsheth MH, Viehman A, Lippa SM, Lippa CF. Notch-1 immunoexpression is increased in Alzheimer\u0026rsquo;s and Pick\u0026rsquo;s disease. J Neurol Sci. 2006;244:111\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGabriel E, Ramani A, Karow U, Gottardo M, Natarajan K, Gooi LM, et al. Recent Zika Virus Isolates Induce Premature Differentiation of Neural Progenitors in Human Brain Organoids. Cell Stem Cell. 2017;20:397\u0026ndash;e4065.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerraris P, Cochet M, Hamel R, Gladwyn-Ng I, Alfano C, Diop F, et al. Zika virus differentially infects human neural progenitor cells according to their state of differentiation and dysregulates neurogenesis through the Notch pathway. Emerg Microbes Infect. 2019;8:1003\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe J, Yang L, Chang P, Yang S, Wang Y, Lin S, et al. Zika Virus Induces Degradation of the Numb Protein Required through Embryonic Neurogenesis. Viruses. 2023;15:1258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKageyama R, Ohtsuka T, Kobayashi T. The Hes gene family: repressors and oscillators that orchestrate embryogenesis. Dev Camb Engl. 2007;134:1243\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F. Targeted disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix-loop-helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995;9:3136\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, et al. Control of endodermal endocrine development by Hes-1. Nat Genet. 2000;24:36\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung K-H, Chu K, Lee S-T, Kang L, Kim SU, Kim M, et al. G-CSF protects human cerebral hybrid neurons against in vitro ischemia. Neurosci Lett. 2006;394:168\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026auml;bitz W-R, Kollmar R, Schwaninger M, Juettler E, Bardutzky J, Sch\u0026ouml;lzke MN, et al. Neuroprotective effect of granulocyte colony-stimulating factor after focal cerebral ischemia. Stroke. 2003;34:745\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider A, Kr\u0026uuml;ger C, Steigleder T, Weber D, Pitzer C, Laage R, et al. The hematopoietic factor G-CSF is a neuronal ligand that counteracts programmed cell death and drives neurogenesis. J Clin Invest. 2005;115:2083\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider A, Kuhn H-G, Sch\u0026auml;bitz W-R. A role for G-CSF (granulocyte-colony stimulating factor) in the central nervous system. Cell Cycle Georget Tex. 2005;4:1753\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee S-T, Chu K, Jung K-H, Ko S-Y, Kim E-H, Sinn DI, et al. Granulocyte colony-stimulating factor enhances angiogenesis after focal cerebral ischemia. Brain Res. 2005;1058:120\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHartung T. Anti-inflammatory effects of granulocyte colony-stimulating factor. Curr Opin Hematol. 1998;5:221\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaraiva M, Vieira P, O\u0026rsquo;Garra A. Biology and therapeutic potential of interleukin-10. J Exp Med. 2020;217:e20190418.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Wong K, Ouyang W, Rutz S, Targeting. IL-10 Family Cytokines for the Treatment of Human Diseases. Cold Spring Harb Perspect Biol. 2019;11:a028548.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Zika virus, Neurospheres, IgG + serum, neural precursor cells","lastPublishedDoi":"10.21203/rs.3.rs-4277717/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4277717/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThe high frequency of Zika virus (ZIKV) infection prompted the World Health Organization (WHO) to declare it an emerging threat in 2016. Presently, countries in South America continue to report a significant number of Zika virus cases. Zika virus infection has been associated with neurological diseases. This article explores the impact of ZIKV infection on IgG\u0026thinsp;+\u0026thinsp;Zika-reactive conditions using a neurosphere model.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eNeurospheres derived from Wistar rats were exposed to Zika virus and IgG\u0026thinsp;+\u0026thinsp;Zika-reactive conditions. The study assessed the area, irregularity rate, and relative gene expression of NOTCH-1, HES-1, and HEY-1, as well as the expression of GCSF and IL-10.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe irregularity rate of ZIKV neurospheres decreased at its lowest concentration; however, our morphology analysis was insufficient to fully elucidate the impact of ZIKV on neurospheres. Interestingly, IgG\u0026thinsp;+\u0026thinsp;serum exhibited neuroprotective effects against subsequent Zika virus exposure, restoring NOTCH-1 and HES-1 expression levels to normal. HEY-1 expression remained unaffected by Zika virus exposure but decreased with IgG\u0026thinsp;+\u0026thinsp;serum. Surprisingly, levels of the anti-inflammatory markers GCSF and IL-10 showed no significant changes.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThese findings highlight the complex interplay between ZIKV infection, immune response, and neurodevelopmental processes. Further research is necessary to elucidate the precise mechanisms underlying these observations and explore potential therapeutic interventions.\u003c/p\u003e","manuscriptTitle":"Influence of IgG+ serum on Zika Virus infection response in a model of neural precursor cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-26 13:46:32","doi":"10.21203/rs.3.rs-4277717/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"702921ac-5d1f-41a7-af33-fc009ec1145e","owner":[],"postedDate":"April 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-09T08:39:07+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-26 13:46:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4277717","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4277717","identity":"rs-4277717","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}