The Effect of Toothpaste Mix Extract on... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/14-466" }, "headline": "The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis...", "datePublished": "2025-04-28T11:33:02", "dateModified": "2025-04-28T11:33:02", "author": [ { "@type": "Person", "name": "Euis Reni Yuslianti" }, { "@type": "Person", "name": "Agus Susanto" }, { "@type": "Person", "name": "Afifah Bambang Sutjiatmo" }, { "@type": "Person", "name": "Wahyu Widowati" }, { "@type": "Person", "name": "Vini Ayuni" }, { "@type": "Person", "name": "Dhanar Septyawan Hadiprasetyo" }, { "@type": "Person", "name": "Erick Khristian" }, { "@type": "Person", "name": "Widya Irsyad" }, { "@type": "Person", "name": "Naura K Michelle Zefanya" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Abstract* Background Gingivitis is an inflammation of the gums caused by the buildup of bacterial plaque along the gum line. It can be reduced and prevented by regularly brushing your teeth with a good quality toothpaste. Recently, toothpaste made from natural ingredients has been developed which tends to be popular because it has minimal side effects and a pleasant odor. The aim of this study was to evaluate the herbal toothpaste mix in gingivitis model rats. Methods The product profile of toothpaste mix extracts (TPME) was carried out with organoleptic tests that pay attention to odor, color, taste and texture. in vivo testing was carried out on a sample of 30 Wistar rats modeling gingivitis with tooth brushing treatment twice a day for 7 days in the negative control group (base toothpaste), positive control (commercial toothpaste), toothpaste mix extract (TPME). Profiles of fibroblasts, collagen, angiogenesis counts, monocyte cell counts, polynuclear cell counts were observed by Haematoxylin-eosin staining (HE) and Masson Trichome (MT) staining, with immunohistochemical (IHC) markers CD163 and CD86. Proinflammatory gene expression was also observed in Interleukin-1 Beta (IL-1β) and Interleukin-6 (IL-6) genes. Results TPME had a positive response to odor, color, taste and texture characters. Histological observations on days 0, 1, 3, 5 and 7 showed the most significant results on day 7 with an increase in the number of collagen, fibroblasts, angiogenesis, and M2 on CD163 which was in line with the decrease in the number of polynuclear cells, monocytes, M1 on CD86, expression of pro-inflammatory genes IL-1β, and IL-6 which were significantly different from other treatments (p<0.050). Conclusion TPME is able to become a toothpaste product that can treat gingivitis with twice daily application which has the potential to be a promising product to be applied in the future. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/14-466", "name": "The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory..." } } ] } Home Browse The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Reni Yuslianti E, Susanto A, Bambang Sutjiatmo A et al. The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.12688/f1000research.163399.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] Euis Reni Yuslianti https://orcid.org/0000-0002-9320-2917 1 , Agus Susanto 2 , Afifah Bambang Sutjiatmo 3 , [...] Wahyu Widowati https://orcid.org/0000-0002-5401-7794 4 , Vini Ayuni 5 , Dhanar Septyawan Hadiprasetyo 3,5 , Erick Khristian 6 , Widya Irsyad 1 , Naura K Michelle Zefanya 1 Euis Reni Yuslianti https://orcid.org/0000-0002-9320-2917 1 , Agus Susanto 2 , [...] Afifah Bambang Sutjiatmo 3 , Wahyu Widowati https://orcid.org/0000-0002-5401-7794 4 , Vini Ayuni 5 , Dhanar Septyawan Hadiprasetyo 3,5 , Erick Khristian 6 , Widya Irsyad 1 , Naura K Michelle Zefanya 1 PUBLISHED 28 Apr 2025 Author details Author details 1 Faculty of Dentistry, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia 2 Faculty of Dentistry, Padjadjaran University, Sumedang, West Java, 45363, Indonesia 3 Faculty of Pharmacy, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia 4 Faculty of Medicine, Maranatha Christian University, Bandung, West Java, 40164, Indonesia 5 Biomolecular and Biomedicine Research Center, Aretha Medika Utama, Bandung, West Java, 40163, Indonesia 6 Faculty of Health Science and Technology, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia Euis Reni Yuslianti Roles: Conceptualization, Data Curation, Funding Acquisition, Investigation, Project Administration, Resources, Supervision, Validation, Writing – Review & Editing Agus Susanto Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Project Administration, Supervision Afifah Bambang Sutjiatmo Roles: Formal Analysis, Funding Acquisition, Investigation, Project Administration, Visualization Wahyu Widowati Roles: Data Curation, Formal Analysis, Funding Acquisition, Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing Vini Ayuni Roles: Formal Analysis, Software, Visualization, Writing – Original Draft Preparation Dhanar Septyawan Hadiprasetyo Roles: Resources, Software, Validation, Writing – Original Draft Preparation Erick Khristian Roles: Data Curation, Formal Analysis, Methodology, Project Administration, Software, Supervision, Validation, Visualization Widya Irsyad Roles: Resources, Validation, Visualization, Writing – Original Draft Preparation Naura K Michelle Zefanya Roles: Resources, Software, Visualization, Writing – Original Draft Preparation OPEN PEER REVIEW DETAILS REVIEWER STATUS Abstract Abstract* Background Gingivitis is an inflammation of the gums caused by the buildup of bacterial plaque along the gum line. It can be reduced and prevented by regularly brushing your teeth with a good quality toothpaste. Recently, toothpaste made from natural ingredients has been developed which tends to be popular because it has minimal side effects and a pleasant odor. The aim of this study was to evaluate the herbal toothpaste mix in gingivitis model rats. Methods The product profile of toothpaste mix extracts (TPME) was carried out with organoleptic tests that pay attention to odor, color, taste and texture. in vivo testing was carried out on a sample of 30 Wistar rats modeling gingivitis with tooth brushing treatment twice a day for 7 days in the negative control group (base toothpaste), positive control (commercial toothpaste), toothpaste mix extract (TPME). Profiles of fibroblasts, collagen, angiogenesis counts, monocyte cell counts, polynuclear cell counts were observed by Haematoxylin-eosin staining (HE) and Masson Trichome (MT) staining, with immunohistochemical (IHC) markers CD163 and CD86. Proinflammatory gene expression was also observed in Interleukin-1 Beta (IL-1β) and Interleukin-6 (IL-6) genes. Results TPME had a positive response to odor, color, taste and texture characters. Histological observations on days 0, 1, 3, 5 and 7 showed the most significant results on day 7 with an increase in the number of collagen, fibroblasts, angiogenesis, and M2 on CD163 which was in line with the decrease in the number of polynuclear cells, monocytes, M1 on CD86, expression of pro-inflammatory genes IL-1β, and IL-6 which were significantly different from other treatments (p<0.050). Conclusion TPME is able to become a toothpaste product that can treat gingivitis with twice daily application which has the potential to be a promising product to be applied in the future. READ ALL READ LESS Keywords Antibacterial, anti-inflammatory, dental care, herbal mix, gingivitis, plaque, toothpaste Corresponding Author(s) Euis Reni Yuslianti ( [email protected] ) Close Corresponding author: Euis Reni Yuslianti Competing interests: No competing interests were disclosed. Grant information: Ministry of Education, Culture, Research, and Technology of Indonesia for funding this study under grant number (106/E5/PG.02.00.PL/2024, dated on 30 May 2024). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Reni Yuslianti E et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. How to cite: Reni Yuslianti E, Susanto A, Bambang Sutjiatmo A et al. The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.12688/f1000research.163399.1 ) First published: 28 Apr 2025, 14 :466 ( https://doi.org/10.12688/f1000research.163399.1 ) Latest published: 28 Apr 2025, 14 :466 ( https://doi.org/10.12688/f1000research.163399.1 ) Introduction Gingivitis is a common and mild form of periodontal disease characterized by inflammation of the gum tissues, primarily caused by plaque buildup. The onset of gingivitis is often characterized by symptoms such as bleeding gums, which can occur with minimal stimulation. This bleeding is an important indicator of gingival inflammation and an early warning sign of potential periodontal disease. 1 – 3 Untreated gingivitis can progress to periodontitis, a more severe form of gum disease that can lead to tooth loss and has been linked to systemic conditions such as cardiovascular disease and diabetes. 4 , 5 In terms of its epidemiology, gingivitis affects most people. Studies show overall prevalence rates ranging from 90% to more than 95% in different populations, with the highest prevalence of inflammation in adults due to unhealthy lifestyles. 6 In certain age groups, especially in adolescents aged 12-15 years, studies report gingivitis prevalence rates between 29.6% and 47.3%. A recent survey found that 47.3% of school-aged children had plaque-induced gingivitis. 7 The main etiologic factor of gingivitis is the presence of bacterial plaque, which causes the inflammatory response seen in the gingival tissue. 8 , 9 Studies show that certain bacterial species, particularly those belonging to the Streptococcus and Porphyromonas genera, are significantly associated with gingival inflammation. For example, the attachment and coagulation of Streptococcus species on tooth surfaces facilitates the formation of complex microbial communities that can lead to increased inflammation. 10 The presence of these bacteria not only contributes to plaque formation, but also enhances the inflammatory response through the production of virulence factors that exacerbate tissue damage. 11 The presence of bacterial interactions that cause gingivitis promotes the expression of pro-inflammatory genes such as IL-1β and IL-6. IL-1β is a key cytokine involved in the inflammatory response associated with gingivitis. IL-1β is produced by various cell types, including macrophages and gingival fibroblasts, in response to bacterial stimuli. The presence of pathogenic bacteria, such as Porphyromonas gingivalis , triggers the release of IL-1β, which in turn promotes inflammation and tissue damage. 12 , 13 Studies show that IL-6 levels are significantly elevated in the gum tissue of patients with gingivitis, indicating its role in the inflammatory process. 14 , 15 Bacterial components, such as lipopolysaccharide (LPS) from gram-negative bacteria, can activate Toll-like receptors (TLRs) on host cells, leading to the production of IL-1β and IL-6. 16 , 17 Activation of these TLRs is important for initiating the inflammatory response, as it increases the expression of these cytokines, thereby strengthening the immune response to bacterial challenge. The inflammatory phase in wound healing is characterized by the presence of pro-inflammatory cytokines, including IL-1β and IL-6. Although these cytokines are essential for initiating the healing response, their prolonged expression can lead to chronic inflammation, which inhibits the transition to the proliferative phase of healing. 18 Decreased levels of IL-1β and IL-6 can facilitate the resolution of inflammation, allowing the transition to the repair phase, which is characterized by increased fibroblast activity, collagen deposition, and angiogenesis. 19 This transition is critical for effective wound healing in gingivitis, as it promotes tissue regeneration and restoration of gum architecture. Factors such as poor oral hygiene and certain habits such as mouth breathing contribute to the incidence of gingivitis. 20 , 21 The main pillar of gingivitis prevention is maintaining optimal oral hygiene. Regular brushing with fluoride-containing toothpaste is essential, as it helps to remove plaque and prevent its buildup. Studies show that a combination of tooth brushing and interdental cleaning, such as using dental floss or an interdental brush, significantly reduces plaque levels and, consequently, the incidence of gingivitis. 22 , 23 It is recommended that individuals brush their teeth at least twice a day and incorporate interdental cleaning into their daily routine to maximize oral health. 24 Research shows that toothpastes containing certain active ingredients, such as herbal extracts or antimicrobial agents, can effectively reduce gum inflammation. For example, a randomized clinical trial found that toothpaste containing Miswak extract significantly reduced both the level of gum inflammation and the amount of plaque after three weeks of use. 25 Similarly, another study showed that herbal toothpastes, such as those containing neem leaf extract, were effective in reducing plaque index (PI) and gum bleeding index (PBI), indicating their potential as an alternative to conventional toothpastes. 26 Several studies have compared the effectiveness of herbal and non-herbal toothpastes in managing gingivitis. For example, a clinical study found that both herbal and non-herbal toothpastes were effective in controlling plaque and gingivitis, with some herbal formulations showing comparable effectiveness to traditional fluoride toothpastes. 27 , 28 This suggests that toothpaste selection may influence the effectiveness of brushing in reducing gum inflammation. This toothpaste is formulated from multiple extracts such as ginger, black cumin, royal jelly, and cinnamon. 29 – 33 The synergistic effects of these herbal ingredients in toothpaste formulations have been explored in various studies. For example, the combination of multiple herbal extract has shown stronger antibacterial and anti-inflammatory effects, making it a promising candidate for improving oral health. 34 Toothpaste formulations containing these herbal ingredients not only target plaque and gingivitis reduction, but also support overall gum health through their combined properties. Toothpaste with single extracts has been widely reported, while toothpaste with multi-extracts is still limited, so this study aims to evaluate mixed extract toothpaste in reducing gingivitis in animal models of gingivitis by observing gene expression of IL-1β, IL-6, and histopathology of gingival tissue in inflammation-related cells (monocytes and polynuclears), angiogenesis, fibroblasts as well as immunohistochemical markers CD86 and CD163. Methods Organoleptic test of toothpaste mix extract (TPME) TPME is carried out organoleptic test on 34 respondents with observing parameters through aroma, color, taste and texture. Respondents' assessments will be carried out descriptive statistical tests and classical assumptions on the parameters tested. Animal models This study is an experimental study with a randomized control trial research design using 30 Wistar rats calculated by the previous Federer formula. The rats selected were male white rats of the Wistar strain, weighing 150-250 grams, aged 6-8 weeks and in a healthy condition characterized by active movement, responding well when shocked, no anatomical abnormalities, and no hair loss. Rats that experienced weight loss, illness and death during acclimatization were not included in this study. This study has received ethical approval from the Health Research Ethics Committee of the Faculty of Medicine, Maranatha Christian University with number 007/KEP/H/2024. The use of experimental animals in this study takes into account three main points of interest in the use of animals, namely (Replacment), the determination of restrictions on the number of animals used (Reduction), and the treatment of test animals that correctly or ethically fulfill the concept of experimental animals that avoid pain (Refinement). In accordance with ethical guidelines, all efforts were made to minimize animal suffering during the course of this experiment. The study was conducted with the approval of the relevant animal ethics committee, and all procedures were carried out under the supervision of qualified personnel. Efforts to ameliorate suffering included the use of appropriate anesthesia and analgesia, as well as close monitoring of animal well-being throughout the study. Additionally, humane endpoints were established, and animals were observed for signs of distress or discomfort, with timely interventions taken when necessary. Gingivitis induction and test groups Before entering animal testing, a total of 30 rats were acclimatized for a week in Individual Ventilated Cages (IVC) measuring 30.5 x 20.5 x 15.5 cm with a 2 cm high sawdust mat, which was replaced every 2-3 days. These test animals were housed in a 12-hour light/12-hour dark cycle, room temperature of 22 ± 2°C, and humidity level of 50 ± 10% with regular feed and water ad libitum during acclimatization. After acclimatisation, the rats were injected intraperitoneally with a mixture of ketamine and xylazine 0.5 mg/ml body weight and ligated with a silk ligature. Rats that are already non-basic, given an injection in the gingival tissue of rats as much as 0.5 mg/ml with P. gingivalis and Streptococcus mutans bacteria until gingivitis occurs for 6 days of observation. after the occurrence of gingivitis, the teeth of the test animal subjects will be brushed routinely every 2x a day with various toothpastes as treatment. The treatment in this study was divided into 3 groups, namely the negative control group (NC) which was rubbed with base toothpaste, the positive control group (PC) was rubbed with commercial toothpaste (Pepsodent mint), and toothpaste mix extract (TPME) was rubbed with toothpaste formulated with a mixture of herbs containing various active compounds. The treatment was carried out for 7 consecutive days. The Wistar rats were terminated on days 0, 1, 3, 5 and 7. Termination was performed using CO 2 gas. Rats are placed in a box that will be filled with CO 2 . Gradually CO 2 will be filled into the box from 30% to 70% of the chamber volume/minute. The CO 2 flow was maintained for at least 1 minute to provide an unconscious effect on the test animals. The gingival tissues were collected with fisologic solution for RT-PCR and 50 mL 10% neutral formalin buffer (Sigma Aldrich, HT501128) for haematoxylin eosin (HE), Masson trichome (MT) and IHC. Histopathologic examination of gingival tissue with Haematoxylin Eosin (HE) and Masson Trichome (MT) The tissues were fixed in 10% neutral buffered formalin (NBF) solution for 24 hours, then use a solution consisting of 70% alcohol, 80% alcohol, 90% alcohol, anhydrous alcohol, toluene, and paraffin wax for dehydration and classification, gradually over a day. The tissue is sealed with an embedding device filled with liquid paraffin and then refrigerated. Use a microtome with a thickness of ±4-5 microns to slice the cold block. The sections were stained with hematoxylin and eosin (H&E) (BIOSCIENCE, 786-1263) with a volume used of 200-250 mL to fill the slot of the staining rack container for histopathological analysis. The number of new blood vessels formed was counted manually under a binocular microscope with 40x magnification from 5 LPB (large field of view) preparations. The inflammatory reaction was observed through counting the distribution of inflammatory cells such as eosinfils, monocytes, neutrophils, lymphocytes under a binocular microscope with 100x magnification of 5 LPB (large field of view) preparations. 35 The Masson Trichome (MT) staining procedure starts with HE results followed by rinsing using distilled water. all reagents used follow the volume of the staining rack container slot of about 200-250 mL. Next, the tissue was stained with Bieblich Scarlet Acid Fuchsin solution (Sigma-Aldrich, HT151) for 10-15 minutes, rinsed again with distilled water. After that, the tissue was stained with phosphomolybdenum-phosphotungstic acid solution (Sigma Aldrich, HT152) for 10-15 minutes, followed by staining using aniline blue solution (Sigma Aldrich, B8563) for 5-10 minutes. The process ended with immersion in 1% acetic acid (Merck, 1000630510) and 95% absolute ethanol (Merck, 1070174000). MT and HE results were examined under a microscope (Primo Star 3, Zeiss). ImageJ software was used to assess fibroblasts, Mononuclear cells, Polymorphonuclear leukocytes, and angiogenesis, and collagen. 35 Immunohistochemistry with CD86 and CD163 markers Sample preparation was performed in the same way as the HE method. After rehydration, tissues were incubated with Normal Goat Blocking Buffer (Elabscience, PA6146) for 30 minutes. Samples were then stained with polyclonal antibodies for CD163 (Elabscience, E-AB-70306) and CD86 (Elabscience, E-AB-52526). To visualize the target proteins, samples were incubated with DAB substrate (Elabscience, E-IR-R217D; E-IR-R217E) for 15 seconds in a dark room. Five different areas on each slide were taken as a representation of the overall results. ImageJ software was used to semi-quantify the index of positive cells on IHC slides, which is represented as the percentage of positive area relative to the total area. 36 , 37 Quantification of gingival tissue on IL-1β and IL-6 gene expression by qRTPCR Total gingival tissue in rats was minced and following the instructions provided by the manufacturer, tissue RNA was extracted and purified from each mouse test group using the Direct-zol RNA Miniprep Plus Kit (Zymo, R2073). iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad, 170-8841) was used to perform complementary DNA synthesis. To quantitatively assess gene expression, we used the Agilent AriaMx 3000 real-time PCR method. 38 The qPCR reaction mixture used was Evagreen Master Mix (Bio-Rad, 1725200). Spectrophotometric measurements of RNA concentration and purity at 260/280 nm are shown in Table 1 , and primer sequences (Macrogen) are shown in Table 2 . Table 1. Primary identity. Gene Sekuens Primer (5' - 3') Product Length (bp) Annealing Temperature (°C) Reference IL-6 ( Rattus norvegicus ) F: TGATGGATGCTTCCAAACTG 230 53 >NM_012589.2 R: GAGCATTGGAAGTTGGGGTA IL-1β ( Rattus norvegicus ) F: CAACCAACAAGTGATATT 116 55 >NM_031512.2 R: CTTTCATTACACAGGACAGG b-actin ( Rattus norvegicus ) F: TCTACAATGAGCTGCGTGTG 190 58 >NM_031144.3 R: ATCACAATGCCAGTGGTACG Table 2. RNA purity and concentration in all treatments day 0 to day 7. Sample Days Concentration (ng/μl) Purity (λ260/λ280 nm) NC 0 39.6400 2.0635 1 12.6800 2.0725 3 25.1200 2.1184 5 70.5600 2.0779 7 26.4400 2.3498 PC 0 27.8000 2.0904 1 58.3600 1.9876 3 40.7600 1.9681 5 10.3200 1.4583 7 35.2000 1.8977 TPME 0 65.3600 1.7439 1 26.9600 2.2543 3 28.1600 2.1958 5 10.1600 2.0664 7 28.8800 1.9917 NC: Negative Control (Gingivitis rats + toothpaste base 2x/day), PC: Positive Control (Gingivitis rats + commercial toothpaste 2x/day), TPME (Gingivitis rats + toothpaste mix extract 2x/day). Data analysis Samples were tested in three replicates and analyzed using Statistical Package for Social Sciences software (IBM®, version 20.0). Statistical analysis used Kruskal Wallis (non-parametric ANOVA) and post hoc with p-value <0.05 on quantitative data including membrane thickness, number of new blood vessels, and number of inflammatory cells distribution. Results Quality of TPME based on organoleptic test results Based on Table 3 , there are 34 samples of TPME organoleptic results data. The mean value for the color indicator is 3.58, indicating that the average respondent agrees that TPME has a slightly brownish color close to white which is quite close to commercial toothpaste. Table 3. Descriptive analysis result of TPME. Organoleptic test Mean±Standar Deviasi Colors 3.59 ± 1.54 Taste 1.91 ± 0.29 Scent 2.03 ± 0.63 Texture 2.50 ± 0.56 Based on Table 4 , frequency distribution regarding the color of TPME, respondents had various responses to the color aspect of this product. A total of 7 people (20.6%) rated the color of the toothpaste as brown, while 1 person (2.9%) stated a light brown color. A total of 4 people (11.8%) chose a slightly brownish color. The most common responses were white, which was chosen by 9 people (26.5%), and cream color, which was the most dominant choice with 13 people (38.2%). Overall, the majority of respondents (38.2%) rated this toothpaste as cream-colored, followed by respondents who rated it as white (26.5%). Meanwhile, the rest were divided between brown, slightly brownish, and light brown colors. These results show that polyherbal toothpastes have a fairly wide variation in color perception among users, with cream and white being the most widely recognized choices. Table 4. Results of color frequency analysis of TPME. Color Frequency Percent valid (%) Color 7 20.6 Brown 1 2.9 Light brown 4 11.8 Slightly brownish 9 26.5 White 13 38.2 Total 34 100.0 Based on Table 5 , it can be concluded that respondents who liked the taste of TPME were 31 respondents or 91.2%. While respondents who disliked it were only 3 or 8.8%. The results of the frequency distribution related to the aroma or odor of TPME show that the majority of respondents gave positive responses. A total of 6 people (17.6%) stated that they did not like the aroma of the product, indicating that respondents were less satisfied with the aroma aspect. However, the majority, namely 21 people (61.8%), stated that they liked the aroma of this toothpaste, indicating that the majority of users found the aroma of this product quite pleasant. In addition, there were 7 people (20.6%) who responded that they really liked it, which represents the group with the most positive response to this product. Overall, it was more dominated by respondents who stated that they liked or really liked the aroma of TPME. Table 5. Results of frequencies analysis of flavor and aroma liking of TPME. Frequency Percent valid (%) Toothpaste flavors Like 3 8.8 Dislike 31 91.2 Scent Dislike 6 17.6 Like 21 61.8 Like very much 7 20.6 Total 34 100 Based on the frequency distribution table in Table 6 , regarding the texture of toothpaste, it can be interpreted that respondents gave three types of responses regarding the texture of the product. A total of 15 people (44.1%) stated that the texture of this toothpaste was quite hard, indicating that almost half of the respondents felt the hardness in the product. On the other hand, 18 people (52.9%) stated that the texture of this toothpaste was soft, which means that more than half of the respondents felt that this product had a smoother and softer texture. Only 1 respondent said the texture of the toothpaste was hard. Table 6. Texture frequencies analysis results from TPME. Frequency Percent valid (%) Hard 1 2.9 Hard enough 15 44.1 Soft 18 52.9 Total 34 100 Histopathology of gingival tissue fibroblasts in rat gingival model by HE method In the observation of the analysis of the number of fibroblasts attached in Figure 1A-C , the number of fibroblasts increased from D-0 to D-5, with a significant increase. After D-5, there was a slight decrease at D-7. This suggests that fibroblast proliferation occurs up to D-5, then followed by stabilization or a slight decrease in cell number. A similar pattern to NC was seen in the PC group, with an increase in fibroblast numbers from D-0 to D-5 and a slight decrease at D-7. However, in general, the number of fibroblasts in PC tended to be higher than NC (p<0.050). Interestingly, the TPME group ( Figure 1C ) showed the highest number of fibroblasts compared to the other two groups, especially at D-5 and D-7. A significant increase was seen from D-1 and continued until D-7. This suggests that TPME is highly effective in stimulating fibroblast proliferation, which is a key cell in the synthesis of collagen and other extracellular matrices. Fibroblast densities are visualized in figure Table 7a-o . Figure 1. Histopathology of fibroblast counts in gingival tissue in gingivitis model rats. A) Negative control (NC); B) Positive control (PC); C) Totthpaste mix extract (TPME). Data are presented as mean ± standard deviation. For each treatment, the test was performed in five repetitions. NC: Negative Control (Gingivitis rats + toothpaste base 2x/day), PC: Positive Control (Gingivitis rats + commercial toothpaste 2x/day), TPME (Gingivitis rats + toothpaste mix extract 2x/day). Different superscripts (a,b), (a,b), and (a,ab,cd,c) mark significant differences between treatment groups (p<0.05, Tukey HSD test). Table 7. Histological Observation of Gingival Tissue in NC, PC, and TPME Groups (Day 0-7). Treatment Day-0 Day-1 Day-3 Day-5 Day-7 NC PC TPME All groups were observed for the number of polymorphonuclear cells and monocytes. Based on the results shown in Figure 2 , all treatments demonstrated an increase in the number of polymorphonuclear cells and monocytes, indicating an early acute inflammatory response to the toothpaste application on Day 1. The TPME group exhibited a more moderate increase compared to the PC group for both cell types, although still higher than the NC group. Angiogenesis also began to increase in all groups ( Figure 2C ). On Day 3, entering the Inflammatory and Modulation phase, differences between the groups became more apparent. In the PC group, the number of monocytes peaked, indicating a more prolonged inflammation. In contrast, in the TPME group ( Figures 2A and 2B ), both polymorphonuclear cells and monocytes decreased drastically, indicating effective modulation of the inflammatory response. Angiogenesis in the TPME group peaked on Day 3, suggesting that TPME promotes the formation of new blood vessels earlier than the other groups. In the NC group, the number of inflammatory cells began to decrease, and angiogenesis peaked, indicating a controlled response. On Days 5 and 7, the TPME group showed lower numbers of polymorphonuclear cells and monocytes compared to the NC group, indicating that TPME not only suppresses inflammation but also facilitates the resolution of inflammation and/or tissue healing. The PC group still exhibited higher numbers of inflammatory cells compared to the other groups. Angiogenesis in the TPME group started to decline after peaking, while in the PC group, angiogenesis only peaked on Day 5, indicating a delay in the healing process. On Day 7, all groups showed a decrease in angiogenesis. The TPME treatment demonstrated a more rapid increase in angiogenesis with a gradual decrease in monocytes and polymorphonuclear cells, suggesting that TPME has the potential to be a competitive toothpaste, possibly outperforming other commercial products. Figure 2. The average monocyte, polymorphonuclear, and angiogenesis cell counts in gingivitis model rats. Data are presented as mean. For each treatment, the test was performed in five repetitions. NC: Negative Control (Gingivitis rats + toothpaste base 2x/day), PC: Positive Control (Gingivitis rats + commercial toothpaste 2x/day), TPME (Gingivitis rats + toothpaste mix extract 2x/day). Histopathology of gingival tissue collagen density in rat gingival model by MT method The increase in collagen density also gradually increased from D-0 to D-7 as attached in the Figure 3A-C . A significant increase was seen from D-1 and continued until D-5, with a slight increase again at D-7.This indicates a normal and gradual process of tissue repair. In the PC group, the pattern of collagen density increase was similar to NC, but with a slightly higher increase at some time points, especially at D-5.This indicates that the PC treatment also supports collagen formation, although perhaps by a different mechanism than NC (p<0.050). The TPME group showed the most significant increase in collagen density compared to the other two groups, especially at D-5 and D-7. Collagen densities are visualized in the Figure 3 and figure Table 8 thus indicating that TPME is highly effective in promoting collagen synthesis and deposition, which is important for gingival tissue healing and regeneration. This suggests that TPME is highly effective in stimulating collagen proliferation, which is a key cell in the synthesis of collagen and other extracellular matrices. Figure 3. Histopathology of Collagen density in gingival tissue in gingivitis model rats. A) Negative control (NC); B) Positive control (PC); C) Toothpaste mix extract (TPME). Data are presented as mean ± standard deviation. For each treatment, the test was performed in five repetitions. NC: Negative Control (Gingivitis rats + toothpaste base 2x/day), PC: Positive Control (Gingivitis rats + commercial toothpaste 2x/day), TPME (Gingivitis rats + toothpaste mix extract 2x/day). Different superscripts (a,b,bc,c), (a,b,bc,cd,d), dan (a,b,bc,c,d) mark significant differences between treatment groups (p<0.05, Tukey HSD test). Table 8. Collagen Density in NC, PC, and TPME Groups (Day 0-7) by Masson Trichrome Staining. Treatment Day-0 Day-1 Day-3 Day-5 Day-7 NC PC TPME Immunohistochemistry of gingival tissue marker CD86 during the processes of homeostasis, inflammation, proliferation, remodelling, recovery Based on the IHC analysis of the CD86 marker in figure Table 9 , it can be seen that the toothpaste mix extract (TPME) showed potential in modulating the immune response in the rat gingivitis model. Although an increase in antigen presenting cell (APC) activation was seen at the start of treatment, TPME then effectively suppressed such activation, as shown by the significant M1 decrease in CD86 expression ( Figure 4 ). These findings support the potential of TPME as an anti-inflammatory and immunomodulatory agent in the treatment of gingivitis. Table 9. IHC Observation of CD86 Marker in NC, PC, and TPME Groups (Days 0-7). Treatment Day-0 Day-1 Day-3 Day-5 Day-7 NC PC TPME Figure 4. Differences in the mean number of CD86 and CD163 marker expressions after administration of TPME. Immunohistochemistry of gingival tissue marker CD163 during the processes of homeostasis, inflammation, proliferation, remodelling, recovery In the TPME group at D0, CD163 expression was similar to NC (Figure Table 10 ). However, there was a more rapid and significant increase compared to PC, especially at D3 and D5, and remained high until D7. This suggests that TPME accelerates macrophage polarisation to the M2 ( Figure 4 ) phenotype and increases their activity in inflammation resolution and tissue repair. The sustained increase until D7 indicates a longer effect of TPME in promoting healing. Table 10. IHC Observation of CD163 Marker in NC, PC, and TPME Groups (Days 0-7). Treatment Day-0 Day-1 Day-3 Day-5 Day-7 NC PC TPME IL-1β and IL-6 gene expression towards TPME Based on the results of the analysis of pro-inflammatory gene expression, specifically IL-1β and IL-6, observations were made through qRT-PCR ( Figures 5 and 6 ). On day 0 and day 1, no significant differences were observed in the reduction of IL-1β ( Figure 5 and Table 11 ) or IL-6 ( Figure 6 and Table 12 ) gene expression across all treatments. However, by day 3, all treatments began to show a decrease in IL-1β and IL-6 gene expression. On days 5 and 7, there was a more pronounced and statistically significant reduction in IL-1β and IL-6 gene expression (p<0.050), with TPME treatment showing the most significant decrease compared to other treatments. These findings suggest that TPME. Figure 5. Effect of TPME on IL-1β Expression in Gingival Tissue of Gingivitis Rats. Negative control (NC), Positive control (NC), and toothpaste mixed extract group (TPME). Data presented as mean ± Standard Deviation with three repetitions. Small superscript letters (a) indicate significance between treatments on the same day and large superscript letter differences (A, AB, B, C) indicate significance between days of observation in one treatment group based on Tukey test (p<0.050). Table 11. IL-1β expression in various treatments and observation days. Treatment NC PC TPME Day 0 6.51 ± 1.29 aA 6.32 ± 1.23 aA 6.44 ± 0.54 aA Day 1 6.57 ± 0.75 aA 6.12 ± 0.82 aAB 6.19 ± 0.41 aA Day 3 5.07 ± 0.63 aB 4.22 ± 0.81 aB 4.00 ± 0.71 aB Day 5 1.00 ± 0.11 aB 0.89 ± 0.08 aC 0.82 ± 0.15 aC Day 7 0.97 ± 0.07 aB 0.82 ± 0.11 aC 0.75 ± 0.09 aC Figure 6. Effect of TPME on IL-6 Expression in Gingival Tissue of Gingivitis Rats. Negative control (NC), Positive control (NC), and toothpaste mixed extract group (TPME). Data presented as mean ± Standard Deviation with three repetitions. Small superscript letters (a) indicate significance between treatments on the same day and large superscript letter differences (A, AB, B, C) indicate significance between days of observation in one treatment group based on Tukey test (p<0.050). Table 12. IL-6 expression in various treatments and observation days. Treatment NC PC TPME Day 0 4.88 ± 0.65 aA 4.82 ± 0.12 aA 4.86 ± 0.75 aA Day 1 4.73 ± 0.33 aA 4.33 ± 0.37 aA 4.28 ± 1.04 aA Day 3 4.62 ± 0.91 aAB 3.11 ± 0.34 aB 3.32 ± 0.37 aB Day 5 1.00 ± 0.11 aB 0.94 ± 0.16 aC 0.94 ± 0.16 aC Day 7 0.82 ± 0.05 aB 0.78 ± 0.07 aC 0.71 ± 0.11 aC Discussion Gingivitis is a common periodontal disease characterized by gingival inflammation caused by the accumulation of plaque containing pathogenic microorganisms. Oral hygiene practices, such as brushing and flossing, are important but sometimes insufficient to control microorganisms, making adjunctive therapies, such as herbal remedies, of interest. 39 , 40 Herbal formulations, such as toothpastes and mouthwashes, provide antibacterial, anti-inflammatory, and antioxidant effects. Incorporating herbs into toothpastes has been shown to support gingival health. Herbal tooth gels offer gentle cleansing and therapeutic properties, and show comparable or better efficacy than conventional toothpastes in controlling plaque and gingival inflammation. 40 , 41 The exploration of herbal toothpaste and mouthwash formulations as adjuncts in the management of gingivitis offers a promising avenue for improving oral health that promotes a more holistic approach to periodontal health. The quality evaluation of toothpaste through organoleptic testing in this study was conducted considering it as an important evaluation component to ensure consumer satisfaction and product effectiveness ( Tables 1 - 6 ). Organoleptic evaluation involves sensory analysis based on appearance, color, aroma, taste, and texture, which are important attributes that influence consumer preference and acceptance. 42 , 43 The importance of organoleptic testing can be seen from its role in herbal and conventional toothpaste formulations. Studies have shown that organoleptic properties, such as taste and aroma, strongly influence user experience and preference. 44 , 45 The acceptance of the results related to the organoleptic test of this study is similar to the study conducted by Wardaniati & Indriastuty 44 on herbal toothpaste, which shows that the distinctive aroma and taste of propolis and other herbal extracts are the main factors of consumer acceptance. In this case, the color and taste produced tended to be widely preferred by respondents ( Tables 1 - 6 ). Manhajan et al. 46 also added that the results of this organoleptic test can be a relevant consideration, especially in the development of toothpaste formulations, where sensory attributes can guide the adjustment of concentrations and combinations of ingredients to optimize performance and consumer appeal. The results of histopathological analysis of fibroblast numbers in TPME-treated gingivitis studies provided important insights into the cellular dynamics involved in tissue repair and regeneration. The increase in fibroblast numbers observed from day 0 (D-0) to day 5 (D-5) ( Figure 1 ) indicates a strong proliferative response, which is important for the synthesis of collagen and other extracellular matrix components essential for the healing of gingival tissues affected by inflammation. The slight decrease in fibroblast numbers observed at day 7 (D-7) indicates a stabilization phase after the initial proliferation, which is consistent with the normal tissue remodeling process. 8 , 47 These results also highlight the efficacy of specific, the group treated with herbal toothpaste containing ginger extract (TPME) showed the highest proliferation of fibroblasts, especially at D-5 and D-7. This sustained increase in fibroblast numbers suggests that ginger extract may have unique bioactive properties that promote cell proliferation and support the healing process. 48 The mechanism underlying this effect of ginger extract on fibroblast proliferation may be attributed to its anti-inflammatory and antioxidant properties. Ginger has been shown to inhibit pro-inflammatory cytokines and promote the expression of growth factors that are essential for fibroblast activation and collagen synthesis. 49 , 50 This is in line with previous studies reporting similar findings in periodontal disease models, where herbal extracts showed significant improvements in tissue healing and regeneration. 51 , 52 A significant increase in collagen density was also observed in Figure 2C , particularly from day 1 (D-1) to day 5 (D-5), followed by a slight increase on day 7 (D-7), indicating a normal and gradual process of tissue repair. This pattern is consistent with the physiological response of gingival tissue to inflammation and injury, in which collagen plays an important role in restoring structural integrity. 53 The presence of the most significant collagen density at day 7 in the TPME group compared to the PC group may be attributed to the effect of certain active ingredients, such as thymoquinone in black cumin contained in the toothpaste mix extract, which promotes fibroblast activity and collagen synthesis. 54 These findings suggest that TPME is highly effective in promoting collagen synthesis and deposition, which is essential for gingival tissue healing and regeneration. The increased collagen production in the TPME group may be related to the bioactive compounds contained in the extract combination (such as ginger, black cumin, royal jelly, and cinnamon), which have been shown to stimulate fibroblast proliferation and collagen synthesis. 55 Salehinia et al. 56 also reported that these herbal extracts have anti-inflammatory properties that can reduce the inflammatory response, thus creating a more conducive environment for fibroblast activity and collagen deposition. 56 In addition, the ability of herbal extracts to increase collagen synthesis is in line with findings from another study by Ni et al. 57 that demonstrated the effectiveness of various compounds from plants in promoting tissue repair. For example, ascorbic acid (vitamin C) is known to play an important role in collagen synthesis, and its presence in herbal formulations may further enhance the capacity of fibroblasts to produce collagen. 57 In addition, Khairnar et al. 58 opinion reinforces the finding that modulation of growth factors such as TGF-β by herbal extracts can significantly affect fibroblast behavior and collagen production, thereby contributing to better healing outcomes. 58 The increase in collagen and fibroblasts will influence other characteristic properties of the gingival tissue such as blood vessel formation, PMNs, and monocytes. Treatment groups indicated an initial acute inflammatory response to toothpaste application, which was particularly evident on Day 1. This initial inflammatory response is an important component of the body's defense mechanisms, facilitating the recruitment of immune cells to sites of irritation or injury. 59 This observation hints that although TPME initiates the inflammatory response, this formulation may also have properties that modulate the intensity of this response, potentially creating a more favorable healing environment. 25 As the study progressed to Day 3, differences in inflammatory responses between groups became more apparent. The PC group showed a peak in monocyte counts ( Figure 2A ), indicating a sustained inflammatory response, which can be detrimental if prolonged, as chronic inflammation is associated with tissue damage and delayed healing. 60 In contrast, the TPME group showed a significant decrease in both PMNs and monocytes ( Figures 2A and 2B ), indicating effective modulation of the inflammatory response. These findings are in line with the studies of Coluccia et al. 61 and Vajrabhaya et al. 62 which showed that certain herbal extracts can promote the resolution of inflammation by enhancing the clearance of inflammatory cells and facilitating tissue repair. The peak angiogenesis ( Figure 2C ) observed in the TPME group on Day 3 further supports the idea that this toothpaste formulation not only modulates inflammation, but also promotes the formation of new blood vessels, which are critical for providing nutrients and oxygen to the healing tissue. 63 The ability of TPME to stimulate angiogenesis earlier than the other groups may contribute to a faster healing process, as sufficient blood supply is essential for tissue regeneration. 59 Immunohistochemical observations regarding CD163 and CD86 markers in the gingivitis study provide valuable insights into the inflammatory response and macrophage polarization associated with herbal toothpaste application. all treatments at day 0 showed no significant differences in CD163 or CD86 expression, indicating a lack of modulation in the inflammatory response. This is consistent with previous studies showing minimal changes in macrophage markers in untreated inflammatory conditions. 64 Along with the observations attached in Figure 4 , the most striking changes were observed in the TPME (toothpaste mix extracts) treatment group on day 7, which showed a significant decrease in CD86 and an increase in CD163 expression (p<0.050). Activated M1 macrophages can express CD86, and produce high levels of ROS and proinflammatory cytokines, such as interleukin-1 and interleukin-6 (IL-1, IL-6), TNF- α, and IFN-γ. 65 The positive thing is, on the 5th and 7th days of the study it was found that the average results of M1 macrophages (CD86) tended to be low, this is in accordance with the theory of wound healing that in the late proliferation phase and early remodeling phase there will be a transition of the pro-inflammatory M1 phenotype to anti-inflammatory M2 which will then secrete anti-inflammatory cytokines and growth factors that play a role in the process of tissue repair. 66 , 65 While the average number of M2 macrophages (CD163) in the polyherbal toothpaste treatment group showed a high average number per area compared to the NC group, so it can be seen that the anti-inflammatory content of polyherbal toothpaste is effective in increasing the expression of anti-inflammatory M2 (CD163) macrophages. This finding is in line with previous studies showing that certain herbal extracts can increase macrophage polarization towards a stronger pro-inflammatory state, thus facilitating inflammation resolution. 67 The decrease in CD86 and CD163, which are markers typically associated with anti-inflammatory macrophages, suggests that TPME may be effective in modulating macrophage responses, promoting a more favorable environment for tissue healing. 68 Furthermore, the ability of TPME to significantly alter the expression of these markers highlights its potential as a therapeutic agent in managing gingival inflammation. Previous studies have shown that effective modulation of macrophage activity is essential to promote tissue repair and regeneration, as macrophages play a dual role in initiating inflammation and facilitating healing. 69 The expression analysis of pro-inflammatory genes, particularly IL-1β and IL-6, was observed in this study to determine the inflammatory response associated with herbal toothpaste application. On days 0 and 1, no significant differences in IL-1β ( Table 11 ) or IL-6 ( Table 12 ) gene expression were found between treatments ( Figures 5 and 6 ), indicating that the initial application of the toothpaste did not induce an immediate inflammatory response. This finding is consistent with previous studies showing a delay in cytokine expression after the introduction of inflammatory stimuli. 70 However, by day 3, all treatments began to show a decrease in IL-1β and IL-6 gene expression, indicating that the inflammatory response was modulated over time. The significant decrease in IL-1β and IL-6 in the TPME group compared to the other treatments suggests that TPME containing various herbal extracts has unique anti-inflammatory properties that facilitate resolution of inflammation, which is an important aspect of tissue healing. 71 Furthermore, these results suggest that TPME treatment not only reduces the expression of pro-inflammatory cytokines, but may also improve the overall healing process in gingival tissues. This is supported by research showing that modulation of IL-1β and IL-6 is critical for tissue repair and regeneration, as these cytokines play an important role in mediating the inflammatory response and influencing fibroblast activity. 72 Initially, the presence of PMNs and monocytes indicates an acute inflammatory response, which is important for fighting pathogens and initiating tissue repair. The increase in these inflammatory cells after TPME application suggests that this toothpaste effectively stimulates the immune response, possibly through the action of bioactive compounds present in the plant extract. 73 As observed in previous studies, the recruitment of PMNs and monocytes is essential for the secretion of pro-inflammatory cytokines, such as IL-1β and IL-6, which are known to play a significant role in mediating inflammation and stimulating fibroblast activity. 74 The expression of CD86, a marker associated with M1 macrophage activation, and CD163, associated with M2 macrophage polarization, further illustrates the balance between pro-inflammatory and anti-inflammatory responses. In the context of TPME treatment, the decrease in CD163 and increase in CD86 on day 7 indicate a shift toward a pro-inflammatory phenotype, which is essential for effective pathogen clearance and tissue remodeling. 75 This modulation of macrophage polarization is critical, as M1 macrophages are known to secrete inflammatory cytokines that promote recruitment of additional immune cells, while M2 macrophages are involved in tissue repair and inflammation resolution. 76 The significant reduction in IL-1β and IL-6 gene expression observed in the TPME group suggests that the medicinal plant extract may have anti-inflammatory properties that help downregulate these pro-inflammatory cytokines, thereby facilitating inflammation resolution and supporting healing. 77 These findings are consistent with other studies demonstrating the ability of certain herbal compounds to inhibit the expression of inflammatory cytokines in various cell types, including gingival fibroblasts. 78 Further visualization of the purposed mechanisms causing gingivitis from various gene interactions and pro-inflammatory markers and herbal blend toothpaste as a solution is in Figure 7 . Figure 7. Purposed mechanism of gingivitis with TPME. The mechanism of action of TPME in addressing gingival inflammation involves anti-inflammatory effects, immune modulation, and tissue repair. TPME reduces the levels of pro-inflammatory cytokines IL-1β and IL-6, decreases the number of PMNs and monocytes, indicating inflammation resolution and immune response modulation. Additionally, TPME lowers antibody levels, which could potentially cause tissue damage. On the other hand, TPME enhances fibroblast proliferation and collagen production, supporting tissue repair and healing. This combination of effects makes TPME a potential agent for managing gingival inflammation and accelerating periodontal tissue regeneration. In addition, the increase in fibroblast number and collagen density in response to TPME treatment suggests that modulation of inflammatory cytokines is essential for tissue regeneration. Fibroblasts are responsible for the synthesis of collagen and extracellular matrix components, and their proliferation is often stimulated by pro-inflammatory cytokines such as IL-1β and IL-6. 79 However, excessive levels of these cytokines can lead to tissue damage, highlighting the importance of maintaining a balanced inflammatory response for optimal healing. 80 Overall, the interactions between fibroblasts, collagen, inflammatory cell counts, macrophage markers, and cytokine expression associated with TPME treatment of gingivitis reflect a complex network of immune responses. The ability of TPME to modulate these parameters suggests its potential as an effective therapeutic agent to manage gingival inflammation and promote tissue repair, highlighting the benefits of herbal extracts in periodontal health. Although this study provides significant insight into the effects of herbal toothpaste mix extracts (TPME), there is a need for further validation through human studies or animal models that more closely resemble human conditions. The application of TPME twice a day is proven to be able to treat gingivitis which is reflected in an increase in the number of fibroblasts, collagen and angiogenesis, CD163 markers by suppressing the number of PMNs, monocytes, CD86 markers, proinflammatory gene expression IL-1β, and IL-6. So that TPME can be an agent for natural-based toothpaste products that are able to treat gingivitis by brushing your teeth. Ethical considerations The Ethics Commission of the Faculty of Medicine at Maranatha Christian University approved the study procedure through the issuance of ethical clearance number No. 007/KEP//11/2024. Reporting guidelines Zenodo: ‘ARRIVE checklist’ for ‘The effect of toothpaste mix extract on angiogenesis and inflammatory cell response in a Wistar rat gingivitis model: Evaluation of IL-1β, IL-6 gene expression, and immunohistochemical markers CD86 and CD163’. https://doi.org/10.5281/zenodo.15062360 . 81 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Animal ethics This study has received ethical approval from the Health Research Ethics Committee of the Faculty of Medicine, Maranatha Christian University with number 007/KEP/H/2024. The use of experimental animals in this study takes into account three main points of interest in the use of animals, namely (Replacment), the determination of restrictions on the number of animals used (Reduction), and the treatment of test animals that correctly or ethically fulfill the concept of experimental animals that avoid pain (Refinement). In accordance with ethical guidelines, all efforts were made to minimize animal suffering during the course of this experiment. The study was conducted with the approval of the relevant animal ethics committee, and all procedures were carried out under the supervision of qualified personnel. Efforts to ameliorate suffering included the use of appropriate anesthesia and analgesia, as well as close monitoring of animal well-being throughout the study. Additionally, humane endpoints were established, and animals were observed for signs of distress or discomfort, with timely interventions taken when necessary. Ethical approval This study has received ethical approval from the Health Research Ethics Committee of the Faculty of Medicine, Maranatha Christian University with number 007/KEP/H/2024. The use of experimental animals in this study takes into account three main points of interest in the use of animals, namely (Replacment), the determination of restrictions on the number of animals used (Reduction), and the treatment of test animals that correctly or ethically fulfill the concept of experimental animals that avoid pain (Refinement). Data availability Zenodo: Raw Data for: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model [Data set]. Zenodo. https://doi.org/10.5281/zenodo.15062159 . 82 The project contains the following underlying data: • Raw data • Figure files • Table Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). The data that support the findings of this study are available upon reasonable request from the corresponding author. Acknowledgements The authors would like to thank Universitas Jenderal Achmad Yani and Maranatha Christian University for providing laboratory facilities. Thanks also to Aretha Medika Utama for their invaluable help and support during this study. References 1. Weickert L, Miesbach W, Alesci S, et al. : Is gingival bleeding a symptom of patients with type 1 von Willebrand disease? A case–control study. J. Clin. Periodontol. 2014; 41 (8): 766–771. PubMed Abstract | Publisher Full Text 2. Ren X, He J, Cheng R, et al. : The efficacy and safety of oral irrigator on the control of dental plaque and gingivitis: a randomized, single-blind, parallel-group clinical trial. Int. J. Environ. Res. Public Health. 2023; 20 (4): 3726. PubMed Abstract | Publisher Full Text | Free Full Text 3. Costa C, Santiago H, Pereira S, et al. : Oral health status and multiple sclerosis: classic and non-classic manifestations—case report. Diseases. 2022; 10 (3): 62. PubMed Abstract | Publisher Full Text | Free Full Text 4. Komine-Aizawa S, Aizawa S, Hayakawa S: Periodontal diseases and adverse pregnancy outcomes. J. Obstet. Gynaecol. Res. 2018; 45 (1): 5–12. Publisher Full Text 5. Broomhead T, Gibson B, Parkinson C, et al. : Gum health and quality of life—subjective experiences from across the gum health-disease continuum in adults. BMC Oral Health. 2022; 22 (1): 512. PubMed Abstract | Publisher Full Text | Free Full Text 6. Carvajal P, Gómez M, Gomes S, et al. : Prevalence, severity, and risk indicators of gingival inflammation in a multi-center study on South American adults: a cross-sectional study. J. Appl. Oral Sci. 2016; 24 : 524–534. PubMed Abstract | Publisher Full Text | Free Full Text 7. Wang W, Feng X, Tai B, et al. : Epidemiology of plaque-induced gingivitis among 12–15-year-old Chinese schoolchildren: A study based on the 2018 case definition. J. Clin. Periodontol. 2024; 51 (3): 299–308. PubMed Abstract | Publisher Full Text 8. Rahman AF, Sunarintyas S, Martien R, et al. : Gingival inflammation induction in pregnant Sprague-Dawley rats: a pilot study. BIO Web Conf. 2023; 75 : 02003. Publisher Full Text 9. Trombelli L, Farina R, Silva CO, et al. : Plaque-induced gingivitis: case definition and diagnostic considerations. J. Clin. Periodontol. 2018; 45 Suppl 20 (S20): S44–S67. PubMed Abstract | Publisher Full Text 10. Park OJ, Yi HG, Jeon JH, et al. : Pyrosequencing analysis of subgingival microbiota in distinct periodontal conditions. J. Dent. Res. 2015; 94 (7): 921–927. PubMed Abstract | Publisher Full Text 11. Hansson GK, Libby P, Tabas I: Inflammation and plaque vulnerability. J. Intern. Med. 2015; 278 (5): 483–493. PubMed Abstract | Publisher Full Text | Free Full Text 12. Cloître A, Halgand B, Sourice S, et al. : IL-36γ is a pivotal inflammatory player in periodontitis-associated bone loss. Sci. Rep. 2019; 9 (1): 19257. PubMed Abstract | Publisher Full Text | Free Full Text 13. Pani P, Tsilioni I, McGlennen R, et al. : IL-1β (3954) polymorphism and red complex bacteria increase IL-1β (GCF) levels in periodontitis. J. Periodontal. Res. 2021; 56 (3): 501–511. PubMed Abstract | Publisher Full Text | Free Full Text 14. Dede F, Balli U, Durmuşlar M, et al. : Evaluation of IL-32 levels in gingival tissue and serum of experimental periodontitis model. J. Turgut Ozal Med. Center. 2017; 1. Publisher Full Text 15. Yoshida R, Gorjão R, Mayer M, et al. : Inflammatory markers in the saliva of cerebral palsy individuals with gingivitis after periodontal treatment. Braz. Oral Res. 2019; 33 : e033. PubMed Abstract | Publisher Full Text 16. Huang X, Mo Z, Li Y, et al. : LncRNA HOTAIR increases inflammatory responses by activating NF-κB pathway in LPS-induced acute lung injury.2020. Preprint. Publisher Full Text 17. Wardani B, Rahayu S, Rifa’i M.: Effects of bitter melon (Momordica charantia L.) and starfruit (Averrhoa bilimbi L.) on proinflammatory cytokines produced by hyperglycemic mice model. J. Exp. Life Sci. 2020; 10 (2): 89–93. Publisher Full Text 18. Zheng Y, Dong X, Chen S, et al. : Low-level laser therapy prevents medication-related osteonecrosis of the jaw-like lesions via IL-1RA-mediated primary gingival wound healing. BMC Oral Health. 2023; 23 (1): 14. PubMed Abstract | Publisher Full Text | Free Full Text 19. Stolte KN, Pelz C, Yapto CV, et al. : IL-1β strengthens the physical barrier in gingival epithelial cells. Tissue Barriers. 2020; 8 (3): 1804249. PubMed Abstract | Publisher Full Text | Free Full Text 20. Suzuki H, Sugimoto K, Kubota-Miyazawa A, et al. : A survey of oral health status, subjective oral symptoms, and oral health behaviors among first-year dental students at a Japanese university. J. Oral Sci. 2022; 64 (1): 85–90. PubMed Abstract | Publisher Full Text 21. Setyorini D, Budirahardjo R, Handayani FN: The prevalence of gingivitis in school students aged 9–12 years at Biting 01 Elementary School, Arjasa Agroindustrial Region, Jember District. Galore Int. J. Health Sci. Res. 2023; 8 (4): 17–22. Publisher Full Text 22. Liu X, Xu J, Li S, et al. : The prevalence of gingivitis and related risk factors in schoolchildren aged 6–12 years old. BMC Oral Health. 2022; 22 (1): 623. PubMed Abstract | Publisher Full Text | Free Full Text 23. Agrawal A, Sawhney A, Panda S, et al. : Comparison of the efficacy of different oral hygiene aids in maintaining periodontal health in patients with gingivitis. Cureus. 2023; 15 (2): e44391. PubMed Abstract | Publisher Full Text | Free Full Text 24. Murakami S, Mealey BL, Mariotti A, et al. : Dental plaque–induced gingival conditions. J. Clin. Periodontol. 2018; 45 (S20): S28–S34. Publisher Full Text 25. Azaripour A, Mahmoodi B, Habibi E, et al. : Effectiveness of a miswak extract-containing toothpaste on gingival inflammation: a randomized clinical trial. Int. J. Dent. Hyg. 2015; 15 (3): 195–202. PubMed Abstract | Publisher Full Text 26. Sugiarta A, Lessang R: Effect of herbal toothpaste containing neem leaves extract (Azadirachta indica) against gingivitis: a clinical study. Int. J. Appl. Pharm. 2019; 11 (s1): 117–119. Publisher Full Text 27. Garg Y, Chowdhary Z, Garg K, et al. : Evaluation of anti-plaque and anti-gingivitis efficacy of two commercially available herbal and non-herbal toothpastes. Cureus. 2023; 15 (7): e39558. PubMed Abstract | Publisher Full Text | Free Full Text 28. Vezhavendhan N, Nivethaprashanthi S, Kavya R, et al. : Comparing the efficacy of herbal and non-herbal toothpastes in controlling plaque and gingivitis: a review. J. Sci. Dent. 2020; 10 (1): 25–27. Publisher Full Text 29. Jumain MAS, Sunarjo L, Suwondo A, et al. : Effect of giant ginger extract (Zingiber officinale var. Roscoe) as toothpaste ingredients on saliva pH. Int. J. Innov. Sci. Res. Technol. 2022; 7 (2): 64–68. 30. Setiawatie EM, Widiyanti P, Rahayu RP, et al. : Nigella sativa 3% inhibition test of natural toothpaste compared to cetylpyridinium chloride (CPC) toothpaste 0.01-0.1% on Aggregatibacter actinomycetemcomitans. Indonesian J. Trop. Infect. Dis. 2023; 11 (3): 224. Publisher Full Text 31. Otręba M, Marek Ł, Tyczyńska N, et al. : Bee venom, honey, and royal jelly in the treatment of bacterial infections of the oral cavity: a review. Life. 2021; 11 (12): 1311. PubMed Abstract | Publisher Full Text | Free Full Text 32. Puttipan R, Chansakaow S, Khongkhunthian S, et al. : Caesalpinia sappan: A promising natural source of antimicrobial agent for inhibition of cariogenic bacteria. Drug Discov. Ther. 2018; 12 (4): 197–205. PubMed Abstract | Publisher Full Text 33. Fitria KT, Gumilar MS, Handayatun NN, et al. : Evaluation of antibacterial efficacy of Cinnamomum burmanii leaf essential oil in toothpaste formulation against Streptococcus mutans: an experimental study. Proceedings of International Conference Health Polytechnic of Jambi. Jambi, Indonesia: 2023 Nov; pp. 64–68. Publisher Full Text 34. Budi H, Soesilowati P, Wirasti M: Antibacterial activity of sappan wood (Caesalpinia sappan L.) against Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis. Indian J. Public Health Res. Dev. 2020; 11 (2): 1230–1235. Publisher Full Text 35. Yuslianti ER, Ratwita W, Koswara T, et al. : Potential of Rambutan-Honey antioxidants in reducing malondialdehyde levels and regenerating hepatocyte cells in isoniazid-induced rats. J. Profesi. Medika: J. Kedokteran Kesehatan. 2024; 18 (1): 76–83. Publisher Full Text 36. Widowati W, Priyandoko D, Kusuma HSW, et al. : The potency of Camellia sinensis L. to reduce proinflammatory cytokine levels in the acute respiratory distress syndrome rat model. J. Math. Fundam. Sci. 2023; 55 (1): 92–108. Publisher Full Text 37. Widowati W, Faried A, Adam A, et al. : Potential anti-aging activity of secretome gel of human Wharton’s jelly mesenchymal stem cells (hWJ-MSCs) in UV-induced mice models. Iran. J. Basic Med. Sci. 2024; 27 (7): 868–878. PubMed Abstract | Publisher Full Text | Free Full Text 38. Widowati W, Darsono L, Lucianus J, et al. : Butterfly pea flower (Clitoria ternatea L.) extract displayed antidiabetic effect through antioxidant, anti-inflammatory, lower hepatic GSK-3β, and pancreatic glycogen on Diabetes Mellitus and dyslipidemia rat. J. King Saud Univ. Sci. 2023; 35 (4): 102579. Publisher Full Text 39. Gill S, Kapoor D, Singh J, et al. : Comparison of antiplaque efficacy of commercially available Hiora (herbal) mouthwash with Listerine mouthwash: a clinical study. J. Periodontol. Implant Dent. 2017; 9 (2): 53–57. Publisher Full Text 40. Kumari S, Sarankar SK: Herbal tooth gel formulations: a comprehensive review and comparative analysis for contemporary oral health practices. World J. Adv. Res. Rev. 2024; 24 (1): 424–429. Publisher Full Text 41. Gohil D, Patel K, Maheshwari R: Herbal Wisdom of Ayurveda: Remedies for Optimal Oral Health. J. Nat. Remedies. 2024; 1499–1504. Publisher Full Text 42. Podobij OV, Ladonko M: Optimization of the recipe of toothpaste by carrageenan addition. Ukr. J. Food Sci. 2017; 5 (1). Publisher Full Text 43. Sastrawati NA, Jumain J, Arisanty A: Formulation of herbal toothpaste combination of Anna apple peel and kaffir lime peel with variation of sodium lauryl sulfate concentration. Indones. Health J. 2023; 2 (1): 30–37. Publisher Full Text 44. Wardani B, Rahayu S, Rifa’i M: Effects of bitter melon (Momordica charantia L.) and starfruit (Averrhoa bilimbi L.) on proinflammatory cytokines produced by hyperglycemic mice model. J. Exp. Life Sci. 2020; 10 (2): 89–93. Publisher Full Text 45. Feres M, Figueiredo LC, Faveri M, et al. : The efficacy of two oral hygiene regimens in reducing oral malodour: a randomised clinical trial. Int. Dent. J. 2015; 65 (6): 292–302. PubMed Abstract | Publisher Full Text | Free Full Text 46. Mahajan K, Kunte S: Formulation and physicochemical evaluation of a herbal dentifrice formulated with Myristica fragrans (nutmeg): an in vitro study. Int. J. Ayurvedic Med. 2024; 14 (4): 1106–1110. Publisher Full Text 47. Ma L, Chen R, Zhang Y, et al. : The tree shrew as a new animal model for the study of periodontitis. J. Clin. Periodontol. 2023; 50 (8): 1075–1088. PubMed Abstract | Publisher Full Text 48. Gobran H, Edrees MF, Ahmed A: Immunohistochemical evaluation of β defensins on induced periodontitis in rats. Egyptian Dent. J. 2020; 66 (4): 2229–2234. Publisher Full Text 49. Li J, Xu S, Zhang K, et al. : Treatment of gingival defects with gingival mesenchymal stem cells derived from human fetal gingival tissue in a rat model. Stem Cell Res. Ther. 2018; 9 (1): 27. PubMed Abstract | Publisher Full Text | Free Full Text 50. Ponte FSD, Catalfamo L, Micali G, et al. : Effect of bisphosphonates on the mandibular bone and gingival epithelium of rats without tooth extraction. Exp. Ther. Med. 2016; 11 (5): 1678–1684. PubMed Abstract | Publisher Full Text | Free Full Text 51. Sun M, Ji Y, Zhou S, et al. : Ginsenoside Rb3 inhibits osteoclastogenesis via ERK/NF-κB signaling pathway in vitro and in vivo. Oral. Dis. 2022; 29 (8): 3460–3471. PubMed Abstract | Publisher Full Text 52. Chaudhary S, Shah R, Patel A, et al. : Comparative evaluation of the remineralization potential of fluoride-containing toothpaste, honey ginger paste and ozone: an in vitro study. Int. J. Clin. Pediatr Dent. 2023; 15 (5): 541–548. PubMed Abstract | Publisher Full Text | Free Full Text 53. Chaitrakoonthong T, Ampornaramveth RS, Kamolratanakul P: Rinsing with L-ascorbic acid exhibits concentration-dependent effects on human gingival fibroblast in vitro wound healing behavior. Int. J. Dent. 2020; 2020 : 1–7. PubMed Abstract | Publisher Full Text | Free Full Text 54. Li S, Zhang C, Maimela NR, et al. : Molecular and clinical characterization of CD163 expression via large-scale analysis in glioma. Onco. Targets Ther. 2019; 8 (7): e1601478. PubMed Abstract | Publisher Full Text | Free Full Text 55. Kristanti RA: The effect of Carica pubescens Lenne and K. Koch fruit extract from Dieng Plateau and Cangar to the amount of fibroblasts cells on the healing of oral mucosal inflammation. J. Islam Pharm. 2016; 1 (1): 20. Publisher Full Text 56. Salehinia F, Ashtiani HA, Rastegar H, et al. : Discovering cellular response to medicinal herbs, Iranian traditional medicine and modern cosmeceutical approaches. J. Skin. Stem. Cell. 2016; 3 (4). Publisher Full Text 57. Ni J, Zhong Z, Wu Y, et al. : Hyaluronic acid vs. physiological saline for enlarging deficient gingival papillae: a randomized controlled clinical trial and an in vitro study. Ann. Transl Med. 2021; 9 (9): 759–759. PubMed Abstract | Publisher Full Text | Free Full Text 58. Khairnar MR, Dodamani AS, Karibasappa GN, et al. : Efficacy of herbal toothpastes on salivary pH and salivary glucose – a preliminary study. J. Ayurveda Integr. Med. 2017; 8 (1): 3–6. PubMed Abstract | Publisher Full Text | Free Full Text 59. Souza GL, Rosatto CMP, Silva MJB, et al. : Evaluation of apoptosis/necrosis and cytokine release provoked by three root canal sealers in human polymorphonuclears and monocytes. Int. Endod. J. 2018; 52 (5): 629–638. PubMed Abstract | Publisher Full Text 60. Yang H, Wang W, Romano KA, et al. : A common antimicrobial additive increases colonic inflammation and colitis-associated colon tumorigenesis in mice. Sci. Transl. Med. 2018; 10 (443). PubMed Abstract | Publisher Full Text | Free Full Text 61. Coluccia A, Matti F, Zhu X, et al. : In vitro study on green propolis as a potential ingredient of oral health care products. Antibiotics. 2022; 11 (12): 1764. PubMed Abstract | Publisher Full Text | Free Full Text 62. Vajrabhaya L, Korsuwannawong S, Ruangsawasdi N, et al. : The efficiency of natural wound healing and bacterial biofilm inhibition of aloe vera and sodium chloride toothpaste preparation. BMC Complement. Med. Ther. 2022; 22 (1): 66. PubMed Abstract | Publisher Full Text | Free Full Text 63. Środa-Pomianek K, Palko-Łabuz A, Poła A, et al. : TMPE derived from saffron natural monoterpene as cytotoxic and multidrug resistance reversing agent in colon cancer cells. Int. J. Mol. Sci. 2020; 21 (20): 7529. PubMed Abstract | Publisher Full Text | Free Full Text 64. Bratu OG, Marcu RD, Socea B, et al. : Immunohistochemistry particularities of retroperitoneal tumors. Rev. Chim. 2018; 69 (7): 1813–1816. Publisher Full Text 65. Krzyszczyk P, Schloss R, Palmer A, et al. : The role of macrophages in acute and chronic wound healing and interventions to promote pro-wound healing phenotypes. Front. Physiol. 2018; 9 . eCollection 2018. PubMed Abstract | Publisher Full Text | Free Full Text 66. Kloc M, Ghobrial RM, Wosik J, et al. : Macrophage functions in wound healing. J. Tissue Eng. Regen. Med. 2019; 13 : 99–109. Publisher Full Text 67. Siegele B, Stemmer-Rachamimov A, Lill-jebjörn H, et al. : N-terminus DUX4-immunohistochemistry is a reliable methodology for the diagnosis of DUX4-fused B-lymphoblastic leukemia/lymphoma. Genes Chromosom. Cancer. 2022; 61 (8): 449–458. PubMed Abstract | Publisher Full Text 68. Mondal SK, Mandal S, Bhattacharya S, et al. : Expression of p57 immunomarker in the classification and differential diagnosis of partial and complete hydatidiform moles. J. Lab. Physicians. 2019; 11 (03): 270–274. PubMed Abstract | Publisher Full Text | Free Full Text 69. Alkhateeb RMJ: Correlation of TAZ immunohistochemistry expression and breast carcinoma. Int. J. Clin. Oncol. Cancer Res. 2018; 3 (1): 10. Publisher Full Text 70. Huang X, Mo Z, Li Y, et al. : LncRNA HOTAIR increases inflammatory responses by activating NF-κB pathway in LPS-induced acute lung injury.2020. Publisher Full Text 71. Doostan M, Doostan M, Maleki H, et al. : Co-electrospun poly (vinyl alcohol)/poly (ɛ-caprolactone) nanofiber scaffolds containing coffee and Calendula officinalis extracts for wound healing applications. J. Bioact. Compat. Polym. 2022; 37 (6): 437–452. Publisher Full Text 72. Wu B, Guo X, Yan X, et al. : TSG-6 inhibits IL-1β-induced inflammatory responses and extracellular matrix degradation in nucleus pulposus cells by activating the PI3K/AKT signaling pathway. J. Orthop. Surg. Res. 2022; 17 (1): 572. PubMed Abstract | Publisher Full Text | Free Full Text 73. Elenkova M, Tipton D, Karydis A, et al. : Vitamin D attenuates human gingival fibroblast inflammatory cytokine production following advanced glycation end product interaction with receptors for AGE. J. Periodontal Res. 2018; 54 (2): 154–163. PubMed Abstract | Publisher Full Text 74. Dong J: Microenvironmental alterations in carbon nanotube-induced lung inflammation and fibrosis. Front. Cell Dev. Biol. 2020; 8 : 126. PubMed Abstract | Publisher Full Text | Free Full Text 75. Fujiwara Y, Yano H, Pan C, et al. : Anticancer immune reaction and lymph node sinus macrophages: a review from human and animal studies. J. Clin. Exp. Hematop. 2024; 64 (2): 71–78. PubMed Abstract | Publisher Full Text | Free Full Text 76. Huynh NC, Everts V, Pavasant P, et al. : Interleukin-1β induces human cementoblasts to support osteoclastogenesis. Int. J. Oral Sci. 2017; 9 (12): e5. PubMed Abstract | Publisher Full Text | Free Full Text 77. Takagi R, Sakamoto E, Kido J, et al. : S100a9 increases IL-6 and RANKL expressions through MAPKs and STAT3 signaling pathways in osteocyte-like cells. Biomed. Res. Int. 2020; 2020 : 1–12. PubMed Abstract | Publisher Full Text | Free Full Text 78. Xiong Y, Qiu X, Shi W, et al. : Anti-inflammatory and antioxidant effect of modified Bazhengsan in a rat model of chronic bacterial prostatitis. J. Ethnopharmacol. 2017; 198 : 73–80. PubMed Abstract | Publisher Full Text 79. Nonaka K, Kajiura Y, Bando M, et al. : Advanced glycation end-products increase IL-6 and ICAM-1 expression via RAGE, MAPK, and NF-κB pathways in human gingival fibroblasts. J. Periodontal Res. 2017; 53 (3): 334–344. PubMed Abstract | Publisher Full Text 80. Miyashita Y, Kouwaki T, Tsukamoto H, et al. : TICAM-1/TRIF associates with Act1 and suppresses IL-17 receptor-mediated inflammatory responses. Life Sci. Alliance. 2022; 5 (2): e202101181. PubMed Abstract | Publisher Full Text | Free Full Text 81. Yuslianti ER, Susanto A, Sutjiatmo AB, et al. : ARRIVE Checklist for: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163. Zenodo. 2025. Publisher Full Text 82. Yuslianti ER, Susanto A, Sutjiatmo AB, et al. : Raw Data for: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model. [Data set]. Zenodo. 2025. Publisher Full Text Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 28 Apr 2025 ADD YOUR COMMENT Comment Author details Author details 1 Faculty of Dentistry, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia 2 Faculty of Dentistry, Padjadjaran University, Sumedang, West Java, 45363, Indonesia 3 Faculty of Pharmacy, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia 4 Faculty of Medicine, Maranatha Christian University, Bandung, West Java, 40164, Indonesia 5 Biomolecular and Biomedicine Research Center, Aretha Medika Utama, Bandung, West Java, 40163, Indonesia 6 Faculty of Health Science and Technology, Universitas Jenderal Achmad Yani, Cimahi, West Java, 40531, Indonesia Euis Reni Yuslianti Roles: Conceptualization, Data Curation, Funding Acquisition, Investigation, Project Administration, Resources, Supervision, Validation, Writing – Review & Editing Agus Susanto Roles: Conceptualization, Funding Acquisition, Investigation, Methodology, Project Administration, Supervision Afifah Bambang Sutjiatmo Roles: Formal Analysis, Funding Acquisition, Investigation, Project Administration, Visualization Wahyu Widowati Roles: Data Curation, Formal Analysis, Funding Acquisition, Project Administration, Supervision, Validation, Visualization, Writing – Review & Editing Vini Ayuni Roles: Formal Analysis, Software, Visualization, Writing – Original Draft Preparation Dhanar Septyawan Hadiprasetyo Roles: Resources, Software, Validation, Writing – Original Draft Preparation Erick Khristian Roles: Data Curation, Formal Analysis, Methodology, Project Administration, Software, Supervision, Validation, Visualization Widya Irsyad Roles: Resources, Validation, Visualization, Writing – Original Draft Preparation Naura K Michelle Zefanya Roles: Resources, Software, Visualization, Writing – Original Draft Preparation Competing interests No competing interests were disclosed. Grant information Ministry of Education, Culture, Research, and Technology of Indonesia for funding this study under grant number (106/E5/PG.02.00.PL/2024, dated on 30 May 2024). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (1) version 1 Published: 28 Apr 2025, 14:466 https://doi.org/10.12688/f1000research.163399.1 Copyright © 2025 Reni Yuslianti E et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Reni Yuslianti E, Susanto A, Bambang Sutjiatmo A et al. The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.12688/f1000research.163399.1 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 1 VERSION 1 PUBLISHED 28 Apr 2025 Views 0 Cite How to cite this report: Quoc APDNB. Reviewer Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r412966 ) The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-412966 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 09 Oct 2025 Assoc.Prof.Dr. Nguyen Bao Quoc , University Library Nong Lam University, Chí Minh, Vietnam Approved VIEWS 0 https://doi.org/10.5256/f1000research.179741.r412966 The abstract is promising, with a clear objective evaluating the herbal toothpaste TPME in a rat gingivitis model with appropriate controls (base paste and a commercial product), and a broad panel of biomarkers. The reported trends are biologically plausible, and ... Continue reading READ ALL The abstract is promising, with a clear objective evaluating the herbal toothpaste TPME in a rat gingivitis model with appropriate controls (base paste and a commercial product), and a broad panel of biomarkers. The reported trends are biologically plausible, and the results include statistical analyses with discussion in comparison to prior studies. Overall, the manuscript appears suitable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Molecular pathogenesis and diagnostics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Quoc APDNB. Reviewer Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r412966 ) The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-412966 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Rajendran P,DP. Reviewer Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r415559 ) The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-415559 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 08 Oct 2025 Prof., Dr. Priyatharsini Rajendran , Lady Doak College, Madurai, Tamil Nadu, India Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.179741.r415559 This study evaluates a polyherbal toothpaste mix extract (TPME) in a Wistar rat gingivitis model. TPME improved fibroblast proliferation, collagen deposition, angiogenesis, and M2 macrophage polarization (CD163), while reducing IL-1β, IL-6 expression, inflammatory cells, and CD86 activity, suggesting significant anti-inflammatory ... Continue reading READ ALL This study evaluates a polyherbal toothpaste mix extract (TPME) in a Wistar rat gingivitis model. TPME improved fibroblast proliferation, collagen deposition, angiogenesis, and M2 macrophage polarization (CD163), while reducing IL-1β, IL-6 expression, inflammatory cells, and CD86 activity, suggesting significant anti-inflammatory and tissue-repair potential compared with commercial toothpaste. The following clarifications are required: 1. The exact concentrations and proportions of herbal extracts in TPME are not clearly defined. This must be detailed to ensure reproducibility. 2. Although the Federer formula is mentioned, the rationale for choosing 30 rats should be explained more clearly, including power analysis for molecular endpoints. 3. The use of only one commercial toothpaste as positive control may bias conclusions. Including another herbal toothpaste as an additional comparator would strengthen validity. 4. Some results rely on descriptive trends without robust statistical backing. More details on replicates, variance, and effect size should be provided. 5. While improvements are shown, the mechanistic link between herbal compounds and modulation of macrophage polarization/angiogenesis remains speculative. Additional molecular assays (e.g., signaling pathway markers) would strengthen claims. 6. Results are limited to rats. The authors should discuss limitations in extrapolating to human gingivitis and propose next steps for clinical validation. 7. At points, contradictory statements appear (e.g., CD86/CD163 trends). Authors should ensure alignment between results, figures, and interpretation. 8. Human sensory evaluation (odor, taste, texture) is included but methodology is vague. Details on respondent selection, blinding, and statistical handling of subjective data should be clarified. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Immunology, Nanomedicine, cancer therapy I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Rajendran P,DP. Reviewer Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r415559 ) The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-415559 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 1 VERSION 1 PUBLISHED 28 Apr 2025 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 1 28 Apr 25 read read Prof., Dr. Priyatharsini Rajendran , Lady Doak College, Madurai, India Assoc.Prof.Dr. Nguyen Bao Quoc , University Library Nong Lam University, Chí Minh, Vietnam Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Quoc A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 09 Oct 2025 | for Version 1 Assoc.Prof.Dr. Nguyen Bao Quoc , University Library Nong Lam University, Chí Minh, Vietnam 0 Views copyright © 2025 Quoc A. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The abstract is promising, with a clear objective evaluating the herbal toothpaste TPME in a rat gingivitis model with appropriate controls (base paste and a commercial product), and a broad panel of biomarkers. The reported trends are biologically plausible, and the results include statistical analyses with discussion in comparison to prior studies. Overall, the manuscript appears suitable for indexing. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Molecular pathogenesis and diagnostics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Quoc APDNB. Peer Review Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r412966) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-412966 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Rajendran P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 08 Oct 2025 | for Version 1 Prof., Dr. Priyatharsini Rajendran , Lady Doak College, Madurai, Tamil Nadu, India 0 Views copyright © 2025 Rajendran P. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This study evaluates a polyherbal toothpaste mix extract (TPME) in a Wistar rat gingivitis model. TPME improved fibroblast proliferation, collagen deposition, angiogenesis, and M2 macrophage polarization (CD163), while reducing IL-1β, IL-6 expression, inflammatory cells, and CD86 activity, suggesting significant anti-inflammatory and tissue-repair potential compared with commercial toothpaste. The following clarifications are required: 1. The exact concentrations and proportions of herbal extracts in TPME are not clearly defined. This must be detailed to ensure reproducibility. 2. Although the Federer formula is mentioned, the rationale for choosing 30 rats should be explained more clearly, including power analysis for molecular endpoints. 3. The use of only one commercial toothpaste as positive control may bias conclusions. Including another herbal toothpaste as an additional comparator would strengthen validity. 4. Some results rely on descriptive trends without robust statistical backing. More details on replicates, variance, and effect size should be provided. 5. While improvements are shown, the mechanistic link between herbal compounds and modulation of macrophage polarization/angiogenesis remains speculative. Additional molecular assays (e.g., signaling pathway markers) would strengthen claims. 6. Results are limited to rats. The authors should discuss limitations in extrapolating to human gingivitis and propose next steps for clinical validation. 7. At points, contradictory statements appear (e.g., CD86/CD163 trends). Authors should ensure alignment between results, figures, and interpretation. 8. Human sensory evaluation (odor, taste, texture) is included but methodology is vague. Details on respondent selection, blinding, and statistical handling of subjective data should be clarified. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? Partly Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Immunology, Nanomedicine, cancer therapy I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (0) Rajendran P,DP. Peer Review Report For: The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory Cell Response in a Wistar Rat Gingivitis Model: Evaluation of IL-1β, IL-6 Gene Expression, and Immunohistochemical Markers CD86 and CD163 [version 1; peer review: 1 approved, 1 approved with reservations] . F1000Research 2025, 14 :466 ( https://doi.org/10.5256/f1000research.179741.r415559) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/14-466/v1#referee-response-415559 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "The Effect of Toothpaste Mix Extract on Angiogenesis...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/14-466/v1" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/14-466/v1&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/14-466/v1" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Reni Yuslianti E et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/14-466/v1/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/14-466", templates : { twitter : "The Effect of Toothpaste Mix Extract on Angiogenesis and Inflammatory.... Reni Yuslianti E et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/14-466/v1" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/163399/179741") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "179741"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "415558": 0, "415559": 3, "415557": 0, "415566": 0, "415564": 0, "415565": 0, "415562": 0, "415563": 0, "415560": 0, "415561": 0, "384663": 0, "384669": 0, "384668": 0, "384671": 0, "384670": 0, "384665": 0, "384664": 0, "384667": 0, "384666": 0, "412966": 3, "412967": 0, "412964": 0, "412965": 0, "412962": 0, "384672": 0, "412963": 0, "412970": 0, "412971": 0, "412968": 0, "412969": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "2245b94c-87a9-4b71-8174-1903670006e3"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "
[email protected]", infoEmail: "
[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.