Absence of superinfection exclusion of Borna disease virus 2 maintains genomic polymorphisms in persistently infected cells

Absence of superinfection exclusion of Borna disease virus 2 maintains genomic polymorphisms in persistently infected cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Absence of superinfection exclusion of Borna disease virus 2 maintains genomic polymorphisms in persistently infected cells Takehiro Kanda, PaulineDianne Santos, Dirk Höper, Martin Beer, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4544977/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Mammalian orthobornaviruses, such as Borna disease virus 1 (BoDV-1) and variegated squirrel bornavirus 1, are zoonotic pathogens that cause fatal encephalitis in humans. BoDV-2, another mammalian orthobornavirus with high genetic homology to BoDV-1, is believed to share the same geographical distribution as BoDV-1, indicating its potential risk to human health. However, due to the limited number of isolations, the virological characteristics of BoDV-2, such as pathogenicity and infectivity, remain largely unexplored. Here, we re-evaluated the whole-genome sequence of BoDV-2 and established a reverse genetics system to investigate its virological properties. Compared to the published reference sequence, we identified two nonsynonymous nucleotide substitutions in the large (L) gene, one of which was critical for restoring polymerase activity, enabling the successful recovery of recombinant BoDV-2 (rBoDV-2). Additionally, we identified two nonsynonymous single-nucleotide polymorphisms (SNPs) in the L gene and one in the phosphoprotein (P) gene. Substitution of these SNPs significantly enhanced the growth ability of rBoDV-2. Furthermore, our studies demonstrated that BoDV-2 does not induce superinfection exclusion in cells, allowing the persistence of low-fitness genome variants for an extended period of time. These findings help to characterize the virological properties of BoDV-2 and shed light on how bornaviruses maintain genetic diversity in infected cells. Biological sciences/Microbiology Biological sciences/Microbiology/Virology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Viruses of the genus Orthobornavirus within the family Bornaviridae have been documented to infect a wide range of vertebrate species, including mammals and avians 1–3 . Currently, the genus comprises 25 viruses belonging to 9 different viral species 4 . Among these, Orthobornavirus bornaense consists of two mammalian viruses: Borna disease virus 1 (BoDV-1), the prototype of the family Bornaviridae , and BoDV-2, a genetically closely related virus to BoDV-1. BoDV-1 has been identified as the etiological agent of Borna disease (BD), a nonpurulent encephalomyelitis affecting horses, sheep, and other mammalian species 1,2 . Conversely, BoDV-2 was only isolated from a single case of a pony showing severe and incurable neurological symptoms in eastern Austria in 1999, where BoDV-1 was not endemic 5 . Although the genome sequence of BoDV-2 isolate No/98 shares approximately 80% nucleotide identity with that of BoDV-1 strains 6 , its virological properties, including host range, replication ability, and pathogenicity, have not been fully elucidated. The pathogenicity of BoDV-1 in humans was controversial until two case studies were reported in 2018; these studies demonstrated the presence of the BoDV-1 antigen and RNA in a healthy young man and in two organ transplant recipients who died of encephalitis 7,8 . Subsequently, several studies have reported that infection with BoDV-1 was associated with more than forty fatal cases of encephalitis in humans 9–15 . Additionally, variegated squirrel bornavirus 1 (VSBV-1; species Orthobornavirus sciuri ) was isolated from squirrel breeders who died of encephalitis 16 . Therefore, both BoDV-1 and VSBV-1 are zoonotic pathogens that cause fatal encephalitis in humans 17 . However, the potential of BoDV-2 to infect and cause disease in humans remains unclear. Considering that BoDV-2 isolate No/98 was isolated from a pony that displayed fatal neurological disorders and that BoDV-2 is genetically more closely related to BoDV-1 than VSBV-1, it is likely that BoDV-2 may also possess zoonotic potential. The reverse genetics system is a powerful tool for elucidating viral characteristics such as replication and pathogenesis. The reverse genetics of BoDV-1 was initially described by Schneider et al. in 2005; a plasmid expressing the full-length BoDV-1 antigenome and three helper plasmids expressing the nucleoprotein (N), phosphoprotein (P), and large protein (L) encoding the RNA-dependent RNA polymerase were transfected into cells expressing T7 polymerase 18 . This system has been further improved by employing highly transfectable HEK293T cells for plasmid transfection and incorporating two helper plasmids expressing matrix protein (M) and glycoprotein (G) 19–21 . Given that the genomic components of BoDV-2 closely resemble those of BoDV-1, it is predicted that recombinant BoDV-2 (rBoDV-2) can be easily rescued by employing the same strategy as used for BoDV-1. However, although the complete genome sequence of BoDV-2 has been deposited in NCBI GenBank, previous studies have raised concerns about potential errors in the L gene, indicating the need to reassess the genome sequence of BoDV-2 6 . In this study, we aimed to investigate the virological properties of BoDV-2 using recombinant viral techniques and therefore redetermine the genome sequence of BoDV-2 isolate No/98, which has been maintained in persistently infected cells. We found two nonsynonymous nucleotide substitutions in the L gene compared to the published sequence. One of these substitutions was crucial for restoring the polymerase activity of L, allowing successful recovery of rBoDV-2 through reverse genetics. Additionally, we identified two nonsynonymous single-nucleotide polymorphisms (SNPs) in the L gene and one in the P gene. Substituting these SNPs significantly enhanced the growth ability of rBoDV-2. Furthermore, our study demonstrated that BoDV-2 does not induce superinfection exclusion in cells, leading to long-term maintenance of low-fitness genome variants in persistently infected cells. Results Reassessment of the complete genome sequence of BoDV-2. The complete genome sequence of BoDV-2 isolate No/98 is deposited in NCBI GenBank; however, it is suspected that this sequence might contain several errors in the L gene because three blocks of amino acid differences are unnaturally accumulated at the C-terminal domain (CTD) of L compared to those of representative strains of BoDV-1, such as He/80 and V (Fig. 1 B) 6 . Therefore, we reassessed the whole-genome sequence of BoDV-2 isolate No/98 via RNA sequencing (RNA-seq) using total RNA extracted from persistently infected Vero cells available at the Friedrich-Loeffler-Institut. Compared to the published sequence (accession no. AJ311524), the reassessed sequence contains one and five nucleotide differences in the P and L genes, respectively (Fig. 1 A). Two of them in the L gene, uracil at positions 2762 and 3334, which are located in the polyribonucleotidyltransferase (PRNTase) domain (Fig. 1 B), were completely substituted with guanine, resulting in amino acid changes of leucine at position 921 with arginine and cysteine at position 1112 with glycine (Fig. 1 A). In addition, three SNPs were detected in the L gene, two of which, positions 3743 and 4250, induce nonsynonymous amino acid changes in the CTD of L, though they do not overlap with the blocks of amino acid differences described in a previous paper (Fig. 1 A and B) 6 . A nonsynonymous SNP was also detected at position 456 of the P gene (Fig. 1 A). Furthermore, we performed rapid amplification of cDNA ends (RACE) analysis to determine the exact 3’ and 5’ terminal sequences, which could not be reconstituted by RNA-seq analysis. Similar to BoDV-1 18,22 , BoDV-2 possesses four nucleotides overhung at the 3’ end of both the genome and antigenome without a complementary sequence at the 5’ end of the opposite strand (Fig. 1 C). Compared to the published sequence, the reassessed sequence lacks uracil at the 5’ end of the genome (Fig. 1 D). The polymerase activity of BoDV-2 L is restored by substituting a nucleotide. In the reassessed sequence, nucleotides at positions 2762 and 3334 of the L gene are completely substituted compared to the reference sequence (Fig. 1 A). To determine whether these differences affect BoDV-2 L gene expression, we constructed L cDNA expression plasmids possessing each nucleotide substitution independently (BoDV-2 L R or L G ) or in combination (BoDV-2 L RG ) and performed western blotting (Fig. 2 A). In a previous study, we could not detect expression of FLAG-tagged BoDV-2 L with the reference sequence, though that of FLAG-tagged BoDV-1 L was clearly demonstrated, suggesting the low expression potential of the FLAG-BoDV2 L construct 23 . However, in the present study, we could detect the expression of BoDV-2 L with the reference sequence when a linker sequence was inserted between FLAG and the L gene to enhance the accessibility of the antibody to the tag (Fig. 2 B). In addition, we confirmed expressions of the reconstructed BoDV-2 L variants in transfected cells (Fig. 2 B). To determine the polymerase activities of the reconstructed BoDV-2 L variants, we performed a BoDV-2 minireplicon assay. As shown in Fig. 2 C, reporter activity was not detected for BoDV-2 L with the reference sequence, indicating that it lacks any polymerase activity. Interestingly, BoDV-2 L possessing a nucleotide substitution at position 2762, namely, BoDV-2 L R , restored its polymerase activity, whereas a substitution at position 3334, namely, BoDV-2 L G , did not (Fig. 2 C). Accordingly, BoDV-2 L RG , which possesses both nucleotide substitutions simultaneously, exhibited the same level of polymerase activity as BoDV-2 L R (Fig. 2 C), indicating that a difference in the nucleotide at position 2762 is detrimental to the polymerase activity of BoDV-2 L. To examine whether nucleotide differences at positions 2762 and 3334 of the L gene affect recovery of rBoDV-2 via reverse genetics, we constructed BoDV-2 cDNA plasmids expressing the full-length BoDV-2 antigenomes possessing each or both nucleotide substitutions. HEK293T cells were transfected with each BoDV-2 cDNA plasmid and five helper plasmids and cocultured with uninfected Vero cells at 3 days post transfection. After two weeks from coculture, rBoDV-2s that contain a nucleotide substitution at position 2762 of the L gene, rBoDV-2 L R and L RG , were successfully rescued (Fig. 2 D). Interestingly, although nucleotide substitution at position 3334 did not affect the polymerase activity of BoDV-2 L in the minireplicon assay (Fig. 2 C), rBoDV-2 L RG , which possesses both substitutions at positions 2762 and 3334, seemed to be recovered more efficiently than rBoDV-2 L R , which possesses a substitution at position 2762 alone (Fig. 2 D), suggesting that the nucleotide at position 3334 of the L gene also plays a role in BoDV-2 replication. To examine the growth ability of rBoDV-2 L RG in comparison with that of the nonrecombinant BoDV-2 isolate No/98, Vero cells infected with rBoDV-2 L RG or isolate No/98 were cocultured with uninfected Vero cells at a ratio of 1 to 19 (Fig. 2 E), and viral propagation and the copy number of viral RNA were evaluated every 3 or 4 days by immunofluorescence assay (IFA) and RT-qPCR, respectively. While the nonrecombinant isolate No/98 spread to almost all Vero cells within 2 weeks of coculture, infection of rBoDV-2 L RG exhibited limited spread within this period (Fig. 2 F). Similarly, the copy number of viral RNA increased 20-fold in isolate No/98-infected cells, whereas it barely increased in rBoDV-2 L RG -infected cells (Fig. 2 G). These results suggest that the growth ability of rBoDV-2 is not only determined by the L2762 and L3334 substitutions, even though both substitutions induce high polymerase activity in the minireplicon assay. Nonsynonymous SNPs in the L gene facilitate the growth of BoDV-2. Our RNA-seq analysis identified two nonsynonymous SNPs in the CTD of the L gene (Fig. 1 A), indicating that the Vero cells persistently infected with BoDV-2 isolate No/98 contain a viral L quasispecies. Therefore, we constructed L expression plasmids harboring each or both nucleotide substitutions at positions 3743 and 4250 based on BoDV-2 L RG and performed a minireplicon assay (Fig. 3 A). While the substitution of uracil at position 3743 with cytosine, L RGT , increased polymerase activity by 1.3-fold, that of adenine at position 4250 with guanine, L RGR , decreased it by 0.7-fold. Substitution of both nucleotides, L RGTR , slightly decreased polymerase activity (Fig. 3 B). To further investigate the impact of these SNPs on the growth ability of BoDV-2, we generated rBoDV-2 possessing each or both substitutions in the L gene and evaluated their growth kinetics. Although the substitution at position 4250 of the L gene had a detrimental effect on polymerase activity in the minireplicon assay (Fig. 3 B), L proteins possessing either SNP substitution remarkably facilitated viral propagation and RNA synthesis of rBoDV-2 (Fig. 3 C and D). These findings suggest that these SNPs influence viral replication through mechanisms other than enhancing polymerase activity in cells. A nonsynonymous SNP in the P gene expedites the growth of BoDV-2. We also identified another nonsynonymous SNP at position 456 of the P gene (Fig. 1 A). The P gene encodes the viral polymerase cofactor, which directly interacts with the L protein and plays a crucial role in viral polymerase activity 24,25 . Therefore, we examined the effects of this SNP on viral polymerase activity and viral growth ability using both a minireplicon assay and rBoDV-2 variants. Substitution of guanine at position 456 of the P gene with adenine, P I , resulted in a slight increase in the polymerase activity of L RG but not that of L RGTR , as observed in the minireplicon assay (Fig. 4 A and B). Furthermore, the P gene with the introduced SNP significantly facilitated viral propagation (Fig. 4 C and D) and RNA synthesis of rBoDV-2 (Fig. 4 E and F). These observations indicate that the nonsynonymous SNP detected in the P gene also contributed to the increase in rBoDV-2 growth ability. Lack of superinfection exclusion maintains the low-fitness polymorphism in cells persistently infected with BoDV-2. Since the isolation of BoDV-2 isolate No/98 from a pony brain in 1999, it has been maintained for a long time in persistently infected Vero cells. Notably, although BoDV-2-infected Vero cells have undergone repeated passages, L- and P-sequence variants with low viral replication ability appear to be the major quasispecies within persistently infected cells. The coexistence of viral quasispecies in infected cells has been shown to affect overall viral replication and pathogenicity and therefore plays a role in the adaptation and evolution of viral populations 26 . To determine the significance of the coexistence of BoDV-2 quasispecies in persistently infected cells, we performed infection experiments using cells infected with different sequences of rBoDV-2. First, we generated rBoDV-2 with different fluorescent marker genes, mCherry and GFP, inserted into the artificial intergenic region between the P and M genes (Fig. 5 A) based on rBoDV-2 P I L RGTR with high-growth ability. As shown in Fig. 5 B, both viruses exhibited similar growth kinetics, confirming that the effects of these two fluorescence marker proteins on the growth ability of BoDV-2 are not different. We therefore examined the propagation of rBoDV-2 variants with different growth abilities, namely, low-growth rBoDV-2 L RG -mCherry (L RG -mCherry) and high-growth rBoDV-2 P I L RGTR -GFP (P I L RGTR -GFP), by a competition assay using Vero cells infected with each recombinant virus. When Vero cells infected with L RG -mCherry or P I L RGTR -GFP were cocultured with uninfected Vero cells at a ratio of 1:1:23, P I L RGTR -GFP rapidly spread throughout the culture, and the number of mCherry-expressing cells gradually decreased (Fig. 5 C). Similarly, after 14 days of coculture, the genomic RNA of P I L RGTR -GFP accounted for almost all the BoDV-2 genomic RNA in the population (Fig. 5 D). However, at 14 days after coculture, almost 1.0% of the cells coexpressed mCherry and GFP, and the proportion of cells expressing mCherry alone or coexpressing mCherry and GFP was approximately 3.3% of the total (Fig. 5 C), indicating that high-growth P I L RGTR -GFP superinfected L RG -mCherry-infected cells and that low-growth rBoDV-2 was maintained without elimination from the cells superinfected with the P I L RGTR -GFP. To confirm the absence of superinfection exclusion between the rBoDV-2 variants, we next cocultured Vero cells infected with L RG -mCherry and P I L RGTR -GFP at a 1:1 ratio. As a result, the percentage of cells coexpressing mCherry and GFP gradually increased; after 14 days of coculture, the proportions of cells expressing GFP alone, mCherry alone, and coexpressing mCherry and GFP were approximately 46.3%, 18.3%, and 32.4%, respectively (Fig. 5 E). This finding suggests that the high-growth P I L RGTR -GFP predominantly superinfected to the L RG -mCherry-infected cells. On the other hand, the proportion of viral genomic RNA of L RG -mCherry in the culture increased to some extent (Fig. 5 F), indicating that the resident viruses were not eliminated even among the cells superinfected with the high-growth virus; rather, the replication of the low-growth viral genome was upregulated by support from the polymerase derived from high-growth virus. In addition, we cloned Vero cells coinfected with both L RG -mCherry and P I L RGTR -GFP (Fig. 5 G) and cocultured them with uninfected Vero cells to investigate whether superinfection affects the propagation abilities of coinfected variants. As shown in Fig. 5 H, the proportion of cells infected with only the P I L RGTR -GFP virus increased; the L RG -mCherry virus could also be transmitted to uninfected Vero cells, albeit only slightly. These observations suggest that BoDV-2 does not exclude superinfection, allowing low-fitness variants to persist within infected cells while maintaining their characteristics and thereby maintaining population diversity. Discussion In this study, to better understand the virological characteristics of BoDV-2, we reassessed the whole-genome sequence of BoDV-2 using RNA extracted from persistently BoDV-2-infected Vero cells. Compared to the original sequence of BoDV-2 isolate No/98, the reassessed sequence contains two nucleotide substitutions at positions 2762 and 3334 of the L gene, both of which induce an amino acid change in the PRNTase domain (Fig. 1 A and B). We found that substitution of uracil at position 2762 with guanine alone is sufficient to restore the polymerase activity of BoDV-2 L and to recover rBoDV-2 by reverse genetics (Fig. 2 ). This nucleotide substitution induces an amino acid change from leucine to arginine at position 921 of L. Interestingly, arginine is completely conserved at the same position in all 47 sequences of BoDV-1 L registered in the database, suggesting that this residue is critical for the polymerase activity of BoDV L. In contrast, the substitution of uracil at position 3334 with guanine, which induces an amino acid change from cysteine to glycine at position 1112 of L, did not affect the polymerase activity of BoDV-2 L in the minireplicon assay (Fig. 2 C). However, interestingly, rBoDV-2, which possesses substitutions at positions 2762 and 3334, rBoDV-2 L RG , seemed to be rescued more efficiently than was rBoDV-2, which possesses a substitution at position 2762 alone, rBoDV-2 L R , by reverse genetics (Fig. 2 D). This observation suggests that substitution at position 3334 may also play a critical role in the replication of BoDV-2 in a way other than enhancing polymerase activity. Position 3334 is located between motifs C (W) and D (HR) in the PRNTase domain, which is associated with the viral mRNA capping reaction 27 , but it overlaps with neither these conserved motifs nor the currently identified signal sequences in BoDV-1 L 28,29 . Further investigations are needed to determine the effect of guanine at position 3334 of BoDV-2 L on viral propagation. Our study showed that while rBoDV-2 could be rescued by substituting nucleotides at positions 2762 and 3334 of the L gene, the growth ability of rBoDV-2 L RG was severely attenuated compared to that of the nonrecombinant BoDV-2 isolate No/98 (Fig. 2 F and G). Interestingly, the substitution of nonsynonymous SNPs at positions 3743 and 4250 of the L gene significantly facilitated the growth ability of rBoDV-2 (Fig. 3 C and D). Nucleotide substitution of uracil at position 3743 with cytosine induces an amino acid change from isoleucine to threonine at amino acid position 1248 of BoDV-2 L. Either isoleucine or threonine is conserved at the same position in BoDV-1 Ls in the database at a similar ratio, though it remains unclear whether substitution of isoleucine with threonine also affects the viral growth ability of BoDV-1. In addition, nucleotide substitution of alanine at position 4250 with guanine induces an amino acid change from lysine to arginine at amino acid position 1417 of BoDV-2 L. All the BoDV-1 Ls in the database except for that of strain CRNP5, which was generated by several passages of isolate He/80 in the brains of Lewis rats and SJL mice, show conservation of a lysine residue at the same amino acid position corresponding to 1417 of BoDV-2 L 30 , but it is unclear whether rBoDV-1 possessing arginine residue at this position shows efficient propagation compared to the parental BoDV-1 isolate He/80 31 . Investigating how these SNPs affect viral replication may help to elucidate the previously unknown role of the CTD of BoDV L. In this study, we also identified one nucleotide substitution within an SNP at position 456 of the P gene. This substitution leads to an amino acid change from methionine to isoleucine at position 152, which facilitates the growth ability of rBoDV-2 (Fig. 4 ). BoDV-1 P interacts with P and L through binding domains spanning amino acid positions 135 to 172 and 135 to 183, respectively 25,32 . Additionally, previous research has indicated the presence of a nuclear export signal between amino acid positions 145 and 165 within BoDV-1 P 33 . Although the role of the amino acid residue in BoDV-1 P, corresponding to position 152 in BoDV-2 P, has yet to be explored, investigating its potential binding interactions with other viral proteins and its influence on the nuclear translocation capability of P would be of considerable interest. Detection of 3 major nonsynonymous SNPs suggests the presence of up to eight distinct BoDV-2 genomes within persistently infected Vero cells. BoDV-2 was initially isolated from the brain of an infected pony using primary young rabbit brain cells and subsequently propagated in Vero cells 5 , after which the infected Vero cells were maintained for two decades. It is unclear when and how BoDV-2 acquired the P and L gene SNPs that we found in this study. However, given the comparable proportion of genome sequences containing SNPs, even those associated with low-fitness effects on propagation in culture, it may be possible that these SNPs were acquired after isolation in vitro to maintain persistent infection within cultured cells. On the other hand, our analysis revealed that BoDV-2 does not exhibit superinfection exclusion, even toward low-fitness mutant viruses (Fig. 5 ). From this observation, it is conceivable that viruses with different sequences may have coexisted before isolation. To better understand the characteristics and evolution of BoDV-2 infection, it is necessary to examine in detail the competition for growth between viruses with genomic variants not only in vitro but also in vivo . In this study, we demonstrated that rBoDV-2 can infect cells infected with another rBoDV-2 with different replication abilities (Fig. 5 C and E), showing that BoDV-2 does not exhibit superinfection exclusion. Superinfection exclusion is a common strategy used by many viruses to prevent sequential infection by closely related viruses 34,35 . For instance, substantial infection of influenza A virus (IAV) in cells that are already infected with IAV is inhibited by the active viral replication complex 36 . It has been reported that IAV superinfection exclusion constrains interactions between viral populations locally within a host to regulate viral fitness and evolution 37 . While superinfection exclusion provides evolutionary advantages for controlling viral fitness and population diversity, it also has the effect of promoting founder effects and reducing diversity and is thought to control the balance between genetic diversification and genome integrity in infected hosts 26 . A simulation study demonstrated that although a mutant with superinfection exclusion can overtake a population that cannot exclude superinfection, superinfection enables a population to adapt to environmental changes, indicating that superinfection exclusion negatively affects the adaptation of a viral population in the long term 38 . These observations suggest that maintenance of genetic diversity through the absence of superinfection exclusion during BoDV-2 infection plays a pivotal role in the establishment of persistent infection. This might be achieved by not excluding low-fitness variants that may regulate replication dynamics and cytopathic effects as a viral population in infected cells. In previous studies, BoDV-1 superinfection in cells persistently infected with BoDV-1 was demonstrated to be excluded both in vivo and in vitro 39,40 . The authors cocultured UTA6 human osteosarcoma cells persistently infected with the BoDV-1 isolate He/80 with either uninfected or BoDV-1 isolate H215-infected Vero cells and evaluated infection of isolate He/80 to Vero cells by IFA using a monoclonal antibody that reacts with the N of He/80 but not with the N of H215. Although infection of the isolate He/80 spread efficiently from the UTA6 cells to uninfected Vero cells, the infection did not spread to the H215-infected Vero cells after 3 weeks of coculture 40 . The authors further demonstrated that expression of either N, accessory protein (X), or P is sufficient to inhibit superinfection with BoDV-1, concluding that the imbalance in intracellular levels of vRNP components is attributable to superinfection exclusion of BoDV-1 40 . However, whereas the growth abilities of both the BoDV-1 isolates H215 and He/80 were high enough for the infection to spread efficiently in the previous study, the growth ability of the two different rBoDV-2s was significantly different in our experiments (Fig. 5 C). In addition, the methods used to detect superinfection differed between these studies. Thus, further studies are necessary to investigate whether the absence of superinfection exclusion is a specific property for BoDV-2 but not for BoDV-1. In conclusion, we successfully established a reverse genetics system for BoDV-2 and revealed lack of superinfection exclusion enables BoDV-2 to maintain the genetic diversity in persistently infected cells. Our study provides valuable insights into the biological properties of BoDV-2 and contributes to development of effective vaccines and antiviral drugs for pathogenic mammalian orthobornaviruses. Materials and Methods Cell culture Human embryonic kidney (HEK) 293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Nacalai Tesque, Japan; #08456-36) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, USA; #10270-106) and 1% penicillin-streptomycin-amphotericin B solution (Fujifilm, Japan; #161-23181). African green monkey kidney Vero cells were cultured in DMEM supplemented with 5% FBS and 1% penicillin-streptomycin-amphotericin B solution. Virus Vero cells persistently infected with BoDV-2 isolate No/98 were kindly provided by Prof. Martin Schwemmle (University of Freiburg, Germany) and propagated by Dennis Rubbenstroth’s group at the Friedrich-Loeffler-Institut (FLI), Greifswald, Germany. Isolate No/98 had originally been isolated using primary young rabbit brain cells, which were subsequently cocultured with Vero cells. After consecutive passages, only Vero cells remained in the culture 5 . The exact propagation history of the isolate No/98-infected culture is unknown. RNA-seq and data processing Total RNA was extracted from persistently BoDV-2-infected Vero cells using Agencourt® RNAdvance Tissue kit (Beckman Coulter) and the KingFisher Flex system (Thermo Fisher Scientific) according to manufacturers’ instructions. Subsequent cDNA synthesis and library preparation were performed as described in Wylezich et al. 48 with slight modifications. Briefly, cDNA was synthesized using the SuperScript IV First-Strand cDNA Synthesis System (Thermo Fisher Scientific) and subsequently, the complete reaction was used for 2nd strand synthesis with the NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs), followed by DNA fragmentation with a Covaris M220 and library preparation with a GeneRead DNA Library L Core kit (QIAGEN) and ION Xpress Barcode adapters (Thermo Fisher Scientific). After size selection as described in Wylezich et al. 48 , library size was measured using a 2100 BioAnalyzer system (Agilent Technologies) with Agilent High Sensitivity DNA Chip and reagents, and the library was quantified using a QIAseq Library Quant Assay Kit (Qiagen). The library was prepared for sequencing and sequenced together with Ion Torrent Calibration Standard (Thermo Fisher) using an Ion Torrent S5 XL instrument with Ion 530 chip and reagents (Thermo Fischer Scientific) in 400 bp mode. Sequencing adapters were trimmed using the Newbler assembler of the 454 Genome Sequencer Software Suite v. 3.0 (Roche) and the FastQC was used to quality control the sequence dataset. Initial reference-based mapping (454 Genome Sequencer Software Suite v. 3.0, Roche) against RefSeq BoDV-2 strain No/98 complete genome (NC_030692) was performed to generate a sample-specific consensus sequence. This consensus sequence was used as a reference for the second round of reference-based mapping analysis. Pairwise sequence alignment of the resulting BoDV-2 genome sequence and BoDV-2 AJ311524.1 was performed MUSCLE 49 . This alignment was visually inspected with Geneious Prime® 2019.2.3 Software (Biomatters). SNPs within the BoDV-2 genome were detected using the Find Variations/SNPs program implemented in the Geneious Prime® 2019.2.3 software. For this analysis, we used the BAM file generated from the 2nd round of mapping analyses as data input and the following parameters, minimum coverage: 50, minimum variant frequency: 25%, maximum variant p -value 10 (raise to) -7, minimum strand bias p -value of 10 (raise to) -5 when exceeding 65% bias. RACE analysis Total RNA extracted from BoDV-2-infected Vero cells was ligated with either 5’ adaptor oligoRNA (5’-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3’ adaptor oligoRNA (5’-GAAGAGAAGGUGGAAAUGGCGUUUUGG; the 5’ and 3’ ends were modified with a monophosphate and an amino-modifier, respectively) using T4 RNA Ligase 1 (New England Biolabs, USA; #M0204) according to the manufacturer’s instructions. The adaptor-ligated RNA was reverse transcribed using SuperScript Ⅳ Reverse Transcriptase (Thermo Fisher Scientific, USA; #18090010) and amplified by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, USA; #M0494) according to the manufacturer’s instructions. The viral terminal sequences were analyzed via Sanger sequencing of the purified PCR amplicons. The primers used in the RACE analysis are listed in the Table. 1. Plasmid construction The plasmid used to express BoDV-2 N, P, and L were described previously 23 . Nucleotide substitutions in the P or L gene were introduced by PCR mutagenesis. A FLAG-tag sequence was inserted with a GS-linker sequence into the 5’ terminus of the L gene by PCR mutagenesis. A plasmid expressing each BoDV-2 M or G was constructed by inserting each gene into the EcoRⅠ and XhoⅠ restriction enzyme recognition sites of the eukaryotic expression plasmid pCAGGS 41 . For both plasmids, synonymous substitutions were introduced by PCR mutagenesis into the splicing donor and acceptor sites to increase protein expression levels 20,42 . An RNA polymerase Ⅱ (Pol Ⅱ)-driven BoDV-2 minigenome plasmid was constructed similarly to the BoDV-1 minireplicon plasmid described previously 23 . In brief, a Gaussia luciferase (Gluc) reporter gene flanked by the 3’ and 5’ untranslated regions of BoDV-2 in the negative-sense orientation was inserted into the XhoⅠ and NotⅠ restriction enzyme recognition sites of pCAG-HRSV3 43 , with a hammerhead ribozyme (HamRz) sequence at the 5’ end and a hepatitis delta virus ribozyme (HdvRz) sequence at the 3’ end. A BoDV-2 cDNA plasmid that expresses the full-length antigenomic RNA of BoDV-2 strain No/98 was constructed similarly to the corresponding BoDV-1 cDNA plasmid described previously 44 . In brief, an artificially synthesized full-length cDNA identical to the published reference sequence of BoDV-2 isolate No/98 was inserted into the XhoⅠ and NotⅠ restriction enzyme recognition sites of pCAG-HRSV3 43 with an HamRz sequence at the 5’ end and an HdvRz sequence at the 3’ end. A BoDV-2 cDNA plasmid that harbors an additional expression cassette between the P and M genes was constructed by inserting a gene of interest flanked by the MluⅠ and PacⅠ restriction enzyme recognition sequences with the repeated 2nd gene end (GE2) and the 3rd gene start (GS3) signal sequences by PCR mutagenesis (Fig. 5 A) 44 . Western blotting Cultured cells were lysed with 1x sample buffer (50 mM Tris-HCl, pH 6.8; 2% sodium dodecyl sulfate (SDS); 5% w/v sucrose; and 5% 2-mercaptoethanol) followed by boiling at 95°C for 10 minutes. Cell lysates were subjected to SDS-PAGE using an ePAGEL (ATTO Corporation, Japan; #2331720), and proteins were subsequently transferred to Trans-Blot® Turbo™ Mini nitrocellulose membranes (Bio-Rad, USA; #1704156). The membranes were blocked with blocking buffer (TBS containing 0.1% Tween-20 with 5% w/v skim milk) and then incubated with the primary antibody (anti-FLAG M2 (Sigma-Aldrich, USA; #F1804) or anti-alpha-tubulin (Sigma-Aldrich, USA; #T5168)), followed by incubation with the secondary antibody (horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Jackson ImmunoResearch, USA; #715-035-150). The protein bands were detected with Clarity Western ECL substrate reagents (Bio-Rad, USA; #170–5060), and chemiluminescence signals were visualized by Fusion Solo S (Vilber, France). BoDV-2 minireplicon assay HEK293T cells seeded into 48-well plates were transfected with 50 ng of BoDV-2 minigenome plasmid, 50 ng of pCAGGS-BoDV-2 N, 5 ng of pCAGGS-BoDV-2 P, 50 ng of pCAGGS-BoDV-2 L, and 5 ng of control plasmid expressing Cypridina luciferase using TransIT293 (Mirus, USA; #MIR2700) according to the manufacturer’s instructions. At 48 hours post transfection, Gaussia luciferase and Cypridina luciferase expression levels were measured with a Biolux Gaussia luciferase assay kit (New England Biolabs, USA; #E3300) and Biolux Cypridina luciferase assay kit (New England Biolabs, USA; #E3309), respectively, according to the manufacturer’s instructions. Luminescence signals were detected by a GloMax Discover Microplate Reader (Promega, USA), and polymerase activity was quantified by normalizing Gaussia luciferase activity to Cypridina luciferase activity. Reverse genetics of BoDV-2 Reverse genetics was performed according to the protocol summarized in our previous review article 21 . HEK293T cells seeded into 6-well plates were transfected with 2.0 µg of BoDV-2 cDNA plasmid, 0.5 µg of pCAGGS-BoDV-2 N, 0.025 µg of pCAGGS-BoDV-2 P, 0.25 µg of pCAGGS-BoDV-1 L, 0.04 µg of pCAGGS-BoDV-2 M, and 0.01 µg of pCAGGS-BoDV-2 G using TransIT293 according to the manufacturer’s instructions. At 3 days post transfection, the transfected cells were cocultured with uninfected Vero cells, which were passaged every 3 or 4 days until the infection spread to almost all the Vero cells. The transfected HEK293T cells were removed by adding 1.0 µg/mL puromycin (InvivoGen, USA; #ant-pr) at the optimal time point. Immunofluorescence assay Cultured cells were fixed with 4% paraformaldehyde (Nacalai Tesque, Japan; #09154-85) for 10 minutes and permeabilized with PBS containing 0.5% Triton X-100 (Wako, Japan; #169-21105) and 5% bovine serum albumin (Sigma-Aldrich, USA; #A3059) for 10 minutes. The cells were incubated with the primary antibody (polyclonal rabbit serum anti-BoDV N HB01), followed by incubation with the secondary antibody (Alexa Fluor® 555-conjugated anti-rabbit IgG (Thermo Fisher Scientific, USA; #A21429)) and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon, Japan). RT-qPCR Total RNA was extracted from cultured cells using NucleoSpin RNA Plus (Macherey-Nagle, Germany; #740984) according to the manufacturer’s instructions. For detection of BoDV-2 RNA, RT-qPCR was performed using qScript XLT one-step RT-qPCR ToughMix Kit (Quanta Biosciences, USA; #95132) with forward primer (5’-TAGTYAGGAGGCTCAATGGCA), reverse primer (5’-GTCCYTCAGGAGCTGGTC), and probe (5’-FAM-AAGAAGATCCCCAGACACTACGACG-BHQ1). Each reaction contained 2.75 µl of RNase-free water, 6.25 µl of 2x qScript XLT One-Step RT-qPCR ToughMix, 1.0 µl of primer-probe mix (7.5 pmol/µl primer and 2.5 pmol/µl probe) and 2.5 µl of RNA template (approximately 500 ng of total RNA) or RNase-free water for the no template control in a total volume of 12.5 µl. The thermal program consisted of 1 cycle of 50°C for 10 min and 95°C for 1 min, followed by 40 cycles of 95°C for 10 sec, 57°C for 30 sec, and 68°C for 30 sec 8 . For detection of GAPDH mRNA, approximately 500 ng of total RNA was reverse transcribed using the Verso cDNA synthesis kit (Thermo Fisher Scientific, USA; #AB1453) with anchored oligo dT primer according to the manufacturer’s instructions. qPCR was performed using Luna Universal qPCR Master Mix (New England Biolabs, USA; #M3003) with forward (5’-ATCTTCTTTTGCGTCGCCAG) and reverse (5’-ACGACCAAATCCGTTGACTCC) primers. Each reaction contained 8.0 µl of RNase-free water, 10.0 µl of Luna Universal qPCR Master Mix, 1.0 µl of primer mixture (10.0 pmol/µl primer) and 1.0 µl of synthesized cDNA or RNase-free water for the no template control in a total volume of 20.0 µl. The thermal program consisted of 1 cycle of 95°C for 1 min and 40 cycles of 95°C for 10 sec and 60°C for 30 sec, followed by a melting reaction. All reactions were performed with a CFX Connect real-time system (Bio-Rad, USA), and relative expression levels of BoDV-2 RNA were calculated via the relative quantification method with GAPDH mRNA serving as a reference. Flow cytometry Cultured cells were fixed with 4% paraformaldehyde for 20 minutes and suspended in PBS containing 2.0% FBS. Proportions of cells expressing either or both mCherry and GFP were analyzed by a CytoFLEX S flow cytometer (Beckman Coulter, USA). The criterion for assessing the extent of positive detection of each mCherry or GFP signal was set using mock-infected cells as a negative control. Amplicon sequencing Total RNA was extracted from cultured cells using NucleoSpin RNA Plus according to the manufacturer’s instructions. BoDV-2 genomic RNA was reverse transcribed using SuperScript Ⅳ Reverse Transcriptase with a genome-specific primer (5’- AGGGACACTCTCGTTCTCCA) according to the manufacturer’s instructions. To prepare the sequencing library, the 1st PCR product ranging from position 3556 to 3954 of the L gene was amplified from 1.0 µl of cDNA using Q5 Hot Start High-Fidelity 2x Master Mix with forward (5’-acactctttccctacacgacgctcttccgatctGGATGCCTCTATGCTGACTCTG) and reverse (5’-gtgactggagttcagacgtgtgctcttccgatctACCAACCAGGAATCGCCAAA) primers. Then, amplicon sequencing was performed by the Bioengineering Lab. Co., Ltd. Briefly, the 2nd PCR product was amplified from 10 ng purified 1st PCR product using the TaKaRa Ex Taq HS (TaKaRa Bio Inc., Japan; #RR006A) with a forward (5’- AATGATACGGCGACCACCGAGATCTACAC- Index2 -ACACTCTTTCCCTACACGACGC) and reverse (5’- CAAGCAGAAGACGGCATACGAGAT- Index1 -GTGACTGGAGTTCAGACGTGTG) primers. Sequencing of the purified 2nd PCR products was performed using the MiSeq system and MiSeq Reagent Kit v3 (Illumina, USA) with a 2x300 bp read length protocol. Adaptor and primer sequences were removed from the raw sequence reads using the FASTX Toolkit (ver. 0.0.14) 45 . Low-quality and short reads were also removed using Sickle (ver. 1.33) with criteria of a quality score of < Q20 and a read length of ≤ 40 bp 46 . Filtered reads were merged using FLASH (ver. 1.2.11) with default settings 47 . The number of BoDV-2 genotypes was counted by analyzing the nucleotide at position 3743 in each read. Statistical analysis All statistical analyses were performed with GraphPad Prism 10 software. The tests used for each experiment are described in figure legends. Declarations Acknowledgments We are grateful to Prof. Martin Schwemmle (University of Freiburg, Germany) for providing BoDV-2-infected Vero cells and to Andrea Aebischer, Doreen Schulz, Patrick Zitzow, and Kathrin Steffen (Friedrich-Loeffler-Institut, Germany) for their technical support. We also thank Prof. Masayuki Horie (Osaka Metropolitan University, Japan) for supporting bilateral research. This study was supported in part by JSPS KAKENHI grants JP19J23468 (TK), JP22K20507 (TK), JP23K14083 (TK), JP19K22530 (KT), JP20H05682 (KT), and JP21K19909 (KT); JSPS Overseas Challenge Program for Young Researchers grant 202080194 (TK); JSPS Core-to-Core Program JPJSCCA20190008 (KT); Kaketsuken Research Grant (KT); the Joint Usage/Research Center Program on Institute for Life and Medical Sciences, Kyoto University (KT); Institute for Life and Medical Sciences Office of Directors’ Research Grants Program, Kyoto University (TK); and the German Federal Ministry of Education and Research, Zoonotic Bornavirus Consortium (ZooBoCo), grants 01KI1722 and 01KI2005 (DR, MB, and DH). Author contributions TK and DR designed the study. TK, PDS, DH, and DR performed experiments and analyzed data. MB, DR, and KT supervised the project. TK and KT wrote the manuscript. All authors reviewed and approved the manuscript. Competing interests All authors declare no financial or non-financial competing interests. Data availability The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Code availability No custom code and scripts were used during data analysis. The versions of the software are described in Materials and Methods. References Richt, J. A. & Rott, R. Borna disease virus: a mystery as an emerging zoonotic pathogen. Vet. J. 161, 24–40 (2001). https://doi.org:10.1053/tvjl.2000.0533 Kinnunen, P. M., Palva, A., Vaheri, A. & Vapalahti, O. Epidemiology and host spectrum of Borna disease virus infections. J. Gen. Virol. 94, 247–262 (2013). https://doi.org:10.1099/vir.0.046961-0 Rubbenstroth, D. Avian Bornavirus Research-A Comprehensive Review. Viruses 14 (2022). https://doi.org:10.3390/v14071513 Kuhn, J. H. et al. Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota). J. Gen. Virol. 104 (2023). https://doi.org:10.1099/jgv.0.001864 Nowotny, N. et al. Isolation and characterization of a new subtype of Borna disease virus. J. Virol. 74, 5655–5658 (2000). https://doi.org:10.1128/jvi.74.12.5655-5658.2000 Pleschka, S. et al. Conservation of coding potential and terminal sequences in four different isolates of Borna disease virus. J. Gen. Virol. 82, 2681–2690 (2001). https://doi.org:10.1099/0022-1317-82-11-2681 Korn, K. et al. Fatal Encephalitis Associated with Borna Disease Virus 1. N. Engl. J. Med. 379, 1375–1377 (2018). https://doi.org:10.1056/NEJMc1800724 Schlottau, K. et al. Fatal Encephalitic Borna Disease Virus 1 in Solid-Organ Transplant Recipients. N. Engl. J. Med. 379, 1377–1379 (2018). https://doi.org:10.1056/NEJMc1803115 Coras, R., Korn, K., Kuerten, S., Huttner, H. B. & Ensser, A. Severe bornavirus-encephalitis presenting as Guillain-Barre-syndrome. Acta Neuropathol. 137, 1017–1019 (2019). https://doi.org:10.1007/s00401-019-02005-z Liesche, F. et al. The neuropathology of fatal encephalomyelitis in human Borna virus infection. Acta Neuropathol. 138, 653–665 (2019). https://doi.org:10.1007/s00401-019-02047-3 Niller, H. H. et al. Zoonotic spillover infections with Borna disease virus 1 leading to fatal human encephalitis, 1999–2019: an epidemiological investigation. The Lancet Infectious Diseases 20, 467–477 (2020). https://doi.org:10.1016/s1473-3099(19)30546-8 Eisermann, P. et al. Active Case Finding of Current Bornavirus Infections in Human Encephalitis Cases of Unknown Etiology, Germany, 2018–2020. Emerg. Infect. Dis. 27, 1371–1379 (2021). https://doi.org:10.3201/eid2705.204490 Tappe, D. et al. Investigation of fatal human Borna disease virus 1 encephalitis outside the previously known area for human cases, Brandenburg, Germany - a case report. BMC Infect. Dis. 21, 787 (2021). https://doi.org:10.1186/s12879-021-06439-3 Frank, C. et al. Human Borna disease virus 1 (BoDV-1) encephalitis cases in the north and east of Germany. Emerg Microbes Infect 11, 6–13 (2022). https://doi.org:10.1080/22221751.2021.2007737 Grosse, L. et al. First detected geographical cluster of BoDV-1 encephalitis from same small village in two children: therapeutic considerations and epidemiological implications. Infection, 1–16 (2023). https://doi.org:10.1007/s15010-023-01998-w Hoffmann, B. et al. A Variegated Squirrel Bornavirus Associated with Fatal Human Encephalitis. N. Engl. J. Med. 373, 154–162 (2015). https://doi.org:10.1056/NEJMoa1415627 Rubbenstroth, D., Schlottau, K., Schwemmle, M., Rissland, J. & Beer, M. Human bornavirus research: Back on track! PLoS Pathog. 15, e1007873 (2019). https://doi.org:10.1371/journal.ppat.1007873 Schneider, U., Schwemmle, M. & Staeheli, P. Genome trimming: a unique strategy for replication control employed by Borna disease virus. Proc. Natl. Acad. Sci. U. S. A. 102, 3441–3446 (2005). https://doi.org:10.1073/pnas.0405965102 Martin, A., Staeheli, P. & Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. J. Virol. 80, 5708–5715 (2006). https://doi.org:10.1128/JVI.02389-05 Kanda, T., Sakai, M., Makino, A. & Tomonaga, K. Exogenous expression of both matrix protein and glycoprotein facilitates infectious viral particle production of Borna disease virus 1. J. Gen. Virol. 103 (2022). https://doi.org:10.1099/jgv.0.001767 Kanda, T. & Tomonaga, K. Reverse Genetics and Artificial Replication Systems of Borna Disease Virus 1. Viruses 14 (2022). https://doi.org:10.3390/v14102236 Martin, A., Hoefs, N., Tadewaldt, J., Staeheli, P. & Schneider, U. Genomic RNAs of Borna disease virus are elongated on internal template motifs after realignment of the 3' termini. Proc. Natl. Acad. Sci. U. S. A. 108, 7206–7211 (2011). https://doi.org:10.1073/pnas.1016759108 Kanda, T., Horie, M., Komatsu, Y. & Tomonaga, K. The Borna Disease Virus 2 (BoDV-2) Nucleoprotein Is a Conspecific Protein That Enhances BoDV-1 RNA-Dependent RNA Polymerase Activity. J. Virol. 95, e0093621 (2021). https://doi.org:10.1128/JVI.00936-21 Walker, M. P., Jordan, I., Briese, T., Fischer, N. & Lipkin, W. I. Expression and characterization of the Borna disease virus polymerase. J. Virol. 74, 4425–4428 (2000). https://doi.org:10.1128/jvi.74.9.4425-4428.2000 Schneider, U., Blechschmidt, K., Schwemmle, M. & Staeheli, P. Overlap of interaction domains indicates a central role of the P protein in assembly and regulation of the Borna disease virus polymerase complex. J. Biol. Chem. 279, 55290–55296 (2004). https://doi.org:10.1074/jbc.M408913200 Andino, R. & Domingo, E. Viral quasispecies. Virology 479–480, 46–51 (2015). https://doi.org:10.1016/j.virol.2015.03.022 Ogino, T. & Banerjee, A. K. An unconventional pathway of mRNA cap formation by vesiculoviruses. Virus Res. 162, 100–109 (2011). https://doi.org:10.1016/j.virusres.2011.09.012 Walker, M. P. & Lipkin, W. I. Characterization of the nuclear localization signal of the borna disease virus polymerase. J. Virol. 76, 8460–8467 (2002). https://doi.org:10.1128/jvi.76.16.8460-8467.2002 Honda, T. & Tomonaga, K. Nucleocytoplasmic shuttling of viral proteins in borna disease virus infection. Viruses 5, 1978–1990 (2013). https://doi.org:10.3390/v5081978 Nishino, Y., Kobasa, D., Rubin, S. A., Pletnikov, M. V. & Carbone, K. M. Enhanced neurovirulence of borna disease virus variants associated with nucleotide changes in the glycoprotein and L polymerase genes. J. Virol. 76, 8650–8658 (2002). https://doi.org:10.1128/jvi.76.17.8650-8658.2002 Ackermann, A., Kugel, D., Schneider, U. & Staeheli, P. Enhanced polymerase activity confers replication competence of Borna disease virus in mice. J. Gen. Virol. 88, 3130–3132 (2007). https://doi.org:10.1099/vir.0.83170-0 Schwemmle, M. et al. Interactions of the borna disease virus P, N, and X proteins and their functional implications. J. Biol. Chem. 273, 9007–9012 (1998). https://doi.org:10.1074/jbc.273.15.9007 Yanai, H. et al. A methionine-rich domain mediates CRM1-dependent nuclear export activity of Borna disease virus phosphoprotein. J. Virol. 80, 1121–1129 (2006). https://doi.org:10.1128/JVI.80.3.1121-1129.2006 Kumar, N., Sharma, S., Barua, S., Tripathi, B. N. & Rouse, B. T. Virological and Immunological Outcomes of Coinfections. Clin. Microbiol. Rev. 31 (2018). https://doi.org:10.1128/cmr.00111-17 Laureti, M., Paradkar, P. N., Fazakerley, J. K. & Rodriguez-Andres, J. Superinfection Exclusion in Mosquitoes and Its Potential as an Arbovirus Control Strategy. Viruses 12 (2020). https://doi.org:10.3390/v12111259 Sun, J. & Brooke, C. B. Influenza A Virus Superinfection Potential Is Regulated by Viral Genomic Heterogeneity. mBio 9 (2018). https://doi.org:10.1128/mBio.01761-18 Sims, A. et al. Superinfection exclusion creates spatially distinct influenza virus populations. PLoS Biol. 21, e3001941 (2023). https://doi.org:10.1371/journal.pbio.3001941 Hunter, M. & Fusco, D. Superinfection exclusion: A viral strategy with short-term benefits and long-term drawbacks. PLoS Comput. Biol. 18, e1010125 (2022). https://doi.org:10.1371/journal.pcbi.1010125 Formella, S., Jehle, C., Sauder, C., Staeheli, P. & Schwemmle, M. Sequence variability of Borna disease virus: resistance to superinfection may contribute to high genome stability in persistently infected cells. J. Virol. 74, 7878–7883 (2000). https://doi.org:10.1128/jvi.74.17.7878-7883.2000 Geib, T. et al. Selective virus resistance conferred by expression of Borna disease virus nucleocapsid components. J. Virol. 77, 4283–4290 (2003). https://doi.org:10.1128/jvi.77.7.4283-4290.2003 Niwa, H., Yamamura, K. & Miyazaki, J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193–199 (1991). https://doi.org:10.1016/0378-1119(91)90434-d Sakai, M. et al. Optimal expression of the envelope glycoprotein of orthobornaviruses determines the production of mature virus particles. J. Virol. 95 (2020). https://doi.org:10.1128/jvi.02221-20 Yanai, H. et al. Development of a novel Borna disease virus reverse genetics system using RNA polymerase II promoter and SV40 nuclear import signal. Microbes Infect 8, 1522–1529 (2006). https://doi.org:10.1016/j.micinf.2006.01.010 Daito, T. et al. A novel borna disease virus vector system that stably expresses foreign proteins from an intercistronic noncoding region. J. Virol. 85, 12170–12178 (2011). https://doi.org:10.1128/JVI.05554-11 Gordon, A. & Hannon, G. J. Fastx-toolkit. FASTQ/A short-reads pre-processing tools. (2010). http://hannonlab.cshl.edu/fastx_toolkit Joshi, N. & Fass, J. Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files. (2011). https://github.com/najoshi/sickle Magoč, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27, 2957–2963 (2011). https://doi.org:10.1093/bioinformatics/btr507 Wylezich C, Papa A, Beer M, Höper D. A. Versatile Sample Processing Workflow for Metagenomic Pathogen Detection. Sci Rep. 8, 13108 (2018). http://doi.org:10.1038/s41598-018-31496-1 Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797 (2004). http://doi.org:10.1093/nar/gkh340 Tables Table 1 is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files floatimage64.png Table. 1. Primers used in the 5’ and 3’ RACE analysis for BoDV-2 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Jul, 2024 Reviews received at journal 29 Jul, 2024 Reviews received at journal 22 Jul, 2024 Reviewers agreed at journal 15 Jul, 2024 Reviewers agreed at journal 14 Jul, 2024 Reviewers invited by journal 09 Jul, 2024 Editor assigned by journal 09 Jul, 2024 Submission checks completed at journal 09 Jul, 2024 First submitted to journal 07 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4544977","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":333018653,"identity":"60d8cc7e-15e6-4e11-a63d-48bb028dac5b","order_by":0,"name":"Takehiro Kanda","email":"","orcid":"","institution":"Kyoto University","correspondingAuthor":false,"prefix":"","firstName":"Takehiro","middleName":"","lastName":"Kanda","suffix":""},{"id":333018654,"identity":"92d347d2-3faf-459d-9872-59c374b43dea","order_by":1,"name":"PaulineDianne Santos","email":"","orcid":"","institution":"Friedrich-Loeffler-Institute","correspondingAuthor":false,"prefix":"","firstName":"PaulineDianne","middleName":"","lastName":"Santos","suffix":""},{"id":333018657,"identity":"f2456337-761a-4a6d-a82a-12326e9a8ee7","order_by":2,"name":"Dirk Höper","email":"","orcid":"","institution":"Friedrich-Loeffler-Institute","correspondingAuthor":false,"prefix":"","firstName":"Dirk","middleName":"","lastName":"Höper","suffix":""},{"id":333018658,"identity":"d518dca0-ba5e-484f-b4eb-4364915d499e","order_by":3,"name":"Martin Beer","email":"","orcid":"","institution":"Friedrich-Loeffler-Institute","correspondingAuthor":false,"prefix":"","firstName":"Martin","middleName":"","lastName":"Beer","suffix":""},{"id":333018659,"identity":"583beee4-23a3-4bd7-95e7-9867a3539ba5","order_by":4,"name":"Dennis Rubbenstroth","email":"","orcid":"","institution":"Friedrich-Loeffler-Institute","correspondingAuthor":false,"prefix":"","firstName":"Dennis","middleName":"","lastName":"Rubbenstroth","suffix":""},{"id":333018661,"identity":"e4cd0f8a-e16c-46b6-ac47-1525ec59a676","order_by":5,"name":"Keizo Tomonaga","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNElEQVRIie2QMUvDQBSAX4kky4tZL6ToX2goKEKkfyUhcE6K0KVDbTNdB6uu8V9YBOcLgcsSd0GXEuicLiWTeI0FrWnAUTAf3HvvjvfxeAfQ0PCnQQAu0xg09uO52rituICiTL9ToOwl9LtSpadde9nl8OoQMI6iYgAXx/cLSpaFAx2uzHNov1Wm4PNjNxSJHejM5SSFfvuVCjN0qVTULgFcVBRy/mShKlqBgR1uM2iF1hmz0I3HDxyOZEO8W3kXvcAwcu6tFTMpFTlFW9UqOht6gT4FHjHwQqKKjYK7p6RyF/2W+wxFJwpS0iVI/ZOQUjBj7BO3uos2uZlluBqd3qGfLYuBc0A0Yb/kjgP7yWSWL6eVH9sQg/pZkHXYKyMo8nhTXqOMtm5K/lUXdUpDQ0PD/+EDHYhqLUPzUtQAAAAASUVORK5CYII=","orcid":"","institution":"Kyoto University","correspondingAuthor":true,"prefix":"","firstName":"Keizo","middleName":"","lastName":"Tomonaga","suffix":""}],"badges":[],"createdAt":"2024-06-07 09:06:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4544977/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4544977/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61590952,"identity":"984066ab-b359-47f3-85a9-d06e37f89bd5","added_by":"auto","created_at":"2024-08-01 15:27:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":95775,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReassessment of the complete genome sequence of BoDV-2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) RNA-seq analysis of total RNA extracted from BoDV-2 isolate No/98-infected Vero cells. Compared to the reference sequence (RefSeq) of BoDV-2 (accession no. NC_030692), substituted nucleotides in the reassessed sequence are represented in bold orange, and their percentages of the total are indicated. Concomitant amino acid changes are also represented in bold orange. (B) Schematic representation of BoDV-2 L. The putative RNA-dependent RNA polymerase (RdRp) domain, polyribonucleotidyltransferase (PRNTase) domain, and C-terminal domain (CTD) are colored blue, green, and gray, respectively. Blocks of amino acid differences between BoDV-1 L and BoDV-2 L in the CTD, which were described in the previous study (6), are represented with pale red bars. The positions at which amino acid changes occur between the reassessed and reference sequences are indicated above, and putative motif C (W) and motif D (HR) in the PRNTase domain are indicated below. (C) RACE analysis of the 5’ and 3’ terminal sequences of both the genome and antigenome of BoDV-2. The 5’ and 3’ ends of total RNA extracted from BoDV-2-infected Vero cells were ligated with each oligoRNA. BoDV-2-specific 5’ and 3’ terminal sequences were amplified via RT-PCR and analyzed via direct sequencing. The border between the viral terminal sequence and ligated oligoRNA is indicated by the dotted line. The analyzed terminal sequences are indicated schematically. (D) Comparison of the reassessed genomic terminal sequences of BoDV-2 with the reference sequence.\u003c/p\u003e","description":"","filename":"floatimage128.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/d868e2942a1c14b601f23efb.png"},{"id":61590954,"identity":"4866a6e2-65c2-4c36-8c6d-61542ac55284","added_by":"auto","created_at":"2024-08-01 15:27:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":144146,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe polymerase activity of BoDV-2 L is restored by substituting a nucleotide.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic representation of the BoDV-2 L gene variants inserted into the expression plasmid and the full-length BoDV-2 cDNA plasmid. The positions of the substituted nucleotides compared to the reference sequence are indicated by red bars. The putative RdRp domain, PRNTase domain, and CTD are colored blue, green, and gray, respectively. (B) Detection of BoDV-2 L variants by western blotting analysis. Whole-cell lysates were prepared from 293T cells transfected with the indicated plasmid. The primary antibodies used for detection are indicated to the right of the panels. Alpha-tubulin was used as the loading control. (C) BoDV-2 minireplicon assay using the indicated BoDV-2 L variants and BoDV-2 N and P as helper plasmids. Data are presented as the means ± standard errors of the means (± SEM) of three biologically independent experiments. One-way analysis of variance (ANOVA) and Tukey’s multiple comparisons test were performed for statistical analysis. ns, not significant; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; Gluc, \u003cem\u003eGaussia\u003c/em\u003e luciferase; RLU, relative light unit. (D) Detection of rBoDV-2 by immunofluorescence assay (IFA). Reverse genetics was performed by transfecting a BoDV-2 cDNA plasmid possessing the indicated substitution in the L gene and five helper plasmids into HEK293T cells. At 3 days post transfection, transfected HEK293T cells were cocultured with uninfected Vero cells. After 14 days of coculture and complete removal of transfected HEK293T cells, Vero cells were subjected to IFA using an antibody against BoDV N. Nuclei were counterstained with DAPI. Bar, 500 μm. (E to G) Growth kinetics assay of rBoDV-2. (E) Schematic representation of the growth kinetics assay. Vero cells infected with BoDV-2 isolate No/98 or with rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e were cocultured with uninfected Vero cells at a ratio of 1 to 19 and passaged every 3 or 4 days. (F) The percentage of infected cells was determined by IFA using an antibody against BoDV N. DPC, days post coculture. (G) The copy number of viral RNA was measured via RT-qPCR using total RNA extracted from each cells. DPC, days post coculture.\u003c/p\u003e","description":"","filename":"floatimage223.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/e21003619cf7d9ae6bbf328a.png"},{"id":61591630,"identity":"52ddb1fd-5e06-4700-9c3c-5ba100405abe","added_by":"auto","created_at":"2024-08-01 15:35:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":49950,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNonsynonymous SNPs in the L gene facilitate the growth of BoDV-2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic representation of the BoDV-2 L gene variants inserted into the expression plasmid and the full-length BoDV-2 cDNA plasmid. The positions of the substituted nucleotides compared to the reference sequence are indicated by red bars. The putative RdRp domain, PRNTase domain, and CTD are colored blue, green, and gray, respectively. (B) BoDV-2 minireplicon assay using the indicated BoDV-2 L variants and BoDV-2 N and P as helper plasmids. Values for Gluc activity were normalized to that of the L\u003csub\u003eRG\u003c/sub\u003e variant as a relative value of 1.0. Data are presented as the means ± SEM of three biologically independent experiments. One-way ANOVA and Dunnett’s multiple comparisons test were performed for statistical analysis. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. (C and D) Growth kinetics assay of rBoDV-2 variants. Vero cells infected with the indicated rBoDV-2 were cocultured with uninfected Vero cells at a ratio of 1 to 19 and passaged every 3 or 4 days. DPC, days post coculture. (C) The percentage of infected cells was determined by IFA using an antibody against BoDV N. (D) The copy number of viral RNA was measured via RT-qPCR using total RNA extracted from each cells. Data are presented as the means ± SEM of three biologically independent experiments. Two-way ANOVA and Tukey’s multiple comparisons test were performed for statistical analysis. Different characters (a, b, c) represent statistically significant differences at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage317.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/dbcfc03be1dace866b3d450e.png"},{"id":61590950,"identity":"ed7f9f79-1436-4f36-8c7f-dbc61d4b2946","added_by":"auto","created_at":"2024-08-01 15:27:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":57839,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA nonsynonymous SNP in the P gene expedites the growth of BoDV-2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A and B) BoDV-2 minireplicon assays using the indicated BoDV-2 P variants and BoDV-2 N and (A) L\u003csub\u003eRG\u003c/sub\u003e or (B) L\u003csub\u003eRGTR\u003c/sub\u003e as helper plasmids. Data are presented as the means ± SEM of three biologically independent experiments. An unpaired \u003cem\u003et\u003c/em\u003e-test was performed for statistical analysis. ns, not significant; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01. (C to F) Growth kinetics assay of rBoDV-2 variants. Vero cells infected with the indicated rBoDV-2 were cocultured with uninfected Vero cells at a ratio of 1 to 19 and passaged every 3 or 4 days. DPC, days post coculture. (C and D) The percentage of infected cells was determined by IFA using an antibody against BoDV N. (E and F) The copy number of viral RNA was measured via RT-qPCR using total RNA extracted from each cells. The data are presented as the means ± SEM of three biologically independent experiments. Two-way ANOVA and Tukey’s or Sidak’s multiple comparisons test were performed for statistical analysis. **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage413.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/9455aa23286fd4046de6d0d1.png"},{"id":61590953,"identity":"019fc7a1-97ff-4911-b82f-c33be010d8f2","added_by":"auto","created_at":"2024-08-01 15:27:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":153416,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLack of superinfection exclusion maintains the low-fitness polymorphism in cells persistently infected with BoDV-2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic representation of rBoDV-2 harboring an artificial expression cassette for the gene of interest (GOI) between the P and M genes. (B) Growth kinetics assay of rBoDV-2 harboring a fluorescent protein. Vero cells infected with rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-mCherry or rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP were cocultured with uninfected Vero cells at a ratio of 1 to 19 and passaged every 3 or 4 days. The ratio of cells expressing fluorescent proteins was measured via flow cytometry. DPC, days post coculture. Data are presented as the means ± SEM of three biologically independent experiments. Two-way ANOVA and Sidak’s multiple comparisons test were performed for statistical analysis. **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ns, not significant. (C and D) Competition assay between rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP. The rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry-infected, rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP-infected, and uninfected Vero cells were cocultured at a ratio of 1 to 1 to 23 and passaged every 3 or 4 days. DPC, days post coculture. (C) The ratio of cells expressing fluorescent proteins was measured via flow cytometry. Representative data at 0 and 14 DPC are shown. (D) A nucleotide at position 3743 of the L gene was analyzed via amplicon sequencing, and the ratios of uracil to cytosine, which represent rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP, respectively, were compared. (E and F) Competition assay between rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP. The rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry-infected and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP-infected Vero cells were cocultured at a ratio of 1 to 1 and passaged every 3 or 4 days. DPC, days post coculture. (E) The ratio of cells expressing fluorescent proteins was measured via flow cytometry. Representative data at 0 and 14 DPC are shown. (F) A nucleotide at position 3743 of the L gene was analyzed via amplicon sequencing, and the ratios of uracil to cytosine, which represent rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP, respectively, were compared. (G) Isolation of Vero cells coinfected with rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP. Bar, 500 μm. (H) Growth kinetics assay of rBoDV-2. Vero cells coinfected with rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry and rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP were cocultured with uninfected Vero cells at a ratio of 1 to 19 and passaged every 3 or 4 days. DPC, days post coculture. The ratio of cells expressing fluorescent proteins was measured via flow cytometry and representative data at 0 and 14 DPC are shown. (C, E, and H) Data are presented as the means ± SEM of three biologically independent experiments. (D and F) Data are presented as the means ± SEM of three biologically independent experiments. Two-way ANOVA and Sidak’s multiple comparisons test were performed for statistical analysis. **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01; ns, not significant.\u003c/p\u003e","description":"","filename":"floatimage59.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/973a6bd0468828ead09229cd.png"},{"id":61592091,"identity":"987b5a64-8eae-4a9a-8942-8a60e2417834","added_by":"auto","created_at":"2024-08-01 15:43:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1135497,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/57dbcb37-465f-4d49-8bb1-997855ae7476.pdf"},{"id":61590949,"identity":"fe690cd8-a7aa-4c9d-9e75-f27a4c9443f7","added_by":"auto","created_at":"2024-08-01 15:27:40","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":23266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable. 1. Primers used in the 5’ and 3’ RACE analysis for BoDV-2\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage64.png","url":"https://assets-eu.researchsquare.com/files/rs-4544977/v1/7c66807a76ae4cf1277e42a7.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Absence of superinfection exclusion of Borna disease virus 2 maintains genomic polymorphisms in persistently infected cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eViruses of the genus \u003cem\u003eOrthobornavirus\u003c/em\u003e within the family \u003cem\u003eBornaviridae\u003c/em\u003e have been documented to infect a wide range of vertebrate species, including mammals and avians \u003csup\u003e1\u0026ndash;3\u003c/sup\u003e. Currently, the genus comprises 25 viruses belonging to 9 different viral species \u003csup\u003e4\u003c/sup\u003e. Among these, \u003cem\u003eOrthobornavirus bornaense\u003c/em\u003e consists of two mammalian viruses: Borna disease virus 1 (BoDV-1), the prototype of the family \u003cem\u003eBornaviridae\u003c/em\u003e, and BoDV-2, a genetically closely related virus to BoDV-1. BoDV-1 has been identified as the etiological agent of Borna disease (BD), a nonpurulent encephalomyelitis affecting horses, sheep, and other mammalian species \u003csup\u003e1,2\u003c/sup\u003e. Conversely, BoDV-2 was only isolated from a single case of a pony showing severe and incurable neurological symptoms in eastern Austria in 1999, where BoDV-1 was not endemic \u003csup\u003e5\u003c/sup\u003e. Although the genome sequence of BoDV-2 isolate No/98 shares approximately 80% nucleotide identity with that of BoDV-1 strains \u003csup\u003e6\u003c/sup\u003e, its virological properties, including host range, replication ability, and pathogenicity, have not been fully elucidated.\u003c/p\u003e \u003cp\u003eThe pathogenicity of BoDV-1 in humans was controversial until two case studies were reported in 2018; these studies demonstrated the presence of the BoDV-1 antigen and RNA in a healthy young man and in two organ transplant recipients who died of encephalitis \u003csup\u003e7,8\u003c/sup\u003e. Subsequently, several studies have reported that infection with BoDV-1 was associated with more than forty fatal cases of encephalitis in humans \u003csup\u003e9\u0026ndash;15\u003c/sup\u003e. Additionally, variegated squirrel bornavirus 1 (VSBV-1; species \u003cem\u003eOrthobornavirus sciuri\u003c/em\u003e) was isolated from squirrel breeders who died of encephalitis \u003csup\u003e16\u003c/sup\u003e. Therefore, both BoDV-1 and VSBV-1 are zoonotic pathogens that cause fatal encephalitis in humans \u003csup\u003e17\u003c/sup\u003e. However, the potential of BoDV-2 to infect and cause disease in humans remains unclear. Considering that BoDV-2 isolate No/98 was isolated from a pony that displayed fatal neurological disorders and that BoDV-2 is genetically more closely related to BoDV-1 than VSBV-1, it is likely that BoDV-2 may also possess zoonotic potential.\u003c/p\u003e \u003cp\u003eThe reverse genetics system is a powerful tool for elucidating viral characteristics such as replication and pathogenesis. The reverse genetics of BoDV-1 was initially described by Schneider et al. in 2005; a plasmid expressing the full-length BoDV-1 antigenome and three helper plasmids expressing the nucleoprotein (N), phosphoprotein (P), and large protein (L) encoding the RNA-dependent RNA polymerase were transfected into cells expressing T7 polymerase \u003csup\u003e18\u003c/sup\u003e. This system has been further improved by employing highly transfectable HEK293T cells for plasmid transfection and incorporating two helper plasmids expressing matrix protein (M) and glycoprotein (G) \u003csup\u003e19\u0026ndash;21\u003c/sup\u003e. Given that the genomic components of BoDV-2 closely resemble those of BoDV-1, it is predicted that recombinant BoDV-2 (rBoDV-2) can be easily rescued by employing the same strategy as used for BoDV-1. However, although the complete genome sequence of BoDV-2 has been deposited in NCBI GenBank, previous studies have raised concerns about potential errors in the L gene, indicating the need to reassess the genome sequence of BoDV-2 \u003csup\u003e6\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we aimed to investigate the virological properties of BoDV-2 using recombinant viral techniques and therefore redetermine the genome sequence of BoDV-2 isolate No/98, which has been maintained in persistently infected cells. We found two nonsynonymous nucleotide substitutions in the L gene compared to the published sequence. One of these substitutions was crucial for restoring the polymerase activity of L, allowing successful recovery of rBoDV-2 through reverse genetics. Additionally, we identified two nonsynonymous single-nucleotide polymorphisms (SNPs) in the L gene and one in the P gene. Substituting these SNPs significantly enhanced the growth ability of rBoDV-2. Furthermore, our study demonstrated that BoDV-2 does not induce superinfection exclusion in cells, leading to long-term maintenance of low-fitness genome variants in persistently infected cells.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eReassessment of the complete genome sequence of BoDV-2.\u003c/b\u003e The complete genome sequence of BoDV-2 isolate No/98 is deposited in NCBI GenBank; however, it is suspected that this sequence might contain several errors in the L gene because three blocks of amino acid differences are unnaturally accumulated at the C-terminal domain (CTD) of L compared to those of representative strains of BoDV-1, such as He/80 and V (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) \u003csup\u003e6\u003c/sup\u003e. Therefore, we reassessed the whole-genome sequence of BoDV-2 isolate No/98 via RNA sequencing (RNA-seq) using total RNA extracted from persistently infected Vero cells available at the Friedrich-Loeffler-Institut. Compared to the published sequence (accession no. AJ311524), the reassessed sequence contains one and five nucleotide differences in the P and L genes, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Two of them in the L gene, uracil at positions 2762 and 3334, which are located in the polyribonucleotidyltransferase (PRNTase) domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), were completely substituted with guanine, resulting in amino acid changes of leucine at position 921 with arginine and cysteine at position 1112 with glycine (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). In addition, three SNPs were detected in the L gene, two of which, positions 3743 and 4250, induce nonsynonymous amino acid changes in the CTD of L, though they do not overlap with the blocks of amino acid differences described in a previous paper (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B) \u003csup\u003e6\u003c/sup\u003e. A nonsynonymous SNP was also detected at position 456 of the P gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Furthermore, we performed rapid amplification of cDNA ends (RACE) analysis to determine the exact 3\u0026rsquo; and 5\u0026rsquo; terminal sequences, which could not be reconstituted by RNA-seq analysis. Similar to BoDV-1 \u003csup\u003e18,22\u003c/sup\u003e, BoDV-2 possesses four nucleotides overhung at the 3\u0026rsquo; end of both the genome and antigenome without a complementary sequence at the 5\u0026rsquo; end of the opposite strand (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Compared to the published sequence, the reassessed sequence lacks uracil at the 5\u0026rsquo; end of the genome (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe polymerase activity of BoDV-2 L is restored by substituting a nucleotide.\u003c/b\u003e In the reassessed sequence, nucleotides at positions 2762 and 3334 of the L gene are completely substituted compared to the reference sequence (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To determine whether these differences affect BoDV-2 L gene expression, we constructed L cDNA expression plasmids possessing each nucleotide substitution independently (BoDV-2 L\u003csub\u003eR\u003c/sub\u003e or L\u003csub\u003eG\u003c/sub\u003e) or in combination (BoDV-2 L\u003csub\u003eRG\u003c/sub\u003e) and performed western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). In a previous study, we could not detect expression of FLAG-tagged BoDV-2 L with the reference sequence, though that of FLAG-tagged BoDV-1 L was clearly demonstrated, suggesting the low expression potential of the FLAG-BoDV2 L construct \u003csup\u003e23\u003c/sup\u003e. However, in the present study, we could detect the expression of BoDV-2 L with the reference sequence when a linker sequence was inserted between FLAG and the L gene to enhance the accessibility of the antibody to the tag (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In addition, we confirmed expressions of the reconstructed BoDV-2 L variants in transfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo determine the polymerase activities of the reconstructed BoDV-2 L variants, we performed a BoDV-2 minireplicon assay. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, reporter activity was not detected for BoDV-2 L with the reference sequence, indicating that it lacks any polymerase activity. Interestingly, BoDV-2 L possessing a nucleotide substitution at position 2762, namely, BoDV-2 L\u003csub\u003eR\u003c/sub\u003e, restored its polymerase activity, whereas a substitution at position 3334, namely, BoDV-2 L\u003csub\u003eG\u003c/sub\u003e, did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Accordingly, BoDV-2 L\u003csub\u003eRG\u003c/sub\u003e, which possesses both nucleotide substitutions simultaneously, exhibited the same level of polymerase activity as BoDV-2 L\u003csub\u003eR\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), indicating that a difference in the nucleotide at position 2762 is detrimental to the polymerase activity of BoDV-2 L.\u003c/p\u003e \u003cp\u003eTo examine whether nucleotide differences at positions 2762 and 3334 of the L gene affect recovery of rBoDV-2 via reverse genetics, we constructed BoDV-2 cDNA plasmids expressing the full-length BoDV-2 antigenomes possessing each or both nucleotide substitutions. HEK293T cells were transfected with each BoDV-2 cDNA plasmid and five helper plasmids and cocultured with uninfected Vero cells at 3 days post transfection. After two weeks from coculture, rBoDV-2s that contain a nucleotide substitution at position 2762 of the L gene, rBoDV-2 L\u003csub\u003eR\u003c/sub\u003e and L\u003csub\u003eRG\u003c/sub\u003e, were successfully rescued (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Interestingly, although nucleotide substitution at position 3334 did not affect the polymerase activity of BoDV-2 L in the minireplicon assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e, which possesses both substitutions at positions 2762 and 3334, seemed to be recovered more efficiently than rBoDV-2 L\u003csub\u003eR\u003c/sub\u003e, which possesses a substitution at position 2762 alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), suggesting that the nucleotide at position 3334 of the L gene also plays a role in BoDV-2 replication. To examine the growth ability of rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e in comparison with that of the nonrecombinant BoDV-2 isolate No/98, Vero cells infected with rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e or isolate No/98 were cocultured with uninfected Vero cells at a ratio of 1 to 19 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), and viral propagation and the copy number of viral RNA were evaluated every 3 or 4 days by immunofluorescence assay (IFA) and RT-qPCR, respectively. While the nonrecombinant isolate No/98 spread to almost all Vero cells within 2 weeks of coculture, infection of rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e exhibited limited spread within this period (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Similarly, the copy number of viral RNA increased 20-fold in isolate No/98-infected cells, whereas it barely increased in rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). These results suggest that the growth ability of rBoDV-2 is not only determined by the L2762 and L3334 substitutions, even though both substitutions induce high polymerase activity in the minireplicon assay.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNonsynonymous SNPs in the L gene facilitate the growth of BoDV-2.\u003c/b\u003e Our RNA-seq analysis identified two nonsynonymous SNPs in the CTD of the L gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), indicating that the Vero cells persistently infected with BoDV-2 isolate No/98 contain a viral L quasispecies. Therefore, we constructed L expression plasmids harboring each or both nucleotide substitutions at positions 3743 and 4250 based on BoDV-2 L\u003csub\u003eRG\u003c/sub\u003e and performed a minireplicon assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). While the substitution of uracil at position 3743 with cytosine, L\u003csub\u003eRGT\u003c/sub\u003e, increased polymerase activity by 1.3-fold, that of adenine at position 4250 with guanine, L\u003csub\u003eRGR\u003c/sub\u003e, decreased it by 0.7-fold. Substitution of both nucleotides, L\u003csub\u003eRGTR\u003c/sub\u003e, slightly decreased polymerase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eTo further investigate the impact of these SNPs on the growth ability of BoDV-2, we generated rBoDV-2 possessing each or both substitutions in the L gene and evaluated their growth kinetics. Although the substitution at position 4250 of the L gene had a detrimental effect on polymerase activity in the minireplicon assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), L proteins possessing either SNP substitution remarkably facilitated viral propagation and RNA synthesis of rBoDV-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). These findings suggest that these SNPs influence viral replication through mechanisms other than enhancing polymerase activity in cells.\u003c/p\u003e \u003cp\u003e \u003cb\u003eA nonsynonymous SNP in the P gene expedites the growth of BoDV-2.\u003c/b\u003e We also identified another nonsynonymous SNP at position 456 of the P gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The P gene encodes the viral polymerase cofactor, which directly interacts with the L protein and plays a crucial role in viral polymerase activity \u003csup\u003e24,25\u003c/sup\u003e. Therefore, we examined the effects of this SNP on viral polymerase activity and viral growth ability using both a minireplicon assay and rBoDV-2 variants. Substitution of guanine at position 456 of the P gene with adenine, P\u003csub\u003eI\u003c/sub\u003e, resulted in a slight increase in the polymerase activity of L\u003csub\u003eRG\u003c/sub\u003e but not that of L\u003csub\u003eRGTR\u003c/sub\u003e, as observed in the minireplicon assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). Furthermore, the P gene with the introduced SNP significantly facilitated viral propagation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D) and RNA synthesis of rBoDV-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and F). These observations indicate that the nonsynonymous SNP detected in the P gene also contributed to the increase in rBoDV-2 growth ability.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLack of superinfection exclusion maintains the low-fitness polymorphism in cells persistently infected with BoDV-2.\u003c/b\u003e Since the isolation of BoDV-2 isolate No/98 from a pony brain in 1999, it has been maintained for a long time in persistently infected Vero cells. Notably, although BoDV-2-infected Vero cells have undergone repeated passages, L- and P-sequence variants with low viral replication ability appear to be the major quasispecies within persistently infected cells. The coexistence of viral quasispecies in infected cells has been shown to affect overall viral replication and pathogenicity and therefore plays a role in the adaptation and evolution of viral populations \u003csup\u003e26\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo determine the significance of the coexistence of BoDV-2 quasispecies in persistently infected cells, we performed infection experiments using cells infected with different sequences of rBoDV-2. First, we generated rBoDV-2 with different fluorescent marker genes, mCherry and GFP, inserted into the artificial intergenic region between the P and M genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) based on rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e with high-growth ability. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, both viruses exhibited similar growth kinetics, confirming that the effects of these two fluorescence marker proteins on the growth ability of BoDV-2 are not different. We therefore examined the propagation of rBoDV-2 variants with different growth abilities, namely, low-growth rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e-mCherry (L\u003csub\u003eRG\u003c/sub\u003e-mCherry) and high-growth rBoDV-2 P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP (P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP), by a competition assay using Vero cells infected with each recombinant virus. When Vero cells infected with L\u003csub\u003eRG\u003c/sub\u003e-mCherry or P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP were cocultured with uninfected Vero cells at a ratio of 1:1:23, P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP rapidly spread throughout the culture, and the number of mCherry-expressing cells gradually decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Similarly, after 14 days of coculture, the genomic RNA of P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP accounted for almost all the BoDV-2 genomic RNA in the population (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). However, at 14 days after coculture, almost 1.0% of the cells coexpressed mCherry and GFP, and the proportion of cells expressing mCherry alone or coexpressing mCherry and GFP was approximately 3.3% of the total (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), indicating that high-growth P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP superinfected L\u003csub\u003eRG\u003c/sub\u003e-mCherry-infected cells and that low-growth rBoDV-2 was maintained without elimination from the cells superinfected with the P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP.\u003c/p\u003e \u003cp\u003eTo confirm the absence of superinfection exclusion between the rBoDV-2 variants, we next cocultured Vero cells infected with L\u003csub\u003eRG\u003c/sub\u003e-mCherry and P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP at a 1:1 ratio. As a result, the percentage of cells coexpressing mCherry and GFP gradually increased; after 14 days of coculture, the proportions of cells expressing GFP alone, mCherry alone, and coexpressing mCherry and GFP were approximately 46.3%, 18.3%, and 32.4%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). This finding suggests that the high-growth P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP predominantly superinfected to the L\u003csub\u003eRG\u003c/sub\u003e-mCherry-infected cells. On the other hand, the proportion of viral genomic RNA of L\u003csub\u003eRG\u003c/sub\u003e-mCherry in the culture increased to some extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF), indicating that the resident viruses were not eliminated even among the cells superinfected with the high-growth virus; rather, the replication of the low-growth viral genome was upregulated by support from the polymerase derived from high-growth virus. In addition, we cloned Vero cells coinfected with both L\u003csub\u003eRG\u003c/sub\u003e-mCherry and P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG) and cocultured them with uninfected Vero cells to investigate whether superinfection affects the propagation abilities of coinfected variants. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, the proportion of cells infected with only the P\u003csub\u003eI\u003c/sub\u003eL\u003csub\u003eRGTR\u003c/sub\u003e-GFP virus increased; the L\u003csub\u003eRG\u003c/sub\u003e-mCherry virus could also be transmitted to uninfected Vero cells, albeit only slightly. These observations suggest that BoDV-2 does not exclude superinfection, allowing low-fitness variants to persist within infected cells while maintaining their characteristics and thereby maintaining population diversity.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, to better understand the virological characteristics of BoDV-2, we reassessed the whole-genome sequence of BoDV-2 using RNA extracted from persistently BoDV-2-infected Vero cells. Compared to the original sequence of BoDV-2 isolate No/98, the reassessed sequence contains two nucleotide substitutions at positions 2762 and 3334 of the L gene, both of which induce an amino acid change in the PRNTase domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). We found that substitution of uracil at position 2762 with guanine alone is sufficient to restore the polymerase activity of BoDV-2 L and to recover rBoDV-2 by reverse genetics (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This nucleotide substitution induces an amino acid change from leucine to arginine at position 921 of L. Interestingly, arginine is completely conserved at the same position in all 47 sequences of BoDV-1 L registered in the database, suggesting that this residue is critical for the polymerase activity of BoDV L. In contrast, the substitution of uracil at position 3334 with guanine, which induces an amino acid change from cysteine to glycine at position 1112 of L, did not affect the polymerase activity of BoDV-2 L in the minireplicon assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). However, interestingly, rBoDV-2, which possesses substitutions at positions 2762 and 3334, rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e, seemed to be rescued more efficiently than was rBoDV-2, which possesses a substitution at position 2762 alone, rBoDV-2 L\u003csub\u003eR\u003c/sub\u003e, by reverse genetics (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). This observation suggests that substitution at position 3334 may also play a critical role in the replication of BoDV-2 in a way other than enhancing polymerase activity. Position 3334 is located between motifs C (W) and D (HR) in the PRNTase domain, which is associated with the viral mRNA capping reaction \u003csup\u003e27\u003c/sup\u003e, but it overlaps with neither these conserved motifs nor the currently identified signal sequences in BoDV-1 L \u003csup\u003e28,29\u003c/sup\u003e. Further investigations are needed to determine the effect of guanine at position 3334 of BoDV-2 L on viral propagation.\u003c/p\u003e \u003cp\u003eOur study showed that while rBoDV-2 could be rescued by substituting nucleotides at positions 2762 and 3334 of the L gene, the growth ability of rBoDV-2 L\u003csub\u003eRG\u003c/sub\u003e was severely attenuated compared to that of the nonrecombinant BoDV-2 isolate No/98 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF and G). Interestingly, the substitution of nonsynonymous SNPs at positions 3743 and 4250 of the L gene significantly facilitated the growth ability of rBoDV-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). Nucleotide substitution of uracil at position 3743 with cytosine induces an amino acid change from isoleucine to threonine at amino acid position 1248 of BoDV-2 L. Either isoleucine or threonine is conserved at the same position in BoDV-1 Ls in the database at a similar ratio, though it remains unclear whether substitution of isoleucine with threonine also affects the viral growth ability of BoDV-1. In addition, nucleotide substitution of alanine at position 4250 with guanine induces an amino acid change from lysine to arginine at amino acid position 1417 of BoDV-2 L. All the BoDV-1 Ls in the database except for that of strain CRNP5, which was generated by several passages of isolate He/80 in the brains of Lewis rats and SJL mice, show conservation of a lysine residue at the same amino acid position corresponding to 1417 of BoDV-2 L \u003csup\u003e30\u003c/sup\u003e, but it is unclear whether rBoDV-1 possessing arginine residue at this position shows efficient propagation compared to the parental BoDV-1 isolate He/80 \u003csup\u003e31\u003c/sup\u003e. Investigating how these SNPs affect viral replication may help to elucidate the previously unknown role of the CTD of BoDV L.\u003c/p\u003e \u003cp\u003eIn this study, we also identified one nucleotide substitution within an SNP at position 456 of the P gene. This substitution leads to an amino acid change from methionine to isoleucine at position 152, which facilitates the growth ability of rBoDV-2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). BoDV-1 P interacts with P and L through binding domains spanning amino acid positions 135 to 172 and 135 to 183, respectively \u003csup\u003e25,32\u003c/sup\u003e. Additionally, previous research has indicated the presence of a nuclear export signal between amino acid positions 145 and 165 within BoDV-1 P \u003csup\u003e33\u003c/sup\u003e. Although the role of the amino acid residue in BoDV-1 P, corresponding to position 152 in BoDV-2 P, has yet to be explored, investigating its potential binding interactions with other viral proteins and its influence on the nuclear translocation capability of P would be of considerable interest.\u003c/p\u003e \u003cp\u003eDetection of 3 major nonsynonymous SNPs suggests the presence of up to eight distinct BoDV-2 genomes within persistently infected Vero cells. BoDV-2 was initially isolated from the brain of an infected pony using primary young rabbit brain cells and subsequently propagated in Vero cells \u003csup\u003e5\u003c/sup\u003e, after which the infected Vero cells were maintained for two decades. It is unclear when and how BoDV-2 acquired the P and L gene SNPs that we found in this study. However, given the comparable proportion of genome sequences containing SNPs, even those associated with low-fitness effects on propagation in culture, it may be possible that these SNPs were acquired after isolation \u003cem\u003ein vitro\u003c/em\u003e to maintain persistent infection within cultured cells. On the other hand, our analysis revealed that BoDV-2 does not exhibit superinfection exclusion, even toward low-fitness mutant viruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). From this observation, it is conceivable that viruses with different sequences may have coexisted before isolation. To better understand the characteristics and evolution of BoDV-2 infection, it is necessary to examine in detail the competition for growth between viruses with genomic variants not only \u003cem\u003ein vitro\u003c/em\u003e but also \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we demonstrated that rBoDV-2 can infect cells infected with another rBoDV-2 with different replication abilities (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and E), showing that BoDV-2 does not exhibit superinfection exclusion. Superinfection exclusion is a common strategy used by many viruses to prevent sequential infection by closely related viruses \u003csup\u003e34,35\u003c/sup\u003e. For instance, substantial infection of influenza A virus (IAV) in cells that are already infected with IAV is inhibited by the active viral replication complex \u003csup\u003e36\u003c/sup\u003e. It has been reported that IAV superinfection exclusion constrains interactions between viral populations locally within a host to regulate viral fitness and evolution \u003csup\u003e37\u003c/sup\u003e. While superinfection exclusion provides evolutionary advantages for controlling viral fitness and population diversity, it also has the effect of promoting founder effects and reducing diversity and is thought to control the balance between genetic diversification and genome integrity in infected hosts \u003csup\u003e26\u003c/sup\u003e. A simulation study demonstrated that although a mutant with superinfection exclusion can overtake a population that cannot exclude superinfection, superinfection enables a population to adapt to environmental changes, indicating that superinfection exclusion negatively affects the adaptation of a viral population in the long term \u003csup\u003e38\u003c/sup\u003e. These observations suggest that maintenance of genetic diversity through the absence of superinfection exclusion during BoDV-2 infection plays a pivotal role in the establishment of persistent infection. This might be achieved by not excluding low-fitness variants that may regulate replication dynamics and cytopathic effects as a viral population in infected cells.\u003c/p\u003e \u003cp\u003eIn previous studies, BoDV-1 superinfection in cells persistently infected with BoDV-1 was demonstrated to be excluded both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e \u003csup\u003e39,40\u003c/sup\u003e. The authors cocultured UTA6 human osteosarcoma cells persistently infected with the BoDV-1 isolate He/80 with either uninfected or BoDV-1 isolate H215-infected Vero cells and evaluated infection of isolate He/80 to Vero cells by IFA using a monoclonal antibody that reacts with the N of He/80 but not with the N of H215. Although infection of the isolate He/80 spread efficiently from the UTA6 cells to uninfected Vero cells, the infection did not spread to the H215-infected Vero cells after 3 weeks of coculture \u003csup\u003e40\u003c/sup\u003e. The authors further demonstrated that expression of either N, accessory protein (X), or P is sufficient to inhibit superinfection with BoDV-1, concluding that the imbalance in intracellular levels of vRNP components is attributable to superinfection exclusion of BoDV-1 \u003csup\u003e40\u003c/sup\u003e. However, whereas the growth abilities of both the BoDV-1 isolates H215 and He/80 were high enough for the infection to spread efficiently in the previous study, the growth ability of the two different rBoDV-2s was significantly different in our experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In addition, the methods used to detect superinfection differed between these studies. Thus, further studies are necessary to investigate whether the absence of superinfection exclusion is a specific property for BoDV-2 but not for BoDV-1.\u003c/p\u003e \u003cp\u003eIn conclusion, we successfully established a reverse genetics system for BoDV-2 and revealed lack of superinfection exclusion enables BoDV-2 to maintain the genetic diversity in persistently infected cells. Our study provides valuable insights into the biological properties of BoDV-2 and contributes to development of effective vaccines and antiviral drugs for pathogenic mammalian orthobornaviruses.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman embryonic kidney (HEK) 293T cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) (Nacalai Tesque, Japan; #08456-36) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, USA; #10270-106) and 1% penicillin-streptomycin-amphotericin B solution (Fujifilm, Japan; #161-23181). African green monkey kidney Vero cells were cultured in DMEM supplemented with 5% FBS and 1% penicillin-streptomycin-amphotericin B solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eVirus\u003c/h2\u003e \u003cp\u003eVero cells persistently infected with BoDV-2 isolate No/98 were kindly provided by Prof. Martin Schwemmle (University of Freiburg, Germany) and propagated by Dennis Rubbenstroth\u0026rsquo;s group at the Friedrich-Loeffler-Institut (FLI), Greifswald, Germany. Isolate No/98 had originally been isolated using primary young rabbit brain cells, which were subsequently cocultured with Vero cells. After consecutive passages, only Vero cells remained in the culture \u003csup\u003e5\u003c/sup\u003e. The exact propagation history of the isolate No/98-infected culture is unknown.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eRNA-seq and data processing\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from persistently BoDV-2-infected Vero cells using Agencourt\u0026reg; RNAdvance Tissue kit (Beckman Coulter) and the KingFisher Flex system (Thermo Fisher Scientific) according to manufacturers\u0026rsquo; instructions. Subsequent cDNA synthesis and library preparation were performed as described in Wylezich et al. \u003csup\u003e48\u003c/sup\u003e with slight modifications. Briefly, cDNA was synthesized using the SuperScript IV First-Strand cDNA Synthesis System (Thermo Fisher Scientific) and subsequently, the complete reaction was used for 2nd strand synthesis with the NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module (New England Biolabs), followed by DNA fragmentation with a Covaris M220 and library preparation with a GeneRead DNA Library L Core kit (QIAGEN) and ION Xpress Barcode adapters (Thermo Fisher Scientific). After size selection as described in Wylezich et al. \u003csup\u003e48\u003c/sup\u003e, library size was measured using a 2100 BioAnalyzer system (Agilent Technologies) with Agilent High Sensitivity DNA Chip and reagents, and the library was quantified using a QIAseq Library Quant Assay Kit (Qiagen). The library was prepared for sequencing and sequenced together with Ion Torrent Calibration Standard (Thermo Fisher) using an Ion Torrent S5 XL instrument with Ion 530 chip and reagents (Thermo Fischer Scientific) in 400 bp mode. Sequencing adapters were trimmed using the Newbler assembler of the 454 Genome Sequencer Software Suite v. 3.0 (Roche) and the FastQC was used to quality control the sequence dataset. Initial reference-based mapping (454 Genome Sequencer Software Suite v. 3.0, Roche) against RefSeq BoDV-2 strain No/98 complete genome (NC_030692) was performed to generate a sample-specific consensus sequence. This consensus sequence was used as a reference for the second round of reference-based mapping analysis. Pairwise sequence alignment of the resulting BoDV-2 genome sequence and BoDV-2 AJ311524.1 was performed MUSCLE \u003csup\u003e49\u003c/sup\u003e. This alignment was visually inspected with Geneious Prime\u0026reg; 2019.2.3 Software (Biomatters). SNPs within the BoDV-2 genome were detected using the Find Variations/SNPs program implemented in the Geneious Prime\u0026reg; 2019.2.3 software. For this analysis, we used the BAM file generated from the 2nd round of mapping analyses as data input and the following parameters, minimum coverage: 50, minimum variant frequency: 25%, maximum variant \u003cem\u003ep\u003c/em\u003e-value 10 (raise to) -7, minimum strand bias \u003cem\u003ep\u003c/em\u003e-value of 10 (raise to) -5 when exceeding 65% bias.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRACE analysis\u003c/h2\u003e \u003cp\u003eTotal RNA extracted from BoDV-2-infected Vero cells was ligated with either 5\u0026rsquo; adaptor oligoRNA (5\u0026rsquo;-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA (Thermo Fisher Scientific, USA; #L150201)) or 3\u0026rsquo; adaptor oligoRNA (5\u0026rsquo;-GAAGAGAAGGUGGAAAUGGCGUUUUGG; the 5\u0026rsquo; and 3\u0026rsquo; ends were modified with a monophosphate and an amino-modifier, respectively) using T4 RNA Ligase 1 (New England Biolabs, USA; #M0204) according to the manufacturer\u0026rsquo;s instructions. The adaptor-ligated RNA was reverse transcribed using SuperScript Ⅳ Reverse Transcriptase (Thermo Fisher Scientific, USA; #18090010) and amplified by PCR using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, USA; #M0494) according to the manufacturer\u0026rsquo;s instructions. The viral terminal sequences were analyzed via Sanger sequencing of the purified PCR amplicons. The primers used in the RACE analysis are listed in the Table. 1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid construction\u003c/h2\u003e \u003cp\u003eThe plasmid used to express BoDV-2 N, P, and L were described previously \u003csup\u003e23\u003c/sup\u003e. Nucleotide substitutions in the P or L gene were introduced by PCR mutagenesis. A FLAG-tag sequence was inserted with a GS-linker sequence into the 5\u0026rsquo; terminus of the L gene by PCR mutagenesis. A plasmid expressing each BoDV-2 M or G was constructed by inserting each gene into the EcoRⅠ and XhoⅠ restriction enzyme recognition sites of the eukaryotic expression plasmid pCAGGS \u003csup\u003e41\u003c/sup\u003e. For both plasmids, synonymous substitutions were introduced by PCR mutagenesis into the splicing donor and acceptor sites to increase protein expression levels \u003csup\u003e20,42\u003c/sup\u003e. An RNA polymerase Ⅱ (Pol Ⅱ)-driven BoDV-2 minigenome plasmid was constructed similarly to the BoDV-1 minireplicon plasmid described previously \u003csup\u003e23\u003c/sup\u003e. In brief, a \u003cem\u003eGaussia\u003c/em\u003e luciferase (Gluc) reporter gene flanked by the 3\u0026rsquo; and 5\u0026rsquo; untranslated regions of BoDV-2 in the negative-sense orientation was inserted into the XhoⅠ and NotⅠ restriction enzyme recognition sites of pCAG-HRSV3 \u003csup\u003e43\u003c/sup\u003e, with a hammerhead ribozyme (HamRz) sequence at the 5\u0026rsquo; end and a hepatitis delta virus ribozyme (HdvRz) sequence at the 3\u0026rsquo; end. A BoDV-2 cDNA plasmid that expresses the full-length antigenomic RNA of BoDV-2 strain No/98 was constructed similarly to the corresponding BoDV-1 cDNA plasmid described previously \u003csup\u003e44\u003c/sup\u003e. In brief, an artificially synthesized full-length cDNA identical to the published reference sequence of BoDV-2 isolate No/98 was inserted into the XhoⅠ and NotⅠ restriction enzyme recognition sites of pCAG-HRSV3 \u003csup\u003e43\u003c/sup\u003e with an HamRz sequence at the 5\u0026rsquo; end and an HdvRz sequence at the 3\u0026rsquo; end. A BoDV-2 cDNA plasmid that harbors an additional expression cassette between the P and M genes was constructed by inserting a gene of interest flanked by the MluⅠ and PacⅠ restriction enzyme recognition sequences with the repeated 2nd gene end (GE2) and the 3rd gene start (GS3) signal sequences by PCR mutagenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) \u003csup\u003e44\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCultured cells were lysed with 1x sample buffer (50 mM Tris-HCl, pH 6.8; 2% sodium dodecyl sulfate (SDS); 5% w/v sucrose; and 5% 2-mercaptoethanol) followed by boiling at 95\u0026deg;C for 10 minutes. Cell lysates were subjected to SDS-PAGE using an ePAGEL (ATTO Corporation, Japan; #2331720), and proteins were subsequently transferred to Trans-Blot\u0026reg; Turbo\u0026trade; Mini nitrocellulose membranes (Bio-Rad, USA; #1704156). The membranes were blocked with blocking buffer (TBS containing 0.1% Tween-20 with 5% w/v skim milk) and then incubated with the primary antibody (anti-FLAG M2 (Sigma-Aldrich, USA; #F1804) or anti-alpha-tubulin (Sigma-Aldrich, USA; #T5168)), followed by incubation with the secondary antibody (horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Jackson ImmunoResearch, USA; #715-035-150). The protein bands were detected with Clarity Western ECL substrate reagents (Bio-Rad, USA; #170\u0026ndash;5060), and chemiluminescence signals were visualized by Fusion Solo S (Vilber, France).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBoDV-2 minireplicon assay\u003c/h2\u003e \u003cp\u003eHEK293T cells seeded into 48-well plates were transfected with 50 ng of BoDV-2 minigenome plasmid, 50 ng of pCAGGS-BoDV-2 N, 5 ng of pCAGGS-BoDV-2 P, 50 ng of pCAGGS-BoDV-2 L, and 5 ng of control plasmid expressing \u003cem\u003eCypridina\u003c/em\u003e luciferase using TransIT293 (Mirus, USA; #MIR2700) according to the manufacturer\u0026rsquo;s instructions. At 48 hours post transfection, \u003cem\u003eGaussia\u003c/em\u003e luciferase and \u003cem\u003eCypridina\u003c/em\u003e luciferase expression levels were measured with a Biolux \u003cem\u003eGaussia\u003c/em\u003e luciferase assay kit (New England Biolabs, USA; #E3300) and Biolux \u003cem\u003eCypridina\u003c/em\u003e luciferase assay kit (New England Biolabs, USA; #E3309), respectively, according to the manufacturer\u0026rsquo;s instructions. Luminescence signals were detected by a GloMax Discover Microplate Reader (Promega, USA), and polymerase activity was quantified by normalizing \u003cem\u003eGaussia\u003c/em\u003e luciferase activity to \u003cem\u003eCypridina\u003c/em\u003e luciferase activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eReverse genetics of BoDV-2\u003c/h2\u003e \u003cp\u003eReverse genetics was performed according to the protocol summarized in our previous review article \u003csup\u003e21\u003c/sup\u003e. HEK293T cells seeded into 6-well plates were transfected with 2.0 \u0026micro;g of BoDV-2 cDNA plasmid, 0.5 \u0026micro;g of pCAGGS-BoDV-2 N, 0.025 \u0026micro;g of pCAGGS-BoDV-2 P, 0.25 \u0026micro;g of pCAGGS-BoDV-1 L, 0.04 \u0026micro;g of pCAGGS-BoDV-2 M, and 0.01 \u0026micro;g of pCAGGS-BoDV-2 G using TransIT293 according to the manufacturer\u0026rsquo;s instructions. At 3 days post transfection, the transfected cells were cocultured with uninfected Vero cells, which were passaged every 3 or 4 days until the infection spread to almost all the Vero cells. The transfected HEK293T cells were removed by adding 1.0 \u0026micro;g/mL puromycin (InvivoGen, USA; #ant-pr) at the optimal time point.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence assay\u003c/h2\u003e \u003cp\u003eCultured cells were fixed with 4% paraformaldehyde (Nacalai Tesque, Japan; #09154-85) for 10 minutes and permeabilized with PBS containing 0.5% Triton X-100 (Wako, Japan; #169-21105) and 5% bovine serum albumin (Sigma-Aldrich, USA; #A3059) for 10 minutes. The cells were incubated with the primary antibody (polyclonal rabbit serum anti-BoDV N HB01), followed by incubation with the secondary antibody (Alexa Fluor\u0026reg; 555-conjugated anti-rabbit IgG (Thermo Fisher Scientific, USA; #A21429)) and 300 nM 4\u0026prime;,6\u0026prime;-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cultured cells using NucleoSpin RNA Plus (Macherey-Nagle, Germany; #740984) according to the manufacturer\u0026rsquo;s instructions. For detection of BoDV-2 RNA, RT-qPCR was performed using qScript XLT one-step RT-qPCR ToughMix Kit (Quanta Biosciences, USA; #95132) with forward primer (5\u0026rsquo;-TAGTYAGGAGGCTCAATGGCA), reverse primer (5\u0026rsquo;-GTCCYTCAGGAGCTGGTC), and probe (5\u0026rsquo;-FAM-AAGAAGATCCCCAGACACTACGACG-BHQ1). Each reaction contained 2.75 \u0026micro;l of RNase-free water, 6.25 \u0026micro;l of 2x qScript XLT One-Step RT-qPCR ToughMix, 1.0 \u0026micro;l of primer-probe mix (7.5 pmol/\u0026micro;l primer and 2.5 pmol/\u0026micro;l probe) and 2.5 \u0026micro;l of RNA template (approximately 500 ng of total RNA) or RNase-free water for the no template control in a total volume of 12.5 \u0026micro;l. The thermal program consisted of 1 cycle of 50\u0026deg;C for 10 min and 95\u0026deg;C for 1 min, followed by 40 cycles of 95\u0026deg;C for 10 sec, 57\u0026deg;C for 30 sec, and 68\u0026deg;C for 30 sec \u003csup\u003e8\u003c/sup\u003e. For detection of GAPDH mRNA, approximately 500 ng of total RNA was reverse transcribed using the Verso cDNA synthesis kit (Thermo Fisher Scientific, USA; #AB1453) with anchored oligo dT primer according to the manufacturer\u0026rsquo;s instructions. qPCR was performed using Luna Universal qPCR Master Mix (New England Biolabs, USA; #M3003) with forward (5\u0026rsquo;-ATCTTCTTTTGCGTCGCCAG) and reverse (5\u0026rsquo;-ACGACCAAATCCGTTGACTCC) primers. Each reaction contained 8.0 \u0026micro;l of RNase-free water, 10.0 \u0026micro;l of Luna Universal qPCR Master Mix, 1.0 \u0026micro;l of primer mixture (10.0 pmol/\u0026micro;l primer) and 1.0 \u0026micro;l of synthesized cDNA or RNase-free water for the no template control in a total volume of 20.0 \u0026micro;l. The thermal program consisted of 1 cycle of 95\u0026deg;C for 1 min and 40 cycles of 95\u0026deg;C for 10 sec and 60\u0026deg;C for 30 sec, followed by a melting reaction. All reactions were performed with a CFX Connect real-time system (Bio-Rad, USA), and relative expression levels of BoDV-2 RNA were calculated via the relative quantification method with GAPDH mRNA serving as a reference.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eCultured cells were fixed with 4% paraformaldehyde for 20 minutes and suspended in PBS containing 2.0% FBS. Proportions of cells expressing either or both mCherry and GFP were analyzed by a CytoFLEX S flow cytometer (Beckman Coulter, USA). The criterion for assessing the extent of positive detection of each mCherry or GFP signal was set using mock-infected cells as a negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eAmplicon sequencing\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cultured cells using NucleoSpin RNA Plus according to the manufacturer\u0026rsquo;s instructions. BoDV-2 genomic RNA was reverse transcribed using SuperScript Ⅳ Reverse Transcriptase with a genome-specific primer (5\u0026rsquo;- AGGGACACTCTCGTTCTCCA) according to the manufacturer\u0026rsquo;s instructions. To prepare the sequencing library, the 1st PCR product ranging from position 3556 to 3954 of the L gene was amplified from 1.0 \u0026micro;l of cDNA using Q5 Hot Start High-Fidelity 2x Master Mix with forward (5\u0026rsquo;-acactctttccctacacgacgctcttccgatctGGATGCCTCTATGCTGACTCTG) and reverse (5\u0026rsquo;-gtgactggagttcagacgtgtgctcttccgatctACCAACCAGGAATCGCCAAA) primers. Then, amplicon sequencing was performed by the Bioengineering Lab. Co., Ltd. Briefly, the 2nd PCR product was amplified from 10 ng purified 1st PCR product using the TaKaRa Ex Taq HS (TaKaRa Bio Inc., Japan; #RR006A) with a forward (5\u0026rsquo;- AATGATACGGCGACCACCGAGATCTACAC-\u003cem\u003eIndex2\u003c/em\u003e-ACACTCTTTCCCTACACGACGC) and reverse (5\u0026rsquo;- CAAGCAGAAGACGGCATACGAGAT-\u003cem\u003eIndex1\u003c/em\u003e-GTGACTGGAGTTCAGACGTGTG) primers. Sequencing of the purified 2nd PCR products was performed using the MiSeq system and MiSeq Reagent Kit v3 (Illumina, USA) with a 2x300 bp read length protocol. Adaptor and primer sequences were removed from the raw sequence reads using the FASTX Toolkit (ver. 0.0.14) \u003csup\u003e45\u003c/sup\u003e. Low-quality and short reads were also removed using Sickle (ver. 1.33) with criteria of a quality score of \u0026lt;\u0026thinsp;Q20 and a read length of \u0026le;\u0026thinsp;40 bp \u003csup\u003e46\u003c/sup\u003e. Filtered reads were merged using FLASH (ver. 1.2.11) with default settings \u003csup\u003e47\u003c/sup\u003e. The number of BoDV-2 genotypes was counted by analyzing the nucleotide at position 3743 in each read.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed with GraphPad Prism 10 software. The tests used for each experiment are described in figure legends.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Prof. Martin Schwemmle (University of Freiburg, Germany) for providing BoDV-2-infected Vero cells and to Andrea Aebischer, Doreen Schulz, Patrick Zitzow, and Kathrin Steffen (Friedrich-Loeffler-Institut, Germany) for their technical support. We also thank Prof. Masayuki Horie (Osaka Metropolitan University, Japan) for supporting bilateral research.\u003c/p\u003e\n\u003cp\u003eThis study was supported in part by JSPS KAKENHI grants JP19J23468 (TK), JP22K20507 (TK), JP23K14083 (TK), JP19K22530 (KT), JP20H05682 (KT), and JP21K19909 (KT); JSPS Overseas Challenge Program for Young Researchers grant 202080194 (TK); JSPS Core-to-Core Program JPJSCCA20190008 (KT); Kaketsuken Research Grant (KT); the Joint Usage/Research Center Program on Institute for Life and Medical Sciences, Kyoto University (KT); Institute for Life and Medical Sciences Office of Directors\u0026rsquo; Research Grants Program, Kyoto University (TK); and the German Federal Ministry of Education and Research, Zoonotic Bornavirus Consortium (ZooBoCo), grants 01KI1722 and 01KI2005 (DR, MB, and DH).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTK and DR designed the study. TK, PDS, DH, and DR performed experiments and analyzed data. MB, DR, and KT supervised the project. TK and KT wrote the manuscript. All authors reviewed and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no financial or non-financial competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo custom code and scripts were used during data analysis. The versions of the software are described in Materials and Methods.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRicht, J. A. \u0026amp; Rott, R. Borna disease virus: a mystery as an emerging zoonotic pathogen. Vet. J. 161, 24\u0026ndash;40 (2001). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1053/tvjl.2000.0533\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1053/tvjl.2000.0533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKinnunen, P. M., Palva, A., Vaheri, A. \u0026amp; Vapalahti, O. Epidemiology and host spectrum of Borna disease virus infections. J. Gen. Virol. 94, 247\u0026ndash;262 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/vir.0.046961-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/vir.0.046961-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubbenstroth, D. Avian Bornavirus Research-A Comprehensive Review. Viruses 14 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v14071513\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v14071513\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuhn, J. H. \u003cem\u003eet al.\u003c/em\u003e Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota). \u003cem\u003eJ. Gen. Virol.\u003c/em\u003e 104 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/jgv.0.001864\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/jgv.0.001864\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNowotny, N. \u003cem\u003eet al.\u003c/em\u003e Isolation and characterization of a new subtype of Borna disease virus. J. Virol. 74, 5655\u0026ndash;5658 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.74.12.5655-5658.2000\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.74.12.5655-5658.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePleschka, S. \u003cem\u003eet al.\u003c/em\u003e Conservation of coding potential and terminal sequences in four different isolates of Borna disease virus. J. Gen. Virol. 82, 2681\u0026ndash;2690 (2001). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/0022-1317-82-11-2681\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/0022-1317-82-11-2681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKorn, K. \u003cem\u003eet al.\u003c/em\u003e Fatal Encephalitis Associated with Borna Disease Virus 1. N. Engl. J. Med. 379, 1375\u0026ndash;1377 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1056/NEJMc1800724\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1056/NEJMc1800724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchlottau, K. \u003cem\u003eet al.\u003c/em\u003e Fatal Encephalitic Borna Disease Virus 1 in Solid-Organ Transplant Recipients. N. Engl. J. Med. 379, 1377\u0026ndash;1379 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1056/NEJMc1803115\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1056/NEJMc1803115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoras, R., Korn, K., Kuerten, S., Huttner, H. B. \u0026amp; Ensser, A. Severe bornavirus-encephalitis presenting as Guillain-Barre-syndrome. Acta Neuropathol. 137, 1017\u0026ndash;1019 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s00401-019-02005-z\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s00401-019-02005-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiesche, F. \u003cem\u003eet al.\u003c/em\u003e The neuropathology of fatal encephalomyelitis in human Borna virus infection. Acta Neuropathol. 138, 653\u0026ndash;665 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s00401-019-02047-3\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s00401-019-02047-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiller, H. H. \u003cem\u003eet al.\u003c/em\u003e Zoonotic spillover infections with Borna disease virus 1 leading to fatal human encephalitis, 1999\u0026ndash;2019: an epidemiological investigation. The Lancet Infectious Diseases 20, 467\u0026ndash;477 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/s1473-3099(19)30546-8\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/s1473-3099(19)30546-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisermann, P. \u003cem\u003eet al.\u003c/em\u003e Active Case Finding of Current Bornavirus Infections in Human Encephalitis Cases of Unknown Etiology, Germany, 2018\u0026ndash;2020. Emerg. Infect. Dis. 27, 1371\u0026ndash;1379 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3201/eid2705.204490\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3201/eid2705.204490\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTappe, D. \u003cem\u003eet al.\u003c/em\u003e Investigation of fatal human Borna disease virus 1 encephalitis outside the previously known area for human cases, Brandenburg, Germany - a case report. BMC Infect. Dis. 21, 787 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1186/s12879-021-06439-3\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1186/s12879-021-06439-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrank, C. \u003cem\u003eet al.\u003c/em\u003e Human Borna disease virus 1 (BoDV-1) encephalitis cases in the north and east of Germany. Emerg Microbes Infect 11, 6\u0026ndash;13 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1080/22221751.2021.2007737\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1080/22221751.2021.2007737\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrosse, L. \u003cem\u003eet al.\u003c/em\u003e First detected geographical cluster of BoDV-1 encephalitis from same small village in two children: therapeutic considerations and epidemiological implications. Infection, 1\u0026ndash;16 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1007/s15010-023-01998-w\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1007/s15010-023-01998-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann, B. \u003cem\u003eet al.\u003c/em\u003e A Variegated Squirrel Bornavirus Associated with Fatal Human Encephalitis. N. Engl. J. Med. 373, 154\u0026ndash;162 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1056/NEJMoa1415627\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1056/NEJMoa1415627\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubbenstroth, D., Schlottau, K., Schwemmle, M., Rissland, J. \u0026amp; Beer, M. Human bornavirus research: Back on track! PLoS Pathog. 15, e1007873 (2019). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.ppat.1007873\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.ppat.1007873\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider, U., Schwemmle, M. \u0026amp; Staeheli, P. Genome trimming: a unique strategy for replication control employed by Borna disease virus. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 102, 3441\u0026ndash;3446 (2005). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1073/pnas.0405965102\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1073/pnas.0405965102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin, A., Staeheli, P. \u0026amp; Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. J. Virol. 80, 5708\u0026ndash;5715 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.02389-05\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.02389-05\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanda, T., Sakai, M., Makino, A. \u0026amp; Tomonaga, K. Exogenous expression of both matrix protein and glycoprotein facilitates infectious viral particle production of Borna disease virus 1. J. Gen. Virol. 103 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/jgv.0.001767\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/jgv.0.001767\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanda, T. \u0026amp; Tomonaga, K. Reverse Genetics and Artificial Replication Systems of Borna Disease Virus 1. \u003cem\u003eViruses\u003c/em\u003e 14 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v14102236\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v14102236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin, A., Hoefs, N., Tadewaldt, J., Staeheli, P. \u0026amp; Schneider, U. Genomic RNAs of Borna disease virus are elongated on internal template motifs after realignment of the 3' termini. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 108, 7206\u0026ndash;7211 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1073/pnas.1016759108\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1073/pnas.1016759108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanda, T., Horie, M., Komatsu, Y. \u0026amp; Tomonaga, K. The Borna Disease Virus 2 (BoDV-2) Nucleoprotein Is a Conspecific Protein That Enhances BoDV-1 RNA-Dependent RNA Polymerase Activity. J. Virol. 95, e0093621 (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.00936-21\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.00936-21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker, M. P., Jordan, I., Briese, T., Fischer, N. \u0026amp; Lipkin, W. I. Expression and characterization of the Borna disease virus polymerase. J. Virol. 74, 4425\u0026ndash;4428 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.74.9.4425-4428.2000\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.74.9.4425-4428.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider, U., Blechschmidt, K., Schwemmle, M. \u0026amp; Staeheli, P. Overlap of interaction domains indicates a central role of the P protein in assembly and regulation of the Borna disease virus polymerase complex. J. Biol. Chem. 279, 55290\u0026ndash;55296 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1074/jbc.M408913200\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1074/jbc.M408913200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndino, R. \u0026amp; Domingo, E. Viral quasispecies. Virology 479\u0026ndash;480, 46\u0026ndash;51 (2015). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.virol.2015.03.022\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.virol.2015.03.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOgino, T. \u0026amp; Banerjee, A. K. An unconventional pathway of mRNA cap formation by vesiculoviruses. Virus Res. 162, 100\u0026ndash;109 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.virusres.2011.09.012\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.virusres.2011.09.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker, M. P. \u0026amp; Lipkin, W. I. Characterization of the nuclear localization signal of the borna disease virus polymerase. J. Virol. 76, 8460\u0026ndash;8467 (2002). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.76.16.8460-8467.2002\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.76.16.8460-8467.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHonda, T. \u0026amp; Tomonaga, K. Nucleocytoplasmic shuttling of viral proteins in borna disease virus infection. Viruses 5, 1978\u0026ndash;1990 (2013). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v5081978\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v5081978\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishino, Y., Kobasa, D., Rubin, S. A., Pletnikov, M. V. \u0026amp; Carbone, K. M. Enhanced neurovirulence of borna disease virus variants associated with nucleotide changes in the glycoprotein and L polymerase genes. J. Virol. 76, 8650\u0026ndash;8658 (2002). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.76.17.8650-8658.2002\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.76.17.8650-8658.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAckermann, A., Kugel, D., Schneider, U. \u0026amp; Staeheli, P. Enhanced polymerase activity confers replication competence of Borna disease virus in mice. J. Gen. Virol. 88, 3130\u0026ndash;3132 (2007). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1099/vir.0.83170-0\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1099/vir.0.83170-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwemmle, M. \u003cem\u003eet al.\u003c/em\u003e Interactions of the borna disease virus P, N, and X proteins and their functional implications. J. Biol. Chem. 273, 9007\u0026ndash;9012 (1998). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1074/jbc.273.15.9007\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1074/jbc.273.15.9007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanai, H. \u003cem\u003eet al.\u003c/em\u003e A methionine-rich domain mediates CRM1-dependent nuclear export activity of Borna disease virus phosphoprotein. J. Virol. 80, 1121\u0026ndash;1129 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.80.3.1121-1129.2006\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.80.3.1121-1129.2006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar, N., Sharma, S., Barua, S., Tripathi, B. N. \u0026amp; Rouse, B. T. Virological and Immunological Outcomes of Coinfections. Clin. Microbiol. Rev. 31 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/cmr.00111-17\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/cmr.00111-17\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaureti, M., Paradkar, P. N., Fazakerley, J. K. \u0026amp; Rodriguez-Andres, J. Superinfection Exclusion in Mosquitoes and Its Potential as an Arbovirus Control Strategy. \u003cem\u003eViruses\u003c/em\u003e 12 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.3390/v12111259\u003c/span\u003e\u003cspan address=\"https://doi.org:10.3390/v12111259\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, J. \u0026amp; Brooke, C. B. Influenza A Virus Superinfection Potential Is Regulated by Viral Genomic Heterogeneity. \u003cem\u003emBio\u003c/em\u003e 9 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/mBio.01761-18\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/mBio.01761-18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSims, A. \u003cem\u003eet al.\u003c/em\u003e Superinfection exclusion creates spatially distinct influenza virus populations. PLoS Biol. 21, e3001941 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pbio.3001941\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pbio.3001941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHunter, M. \u0026amp; Fusco, D. Superinfection exclusion: A viral strategy with short-term benefits and long-term drawbacks. PLoS Comput. Biol. 18, e1010125 (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1371/journal.pcbi.1010125\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1371/journal.pcbi.1010125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFormella, S., Jehle, C., Sauder, C., Staeheli, P. \u0026amp; Schwemmle, M. Sequence variability of Borna disease virus: resistance to superinfection may contribute to high genome stability in persistently infected cells. J. Virol. 74, 7878\u0026ndash;7883 (2000). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.74.17.7878-7883.2000\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.74.17.7878-7883.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeib, T. \u003cem\u003eet al.\u003c/em\u003e Selective virus resistance conferred by expression of Borna disease virus nucleocapsid components. J. Virol. 77, 4283\u0026ndash;4290 (2003). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.77.7.4283-4290.2003\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.77.7.4283-4290.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiwa, H., Yamamura, K. \u0026amp; Miyazaki, J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108, 193\u0026ndash;199 (1991). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/0378-1119(91)90434-d\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/0378-1119(91)90434-d\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakai, M. \u003cem\u003eet al.\u003c/em\u003e Optimal expression of the envelope glycoprotein of orthobornaviruses determines the production of mature virus particles. J. Virol. 95 (2020). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/jvi.02221-20\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/jvi.02221-20\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanai, H. \u003cem\u003eet al.\u003c/em\u003e Development of a novel Borna disease virus reverse genetics system using RNA polymerase II promoter and SV40 nuclear import signal. Microbes Infect 8, 1522\u0026ndash;1529 (2006). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1016/j.micinf.2006.01.010\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1016/j.micinf.2006.01.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaito, T. \u003cem\u003eet al.\u003c/em\u003e A novel borna disease virus vector system that stably expresses foreign proteins from an intercistronic noncoding region. J. Virol. 85, 12170\u0026ndash;12178 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1128/JVI.05554-11\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1128/JVI.05554-11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGordon, A. \u0026amp; Hannon, G. J. Fastx-toolkit. FASTQ/A short-reads pre-processing tools. (2010). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://hannonlab.cshl.edu/fastx_toolkit\u003c/span\u003e\u003cspan address=\"http://hannonlab.cshl.edu/fastx_toolkit\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoshi, N. \u0026amp; Fass, J. Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files. (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/najoshi/sickle\u003c/span\u003e\u003cspan address=\"https://github.com/najoshi/sickle\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagoč, T. \u0026amp; Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27, 2957\u0026ndash;2963 (2011). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org:10.1093/bioinformatics/btr507\u003c/span\u003e\u003cspan address=\"https://doi.org:10.1093/bioinformatics/btr507\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWylezich C, Papa A, Beer M, H\u0026ouml;per D. A. Versatile Sample Processing Workflow for Metagenomic Pathogen Detection. Sci Rep. 8, 13108 (2018). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org:10.1038/s41598-018-31496-1\u003c/span\u003e\u003cspan address=\"http://doi.org:10.1038/s41598-018-31496-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792\u0026ndash;1797 (2004). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi.org:10.1093/nar/gkh340\u003c/span\u003e\u003cspan address=\"http://doi.org:10.1093/nar/gkh340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 is available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"npj-viruses","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [npj Viruses](https://www.nature.com/npjviruses)","snPcode":"44298","submissionUrl":"https://submission.springernature.com/new-submission/44298/3","title":"npj Viruses","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4544977/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4544977/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMammalian orthobornaviruses, such as Borna disease virus 1 (BoDV-1) and variegated squirrel bornavirus 1, are zoonotic pathogens that cause fatal encephalitis in humans. BoDV-2, another mammalian orthobornavirus with high genetic homology to BoDV-1, is believed to share the same geographical distribution as BoDV-1, indicating its potential risk to human health. However, due to the limited number of isolations, the virological characteristics of BoDV-2, such as pathogenicity and infectivity, remain largely unexplored. Here, we re-evaluated the whole-genome sequence of BoDV-2 and established a reverse genetics system to investigate its virological properties. Compared to the published reference sequence, we identified two nonsynonymous nucleotide substitutions in the large (L) gene, one of which was critical for restoring polymerase activity, enabling the successful recovery of recombinant BoDV-2 (rBoDV-2). Additionally, we identified two nonsynonymous single-nucleotide polymorphisms (SNPs) in the L gene and one in the phosphoprotein (P) gene. Substitution of these SNPs significantly enhanced the growth ability of rBoDV-2. Furthermore, our studies demonstrated that BoDV-2 does not induce superinfection exclusion in cells, allowing the persistence of low-fitness genome variants for an extended period of time. These findings help to characterize the virological properties of BoDV-2 and shed light on how bornaviruses maintain genetic diversity in infected cells.\u003c/p\u003e","manuscriptTitle":"Absence of superinfection exclusion of Borna disease virus 2 maintains genomic polymorphisms in persistently infected cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-01 15:27:35","doi":"10.21203/rs.3.rs-4544977/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-29T07:33:05+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-29T05:32:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-22T12:17:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"42021546321434780694139381918959572542","date":"2024-07-15T05:40:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59596764428057172601552872266445881497","date":"2024-07-14T18:13:01+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-09T09:20:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-09T09:15:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-09T04:15:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"npj Viruses","date":"2024-06-07T09:04:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"npj-viruses","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [npj Viruses](https://www.nature.com/npjviruses)","snPcode":"44298","submissionUrl":"https://submission.springernature.com/new-submission/44298/3","title":"npj Viruses","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"NPJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"81b3de98-1899-45c5-b0a6-88a9a88e543e","owner":[],"postedDate":"August 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":35257321,"name":"Biological sciences/Microbiology"},{"id":35257322,"name":"Biological sciences/Microbiology/Virology"}],"tags":[],"updatedAt":"2025-04-04T08:23:10+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-01 15:27:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4544977","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4544977","identity":"rs-4544977","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}