The Z-Ring in Multicellular Cyanobacteria has a dynamic pearl necklace arrangement

The Z-Ring in Multicellular Cyanobacteria has a dynamic pearl necklace arrangement | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The Z-Ring in Multicellular Cyanobacteria has a dynamic pearl necklace arrangement Mónica Vásquez, Jorge Olivares, Derly Andrade Molina, Annia González-Crespo, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4660361/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Z-ring formation by FtsZ in the midcell is a key event in bacterial cell division. Results obtained with different super-resolution techniques have shown that the Z-ring is discontinuous, while live cell imaging has shown that FtsZ moves by treadmilling. In multicellular cyanobacteria, there have been no studies on the structure or dynamics of the Z-ring. In this study, we generated fully segregant mutants that express FtsZ fusions with fluorescent tags under the control of the native promoter in Anabaena sp., in which the Z-ring resembles a pearl necklace of dynamic arrangement with mobilization of FtsZ on the seconds scale. Division along filaments is asynchronous; however, manipulating the light conditions improves cell synchronization. Using correlative microscopy, we demonstrate that the DNA remains in the septum during constriction, therefore, the nucleoid occlusion mechanism does not apply here. To the best of our knowledge, this is the first live imaging of Z-ring behavior using fully segregated FtsZ mutants in a multicellular bacterial system. Biological sciences/Microbiology/Bacteria/Bacterial development Biological sciences/Molecular biology/Cell division Biological sciences/Microbiology/Cellular microbiology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The bacterial cell division machinery involves coordination of two processes: cellular elongation, which encompasses chromosome replication and segregation, and septum formation 1 . The first event in the septation process is the localization of FtsZ at the cell midpoint. This protein, which is structurally homologous to tubulin, is conserved and widely distributed in most bacteria 2 . Within the group of S-layered Archaea and chloroplasts, two copies of FtsZ (FtsZ1 and FtsZ2) were identified 3 . Recently, it was found that FtsZ has two conformational states (T for tense and R for relaxed) that may play a key role in the formation of protofilaments 4 , which are arranged in the Z-ring structure in vivo as a scaffold for other division proteins, orchestrating the molecular machinery known as divisome 5 . This structure comprises proteins that directly interact with FtsZ, such as FtsA, along with components that regulate peptidoglycan remodeling during cell division. The precise architecture and dynamics of the Z-ring in bacteria have been challenging. However, recent advances in Super-Resolution Microscopy (SRM) and fluorescent protein fusion have served to elucidate its structure across different organisms. Studies in Escherichia coli using Photoactivated Localization Microscopy (PALM), three-dimensional Structured Illumination Microscopy (3D-SIM), and Stimulated Emission Depletion (STED) microscopy have revealed that the Z-ring consists of randomly distributed protofilaments that localize in patches within the ring structure 6 , a pattern modifiable by the GTPase activity and concentration of FtsZ 7 . Similar heterogeneous FtsZ organization within the Z-ring has been described in Streptococcus pneumoniae 8 , Caulobacter crescentus 9 , Bacillus subtilis , and Staphylococcus aureus 10 . A major question in bacterial division revolves around whether FtsZ alone generates the active force driving cell division, but the answer remains unclear owing to conflicting evidence. While FtsZ can deform liposomes and vesicles in vitro 11 , it has been shown that the Z-ring is not essential during the late stage of constriction 12 . In addition, alterations in the peptidoglycan (PG) machinery affect the rate of constriction, whereas modifications to the assembly and GTPase activity of FtsZ do not have the same effect 13 . Furthermore, dynamics-wise studies in different models have highlighted the Z-ring dynamic behavior by treadmilling, a property regulated by the GTPase activity of FtsZ. In B. subtilis , treadmilling limits PG synthesis and cell constriction 14 . Whereas in E. coli , although treadmilling of the Z-ring contributed to the spatial organization of the PG synthesis machinery, it did not limit the constriction rate 15 . Cyanobacteria are photosynthetic microorganisms classified as gram-negative based on cellular morphology but phylogenetically closer to gram-positive bacteria 16 . These organisms possess cell division proteins shared by both gram-positive and gram-negative bacteria 17 and feature unique proteins in their divisome 18 . The only study of the spatial organization of FtsZ within the Z-ring in cyanobacteria has been conducted in the unicellular organism Prochlorococcus. Through Stochastic Optical Reconstruction Microscopy (STORM) and labeled antibodies in fixed cells, a pattern of patches and discontinuous structures has been observed in the Z-rings of this unicellular model 19 . The multicellular filamentous cyanobacteria, Anabaena sp. PCC 7120 (hereafter Anabaena sp.) has been used as a cell division model. Previous studies using fluorescent fusions in Anabaena sp. have determined only FtsZ positioning in the middle of the cells 20 , 21 , unveiling new polymerization regulators, such as SepF 22 . In addition to its role in the divisome of Anabaena sp., FtsZ involvement in cell-to-cell communication and filament integrity has been postulated because of its interactions with septal proteins such as SepJ 23 . Studies for the visualization of the Z-ring have been performed in other filamentous cyanobacteria, such as Fischerella muscicola PCC 7414 and Chlorogloeopsis fritschii PCC 6912, employing FtsZ-GFP fluorescence fusions from expression vectors and different promoters 24 . However, the 3D organization of the Z-ring and the dynamics of FtsZ in filamentous cyanobacteria in vivo remain unexplored. In our study, mutants of Anabaena sp. expressing the FtsZ protein fused with the fluorescent proteins sfGFP, mTagBFP2, and mVenus were generated through triparental mating and homologous recombination by replacing the fts Z wild-type gene with the corresponding fusion variant. Using these mutants, we describe the first details of FtsZ localization in filamentous cyanobacteria and their dynamics within the Z-ring. Our research reveals the asynchronous nature of Z-ring formation in cyanobacterial cell division. Additionally, by resetting and training, we observe a modest enhancement in the synchronization of cell division across filaments. Our observations indicate that the Z-ring in Anabaena sp. showcases a pearl necklace arrangement characterized by highly dynamic behavior—treadmilling forward and reverse. This dynamism is emphasized by swift changes in fluorescence occurring on a time scale of seconds, indicating a notable turnover of FtsZ. Results Functionality of FtsZ fused to mVenus in the C-terminal region. To follow the cell division process in Anabaena sp., different strains of mutants with FtsZ fused to fluorescent proteins in the C-terminal region under the transcriptional control of the native promoter were generated (Fig. 1 a). Given that Anabaena sp. possesses multiple chromosomal copies, segregation was confirmed by PCR, demonstrating that the FtsZ-sfGFP, FtsZ-mVenus, and FtsZ-mTagBFP strains were fully segregated at the genetic level (Supplementary Fig. 1). In these mutants, the FtsZ fluorescent tag-labelled protein was the only FtsZ source in the cells. The fully segregated strains formed filaments as the wild-type and exhibited Z-rings with the expected fluorescent signal in the middle of the cell (Fig. 1 b and Video 1). Notably, filaments formed by mutant cells showed varying cell division stages under a 12:12 Light-Dark cycle (12:12 LD). Their growth rate was similar to the wild-type (Supplementary Fig. 2), indicating that the fusion proteins effectively replaced native FtsZ, thereby maintaining a normal division process. Cell morphology across different strains was analyzed, and the comparison revealed no significant differences in individual cell area between the wild-type (mean ± SD = 9.02 ± 1.89 µm 2 ; n = 210) and the FtsZ-mVenus strain (mean ± SD = 9.07 ± 1.73 µm 2 ; n = 322). However, both FtsZ-sfGFP (mean ± SD = 10.06 ± 2.54 µm 2 ; n = 198) and FtsZ-mTagBFP2 (mean ± SD = 10.23 ± 2.14 µm 2 ; n = 209) strains displayed a different morphology than the wild-type, with a larger cell area. Similar results were obtained when the major and minor axes of the cells were measured (Fig. 1 c). Hence, we concluded that the FtsZ-mVenus fusion effectively replace the native FtsZ, preserving morphological characteristics similar to the wild-type, unlike what occurs with E. coli fusion tags. For instance, subsequent analysis mainly utilized the FtsZ-mVenus strain. As expected, upon nitrogen depletion, the filaments did not exhibit the FtsZ signal in the heterocysts (Supplementary Fig. 3). Segregation of genetic material occurs during the late stage of cell division in Anabaena sp. The coordination between Z-ring constriction and DNA segregation was studied by DAPI staining in the FtsZ-mVenus and FtsZ-sfGFP mutants (Fig. 2 a). We noted the absence of autofluorescence, and therefore, a lack of thylakoids, in the central region of the cells. This zone coincides with the area stained with DAPI, indicating the presence of DNA. Throughout various stages of cellular division, the Z-ring demonstrated co-localization with the genetic material, suggesting the existence of a nucleoid in the septum region, even during advanced constriction stages. To further elucidate the aforementioned findings, cryo-Correlative Light and Electron Microscopy (cryo-CLEM) was employed, integrating cryo-Airyscan microscopy and cryo-Focus Ion Beam Scanning Electron Microscopy (cryo-FIB-SEM) volume imaging data of the FtsZ mutants. The cryo-FIB-SEM imaging (Supplementary Fig. 4) reveals by its features the presence of unsegregated DNA located at the division septum during ongoing constriction. Through cryo-CLEM analysis (Fig. 2 b), the peripheral localization of thylakoid membranes within the cells was verified, along with the central positioning of nucleoids lacking autofluorescence signal. The co-localization of the unsegregated nucleoid with the Z-ring fluorescence signal in the FtsZ-mVenus and FtsZ-sfGFP mutants was confirmed with improved resolution. It was observed that as Z-ring constriction progressed, the genetic material partially migrated towards the poles of the emerging cells, with definitive chromosomal segregation culminating as the septum neared closure. An intriguing observation was the presence of abnormal morphology in a subset of cells from the FtsZ-sfGFP mutant. Notably, we observed the occurrence of a double septum (an extremely rare event in the wild-type strain), indicating potential dysfunction in FtsZ in this strain (Supplementary Fig. 5). Cell division along the filaments of Anabaena sp. is asynchronous. To evaluate the synchronization of cell division along Anabaena sp. filaments, a quantitative analysis was conducted by measuring the Z-ring diameter using confocal microscopy acquisitions and Fiji (ImageJ) software 25 . The classification of cell division stages was based on Z-ring diameter and the degree of constriction: Z-ring diameters above 2.5 µm were categorized as "early division," indicating the formation of a Z-ring without significant cell constriction; Z-ring diameters ranging from 2.5 µm to 1.5 µm indicated a "mid-division" state, characterized by an evident constriction between the emerging cells. For Z-ring diameters less than 1.5 µm, the cells enter a "late division" state, marking the final phase of constriction as cells nearly complete the separation process. Concerning the FtsZ-sfGFP fusion, out of a total of 349 rings analyzed in cells under normal growth conditions (12:12 LD), 210 Z-rings were classified as early rings (60.2%), 91 as mid rings (26.1%), and 48 as late rings (13.7%) (data not shown). The Z-ring diameter in the FtsZ-mVenus was measured under different light-dark conditions: constant light (LL; n = 545), 12:12 LD cycle (LD; n = 638), and 12:12 LD cycle with a prior reset after 48 hours of darkness (DD-LD; n = 777) (Fig. 3 a). The results indicate that the distribution of the Z-ring diameters within individual cells fluctuates based on the light-dark treatment, with a reduced occurrence of late rings in the case of the DD-LD condition (Fig. 3 b). Subsequent analysis of the Z-rings per filament revealed that under continuous light (LL) conditions, the filaments (n = 17) exhibited a lower proportion of early rings but a higher proportion of late rings in comparison to filaments under the DD-LD regimen (n = 16) (Fig. 3 c). These results lead to the conclusion that cell division in Anabaena sp. is asynchronous in terms of Z-ring constriction under normal growth conditions, yet it can be partially synchronized with 48 hours of darkness. FtsZ has a pearl necklace arrangement in the Z-ring of Anabaena sp. To study the spatial arrangement of FtsZ within the Z-ring, Airyscan microscopy analysis and 3D reconstructions of Z-rings in the FtsZ-mVenus strain were conducted. Our observations revealed that cells at different stages of division exhibited a heterogeneous fluorescence distribution along the Z-ring structure. Two predominant architectures were identified: Z-rings with multiple and large signal-free regions, indicating high discontinuity (Video 2), and those with nearly closed structures and minimal fluorescence gaps, indicating low discontinuity (Video 3). Subsequently, these rings were further classified based on the cell division stage, indicating that the majority of high-discontinuity rings (n = 38) were in the early division phase (97.37%). In contrast, low-discontinuity rings (n = 23) were mainly in the mid (56.52%) or late (34.78%) division states (Fig. 4 a). This demonstrates that the Z-ring architecture undergoes dynamic transformations as cell division progresses, ultimately leading to a more compact structure by the end of the process. By examining the fluorescence intensity of rings with different diameters, a heterogeneous pattern with two regions of increased fluorescence intensity positioned opposite to each other was observed (Fig. 4 b). These findings suggest that the spatial distribution of FtsZ along the Z-ring in Anabaena sp. occurs in patches and is not due to ring diameter, consistent with observations made in other bacterial models 10 . In the case of the FtsZ-sfGFP strain, a similar signal distribution was noted in the 3D reconstructions, along with the presence of fluorescent clusters within the cytoplasm, which is a characteristic absent in the FtsZ-mVenus strain (Supplementary Fig. 6 and Video 4). Despite the low fluorescent protein signal, 3D reconstructions were successfully performed in the FtsZ-mTagBFP2 rings, yielding comparable outcomes (Supplementary Fig. 7). The Anabaena sp. Z-ring is a highly dynamic structure. It has been demonstrated that variations in fluorescence intensity occur temporally along the Z-ring when FtsZ is fused to a fluorescent tag, whether employing complete or partial gene replacement, and across different bacterial systems 15 , 26 , 27 . To investigate whether this phenomenon also occurs in Anabaena sp., time-lapse microscopy experiments were conducted on filaments of the FtsZ-mVenus strain parallel to the optical axis of the microscope, with observations made in the transversal plane in Anabaena sp. 28 . The ring dynamics were visualized at 10-second intervals, uncovering rapid fluctuations in the signal along the rings in a short time (Fig. 5 a and Video 5). Owing to the heterogeneous distribution of FtsZ within the rings, the fluctuations in the fluorescence signal varied in magnitude and direction (increase or decrease). This temporal pattern was consistently observed across rings at different division states. Kymographs of the FtsZ-mVenus clusters were produced, and individual trajectories of the fluorescence signal were tracked to determine the filament velocity of FtsZ within early (mean ± SD = 16.91 ± 0.64 nm/sec; n = 727 trajectories), mid (mean ± SD = 15.13 ± 0.52 nm/sec; n = 125 trajectories), and late (mean ± SD = 14.95 ± 0.42 nm/sec; n = 20 trajectories) Z-rings (Fig. 5 b). We observed a slight yet significant difference in velocity between clusters within the early and mid-rings. Moreover, forward and backward movements of FtsZ filaments along the early, mid, and late Z-rings were noted (Fig. 5 c). Fluorescence Recovery After Photobleaching (FRAP) with FtsZ-sfGFP was performed because of its better signal and photostability than FtsZ-mVenus fusion. After photobleaching, a rapid recovery recuperation of fluorescence within the ring was observed, with a T-half of 39 seconds and a mobile fraction of 1 within a period of 110 seconds for signal restoring (Supplementary Fig. 8). Based on the findings, it suggests that FtsZ undergoes bidirectional motion along the Z-ring in Anabaena sp. during cell division, with swift exchange between the cytoplasmic pool and the Z-ring occurring within seconds. To conduct time-lapse microscopy over an extended time, a microfluidic system tailored to Anabaena sp. was developed using a mother-machine device. This setup comprises a central channel of 100 µm flanked by crypts on each side that facilitate the entry and immobilization of filaments within a liquid medium (Fig. 6 a). We effectively tracked the cell division process of Anabaena sp., confirming the functionality of the Z-ring in terms of its ability to constrict (Fig. 6 b and Video 6). Surprisingly, although most of the Z-rings were present in the cells, a large portion remained inactive in terms of constriction along the filaments. Specifically, under normal LD conditions, only 82 rings (27.06%) exhibited activity, whereas 221 rings (72.94%) did not contract during the long-term experiments. Under the DD-LD condition, a lower percentage of active rings was observed, with only 26 rings (13.54%) displaying activity. Furthermore, static behavior was evident in cells that remained undivided, even after 58 hours of observation (Supplementary Fig. 9). Accordingly, cell division occurs predominantly in a few selected cells along the filaments of Anabaena sp., serving as hotspots of growth but apparently with no specific pattern. Using this dataset, we assessed the velocity of constriction in rings that were active during acquisition in both LD (n = 303) and DD-LD (n = 192) treatments. Surprisingly, results indicated the absence of significant variances between the two conditions concerning constriction velocity for early (LD mean ± SD = 92.88 ± 33.74 nm/h; DD-LD mean ± SD = 119.5 ± 22.00 nm/h), mid (LD mean ± SD = 119.4 ± 34.48 nm/h; DD-LD mean ± SD = 150.6 ± 17.50 nm/h), and late (LD mean ± SD = 100.5 ± 22.69 nm/h; DD-LD mean ± SD = 130.2 ± 28.80 nm/h) rings (Fig. 6 C). Our results suggest that the velocity of constriction remains uniform even after the darkness reset, a measure implemented to optimize the synchronization of cell division in Anabaena sp. Discussion One of the primary hurdles in fluorescent protein labeling is the achievement of a fully operational fluorescent fusion that serves as an exclusive source of the protein under scrutiny. This is crucial in cell division studies, where fluctuations in protein concentration or improper folding can result in irregularities in cell structure and division mechanisms. The objective of fusing FtsZ with a fluorescent tag as the only source of FtsZ in E. coli was achieved in 2006, owing to the utilization of suppressor strains and creation of an FtsZ-CtYFP fusion 29 . A breakthrough occurred in 2017 with the creation of a fully functional FtsZ fusion incorporating mVenus inserted at the G55-Q56 site 30 . Despite the successful mutation, this construct exhibits morphological and divisional abnormalities. In a recent study, a novel strain of E. coli featuring an FtsZ fusion tagged with a nanotag (FtsZ-ALFA) expressing fluorescently labeled nanobodies was generated 31 . Although successful in achieving in vivo FtsZ labeling, this system poses challenges, particularly in optimizing nanobody expression via arabinose induction. Full replacement of a division protein with fluorescent fusion has been demonstrated with other components of the divisome, including FtsA 32 and FtsN 33 , as well as with FtsZ in gram-positive models such as B. subtilis 10 . Creating functional fluorescent fusions with FtsZ is challenging due to its interactions with other divisome components, which can be disrupted by fluorophore insertion. Additionally, misfolding may occur in the absence of an appropriate linker. Knowledge of FtsZ dynamics in cyanobacteria, such as Anabaena sp., has been less explored than in other bacterial systems. Researchers have primarily focused on the interactions between FtsZ and other proteins, and on assessing the repercussions of altering other divisome components on Z-ring positioning utilizing FtsZ tagged with fluorescent markers 34 . However, initial research efforts were unable to offer comprehensive insights into the spatial organization of FtsZ protofilaments in vivo . In this study, we describe for the first time the intricate Z-ring dynamics in filamentous cyanobacteria, using a fully functional FtsZ-mVenus fusion protein within an in vivo system. Prior FtsZ fusions in Anabaena sp. predominantly incorporated the wild-type (WT) copy as an extra source of the protein, with some instances featuring fusions controlled by the inducible pet E promoter 35 . However, these systems are not optimal for characterizing subcellular localization because of variations in expression level 7 . Recently, Xing et al ., explored the role of HetF as a divisome component that is significantly affected by the light intensity. In this study, a mutant with FtsZ fused to CFP was constructed as a fluorescent marker. However, it did not demonstrate the full substitution of wild-type FtsZ with the CFP-fused variant 36 . In our study, we replaced the wild-type ftsZ gene with three distinct FtsZ fusions regulated by the Anabaena sp. native promoter, thus confirming full gene replacement. Among these mutants, only FtsZ-mVenus exhibited a morphology indistinguishable from the wild type (Fig. 1 c), likely due to mVenus monomeric properties. In contrast, the tendency of GFP to dimerize 37 could account for the observed division anomalies and aggregate formation in the FtsZ-sfGFP mutant (Supplementary Figs. 5 and 6). Future investigations employing fluorescent fusions with cell division proteins in filamentous cyanobacteria should prioritize the use of monomeric, smaller, brighter, and more stable fluorescent markers. This approach is essential for minimizing misfolding and propensity towards dimerization and achieving robustness, thus leading to the attainment of strong fluorescent signals and preventing artifacts in fluorescence microscopy. Similarly, in the multicellular bacteria Streptomyces coelicolor , it was possible to express an FtsZ-eGFP fusion, but the strain also contained a wild-type copy of the fts Z gene 38 . The sporulating hyphae of this model have a similar distribution of the Z-rings in almost all cells along the filaments, which the authors referred to as “Z-ladder”, as we found in Anabaena sp. In our observations, we consistently detected the presence of the Z-ring in cells regardless of their division state, and we found cells without a Z-ring in only a small percentage of the samples. This suggests that many cells actively generate and maintain the Z-ring structure in multicellular systems, even when not undergoing cytoplasm contraction, as corroborated by time-lapse recordings (Fig. 6 ). It was somewhat surprising that chromosome segregation was incomplete during cell constriction in Anabaena sp. (Fig. 2 a). Cryo-CLEM analysis confirmed that unsegregated DNA colocalizes with the Z-ring during the final stage of constriction (Fig. 2 b). Similarly, in the unicellular cyanobacteria Synechocystis , chromosome segregation occurs in the late stage of the cell cycle through a random and less stringent mechanism of DNA distribution, contrasting with the uniform spatial arrangement seen in classic bacterial models 39 . These results support the notion that the nucleoid occlusion system might not be applicable to cyanobacteria, as previously described 40 . In Synechococcus elongatus , a time-lapse study with individually labeled chromosomes described a linear organization along the long axis of the cell that allows equal segregation of the genetic material 41 . This indicates that cyanobacteria might have different mechanisms of DNA distribution during cell division depending on the species. Both fluorescent FtsZ and chromosome labeling at the ori zone together could provide insights into the mechanism of DNA segregation in Anabaena sp. The distribution of Z-rings with different diameters in Anabaena sp. under LD conditions (Fig. 3 a) showed that most rings were in an early stage of cell division, but late rings can also be found along the filaments, even after 48 hours of dark synchronization (Fig. 3 b). This indicates that cell division in Anabaena sp. under normal growth conditions was asynchronous, and alterations in light exposure affected the distribution of the Z-ring diameters. Consequently, cell division could be regulated by light in Anabaena sp. It has been proposed that the circadian rhythm plays a role in regulating cell division, affecting the localization of FtsZ in the unicellular cyanobacteria S. elongatus. In this model, it was shown that the Z-ring assembly is inhibited by KaiC during the early dark phase due to an increase in its ATPase activity 42 , and that cell division is asynchronous with two subpopulations of cells that have different times of birth and cell cycle duration in 12:12 LD conditions 43 . Therefore, as observed in Anabaena sp., it is not possible to achieve complete synchronization of the whole system, possibly because of other factors that can affect cell division such as nutrients, redox state, and environmental signals. This implies that the cells in the Anabaena sp. filaments are always in different metabolic states, and thus, the only valid approach for studies on gene expression in filamentous cyanobacteria is to use techniques that can show what is happening at the single-cell level. Therefore, studies measuring gene expression using the entire filament should not be considered 44 . A deep look at the Z-ring structure of Anabaena sp. was performed by 3D reconstruction along the Z plane of the Z-rings, revealing a heterogeneous distribution of FtsZ within the rings, with clusters of FtsZ distributed in a pearl necklace-like arrangement, as previously described for B. subtilis and S. aureus 10 , both gram-positive bacteria. This arrangement consists of regions with higher concentration of FtsZ protofilaments (beads) and gaps with no signal. In our model, we found that the presence of gaps diminishes as the process of cell division progresses, which is consistent with the idea that these gaps could serve as a space that allows the accommodation of protofilaments. Therefore, the Z-ring condenses as the constriction advances. It is possible that other divisome components are present in the gap regions, as previously demonstrated with FtsN in E. coli 45 . Similar to FtsN, other cyanobacterial proteins that interact with the cell wall can influence FtsZ positioning because of their dynamics during peptidoglycan remodeling. The present study is the first to analyze the distribution of FtsZ in the in vivo Z-ring structure with fully segregant cyanobacterial strains. In our model, better resolution is necessary to resolve the spatial organization of individual FtsZ protofilaments, and how FtsZ may form within the ring and other substructures such as toroids 46 or mini rings 47 . In Z-ring studies, cells parallel to the microscope optical axis are frequently used to increase the data quality because of the higher resolution in the XY plane compared with the XZ or YZ planes. We previously developed a vertical orientation method for filamentous cyanobacteria that allowed us to perform imaging of the whole Z-ring in one plane 28 and observed the same pearl necklace-like arrangement without 3D reconstruction in the FtsZ-mVenus mutant (Fig. 5 a). With this methodology, we were able to record the dynamics of the Z-ring on a time scale of seconds, and with the results we suspect that the pearl necklace arrangement is highly dynamic with bidirectional movement of FtsZ protofilaments, which is consistent with observations in gram-positive systems like Streptococcus pneumoniae 48 , and other gram-negative bacteria such as E. coli 11 . Previously, FtsZ localization in the Z-ring in cyanobacteria was performed in unicellular Prochlorococcus using antibodies and fixed cells 19 . Similar to our results, the FtsZ protein predominantly localizes as a patchy midcell band rather than a continuous ring. The dynamics of the Z-ring structure of filaments may be crucial for understanding the regulation and timing of cell division in this multicellular model. As a result, we recorded the complete cell division process of Anabaena sp. by time-lapse microscopy in the FtsZ-mVenus mutant (Fig. 6 ), and we found a large percentage of rings in an early stage that did not divide during the acquisition, with only a few rings actively dividing. The latent stage of the Z-ring constriction has been reported previously in C. crescentus, a gram-negative alpha proteobacterium that exhibits a dimorphic life cycle, in which there is a 30-minute delay between the positioning of the Z-ring and the contraction of the cells 49 . In B. subtilis , non-constricted rings were found and described as “mature” rings using an FtsZ-GFP mutant 50 , whereas in a strain of E. coli BW25113 that also expresses an FtsZ-GFP fusion, there is a period of approximately 50 minutes, during which a latent phase between the stabilization of the Z-ring and the constriction can be observed in M9 medium 51 . The maintenance of a dynamic structure as the Z-ring is an energy-consuming process, therefore, the presence of early rings without an active cell division implies that FtsZ, and the Z-ring, could be performing in Anabaena sp. other important functions such as filament integrity. It is unclear whether the presence of non-dividing Z-rings in Anabaena sp. cells is maintained by the activity of other division proteins, or if the Z-ring is stimulated by a signal that triggers the assembly of the divisome to start constriction. Further studies are required to answer the question of when cyanobacterial cells go to division or, in other words, when the switch from the latent state of the Z-ring to an active and contractile structure occurs. Cyanobacteria possess a gram-negative cell wall organization but share features with gram-positive bacteria such as the chemical composition, cross-linking, and thickness of the peptidoglycan 52 . In a recent genomic analysis, Cyanobacteria were classified within the clade Terrabacteria, where they are closely related to Actinobacteriota and Firmicutes, both gram-positive 53 . This duality between gram-negative and gram-positive in Cyanobacteria is also reflected in the mixture of their divisome components; therefore, the mechanism and dynamics of divisome assembly could be different from what is known in classic division models. In E. coli , the temporal hierarchy of divisome assembly is divided into two steps by a specific time delay, which is also true for gram-positive model B. subtilis 54 , 55 . However, in the case of E. coli , the divisome follows a linear pathway of assembly dependency, whereas in B. subtilis , the assembly is interdependent and concerted 56 . Our work is the first step in detailing the assembly of a divisome in a multicellular system and its temporal hierarchy. This can be accomplished by tagging other divisome components in our FtsZ mutants, such as CyDiv, SepF, and FtsQ, and subsequently performing time-lapse microscopy to determine the timing of their assembly. Our findings suggest that Anabaena sp. might regulate cell division to improve filament fitness, with only certain cells consuming energy to enable reproduction along the filaments, which could lead to asynchronous division. In some filamentous cyanobacteria, complex cellular processes are highly regulated, such as differentiation into heterocysts under nitrogen-depleted conditions 57 . This differentiation process is regulated by the diffusion of signaling molecules through filaments 58 . As occurs during heterocyst differentiation, cells under division may produce some factors that inhibit the Z-ring constriction in the neighboring cells, or an asymmetric cell division, proposed in Anabaena sp., could influence cell division patterns, as observed in CyDiv protein localization 59 . Proteins that are present exclusively in either the "new" or "old" nascent cells may mediate cellular aging and gating the constriction of the Z-ring. Methods Bacterial growth conditions. Anabaena sp. PCC 7120 (wild-type) was grown in BG11 medium under a 12:12 LD cycle. The FtsZ-sfGFP mutant was grown in BG11 or BG11 0 medium (liquid) supplemented with 10 µg/mL spectinomycin and streptomycin (Sp 10 /Sm 10 ) at 25°C in 12:12 LD. The other mutants (FtsZ-mTagBFP2 and FtsZ-mVenus) were grown under the same conditions as the FtsZ-sfGFP mutant, but with spectinomycin at 10 µg/mL (Sp 10 ). E. coli strains were grown in LB medium supplemented with Sp (50 µg/mL), Sm (25 µg/mL), and Cm (30 µg/mL) at 37°C. Assembly of the FtsZ-sfGFP construct in pRL271 plasmid. The FtsZ-sfGFP fusion of this work (Fig. 1 a) contains fts Z of Anabaena sp. fused to the coding sequence of sfGFP through the linker TTACAATCTAGATTAGAA (LQSRLE) previously described in the N-terminal region of FtsZ 60 . Downstream of the fusion, the resistance cassette C.SR3 (Sp/Sm) was incorporated. Two flanking regions (I.R.1 and I.R.2- all 3859) were added, which are homologous to the genome of Anabaena sp. and were necessary for subsequent homologous recombination in cyanobacteria. Amplification of different parts of the construct was performed by PCR using the enzyme Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) and primers containing homologous regions between adjacent pieces to obtain overlapping regions of 40 bp, thus allowing homologous recombination in yeast. The PCR products obtained were co-transformed with the linearized vector pRS426 following a previously described method 61 and assembled in Saccharomyces cerevisiae FY834. Subsequently, the assembled plasmids were extracted from yeast and transformed into E. coli DH5α. Bgl II and Pst I enzymes were used to extract the construct from the pRS426 plasmid. Next, the digested product and pRL271 plasmid linearized with the respective restriction enzymes were purified using the GeneJET Gel Extraction kit (Thermo Scientific). Thereby, ligation was carried out with the enzyme T4 DNA ligase (Thermo Scientific) at 4°C O.N. The ligation products were transformed by heat shock in chemocompetent E. coli HB101, and the cells were plated on LB agar supplemented with antibiotics (Sp 50 /Sm 25 ) and incubated at 37°C O/N. Finally, antibiotic-resistant colonies were grown in liquid LB medium (Sp 50 /Sm 25 /Cm 30 ) and the pRL271 plasmid with FtsZ-sfGFP fusion (pRL217_FtsZ::sfGFP) was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific). Assembly of FtsZ-mVenus and FtsZ-mTagBFP2 constructs in the pRL271 plasmid. The genetic constructs of FtsZ-mVenus and FtsZ-mTagBFP2 had an assembly approach similar to FtsZ-sfGFP (Fig. 1 a), but with replacement of the corresponding fluorophore (mVenus or mTagBFP2) and a shorter resistance (Sp only). Amplification of the different regions was performed by PCR using the enzyme Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) and primers with homologous regions to create overlapping regions of 40 bp. The amplified products were purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific), and the Gibson assembly reaction was performed as described before 62 . The assembled DNA was transformed into chemocompetent E. coli HB101 cells, and the transformed cells were plated on LB agar with 50 µg/mL spectinomycin at 37°C O.N. Then, the resistant colonies were grown in liquid LB medium (Sp 50 /Cm 30 ), and pRL271 plasmids with the FtsZ-mVenus and FtsZ-mTagBFP2 fusions (pRL217_FtsZ::mVenus and pRL217_FtsZ::mTagBFP2) were extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific). Triparental mating in Anabaena sp. E. coli HB101 carrying a methylation plasmid (pRL623) was transformed with the pRL271_FtsZ::sfGFP, pRL217_FtsZ::mVenus and pRL217_FtsZ::mTagBFP2 plasmids to generate the cargo strains. Conjugation of Anabaena sp. with the cargo and the conjugal strains ( E. coli HB101 carrying the conjugal plasmid pRL443) was performed as previously described 63 . Replacements of fusions and antibiotic resistance were generated through homologous recombination in Anabaena sp. Colonies were selected in BG11 agar medium with antibiotics (Sp 50 /Sm 25 or Sp 50 ), and resistant colonies were grown in BG11 medium with antibiotics (Sp 10 /Sm 10 or Sp 10 ). Sm/Sp or Sp-resistant colonies were plated on BG11 agar medium with 5% sucrose plus antibiotics to select clones with double recombination events 64 . DNA extraction. Colonies resistant to antibiotics and sucrose were grown in BG11 with antibiotics (Sp 10 /Sm 10 or Sp 10 ), and genomic DNA was extracted with a modified version of the xanthogenate method. In a 1.5 ml tube, 200 µl of the cultures were mixed with 500 µl of buffer X (1% m/v of potassium ethyl xanthogenate, 0.8 M ammonium acetate, 0.1 M Tris-HCl pH 7.4 and 0.02 M EDTA pH 8.0) and glass beads of 600 nm. The cultures were lysed in the TissueLyser II system (QIAGEN) using a 3-minute/30-second cycle. 50 µl of 10% SDS were added, and the samples were incubated first for 1 hour at 70°C and then for 30 minutes on ice. After the incubation on ice, the lysates were centrifuged at 13000 rpm for 10 minutes at room temperature. The supernatants were transferred to a new 1.5 ml tube, then were mixed with 500 µL of phenol:chloroform:isoamyl alcohol (25:24:1), and centrifuged at 13000 rpm for 10 minutes at 4°C. The upper phase of the tubes was transferred to a new 1.5 ml tube and mixed with 500 µL of chloroform:isoamyl alcohol (24:1). The mixtures were centrifuged again at 13000 rpm for 10 minutes at 4°C, and the upper phase containing the DNA was mixed O/N with the same volume of isopropyl alcohol and a 1:10 volume of 4 M ammonium acetate at -20°C. Finally, the precipitated DNA was centrifuged at 13000 rpm for 10 minutes at 4°C, the supernatant was eliminated, and the pellet was dried at room temperature for 1 hour. The DNA was resuspended in 30 µL of nuclease-free water. Screening and segregation of the strains. To determine the degree of segregation of the colonies, PCR amplification was performed using the TTTCTTCAGAGACGGCGACCA (Fw) and TGGTACTCGCCTGGCTCATC (Rv) primers, which differentially amplify the fts Z wild-type gene (approximately 370 bp) and the presence of the constructs with the Sp/Sm or Sp cassette (approximately 3200 bp and 2000 bp, respectively). Confocal microscopy. Aliquots (10 µL) were placed on slides with LMP agarose 3% to immobilize the cells. To observe the distribution of genetic material during the process of cell division, before depositing the sample of the mutant on agarose, the culture was incubated in the dark for 10 minutes with a final concentration of DAPI at 7.5 µg/mL. To capture images, a Nikon Ti2-E inverted microscope or Leica SP5/SP8 confocal microscope was used with a 100x objective at 21°C. A 2x or 3x digital zoom was added. The lasers used to excite DAPI and the autofluorescence were 405 and 561 nm, respectively, while the detection spectra for these signals were 410–483 and 561–781 nm respectively. For FtsZ-mVenus, FtsZ-sfGFP, and FtsZ-mTagBFP2, the excitation wavelengths were 514, 488, and 405 nm, while the detection ranges were 525–572, 496–545, and 415–493 nm respectively. Time-lapse microscopy and mother machine device. To immobilize the cells for time-lapse records on a short temporal scale (seconds), a previously described method 28 was used in the FtsZ-mVenus mutant. These samples were observed using a ZEISS LSM 880 Confocal Laser Scanning Microscope (Airyscan) using a 63x objective, 514 nm excitation laser, and–525–572 nm detection range at 21°C with an optical zoom of 4x. For FRAP analysis, the acquisition was performed in the FtsZ-sfGFP mutant with a 5-second interval using the 488 mm laser at 0.4%, and bleaching was performed with the same laser at 100% intensity. Microfluidic devices were designed as a modified version of the “Mother Machine” 65 for long-time observation of Anabaena sp. The design consists of a central 100 µm-wide channel for continuous media injection, flanked by a series of growth channels, each 15 µm in width and 100 µm in length. To facilitate the entry of bacteria into the growth channels, they ended in a narrow, 5 µm wide, and 10 µm long flushing channel, which was connected to a wide collecting chamber connected to the outside through an outlet hole. The height of the device was measured at 7.5 µm. The devices were fabricated using standard ultraviolet (UV) and soft lithography techniques 66 . The molds were fabricated via UV lithography using a maskless laser writer (MLA100, Heidelberg) on a 3-inch silicon wafer (University wafer) covered with a layer of SU-8 (GM1060, Gersteltec Sarl). From the mold, polydimethylsiloxane (PDMS) replicas were obtained from the mold using soft lithography. The PDMS prepolymer and curing agent (Sylgard 184, Dow Corning) were mixed in a 10:1 weight ratio and poured into the mold. After degassing in a vacuum chamber, the PDMS was cured in an oven at 65°C for at least 1 h, cut with a scalpel, and detached from the mold. The inlets and outlet ports were pierced with a biopsy punch on PDMS, and the devices were assembled against a glass coverslip by irreversible bonding after air plasma treatment. The samples were observed in a Nikon Ti2-E inverted microscope using the 100x objective, 488, and 561 excitation lasers with detection ranges of 496–545 and 561–781 nm respectively, at 25°C and 0.1% CO 2 . Cryo-CLEM. Cultures of the wild-type strain and mutants were grown at 30°C and 120 rpm until reaching an OD 650nm of 0.9, and 1 ml of each culture was centrifuged at 3000 rpm for 10 minutes. 800 µl of the medium were discarded and 15 µL of the remnant volume was incubated for 30 minutes at room temperature in a grid that was previously glow discharged to render it hydrophilic and functionalized with poly-lysine (50 ug/ml). The samples were vitrified by plunge freezing into liquid ethane using Leica GP2 equipment, with a blotting time of 4 seconds using the blotting sensor and were stored in liquid nitrogen for further analysis. Cryo-fluorescence imaging was acquired with a Zeiss LS900 Airyscan2 confocal microscope equipped with a Linkam CSM196 cryo-stage using a LD EC Epiplan-Neofluar 100x/0.75 DIC objective, followed by a Z step of 430 nm. Cryo-FIB-SEM imaging was guided by cryo-fluorescence information, and cryo-FIB-SEM tomograms were acquired in confocal areas imaged at high magnification using a Zeiss CrossBeam 550 cryo-FIB-SEM microscope. SEM images were captured at an accelerating voltage of 2 kV and a beam current of 36 pA. The magnification was set to 3.72 Kx, resulting in a pixel size of 5 nm. The Z-track was 25 nm, and a line average of 72 lines was used for noise reduction. Confocal and Airyscan data processing. Airyscan processing was performed in the ZEN Imaging Software (Blue edition) and ImageJ (Fiji). Conventional confocal microscopy was performed using Leica Application Suite X (LAS X) software and ImageJ (Fiji). The time-lapse data was aligned in ImageJ (Fiji) using the StackReg plug-in and then adjusted with Bleach correction. With the KymographClear tool, the time-lapse data was used to generate the corresponding kymographs that were analyzed with KymographDirect software 67 to obtain the velocity of individual trajectories. For FRAP, the data was analyzed using the online tool easy-FRAP web 68 . Cryo-CLEM data processing. Cryo-confocal data was deconvoluted and aligned along the Z-axis and between channels using ZEN Imaging Software (Blue edition). The Cryo-FIB-SEM volumes were processed in Fiji (ImageJ) 25 using linear stack alignment with SIFT in two rounds: first with a maximal alignment error of 600 pixels and second of 5 pixels. The images were denoised with the N2V train and predict tool 69 , and the curtaining effect was corrected using FFT Bandpass Filter processing in Fiji (ImageJ) in two rounds, first with a vertical tolerance of 5% and second, with a horizontal tolerance of 95%. The local contrast correction was performed with the Normalize Local Contrast plug-in in Fiji (ImageJ) using a block radius of 1 pixel in X and 100 pixels in Y, and standard deviations of 3. Cryo-fluorescence and cryo-FIB-SEM data were aligned using Dragonfly software 70 with the manual registration tool in the 4 views mode. Statistical analysis. One-way ANOVA with Tukey’s multiple comparison test was conducted to analyze the percentage of early rings. For late rings, the Kruskal-Wallis test and Dunn’s multiple comparison test were used. The filament velocity of individual trajectories of the FtsZ protofilaments was analyzed using the Kruskal-Wallis test and Dunn’s multiple comparison test. A two-way ANOVA followed by Tukey’s multiple comparison test was employed for the analysis of constriction velocity. Declarations Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Competing interests The authors declare no competing interests. Materials & Correspondence All correspondence and material requests should be directed to the corresponding author. Author contributions JO and MV contributed to the design and execution of all experiments presented in this publication. DA, AGC, and MSG contributed to the design and assembly of plasmids as well as confocal microscopy analysis. MLC contributed to the design and creation of the mother machine system. JC and JMV contributed to cryo-CLEM microscopy and data processing, and OM contributed to the morphological description of the mutants. Acknowledgments This work was supported by Fondecyt #1161232 and CONICYT-PCHA/DoctoradoNacional/2019-21191389 grants (to MV), and by grant PID2022-137175NB-I00 (AEI/FEDER, UE) from the Spanish Ministry of Science, Innovation and Universities (to JMV). The microscopy data was acquired in collaboration with the Advanced Microscopy Facility UMA-UC (Santiago, Chile), CNB-CSIC cryoelectron microscopy (CryoEM CNB-CSIC) facility, and CNB-CSIC Advanced Light Microscopy Facility (Madrid, Spain). References Buss J et al (2015) A Multi-layered Protein Network Stabilizes the Escherichia coli FtsZ-ring and Modulates Constriction Dynamics. PLoS Genet 11:1–24 Duman R et al (2013) Structural and genetic analyses reveal the protein SepF as a new membrane anchor for the Z ring. 10.1073/pnas.1313978110 Terbush AD, Osteryoung KW (2012) Distinct functions of chloroplast FtsZ1 and FtsZ2 in Z-ring structure and remodeling. J Cell Biol 199:623–637 Fujita J et al (2023) Structures of a FtsZ single protofilament and a double-helical tube in complex with a monobody. Nat Commun 14 Lopes Pinto F, Erasmie S, Blikstad C, Lindblad P, Oliveira P (2011) FtsZ degradation in the cyanobacterium Anabaena sp. strain PCC 7120. J Plant Physiol 168:1934–1942 Söderström B, Chan H, Shilling PJ, Skoglund U, Daley DO (2018) Spatial separation of FtsZ and FtsN during cell division. Mol Microbiol 107:387–401 Lyu Z, Coltharp C, Yang X, Xiao J (2016) Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Biopolymers 725–734. 10.1002/bip.22895 Jacq (2015) Remodeling of the Z-Ring Nanostructure during the Streptococcus pneumoniae Cell Cycle Revealed by Photoactivated Localization Microscopy. 6:1–12 Biteen JS, Goley ED, Shapiro L, Moerner WE (2012) Three-dimensional super-resolution imaging of the midplane protein FtsZ in live Caulobacter crescentus cells using astigmatism. ChemPhysChem 13:1007–1012 Strauss MP et al (2012) 3D-SIM Super Resolution Microscopy Reveals a Bead-Like Arrangement for FtsZ and the Division Machinery: Implications for Triggering Cytokinesis. PLoS Biol 10 Ramirez-Diaz DA et al (2021) FtsZ induces membrane deformations via torsional stress upon GTP hydrolysis. Nat Commun 12 Goodman LCC, Erickson H (2022) P. FtsZ is essential until the late stage of constriction. 10.1101/2022.03.01.482533 Coltharp C, Buss J, Plumer TM, Xiao J (2016) Defining the rate-limiting processes of bacterial cytokinesis. Proc Natl Acad Sci U S A 113:E1044–E1053 Bisson-Filho AW et al (2017) Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division. Sci (1979) 355:739–743 Yang X, Lyu Z, Miguel A, Mcquillen R, Huang KC (2017) GTPase activity – coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. 747:744–747 Battistuzzi FU, Hedges SB (2009) A major clade of prokaryotes with ancient adaptations to life on land. Mol Biol Evol 26:335–343 Koksharova OA, Babykin MM (2011) Cyanobacterial cell division: Genetics and comparative genomics of cyanobacterial cell division. Russ J Genet 47:255–261 Mandakovic D et al (2016) CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Front Microbiol 7:1–11 Liu R et al (2017) Three-dimensional superresolution imaging of the FtsZ ring during cell division of the cyanobacterium prochlorococcus. mBio 8 Zhang JY, Lin GM, Xing WY, Zhang CC (2018) Diversity of growth patterns probed in live cyanobacterial cells using a fluorescent analog of a peptidoglycan precursor. Front Microbiol 9 Sakr S, Jeanjean R, Zhang CC, Arcondeguy T (2006) Inhibition of cell division suppresses heterocyst development in Anabaena sp. strain PCC 7120. J Bacteriol 188:1396–1404 Valladares A, Picossi S, Corrales-Guerrero L, Herrero A (2023) The role of SepF in cell division and diazotrophic growth in the multicellular cyanobacterium Anabaena sp. strain PCC 7120. Microbiol Res 277 Ramos-León F, Mariscal V, Frías JE, Flores E, Herrero A (2015) Divisome-dependent subcellular localization of cell-cell joining protein SepJ in the filamentous cyanobacterium Anabaena. Mol Microbiol 96:566–580 Springstein BL, Weissenbach J, Koch R, Stücker F, Stucken K (2020) The role of the cytoskeletal proteins MreB and FtsZ in multicellular cyanobacteria. FEBS Open Bio 10:2510–2531 Schindelin J et al (2012) Fiji: An open-source platform for biological-image analysis. Nature Methods vol. 9 676–682 Preprint at https://doi.org/10.1038/nmeth.2019 Strauss MP et al (2012) 3D-SIM Super Resolution Microscopy Reveals a Bead-Like Arrangement for FtsZ and the Division Machinery: Implications for Triggering Cytokinesis. 10 Bisson-Filho AW et al (2017) Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division. Sci (1979) 355:739–743 Olivares J, González A, Andrade D, Vásquez M (2023) Vertical Immobilization Method for Time-Lapse Microscopy Analysis in Filamentous Cyanobacteria. J Vis Exp. 10.3791/65612 Osawa M, Erickson HP (2006) FtsZ from divergent foreign bacteria can function for cell division in Escherichia coli. J Bacteriol 188:7132–7140 Moore DA, Whatley ZN, Joshi CP, Osawa M, Erickson H (2017) P. Probing for binding regions of the FtsZ protein surface through site-directed insertions: Discovery of fully functional FtsZ-fluorescent proteins. J Bacteriol 199 Westlund E et al (2023) Application of nanotags and nanobodies for live cell single-molecule imaging of the Z-ring in Escherichia coli. Curr Genet 69:153–163 Cameron TA, Margolin W (2023) Construction and Characterization of Functional FtsA Sandwich Fusions for Studies of FtsA Localization and Dynamics during Escherichia coli Cell Division. J Bacteriol 205 Lyu Z et al (2022) FtsN maintains active septal cell wall synthesis by forming a processive complex with the septum-specific peptidoglycan synthases in E. coli. Nat Commun 13 Camargo S et al (2019) ZipN is an essential FtsZ membrane tether and contributes to the septal localization of SepJ in the filamentous cyanobacterium Anabaena. Sci Rep 9 Zheng Z et al (2017) An amidase is required for proper intercellular communication in the filamentous cyanobacterium Anabaena sp. PCC 7120. Proceedings of the National Academy of Sciences 114, E1405–E1412 Xing W-Y et al (2021) HetF Protein Is a New Divisome Component in a Filamentous and Developmental Cyanobacterium. 10.1128/mBio Valbuena FM et al (2020) A photostable monomeric superfolder green fluorescent protein. Traffic 21:534–544 Yagüe P et al (2023) FtsZ phosphorylation pleiotropically affects Z-ladder formation, antibiotic production, and morphogenesis in Streptomyces coelicolor. Antonie van Leeuwenhoek Int J Gen Mol Microbiol 116:1–19 Schneider D, Fuhrmann E, Scholz I, Hess WR, Graumann PL (2007) Fluorescence staining of live cyanobacterial cells suggest non-stringent chromosome segregation and absence of a connection between cytoplasmic and thylakoid membranes. BMC Cell Biol 8 Miyagishima SY, Wolk PP, Osteryoung KW (2005) Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol Microbiol 56:126–143 Jain IH, Vijayan V, O’Shea EK (2012) Spatial ordering of chromosomes enhances the fidelity of chromosome partitioning in cyanobacteria. Proc Natl Acad Sci U S A 109:13638–13643 Dong G et al (2010) Elevated ATPase Activity of KaiC Applies a Circadian Checkpoint on Cell Division in Synechococcus elongatus. Cell 140:529–539 Martins BMC, Tooke AK, Thomas P, Locke JC (2018) W. Cell size control driven by the circadian clock and environment in cyanobacteria SYSTEMS BIOLOGY BIOPHYSICS AND COMPUTATIONAL BIOLOGY. 10.17863/CAM.31834 Kushige H et al (2013) Genome-wide and heterocyst-specific circadian gene expression in the filamentous cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 195:1276–1284 Söderström B, Chan H, Shilling PJ, Skoglund U, Daley DO (2018) Spatial separation of FtsZ and FtsN during cell division. Mol Microbiol 107:387–401 Merino-Salomón A et al Crosslinking by ZapD drives the assembly of short, discontinuous FtsZ filaments into ring-like structures in solution. 10.1101/2023.01.12.523557 Erickson HP, Taylor DW, Taylor KA, Bramhill D (1996) Bacterial Cell Division Protein FtsZ Assembles into Protofilament Sheets and Minirings, Structural Homologs of Tubulin Polymers . Proc. Natd. Acad. Sci. USA vol. 93 Perez AJ et al (2019) Movement dynamics of divisome proteins and PBP2x: FtsW in cells of Streptococcus pneumoniae. Proc Natl Acad Sci U S A 116:3211–3220 Quardokus EM, Din N, Brun YV (2001) Cell cycle and positional constraints on FtsZ localization and the initiation of cell division in Caulobacter crescentus. Mol Microbiol 39:949–959 Whitley KD et al (2021) FtsZ treadmilling is essential for Z-ring condensation and septal constriction initiation in Bacillus subtilis cell division. Nat Commun 12 Coltharp C, Buss J, Plumer TM, Xiao J (2016) Defining the rate-limiting processes of bacterial cytokinesis. Proc Natl Acad Sci U S A 113:E1044–E1053 Stewart I, Schluter PJ, Shaw GR (2006) Cyanobacterial lipopolysaccharides and human health - A review. Environmental Health: A Global Access Science Source vol. 5 Preprint at https://doi.org/10.1186/1476-069X-5-7 Coleman GA et al (2021) A rooted phylogeny resolves early bacterial evolution. Sci (1979) 372 Du S, Lutkenhaus J (2017) Assembly and activation of the Escherichia coli divisome. Molecular Microbiology vol. 105 177–187 Preprint at https://doi.org/10.1111/mmi.13696 Gamba P, Veening JW, Saunders NJ, Hamoen LW, Daniel RA (2009) Two-step assembly dynamics of the Bacillus subtilis divisome. J Bacteriol 191:4186–4194 Adams DW, Errington J (2009) Bacterial cell division: Assembly, maintenance and disassembly of the Z ring. Nature Reviews Microbiology vol. 7 642–653 Preprint at https://doi.org/10.1038/nrmicro2198 Kumar K, Mella-Herrera RA, Golden JW (2010) Cyanobacterial heterocysts. Cold Spring Harb Perspect Biol 2 Zhang L, Zhou F, Wang S, Xu X (2017) Processing of PatS, a morphogen precursor, in cell extracts of Anabaena sp. PCC 7120. FEBS Lett 591:751–759 Mandakovic D et al (2016) CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Front Microbiol 7 Pcc S, Sakr S, Jeanjean R, Zhang C, Arcondeguy T (2006) Inhibition of Cell Division Suppresses Heterocyst Development in. 188:1396–1404 Method DNAPEG, Gietz RD, Woods RA (1998) 4 Transformation of Yeast bv the Lithium Acetate /. Single-Stranded Carrier. 26 Gibson DG (2011) Enzymatic assembly of overlapping DNA fragments. Methods in Enzymology, vol 498. Academic Press Inc., pp 349–361 Elhai J, Wolk CP (1988) Conjugal Transfer of DNA to Cyanobacteria. Methods Enzymol 167:747–754 Cai Y, Wolk CP (1990) Use of a condtionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinats and to entrap insertion sequnces. J Bacteriol 172:3138–3145 Wang P et al (2010) Robust growth of escherichia coli. Curr Biol 20:1099–1103 Mcdonald JC Fabrication of Microfluidic Systems in Poly(Dimethylsiloxane) Mangeol P, Prevo B, Peterman EJG (2016) KymographClear and KymographDirect: Two tools for the automated quantitative analysis of molecular and cellular dynamics using kymographs. Mol Biol Cell 27:1948–1957 Koulouras G et al (2018) EasyFRAP-web: A web-based tool for the analysis of fluorescence recovery after photobleaching data. Nucleic Acids Res 46:W467–W472 Krull A, Buchholz T-O, Jug F Noise2Void-Learning Denoising from Single Noisy Images . http://celltrackingchallenge.net/ Makovetsky R, Piche N, Marsh M (2018) Dragonfly as a Platform for Easy Image-based Deep Learning Applications. Microsc Microanal 24:532–533 Additional Declarations There is NO Competing Interest. Supplementary Files Video1.avi Video 1 video2.avi Video 2 video3.avi Video 3 Video4.avi Video 4 Video5.avi Video 5 video6f.avi Video 6 Olivaresetal.2024SUP.docx Supplementary Information Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4660361","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":342093711,"identity":"00e107f4-d4fb-47b5-b849-a2b07dea60bb","order_by":0,"name":"Mónica Vásquez","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAr0lEQVRIiWNgGAWjYBACPjiLvQFEWhDWwgZn8RwAkRKkaJFIIFaLRPLjD2/bbOzNJd8YfmCoIUpLmpnk3LY0ZsvZOcYSDMeI0cJzwIyZt+0wm8HtHDMGxgaitBz//Jm37T+Pwc0zxGph7zGQ5m07IGFwg4d4LWWSc84lG1j2pBVLJBDjF35m9s0f3pTZ2ZuzH9744UONDWEtYMADxAYgRgKRGpC0jIJRMApGwSjABgDq6Cz/w4bO8QAAAABJRU5ErkJggg==","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":true,"prefix":"","firstName":"Mónica","middleName":"","lastName":"Vásquez","suffix":""},{"id":342093712,"identity":"df8036f3-b6a5-49c2-a191-db2eea0d4ff1","order_by":1,"name":"Jorge Olivares","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"","lastName":"Olivares","suffix":""},{"id":342093713,"identity":"33f99261-5a22-4f4a-a20f-b91fe8d00bec","order_by":2,"name":"Derly Andrade Molina","email":"","orcid":"https://orcid.org/0000-0002-2651-5884","institution":"Omics Sciences Laboratory, Faculty of Medical Sciences, Universidad Espíritu Santo","correspondingAuthor":false,"prefix":"","firstName":"Derly","middleName":"Andrade","lastName":"Molina","suffix":""},{"id":342093714,"identity":"f4df2792-fb21-4f3c-8b6b-6afd6dbedafc","order_by":3,"name":"Annia González-Crespo","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Annia","middleName":"","lastName":"González-Crespo","suffix":""},{"id":342093715,"identity":"6c475e8a-45aa-46b4-9b50-d75c3ed5297e","order_by":4,"name":"Marcial Silva-Guzmán","email":"","orcid":"","institution":"Pontificia Universidad Católica de Chile","correspondingAuthor":false,"prefix":"","firstName":"Marcial","middleName":"","lastName":"Silva-Guzmán","suffix":""},{"id":342093716,"identity":"48719f1a-ee6b-4ded-9e27-5c3aad57ed18","order_by":5,"name":"José Conesa","email":"","orcid":"","institution":"Centro Nacional de Biotecnologia (CNB-CSIC)","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"","lastName":"Conesa","suffix":""},{"id":342093717,"identity":"aff447ca-5cd0-42c0-9f6c-e07c45327a16","order_by":6,"name":"Maria Luisa Cordero","email":"","orcid":"https://orcid.org/0000-0002-5601-6103","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Luisa","lastName":"Cordero","suffix":""},{"id":342093718,"identity":"4e06549b-2c70-4778-b49b-37734b80d90a","order_by":7,"name":"Octavio Monasterio","email":"","orcid":"","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Octavio","middleName":"","lastName":"Monasterio","suffix":""},{"id":342093719,"identity":"9625b524-5ba6-49cb-9924-2ee8830f8631","order_by":8,"name":"José Valpuesta","email":"","orcid":"https://orcid.org/0000-0001-7468-8053","institution":"CNB, CSIC","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"","lastName":"Valpuesta","suffix":""}],"badges":[],"createdAt":"2024-06-29 18:20:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4660361/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4660361/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63128678,"identity":"d686a731-898e-4b29-88b5-c82a00ebc5f0","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":571167,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSubcellular localization of FtsZ in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sp. and morphological analysis.\u003c/strong\u003e Fully segregated strains were observed by confocal microscopy, followed by morphological analysis. \u0026nbsp;\u003cstrong\u003e(a)\u003c/strong\u003e Visual representation of constructs designed to replace the genomic \u003cem\u003efts\u003c/em\u003eZ gene with FtsZ fusions with sfGFP, mVenus, or mTagBFP2. The sequences contain the \u003cem\u003efts\u003c/em\u003eZ gene, a linker (TTACAATCTAGATTAGAA), the coding region of the fluorescent protein, and an antibiotic resistance gene (SpR = spectinomycin; SmR = streptomycin), with two flanking homologous regions. \u003cstrong\u003e(b) \u003c/strong\u003eConfocal microscopy of the mutant strains. Z-axis projection of the autofluorescence (I), the FtsZ fusion signal (II), and the merge of both are shown in (III).\u003cstrong\u003e (c) \u003c/strong\u003eMorphological analysis of different strains. The area and minor and major axes of individual cells were measured in the wild-type (WT; n = 210), FtsZ-sfGFP (G; n = 198), FtsZ-mVenus (V; n = 322), and FtsZ-mTagBFP2 (B; n = 209) strains, and the means with their 95% confidence intervals were plotted. Kruskal Wallis and Dunn’s multiple comparison tests were performed to determine the differences between the groups. ns (not significant) = P \u0026gt; 0.05; * = P ≤ 0.05; ** = P ≤ 0.01; *** = P ≤ 0.001; **** = P ≤ 0.0001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/19bfb8ceec6c68602b247b9c.png"},{"id":63129121,"identity":"e8179693-b122-46b8-843b-6545d689aed0","added_by":"auto","created_at":"2024-08-23 12:48:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2786153,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSegregation of genetic material during cell division in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sp.\u003c/strong\u003e The FtsZ-mVenus and the FtsZ-sfGFP strains treated with DAPI were observed along the Z-axis. Cryo-CLEM was then performed separately. \u003cstrong\u003e(a)\u003c/strong\u003e Z-axis projection and merge of the autofluorescence (red), DAPI (blue), and the FtsZ-mVenus (yellow) or the FtsZ-sfGFP (green) signal in the different strains. A zoom of the division event within the white box is shown on the right side of each image. \u003cstrong\u003e(b)\u003c/strong\u003e Cryo-CLEM of the FtsZ-mVenus and FtsZ-sfGFP mutants displaying the autofluorescence (red), FtsZ signal (yellow or green), and the corresponding merge.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/7a1e0d9a0b0867438a5d8ada.png"},{"id":63128681,"identity":"025afc1e-921a-4917-aca3-657bee5aeb0f","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":713602,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAsynchronous cell division along the filaments of the FtsZ-mVenus strain of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esp. \u003c/strong\u003eConfocal microscopy along the Z-axis was performed in the FtsZ-mVenus strain exposed to different light-dark conditions: LD = Light-Dark cycle of 12:12 hours; DD-LD = Light-Dark cycle of 12:12 with a previous reset in 48 hours of dark; LL = constant light. \u003cstrong\u003e(a)\u003c/strong\u003e Merge of the Z-axis projection of both autofluorescence and FtsZ-mVenus signals in all light-dark cycle conditions.\u003cstrong\u003e (b)\u003c/strong\u003e Z-ring diameter distribution, in percentage, of individual cells of the LD (n = 638), DD-LD (n = 777), and LL (n = 545) treatments, respectively. \u003cstrong\u003e(c)\u003c/strong\u003e Percentage of early and late rings in individual filaments that were analyzed in LD (n = 26), LL (n = 17), and DD-LD (n = 16). The data are shown in box-whisker plots, and a one-way ANOVA with Tukey’s multiple comparisons test was used in the early ring data analysis. In the case of late rings, Kruskal Wallis and Dunn’s multiple comparison tests were performed. ns (not significant) = P \u0026gt; 0.05; * = P ≤ 0.05; ** = P ≤ 0.01; *** = P ≤ 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/448b8df135ac323cae8d9595.png"},{"id":63129559,"identity":"1e725db5-c29c-4497-a43d-f9db9c3ee481","added_by":"auto","created_at":"2024-08-23 12:56:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":538479,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eZ-ring 3D reconstruction in the FtsZ-mVenus mutant of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esp. \u003c/strong\u003eCells of the FtsZ-mVenus strain were immobilized, and the Z-rings of individual cells were observed using Airyscan microscopy along the Z-axis.\u003cstrong\u003e (a) \u003c/strong\u003eRepresentative 3D reconstruction of rings with different diameters is divided into two main categories: high and low discontinuities. The table at the bottom shows the percentage of early, mid, and late rings for these two groups with a total of 61 rings analyzed. \u003cstrong\u003e(b)\u003c/strong\u003e 3D surface plots of the fluorescence intensity distribution of the FtsZ-mVenus signal within the Z-rings and their respective diameters. A general view of the ring is shown in the upper-right corner of each plot on the LUT scale.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/86f0f9887d482f095e4fa4a9.png"},{"id":63129124,"identity":"cf39dc3f-aef8-4886-9194-4f4c2b7acdab","added_by":"auto","created_at":"2024-08-23 12:48:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":947363,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTime-lapse microscopy of the Z-ring in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sp. FtsZ-mVenus strain. \u003c/strong\u003eThe filaments grown under normal LD conditions were vertically oriented, and the fluorescence of the Z-ring was detected with Airyscan microscopy every 10 seconds in early, mid, and late rings. \u003cstrong\u003e(a) \u003c/strong\u003eImages in the XY plane of an early Z-ring in a time-lapse experiment with a period of 70 seconds with 3D surface plots of the fluorescence intensity distribution. Scale bar of 1 µm. \u003cstrong\u003e(b)\u003c/strong\u003e Filament velocity of individual trajectories within the Z-rings in the early (n = 727), mid (n = 125), and late (n = 20) stages of cell division. The data are shown in a violin plot, and Kruskal–Wallis and Dunn’s multiple comparison tests were used to compare the data. ns (not significant) = P \u0026gt; 0.05; * P ≤ 0.05. \u003cstrong\u003e(c)\u003c/strong\u003e Average fluorescence intensity was measured over time at distinct stages of ring formation: early (t = 250 seconds), mid (t = 290 seconds), and late rings (t = 290 seconds), and the corresponding kymographs depicting trajectories, with forward movement represented in red and backward movement in green.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/bcf0bf24b90dd72e35b8f696.png"},{"id":63129560,"identity":"3936511b-9074-4259-afbf-7e3f4325c02d","added_by":"auto","created_at":"2024-08-23 12:56:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1944956,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTime-lapse recording of the Z-ring constriction during cytokinesis in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAnabaena\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e sp. utilizing confocal microscopy. \u003c/strong\u003eThe subcellular localization of FtsZ was observed in the FtsZ-mVenus mutant of \u003cem\u003eAnabaena\u003c/em\u003esp. \u003cstrong\u003e(a)\u003c/strong\u003e Design of the mother machine device tailored for \u003cem\u003eAnabaena\u003c/em\u003e sp. (left) alongside a merged image displaying brightfield, autofluorescence, and FtsZ-mVenus signals of immobilized filaments within the crypts of the system (right). \u003cstrong\u003e(b)\u003c/strong\u003e Merge of the Z-axis projection displaying both autofluorescence and FtsZ-mVenus signals over time. Time (hours) is indicated in the upper left corner of each image. \u003cstrong\u003e(c) \u003c/strong\u003eConstriction velocity of early, mid, and late rings in LD and DD-LD conditions. A two-way ANOVA was performed, followed by Tukey’s multiple comparison test. ns (not significant), P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/ee8bb66a9da13dbb97652011.png"},{"id":65073711,"identity":"5bbee059-fde5-45b8-bade-f9773b210f60","added_by":"auto","created_at":"2024-09-23 10:28:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8377783,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/2216e4c1-1681-464f-b68a-22102460f184.pdf"},{"id":63129123,"identity":"b50f0295-a1f2-47d4-bb1e-cd21fe71bb1b","added_by":"auto","created_at":"2024-08-23 12:48:14","extension":"avi","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5238360,"visible":true,"origin":"","legend":"Video 1","description":"","filename":"Video1.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/f247e53fc94d720f7a52b566.avi"},{"id":63128683,"identity":"317e138b-9a2a-4494-8c1b-1f42b24343d2","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"avi","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1513628,"visible":true,"origin":"","legend":"Video 2","description":"","filename":"video2.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/e6463c74e06b7f60199fad30.avi"},{"id":63128679,"identity":"8ed511a2-429e-4edb-a3cf-71c02e5d348b","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"avi","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1478556,"visible":true,"origin":"","legend":"Video 3","description":"","filename":"video3.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/f040ec139a9579854d4df98a.avi"},{"id":63129126,"identity":"8f4d776c-861b-4dcb-8dcc-a908786c02da","added_by":"auto","created_at":"2024-08-23 12:48:15","extension":"avi","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3322796,"visible":true,"origin":"","legend":"Video 4","description":"","filename":"Video4.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/895e0e28a5459eab9b299957.avi"},{"id":63128686,"identity":"d3bee966-86b3-41db-99bb-d2e1fb5da689","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"avi","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":485636,"visible":true,"origin":"","legend":"\u003cp\u003eVideo 5\u003c/p\u003e","description":"","filename":"Video5.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/544b6e4833450bb797803845.avi"},{"id":63128687,"identity":"76b4bcab-3a71-407d-89db-e0c76c614fa5","added_by":"auto","created_at":"2024-08-23 12:40:14","extension":"avi","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":8400036,"visible":true,"origin":"","legend":"Video 6","description":"","filename":"video6f.avi","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/c6ecd1a2e9d572e0fcca49eb.avi"},{"id":63128689,"identity":"d54bf685-459b-4821-8e02-3416b0e2d961","added_by":"auto","created_at":"2024-08-23 12:40:15","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":4539161,"visible":true,"origin":"","legend":"Supplementary Information","description":"","filename":"Olivaresetal.2024SUP.docx","url":"https://assets-eu.researchsquare.com/files/rs-4660361/v1/c8cfe161cc7533bc769fcbc2.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"The Z-Ring in Multicellular Cyanobacteria has a dynamic pearl necklace arrangement","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe bacterial cell division machinery involves coordination of two processes: cellular elongation, which encompasses chromosome replication and segregation, and septum formation \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The first event in the septation process is the localization of FtsZ at the cell midpoint. This protein, which is structurally homologous to tubulin, is conserved and widely distributed in most bacteria \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Within the group of S-layered Archaea and chloroplasts, two copies of FtsZ (FtsZ1 and FtsZ2) were identified \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Recently, it was found that FtsZ has two conformational states (T for tense and R for relaxed) that may play a key role in the formation of protofilaments \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e, which are arranged in the Z-ring structure \u003cem\u003ein vivo\u003c/em\u003e as a scaffold for other division proteins, orchestrating the molecular machinery known as divisome \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. This structure comprises proteins that directly interact with FtsZ, such as FtsA, along with components that regulate peptidoglycan remodeling during cell division. The precise architecture and dynamics of the Z-ring in bacteria have been challenging. However, recent advances in Super-Resolution Microscopy (SRM) and fluorescent protein fusion have served to elucidate its structure across different organisms. Studies in \u003cem\u003eEscherichia coli\u003c/em\u003e using Photoactivated Localization Microscopy (PALM), three-dimensional Structured Illumination Microscopy (3D-SIM), and Stimulated Emission Depletion (STED) microscopy have revealed that the Z-ring consists of randomly distributed protofilaments that localize in patches within the ring structure \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, a pattern modifiable by the GTPase activity and concentration of FtsZ \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Similar heterogeneous FtsZ organization within the Z-ring has been described in \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e, \u003cem\u003eCaulobacter crescentus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e, \u003cem\u003eBacillus subtilis\u003c/em\u003e, and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. A major question in bacterial division revolves around whether FtsZ alone generates the active force driving cell division, but the answer remains unclear owing to conflicting evidence. While FtsZ can deform liposomes and vesicles \u003cem\u003ein vitro\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, it has been shown that the Z-ring is not essential during the late stage of constriction\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. In addition, alterations in the peptidoglycan (PG) machinery affect the rate of constriction, whereas modifications to the assembly and GTPase activity of FtsZ do not have the same effect \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Furthermore, dynamics-wise studies in different models have highlighted the Z-ring dynamic behavior by treadmilling, a property regulated by the GTPase activity of FtsZ. In \u003cem\u003eB. subtilis\u003c/em\u003e, treadmilling limits PG synthesis and cell constriction \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Whereas in \u003cem\u003eE. coli\u003c/em\u003e, although treadmilling of the Z-ring contributed to the spatial organization of the PG synthesis machinery, it did not limit the constriction rate \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCyanobacteria are photosynthetic microorganisms classified as gram-negative based on cellular morphology but phylogenetically closer to gram-positive bacteria \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. These organisms possess cell division proteins shared by both gram-positive and gram-negative bacteria \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e and feature unique proteins in their divisome \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. The only study of the spatial organization of FtsZ within the Z-ring in cyanobacteria has been conducted in the unicellular organism \u003cem\u003eProchlorococcus.\u003c/em\u003e Through Stochastic Optical Reconstruction Microscopy (STORM) and labeled antibodies in fixed cells, a pattern of patches and discontinuous structures has been observed in the Z-rings of this unicellular model \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The multicellular filamentous cyanobacteria, \u003cem\u003eAnabaena\u003c/em\u003e sp. PCC 7120 (hereafter \u003cem\u003eAnabaena\u003c/em\u003e sp.) has been used as a cell division model. Previous studies using fluorescent fusions in \u003cem\u003eAnabaena\u003c/em\u003e sp. have determined only FtsZ positioning in the middle of the cells\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, unveiling new polymerization regulators, such as SepF \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. In addition to its role in the divisome of \u003cem\u003eAnabaena\u003c/em\u003e sp., FtsZ involvement in cell-to-cell communication and filament integrity has been postulated because of its interactions with septal proteins such as SepJ \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Studies for the visualization of the Z-ring have been performed in other filamentous cyanobacteria, such as \u003cem\u003eFischerella muscicola\u003c/em\u003e PCC 7414 and \u003cem\u003eChlorogloeopsis fritschii\u003c/em\u003e PCC 6912, employing FtsZ-GFP fluorescence fusions from expression vectors and different promoters \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. However, the 3D organization of the Z-ring and the dynamics of FtsZ in filamentous cyanobacteria \u003cem\u003ein vivo\u003c/em\u003e remain unexplored. In our study, mutants of \u003cem\u003eAnabaena\u003c/em\u003e sp. expressing the FtsZ protein fused with the fluorescent proteins sfGFP, mTagBFP2, and mVenus were generated through triparental mating and homologous recombination by replacing the \u003cem\u003efts\u003c/em\u003eZ wild-type gene with the corresponding fusion variant. Using these mutants, we describe the first details of FtsZ localization in filamentous cyanobacteria and their dynamics within the Z-ring. Our research reveals the asynchronous nature of Z-ring formation in cyanobacterial cell division. Additionally, by resetting and training, we observe a modest enhancement in the synchronization of cell division across filaments. Our observations indicate that the Z-ring in \u003cem\u003eAnabaena\u003c/em\u003e sp. showcases a pearl necklace arrangement characterized by highly dynamic behavior\u0026mdash;treadmilling forward and reverse. This dynamism is emphasized by swift changes in fluorescence occurring on a time scale of seconds, indicating a notable turnover of FtsZ.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eFunctionality of FtsZ fused to mVenus in the C-terminal region.\u003c/b\u003e To follow the cell division process in \u003cem\u003eAnabaena\u003c/em\u003e sp., different strains of mutants with FtsZ fused to fluorescent proteins in the C-terminal region under the transcriptional control of the native promoter were generated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Given that \u003cem\u003eAnabaena\u003c/em\u003e sp. possesses multiple chromosomal copies, segregation was confirmed by PCR, demonstrating that the FtsZ-sfGFP, FtsZ-mVenus, and FtsZ-mTagBFP strains were fully segregated at the genetic level (Supplementary Fig.\u0026nbsp;1). In these mutants, the FtsZ fluorescent tag-labelled protein was the only FtsZ source in the cells. The fully segregated strains formed filaments as the wild-type and exhibited Z-rings with the expected fluorescent signal in the middle of the cell (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb and Video 1). Notably, filaments formed by mutant cells showed varying cell division stages under a 12:12 Light-Dark cycle (12:12 LD). Their growth rate was similar to the wild-type (Supplementary Fig.\u0026nbsp;2), indicating that the fusion proteins effectively replaced native FtsZ, thereby maintaining a normal division process. Cell morphology across different strains was analyzed, and the comparison revealed no significant differences in individual cell area between the wild-type (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;9.02\u0026thinsp;\u0026plusmn;\u0026thinsp;1.89 \u0026micro;m\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; n\u0026thinsp;=\u0026thinsp;210) and the FtsZ-mVenus strain (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;9.07\u0026thinsp;\u0026plusmn;\u0026thinsp;1.73 \u0026micro;m\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; n\u0026thinsp;=\u0026thinsp;322). However, both FtsZ-sfGFP (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;10.06\u0026thinsp;\u0026plusmn;\u0026thinsp;2.54 \u0026micro;m\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; n\u0026thinsp;=\u0026thinsp;198) and FtsZ-mTagBFP2 (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;10.23\u0026thinsp;\u0026plusmn;\u0026thinsp;2.14 \u0026micro;m\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; n\u0026thinsp;=\u0026thinsp;209) strains displayed a different morphology than the wild-type, with a larger cell area. Similar results were obtained when the major and minor axes of the cells were measured (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Hence, we concluded that the FtsZ-mVenus fusion effectively replace the native FtsZ, preserving morphological characteristics similar to the wild-type, unlike what occurs with \u003cem\u003eE. coli\u003c/em\u003e fusion tags. For instance, subsequent analysis mainly utilized the FtsZ-mVenus strain. As expected, upon nitrogen depletion, the filaments did not exhibit the FtsZ signal in the heterocysts (Supplementary Fig.\u0026nbsp;3).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSegregation of genetic material occurs during the late stage of cell division in\u003c/b\u003e \u003cb\u003eAnabaena\u003c/b\u003e \u003cb\u003esp.\u003c/b\u003e The coordination between Z-ring constriction and DNA segregation was studied by DAPI staining in the FtsZ-mVenus and FtsZ-sfGFP mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). We noted the absence of autofluorescence, and therefore, a lack of thylakoids, in the central region of the cells. This zone coincides with the area stained with DAPI, indicating the presence of DNA. Throughout various stages of cellular division, the Z-ring demonstrated co-localization with the genetic material, suggesting the existence of a nucleoid in the septum region, even during advanced constriction stages. To further elucidate the aforementioned findings, cryo-Correlative Light and Electron Microscopy (cryo-CLEM) was employed, integrating cryo-Airyscan microscopy and cryo-Focus Ion Beam Scanning Electron Microscopy (cryo-FIB-SEM) volume imaging data of the FtsZ mutants. The cryo-FIB-SEM imaging (Supplementary Fig.\u0026nbsp;4) reveals by its features the presence of unsegregated DNA located at the division septum during ongoing constriction. Through cryo-CLEM analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), the peripheral localization of thylakoid membranes within the cells was verified, along with the central positioning of nucleoids lacking autofluorescence signal. The co-localization of the unsegregated nucleoid with the Z-ring fluorescence signal in the FtsZ-mVenus and FtsZ-sfGFP mutants was confirmed with improved resolution. It was observed that as Z-ring constriction progressed, the genetic material partially migrated towards the poles of the emerging cells, with definitive chromosomal segregation culminating as the septum neared closure. An intriguing observation was the presence of abnormal morphology in a subset of cells from the FtsZ-sfGFP mutant. Notably, we observed the occurrence of a double septum (an extremely rare event in the wild-type strain), indicating potential dysfunction in FtsZ in this strain (Supplementary Fig.\u0026nbsp;5).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCell division along the filaments of\u003c/b\u003e \u003cb\u003eAnabaena\u003c/b\u003e \u003cb\u003esp. is asynchronous.\u003c/b\u003e To evaluate the synchronization of cell division along \u003cem\u003eAnabaena\u003c/em\u003e sp. filaments, a quantitative analysis was conducted by measuring the Z-ring diameter using confocal microscopy acquisitions and Fiji (ImageJ) software \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. The classification of cell division stages was based on Z-ring diameter and the degree of constriction: Z-ring diameters above 2.5 \u0026micro;m were categorized as \"early division,\" indicating the formation of a Z-ring without significant cell constriction; Z-ring diameters ranging from 2.5 \u0026micro;m to 1.5 \u0026micro;m indicated a \"mid-division\" state, characterized by an evident constriction between the emerging cells. For Z-ring diameters less than 1.5 \u0026micro;m, the cells enter a \"late division\" state, marking the final phase of constriction as cells nearly complete the separation process. Concerning the FtsZ-sfGFP fusion, out of a total of 349 rings analyzed in cells under normal growth conditions (12:12 LD), 210 Z-rings were classified as early rings (60.2%), 91 as mid rings (26.1%), and 48 as late rings (13.7%) (data not shown). The Z-ring diameter in the FtsZ-mVenus was measured under different light-dark conditions: constant light (LL; n\u0026thinsp;=\u0026thinsp;545), 12:12 LD cycle (LD; n\u0026thinsp;=\u0026thinsp;638), and 12:12 LD cycle with a prior reset after 48 hours of darkness (DD-LD; n\u0026thinsp;=\u0026thinsp;777) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The results indicate that the distribution of the Z-ring diameters within individual cells fluctuates based on the light-dark treatment, with a reduced occurrence of late rings in the case of the DD-LD condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Subsequent analysis of the Z-rings per filament revealed that under continuous light (LL) conditions, the filaments (n\u0026thinsp;=\u0026thinsp;17) exhibited a lower proportion of early rings but a higher proportion of late rings in comparison to filaments under the DD-LD regimen (n\u0026thinsp;=\u0026thinsp;16) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). These results lead to the conclusion that cell division in \u003cem\u003eAnabaena\u003c/em\u003e sp. is asynchronous in terms of Z-ring constriction under normal growth conditions, yet it can be partially synchronized with 48 hours of darkness.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFtsZ has a pearl necklace arrangement in the Z-ring of\u003c/b\u003e \u003cb\u003eAnabaena\u003c/b\u003e \u003cb\u003esp.\u003c/b\u003e To study the spatial arrangement of FtsZ within the Z-ring, Airyscan microscopy analysis and 3D reconstructions of Z-rings in the FtsZ-mVenus strain were conducted. Our observations revealed that cells at different stages of division exhibited a heterogeneous fluorescence distribution along the Z-ring structure. Two predominant architectures were identified: Z-rings with multiple and large signal-free regions, indicating high discontinuity (Video 2), and those with nearly closed structures and minimal fluorescence gaps, indicating low discontinuity (Video 3). Subsequently, these rings were further classified based on the cell division stage, indicating that the majority of high-discontinuity rings (n\u0026thinsp;=\u0026thinsp;38) were in the early division phase (97.37%). In contrast, low-discontinuity rings (n\u0026thinsp;=\u0026thinsp;23) were mainly in the mid (56.52%) or late (34.78%) division states (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). This demonstrates that the Z-ring architecture undergoes dynamic transformations as cell division progresses, ultimately leading to a more compact structure by the end of the process. By examining the fluorescence intensity of rings with different diameters, a heterogeneous pattern with two regions of increased fluorescence intensity positioned opposite to each other was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). These findings suggest that the spatial distribution of FtsZ along the Z-ring in \u003cem\u003eAnabaena\u003c/em\u003e sp. occurs in patches and is not due to ring diameter, consistent with observations made in other bacterial models\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. In the case of the FtsZ-sfGFP strain, a similar signal distribution was noted in the 3D reconstructions, along with the presence of fluorescent clusters within the cytoplasm, which is a characteristic absent in the FtsZ-mVenus strain (Supplementary Fig.\u0026nbsp;6 and Video 4). Despite the low fluorescent protein signal, 3D reconstructions were successfully performed in the FtsZ-mTagBFP2 rings, yielding comparable outcomes (Supplementary Fig.\u0026nbsp;7).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe\u003c/b\u003e \u003cb\u003eAnabaena\u003c/b\u003e \u003cb\u003esp. Z-ring is a highly dynamic structure.\u003c/b\u003e It has been demonstrated that variations in fluorescence intensity occur temporally along the Z-ring when FtsZ is fused to a fluorescent tag, whether employing complete or partial gene replacement, and across different bacterial systems \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. To investigate whether this phenomenon also occurs in \u003cem\u003eAnabaena\u003c/em\u003e sp., time-lapse microscopy experiments were conducted on filaments of the FtsZ-mVenus strain parallel to the optical axis of the microscope, with observations made in the transversal plane in \u003cem\u003eAnabaena\u003c/em\u003e sp. \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. The ring dynamics were visualized at 10-second intervals, uncovering rapid fluctuations in the signal along the rings in a short time (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and Video 5). Owing to the heterogeneous distribution of FtsZ within the rings, the fluctuations in the fluorescence signal varied in magnitude and direction (increase or decrease). This temporal pattern was consistently observed across rings at different division states. Kymographs of the FtsZ-mVenus clusters were produced, and individual trajectories of the fluorescence signal were tracked to determine the filament velocity of FtsZ within early (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;16.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64 nm/sec; n\u0026thinsp;=\u0026thinsp;727 trajectories), mid (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;15.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52 nm/sec; n\u0026thinsp;=\u0026thinsp;125 trajectories), and late (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;14.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.42 nm/sec; n\u0026thinsp;=\u0026thinsp;20 trajectories) Z-rings (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). We observed a slight yet significant difference in velocity between clusters within the early and mid-rings. Moreover, forward and backward movements of FtsZ filaments along the early, mid, and late Z-rings were noted (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Fluorescence Recovery After Photobleaching (FRAP) with FtsZ-sfGFP was performed because of its better signal and photostability than FtsZ-mVenus fusion. After photobleaching, a rapid recovery recuperation of fluorescence within the ring was observed, with a T-half of 39 seconds and a mobile fraction of 1 within a period of 110 seconds for signal restoring (Supplementary Fig.\u0026nbsp;8). Based on the findings, it suggests that FtsZ undergoes bidirectional motion along the Z-ring in \u003cem\u003eAnabaena\u003c/em\u003e sp. during cell division, with swift exchange between the cytoplasmic pool and the Z-ring occurring within seconds.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo conduct time-lapse microscopy over an extended time, a microfluidic system tailored to \u003cem\u003eAnabaena\u003c/em\u003e sp. was developed using a mother-machine device. This setup comprises a central channel of 100 \u0026micro;m flanked by crypts on each side that facilitate the entry and immobilization of filaments within a liquid medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). We effectively tracked the cell division process of \u003cem\u003eAnabaena\u003c/em\u003e sp., confirming the functionality of the Z-ring in terms of its ability to constrict (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb and Video 6). Surprisingly, although most of the Z-rings were present in the cells, a large portion remained inactive in terms of constriction along the filaments. Specifically, under normal LD conditions, only 82 rings (27.06%) exhibited activity, whereas 221 rings (72.94%) did not contract during the long-term experiments. Under the DD-LD condition, a lower percentage of active rings was observed, with only 26 rings (13.54%) displaying activity. Furthermore, static behavior was evident in cells that remained undivided, even after 58 hours of observation (Supplementary Fig.\u0026nbsp;9). Accordingly, cell division occurs predominantly in a few selected cells along the filaments of \u003cem\u003eAnabaena\u003c/em\u003e sp., serving as hotspots of growth but apparently with no specific pattern. Using this dataset, we assessed the velocity of constriction in rings that were active during acquisition in both LD (n\u0026thinsp;=\u0026thinsp;303) and DD-LD (n\u0026thinsp;=\u0026thinsp;192) treatments. Surprisingly, results indicated the absence of significant variances between the two conditions concerning constriction velocity for early (LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;92.88\u0026thinsp;\u0026plusmn;\u0026thinsp;33.74 nm/h; DD-LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;119.5\u0026thinsp;\u0026plusmn;\u0026thinsp;22.00 nm/h), mid (LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;119.4\u0026thinsp;\u0026plusmn;\u0026thinsp;34.48 nm/h; DD-LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;150.6\u0026thinsp;\u0026plusmn;\u0026thinsp;17.50 nm/h), and late (LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;100.5\u0026thinsp;\u0026plusmn;\u0026thinsp;22.69 nm/h; DD-LD mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u0026thinsp;=\u0026thinsp;130.2\u0026thinsp;\u0026plusmn;\u0026thinsp;28.80 nm/h) rings (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Our results suggest that the velocity of constriction remains uniform even after the darkness reset, a measure implemented to optimize the synchronization of cell division in \u003cem\u003eAnabaena\u003c/em\u003e sp.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOne of the primary hurdles in fluorescent protein labeling is the achievement of a fully operational fluorescent fusion that serves as an exclusive source of the protein under scrutiny. This is crucial in cell division studies, where fluctuations in protein concentration or improper folding can result in irregularities in cell structure and division mechanisms. The objective of fusing FtsZ with a fluorescent tag as the only source of FtsZ in \u003cem\u003eE. coli\u003c/em\u003e was achieved in 2006, owing to the utilization of suppressor strains and creation of an FtsZ-CtYFP fusion \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. A breakthrough occurred in 2017 with the creation of a fully functional FtsZ fusion incorporating mVenus inserted at the G55-Q56 site \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Despite the successful mutation, this construct exhibits morphological and divisional abnormalities. In a recent study, a novel strain of \u003cem\u003eE. coli\u003c/em\u003e featuring an FtsZ fusion tagged with a nanotag (FtsZ-ALFA) expressing fluorescently labeled nanobodies was generated \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Although successful in achieving \u003cem\u003ein vivo\u003c/em\u003e FtsZ labeling, this system poses challenges, particularly in optimizing nanobody expression via arabinose induction. Full replacement of a division protein with fluorescent fusion has been demonstrated with other components of the divisome, including FtsA\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e and FtsN \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e, as well as with FtsZ in gram-positive models such as \u003cem\u003eB. subtilis\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Creating functional fluorescent fusions with FtsZ is challenging due to its interactions with other divisome components, which can be disrupted by fluorophore insertion. Additionally, misfolding may occur in the absence of an appropriate linker.\u003c/p\u003e \u003cp\u003eKnowledge of FtsZ dynamics in cyanobacteria, such as \u003cem\u003eAnabaena\u003c/em\u003e sp., has been less explored than in other bacterial systems. Researchers have primarily focused on the interactions between FtsZ and other proteins, and on assessing the repercussions of altering other divisome components on Z-ring positioning utilizing FtsZ tagged with fluorescent markers \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. However, initial research efforts were unable to offer comprehensive insights into the spatial organization of FtsZ protofilaments \u003cem\u003ein vivo\u003c/em\u003e. In this study, we describe for the first time the intricate Z-ring dynamics in filamentous cyanobacteria, using a fully functional FtsZ-mVenus fusion protein within an \u003cem\u003ein vivo\u003c/em\u003e system.\u003c/p\u003e \u003cp\u003ePrior FtsZ fusions in \u003cem\u003eAnabaena\u003c/em\u003e sp. predominantly incorporated the wild-type (WT) copy as an extra source of the protein, with some instances featuring fusions controlled by the inducible \u003cem\u003epet\u003c/em\u003eE promoter \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. However, these systems are not optimal for characterizing subcellular localization because of variations in expression level \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Recently, Xing \u003cem\u003eet al\u003c/em\u003e., explored the role of HetF as a divisome component that is significantly affected by the light intensity. In this study, a mutant with FtsZ fused to CFP was constructed as a fluorescent marker. However, it did not demonstrate the full substitution of wild-type FtsZ with the CFP-fused variant \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. In our study, we replaced the wild-type \u003cem\u003eftsZ\u003c/em\u003e gene with three distinct FtsZ fusions regulated by the \u003cem\u003eAnabaena\u003c/em\u003e sp. native promoter, thus confirming full gene replacement. Among these mutants, only FtsZ-mVenus exhibited a morphology indistinguishable from the wild type (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec), likely due to mVenus monomeric properties. In contrast, the tendency of GFP to dimerize \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e could account for the observed division anomalies and aggregate formation in the FtsZ-sfGFP mutant (Supplementary Figs.\u0026nbsp;5 and 6). Future investigations employing fluorescent fusions with cell division proteins in filamentous cyanobacteria should prioritize the use of monomeric, smaller, brighter, and more stable fluorescent markers. This approach is essential for minimizing misfolding and propensity towards dimerization and achieving robustness, thus leading to the attainment of strong fluorescent signals and preventing artifacts in fluorescence microscopy.\u003c/p\u003e \u003cp\u003eSimilarly, in the multicellular bacteria \u003cem\u003eStreptomyces coelicolor\u003c/em\u003e, it was possible to express an FtsZ-eGFP fusion, but the strain also contained a wild-type copy of the \u003cem\u003efts\u003c/em\u003eZ gene \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The sporulating hyphae of this model have a similar distribution of the Z-rings in almost all cells along the filaments, which the authors referred to as \u0026ldquo;Z-ladder\u0026rdquo;, as we found in \u003cem\u003eAnabaena\u003c/em\u003e sp. In our observations, we consistently detected the presence of the Z-ring in cells regardless of their division state, and we found cells without a Z-ring in only a small percentage of the samples. This suggests that many cells actively generate and maintain the Z-ring structure in multicellular systems, even when not undergoing cytoplasm contraction, as corroborated by time-lapse recordings (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). It was somewhat surprising that chromosome segregation was incomplete during cell constriction in \u003cem\u003eAnabaena\u003c/em\u003e sp. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Cryo-CLEM analysis confirmed that unsegregated DNA colocalizes with the Z-ring during the final stage of constriction (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Similarly, in the unicellular cyanobacteria \u003cem\u003eSynechocystis\u003c/em\u003e, chromosome segregation occurs in the late stage of the cell cycle through a random and less stringent mechanism of DNA distribution, contrasting with the uniform spatial arrangement seen in classic bacterial models \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. These results support the notion that the nucleoid occlusion system might not be applicable to cyanobacteria, as previously described \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eSynechococcus elongatus\u003c/em\u003e, a time-lapse study with individually labeled chromosomes described a linear organization along the long axis of the cell that allows equal segregation of the genetic material \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. This indicates that cyanobacteria might have different mechanisms of DNA distribution during cell division depending on the species. Both fluorescent FtsZ and chromosome labeling at the ori zone together could provide insights into the mechanism of DNA segregation in \u003cem\u003eAnabaena\u003c/em\u003e sp.\u003c/p\u003e \u003cp\u003eThe distribution of Z-rings with different diameters in \u003cem\u003eAnabaena\u003c/em\u003e sp. under LD conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea) showed that most rings were in an early stage of cell division, but late rings can also be found along the filaments, even after 48 hours of dark synchronization (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). This indicates that cell division in \u003cem\u003eAnabaena\u003c/em\u003e sp. under normal growth conditions was asynchronous, and alterations in light exposure affected the distribution of the Z-ring diameters. Consequently, cell division could be regulated by light in \u003cem\u003eAnabaena\u003c/em\u003e sp. It has been proposed that the circadian rhythm plays a role in regulating cell division, affecting the localization of FtsZ in the unicellular cyanobacteria \u003cem\u003eS. elongatus.\u003c/em\u003e In this model, it was shown that the Z-ring assembly is inhibited by KaiC during the early dark phase due to an increase in its ATPase activity \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, and that cell division is asynchronous with two subpopulations of cells that have different times of birth and cell cycle duration in 12:12 LD conditions \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Therefore, as observed in \u003cem\u003eAnabaena\u003c/em\u003e sp., it is not possible to achieve complete synchronization of the whole system, possibly because of other factors that can affect cell division such as nutrients, redox state, and environmental signals. This implies that the cells in the \u003cem\u003eAnabaena\u003c/em\u003e sp. filaments are always in different metabolic states, and thus, the only valid approach for studies on gene expression in filamentous cyanobacteria is to use techniques that can show what is happening at the single-cell level. Therefore, studies measuring gene expression using the entire filament should not be considered \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eA deep look at the Z-ring structure of \u003cem\u003eAnabaena\u003c/em\u003e sp. was performed by 3D reconstruction along the Z plane of the Z-rings, revealing a heterogeneous distribution of FtsZ within the rings, with clusters of FtsZ distributed in a pearl necklace-like arrangement, as previously described for \u003cem\u003eB. subtilis\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, both gram-positive bacteria. This arrangement consists of regions with higher concentration of FtsZ protofilaments (beads) and gaps with no signal. In our model, we found that the presence of gaps diminishes as the process of cell division progresses, which is consistent with the idea that these gaps could serve as a space that allows the accommodation of protofilaments. Therefore, the Z-ring condenses as the constriction advances. It is possible that other divisome components are present in the gap regions, as previously demonstrated with FtsN in \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Similar to FtsN, other cyanobacterial proteins that interact with the cell wall can influence FtsZ positioning because of their dynamics during peptidoglycan remodeling.\u003c/p\u003e \u003cp\u003eThe present study is the first to analyze the distribution of FtsZ in the \u003cem\u003ein vivo\u003c/em\u003e Z-ring structure with fully segregant cyanobacterial strains. In our model, better resolution is necessary to resolve the spatial organization of individual FtsZ protofilaments, and how FtsZ may form within the ring and other substructures such as toroids \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e or mini rings \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. In Z-ring studies, cells parallel to the microscope optical axis are frequently used to increase the data quality because of the higher resolution in the XY plane compared with the XZ or YZ planes. We previously developed a vertical orientation method for filamentous cyanobacteria that allowed us to perform imaging of the whole Z-ring in one plane \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e and observed the same pearl necklace-like arrangement without 3D reconstruction in the FtsZ-mVenus mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). With this methodology, we were able to record the dynamics of the Z-ring on a time scale of seconds, and with the results we suspect that the pearl necklace arrangement is highly dynamic with bidirectional movement of FtsZ protofilaments, which is consistent with observations in gram-positive systems like \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e, and other gram-negative bacteria such as \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Previously, FtsZ localization in the Z-ring in cyanobacteria was performed in unicellular \u003cem\u003eProchlorococcus\u003c/em\u003e using antibodies and fixed cells\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Similar to our results, the FtsZ protein predominantly localizes as a patchy midcell band rather than a continuous ring.\u003c/p\u003e \u003cp\u003eThe dynamics of the Z-ring structure of filaments may be crucial for understanding the regulation and timing of cell division in this multicellular model. As a result, we recorded the complete cell division process of \u003cem\u003eAnabaena\u003c/em\u003e sp. by time-lapse microscopy in the FtsZ-mVenus mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), and we found a large percentage of rings in an early stage that did not divide during the acquisition, with only a few rings actively dividing. The latent stage of the Z-ring constriction has been reported previously in \u003cem\u003eC. crescentus, a\u003c/em\u003e gram-negative alpha proteobacterium that exhibits a dimorphic life cycle, in which there is a 30-minute delay between the positioning of the Z-ring and the contraction of the cells \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eB. subtilis\u003c/em\u003e, non-constricted rings were found and described as \u0026ldquo;mature\u0026rdquo; rings using an FtsZ-GFP mutant \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e, whereas in a strain of \u003cem\u003eE. coli\u003c/em\u003e BW25113 that also expresses an FtsZ-GFP fusion, there is a period of approximately 50 minutes, during which a latent phase between the stabilization of the Z-ring and the constriction can be observed in M9 medium \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. The maintenance of a dynamic structure as the Z-ring is an energy-consuming process, therefore, the presence of early rings without an active cell division implies that FtsZ, and the Z-ring, could be performing in \u003cem\u003eAnabaena\u003c/em\u003e sp. other important functions such as filament integrity. It is unclear whether the presence of non-dividing Z-rings in \u003cem\u003eAnabaena\u003c/em\u003e sp. cells is maintained by the activity of other division proteins, or if the Z-ring is stimulated by a signal that triggers the assembly of the divisome to start constriction. Further studies are required to answer the question of when cyanobacterial cells go to division or, in other words, when the switch from the latent state of the Z-ring to an active and contractile structure occurs.\u003c/p\u003e \u003cp\u003eCyanobacteria possess a gram-negative cell wall organization but share features with gram-positive bacteria such as the chemical composition, cross-linking, and thickness of the peptidoglycan \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. In a recent genomic analysis, Cyanobacteria were classified within the clade Terrabacteria, where they are closely related to Actinobacteriota and Firmicutes, both gram-positive \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. This duality between gram-negative and gram-positive in Cyanobacteria is also reflected in the mixture of their divisome components; therefore, the mechanism and dynamics of divisome assembly could be different from what is known in classic division models. In \u003cem\u003eE. coli\u003c/em\u003e, the temporal hierarchy of divisome assembly is divided into two steps by a specific time delay, which is also true for gram-positive model \u003cem\u003eB. subtilis\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. However, in the case of \u003cem\u003eE. coli\u003c/em\u003e, the divisome follows a linear pathway of assembly dependency, whereas in \u003cem\u003eB. subtilis\u003c/em\u003e, the assembly is interdependent and concerted \u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. Our work is the first step in detailing the assembly of a divisome in a multicellular system and its temporal hierarchy. This can be accomplished by tagging other divisome components in our FtsZ mutants, such as CyDiv, SepF, and FtsQ, and subsequently performing time-lapse microscopy to determine the timing of their assembly.\u003c/p\u003e \u003cp\u003eOur findings suggest that \u003cem\u003eAnabaena\u003c/em\u003e sp. might regulate cell division to improve filament fitness, with only certain cells consuming energy to enable reproduction along the filaments, which could lead to asynchronous division. In some filamentous cyanobacteria, complex cellular processes are highly regulated, such as differentiation into heterocysts under nitrogen-depleted conditions \u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. This differentiation process is regulated by the diffusion of signaling molecules through filaments \u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. As occurs during heterocyst differentiation, cells under division may produce some factors that inhibit the Z-ring constriction in the neighboring cells, or an asymmetric cell division, proposed in \u003cem\u003eAnabaena\u003c/em\u003e sp., could influence cell division patterns, as observed in CyDiv protein localization \u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e. Proteins that are present exclusively in either the \"new\" or \"old\" nascent cells may mediate cellular aging and gating the constriction of the Z-ring.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e \u003cb\u003eBacterial growth conditions.\u003c/b\u003e \u003cem\u003eAnabaena\u003c/em\u003e sp. PCC 7120 (wild-type) was grown in BG11 medium under a 12:12 LD cycle. The FtsZ-sfGFP mutant was grown in BG11 or BG11\u003csub\u003e0\u003c/sub\u003e medium (liquid) supplemented with 10 \u0026micro;g/mL spectinomycin and streptomycin (Sp\u003csub\u003e10\u003c/sub\u003e/Sm\u003csub\u003e10\u003c/sub\u003e) at 25\u0026deg;C in 12:12 LD. The other mutants (FtsZ-mTagBFP2 and FtsZ-mVenus) were grown under the same conditions as the FtsZ-sfGFP mutant, but with spectinomycin at 10 \u0026micro;g/mL (Sp\u003csub\u003e10\u003c/sub\u003e). \u003cem\u003eE. coli\u003c/em\u003e strains were grown in LB medium supplemented with Sp (50 \u0026micro;g/mL), Sm (25 \u0026micro;g/mL), and Cm (30 \u0026micro;g/mL) at 37\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAssembly of the FtsZ-sfGFP construct in pRL271 plasmid.\u003c/b\u003e The FtsZ-sfGFP fusion of this work (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) contains \u003cem\u003efts\u003c/em\u003eZ of \u003cem\u003eAnabaena\u003c/em\u003e sp. fused to the coding sequence of sfGFP through the linker TTACAATCTAGATTAGAA (LQSRLE) previously described in the N-terminal region of FtsZ \u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. Downstream of the fusion, the resistance cassette C.SR3 (Sp/Sm) was incorporated. Two flanking regions (I.R.1 and I.R.2-\u003cem\u003eall\u003c/em\u003e3859) were added, which are homologous to the genome of \u003cem\u003eAnabaena\u003c/em\u003e sp. and were necessary for subsequent homologous recombination in cyanobacteria. Amplification of different parts of the construct was performed by PCR using the enzyme Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) and primers containing homologous regions between adjacent pieces to obtain overlapping regions of 40 bp, thus allowing homologous recombination in yeast. The PCR products obtained were co-transformed with the linearized vector pRS426 following a previously described method \u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e and assembled in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e FY834. Subsequently, the assembled plasmids were extracted from yeast and transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α. \u003cem\u003eBgl\u003c/em\u003eII and \u003cem\u003ePst\u003c/em\u003eI enzymes were used to extract the construct from the pRS426 plasmid. Next, the digested product and pRL271 plasmid linearized with the respective restriction enzymes were purified using the GeneJET Gel Extraction kit (Thermo Scientific). Thereby, ligation was carried out with the enzyme T4 DNA ligase (Thermo Scientific) at 4\u0026deg;C O.N. The ligation products were transformed by heat shock in chemocompetent \u003cem\u003eE. coli\u003c/em\u003e HB101, and the cells were plated on LB agar supplemented with antibiotics (Sp\u003csub\u003e50\u003c/sub\u003e/Sm\u003csub\u003e25\u003c/sub\u003e) and incubated at 37\u0026deg;C O/N. Finally, antibiotic-resistant colonies were grown in liquid LB medium (Sp\u003csub\u003e50\u003c/sub\u003e/Sm\u003csub\u003e25\u003c/sub\u003e/Cm\u003csub\u003e30\u003c/sub\u003e) and the pRL271 plasmid with FtsZ-sfGFP fusion (pRL217_FtsZ::sfGFP) was extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAssembly of FtsZ-mVenus and FtsZ-mTagBFP2 constructs in the pRL271 plasmid.\u003c/b\u003e The genetic constructs of FtsZ-mVenus and FtsZ-mTagBFP2 had an assembly approach similar to FtsZ-sfGFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), but with replacement of the corresponding fluorophore (mVenus or mTagBFP2) and a shorter resistance (Sp only). Amplification of the different regions was performed by PCR using the enzyme Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) and primers with homologous regions to create overlapping regions of 40 bp. The amplified products were purified using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific), and the Gibson assembly reaction was performed as described before \u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. The assembled DNA was transformed into chemocompetent \u003cem\u003eE. coli\u003c/em\u003e HB101 cells, and the transformed cells were plated on LB agar with 50 \u0026micro;g/mL spectinomycin at 37\u0026deg;C O.N. Then, the resistant colonies were grown in liquid LB medium (Sp\u003csub\u003e50\u003c/sub\u003e/Cm\u003csub\u003e30\u003c/sub\u003e), and pRL271 plasmids with the FtsZ-mVenus and FtsZ-mTagBFP2 fusions (pRL217_FtsZ::mVenus and pRL217_FtsZ::mTagBFP2) were extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific).\u003c/p\u003e \u003cp\u003e \u003cb\u003eTriparental mating in\u003c/b\u003e \u003cb\u003eAnabaena\u003c/b\u003e \u003cb\u003esp.\u003c/b\u003e \u003cem\u003eE. coli\u003c/em\u003e HB101 carrying a methylation plasmid (pRL623) was transformed with the pRL271_FtsZ::sfGFP, pRL217_FtsZ::mVenus and pRL217_FtsZ::mTagBFP2 plasmids to generate the cargo strains. Conjugation of \u003cem\u003eAnabaena\u003c/em\u003e sp. with the cargo and the conjugal strains (\u003cem\u003eE. coli\u003c/em\u003e HB101 carrying the conjugal plasmid pRL443) was performed as previously described \u003csup\u003e\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u003c/sup\u003e. Replacements of fusions and antibiotic resistance were generated through homologous recombination in \u003cem\u003eAnabaena\u003c/em\u003e sp. Colonies were selected in BG11 agar medium with antibiotics (Sp\u003csub\u003e50\u003c/sub\u003e/Sm\u003csub\u003e25\u003c/sub\u003e or Sp\u003csub\u003e50\u003c/sub\u003e), and resistant colonies were grown in BG11 medium with antibiotics (Sp\u003csub\u003e10\u003c/sub\u003e/Sm\u003csub\u003e10\u003c/sub\u003e or Sp\u003csub\u003e10\u003c/sub\u003e). Sm/Sp or Sp-resistant colonies were plated on BG11 agar medium with 5% sucrose plus antibiotics to select clones with double recombination events \u003csup\u003e\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDNA extraction.\u003c/b\u003e Colonies resistant to antibiotics and sucrose were grown in BG11 with antibiotics (Sp\u003csub\u003e10\u003c/sub\u003e/Sm\u003csub\u003e10\u003c/sub\u003e or Sp\u003csub\u003e10\u003c/sub\u003e), and genomic DNA was extracted with a modified version of the xanthogenate method. In a 1.5 ml tube, 200 \u0026micro;l of the cultures were mixed with 500 \u0026micro;l of buffer X (1% m/v of potassium ethyl xanthogenate, 0.8 M ammonium acetate, 0.1 M Tris-HCl pH 7.4 and 0.02 M EDTA pH 8.0) and glass beads of 600 nm. The cultures were lysed in the TissueLyser II system (QIAGEN) using a 3-minute/30-second cycle. 50 \u0026micro;l of 10% SDS were added, and the samples were incubated first for 1 hour at 70\u0026deg;C and then for 30 minutes on ice. After the incubation on ice, the lysates were centrifuged at 13000 rpm for 10 minutes at room temperature. The supernatants were transferred to a new 1.5 ml tube, then were mixed with 500 \u0026micro;L of phenol:chloroform:isoamyl alcohol (25:24:1), and centrifuged at 13000 rpm for 10 minutes at 4\u0026deg;C. The upper phase of the tubes was transferred to a new 1.5 ml tube and mixed with 500 \u0026micro;L of chloroform:isoamyl alcohol (24:1). The mixtures were centrifuged again at 13000 rpm for 10 minutes at 4\u0026deg;C, and the upper phase containing the DNA was mixed O/N with the same volume of isopropyl alcohol and a 1:10 volume of 4 M ammonium acetate at -20\u0026deg;C. Finally, the precipitated DNA was centrifuged at 13000 rpm for 10 minutes at 4\u0026deg;C, the supernatant was eliminated, and the pellet was dried at room temperature for 1 hour. The DNA was resuspended in 30 \u0026micro;L of nuclease-free water.\u003c/p\u003e \u003cp\u003e \u003cb\u003eScreening and segregation of the strains.\u003c/b\u003e To determine the degree of segregation of the colonies, PCR amplification was performed using the TTTCTTCAGAGACGGCGACCA (Fw) and TGGTACTCGCCTGGCTCATC (Rv) primers, which differentially amplify the \u003cem\u003efts\u003c/em\u003eZ wild-type gene (approximately 370 bp) and the presence of the constructs with the Sp/Sm or Sp cassette (approximately 3200 bp and 2000 bp, respectively).\u003c/p\u003e \u003cp\u003e \u003cb\u003eConfocal microscopy.\u003c/b\u003e Aliquots (10 \u0026micro;L) were placed on slides with LMP agarose 3% to immobilize the cells. To observe the distribution of genetic material during the process of cell division, before depositing the sample of the mutant on agarose, the culture was incubated in the dark for 10 minutes with a final concentration of DAPI at 7.5 \u0026micro;g/mL. To capture images, a Nikon Ti2-E inverted microscope or Leica SP5/SP8 confocal microscope was used with a 100x objective at 21\u0026deg;C. A 2x or 3x digital zoom was added. The lasers used to excite DAPI and the autofluorescence were 405 and 561 nm, respectively, while the detection spectra for these signals were 410\u0026ndash;483 and 561\u0026ndash;781 nm respectively. For FtsZ-mVenus, FtsZ-sfGFP, and FtsZ-mTagBFP2, the excitation wavelengths were 514, 488, and 405 nm, while the detection ranges were 525\u0026ndash;572, 496\u0026ndash;545, and 415\u0026ndash;493 nm respectively.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTime-lapse microscopy and mother machine device.\u003c/b\u003e To immobilize the cells for time-lapse records on a short temporal scale (seconds), a previously described method \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e was used in the FtsZ-mVenus mutant. These samples were observed using a ZEISS LSM 880 Confocal Laser Scanning Microscope (Airyscan) using a 63x objective, 514 nm excitation laser, and\u0026ndash;525\u0026ndash;572 nm detection range at 21\u0026deg;C with an optical zoom of 4x. For FRAP analysis, the acquisition was performed in the FtsZ-sfGFP mutant with a 5-second interval using the 488 mm laser at 0.4%, and bleaching was performed with the same laser at 100% intensity. Microfluidic devices were designed as a modified version of the \u0026ldquo;Mother Machine\u0026rdquo; \u003csup\u003e\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e for long-time observation of \u003cem\u003eAnabaena\u003c/em\u003e sp. The design consists of a central 100 \u0026micro;m-wide channel for continuous media injection, flanked by a series of growth channels, each 15 \u0026micro;m in width and 100 \u0026micro;m in length. To facilitate the entry of bacteria into the growth channels, they ended in a narrow, 5 \u0026micro;m wide, and 10 \u0026micro;m long flushing channel, which was connected to a wide collecting chamber connected to the outside through an outlet hole. The height of the device was measured at 7.5 \u0026micro;m. The devices were fabricated using standard ultraviolet (UV) and soft lithography techniques \u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. The molds were fabricated via UV lithography using a maskless laser writer (MLA100, Heidelberg) on a 3-inch silicon wafer (University wafer) covered with a layer of SU-8 (GM1060, Gersteltec Sarl). From the mold, polydimethylsiloxane (PDMS) replicas were obtained from the mold using soft lithography. The PDMS prepolymer and curing agent (Sylgard 184, Dow Corning) were mixed in a 10:1 weight ratio and poured into the mold. After degassing in a vacuum chamber, the PDMS was cured in an oven at 65\u0026deg;C for at least 1 h, cut with a scalpel, and detached from the mold. The inlets and outlet ports were pierced with a biopsy punch on PDMS, and the devices were assembled against a glass coverslip by irreversible bonding after air plasma treatment. The samples were observed in a Nikon Ti2-E inverted microscope using the 100x objective, 488, and 561 excitation lasers with detection ranges of 496\u0026ndash;545 and 561\u0026ndash;781 nm respectively, at 25\u0026deg;C and 0.1% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCryo-CLEM.\u003c/b\u003e Cultures of the wild-type strain and mutants were grown at 30\u0026deg;C and 120 rpm until reaching an OD\u003csub\u003e650nm\u003c/sub\u003e of 0.9, and 1 ml of each culture was centrifuged at 3000 rpm for 10 minutes. 800 \u0026micro;l of the medium were discarded and 15 \u0026micro;L of the remnant volume was incubated for 30 minutes at room temperature in a grid that was previously glow discharged to render it hydrophilic and functionalized with poly-lysine (50 ug/ml). The samples were vitrified by plunge freezing into liquid ethane using Leica GP2 equipment, with a blotting time of 4 seconds using the blotting sensor and were stored in liquid nitrogen for further analysis. Cryo-fluorescence imaging was acquired with a Zeiss LS900 Airyscan2 confocal microscope equipped with a Linkam CSM196 cryo-stage using a LD EC Epiplan-Neofluar 100x/0.75 DIC objective, followed by a Z step of 430 nm. Cryo-FIB-SEM imaging was guided by cryo-fluorescence information, and cryo-FIB-SEM tomograms were acquired in confocal areas imaged at high magnification using a Zeiss CrossBeam 550 cryo-FIB-SEM microscope. SEM images were captured at an accelerating voltage of 2 kV and a beam current of 36 pA. The magnification was set to 3.72 Kx, resulting in a pixel size of 5 nm. The Z-track was 25 nm, and a line average of 72 lines was used for noise reduction.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConfocal and Airyscan data processing.\u003c/b\u003e Airyscan processing was performed in the ZEN Imaging Software (Blue edition) and ImageJ (Fiji). Conventional confocal microscopy was performed using Leica Application Suite X (LAS X) software and ImageJ (Fiji). The time-lapse data was aligned in ImageJ (Fiji) using the StackReg plug-in and then adjusted with Bleach correction. With the KymographClear tool, the time-lapse data was used to generate the corresponding kymographs that were analyzed with \u003cem\u003eKymographDirect\u003c/em\u003e software \u003csup\u003e\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e to obtain the velocity of individual trajectories. For FRAP, the data was analyzed using the online tool easy-FRAP web \u003csup\u003e\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCryo-CLEM data processing.\u003c/b\u003e Cryo-confocal data was deconvoluted and aligned along the Z-axis and between channels using ZEN Imaging Software (Blue edition). The Cryo-FIB-SEM volumes were processed in Fiji (ImageJ) \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e using linear stack alignment with SIFT in two rounds: first with a maximal alignment error of 600 pixels and second of 5 pixels. The images were denoised with the N2V train and predict tool \u003csup\u003e\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e, and the curtaining effect was corrected using FFT Bandpass Filter processing in Fiji (ImageJ) in two rounds, first with a vertical tolerance of 5% and second, with a horizontal tolerance of 95%. The local contrast correction was performed with the Normalize Local Contrast plug-in in Fiji (ImageJ) using a block radius of 1 pixel in X and 100 pixels in Y, and standard deviations of 3. Cryo-fluorescence and cryo-FIB-SEM data were aligned using Dragonfly software \u003csup\u003e\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e with the manual registration tool in the 4 views mode.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical analysis.\u003c/b\u003e One-way ANOVA with Tukey\u0026rsquo;s multiple comparison test was conducted to analyze the percentage of early rings. For late rings, the Kruskal-Wallis test and Dunn\u0026rsquo;s multiple comparison test were used. The filament velocity of individual trajectories of the FtsZ protofilaments was analyzed using the Kruskal-Wallis test and Dunn\u0026rsquo;s multiple comparison test. A two-way ANOVA followed by Tukey\u0026rsquo;s multiple comparison test was employed for the analysis of constriction velocity.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e \u003c/div\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eMaterials \u0026amp; Correspondence\u003c/h2\u003e \u003cp\u003eAll correspondence and material requests should be directed to the corresponding author.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eJO and MV contributed to the design and execution of all experiments presented in this publication. DA, AGC, and MSG contributed to the design and assembly of plasmids as well as confocal microscopy analysis. MLC contributed to the design and creation of the mother machine system. JC and JMV contributed to cryo-CLEM microscopy and data processing, and OM contributed to the morphological description of the mutants.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eThis work was supported by Fondecyt #1161232 and CONICYT-PCHA/DoctoradoNacional/2019-21191389 grants (to MV), and by grant PID2022-137175NB-I00 (AEI/FEDER, UE) from the Spanish Ministry of Science, Innovation and Universities (to JMV). The microscopy data was acquired in collaboration with the Advanced Microscopy Facility UMA-UC (Santiago, Chile), CNB-CSIC cryoelectron microscopy (CryoEM CNB-CSIC) facility, and CNB-CSIC Advanced Light Microscopy Facility (Madrid, Spain).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBuss J et al (2015) A Multi-layered Protein Network Stabilizes the Escherichia coli FtsZ-ring and Modulates Constriction Dynamics. PLoS Genet 11:1\u0026ndash;24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuman R et al (2013) Structural and genetic analyses reveal the protein SepF as a new membrane anchor for the Z ring. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1313978110\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1313978110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerbush AD, Osteryoung KW (2012) Distinct functions of chloroplast FtsZ1 and FtsZ2 in Z-ring structure and remodeling. J Cell Biol 199:623\u0026ndash;637\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujita J et al (2023) Structures of a FtsZ single protofilament and a double-helical tube in complex with a monobody. Nat Commun 14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopes Pinto F, Erasmie S, Blikstad C, Lindblad P, Oliveira P (2011) FtsZ degradation in the cyanobacterium Anabaena sp. strain PCC 7120. J Plant Physiol 168:1934\u0026ndash;1942\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026ouml;derstr\u0026ouml;m B, Chan H, Shilling PJ, Skoglund U, Daley DO (2018) Spatial separation of FtsZ and FtsN during cell division. Mol Microbiol 107:387\u0026ndash;401\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyu Z, Coltharp C, Yang X, Xiao J (2016) Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Biopolymers 725\u0026ndash;734. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bip.22895\u003c/span\u003e\u003cspan address=\"10.1002/bip.22895\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacq (2015) Remodeling of the Z-Ring Nanostructure during the Streptococcus pneumoniae Cell Cycle Revealed by Photoactivated Localization Microscopy. 6:1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiteen JS, Goley ED, Shapiro L, Moerner WE (2012) Three-dimensional super-resolution imaging of the midplane protein FtsZ in live Caulobacter crescentus cells using astigmatism. ChemPhysChem 13:1007\u0026ndash;1012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrauss MP et al (2012) 3D-SIM Super Resolution Microscopy Reveals a Bead-Like Arrangement for FtsZ and the Division Machinery: Implications for Triggering Cytokinesis. PLoS Biol 10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamirez-Diaz DA et al (2021) FtsZ induces membrane deformations via torsional stress upon GTP hydrolysis. Nat Commun 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoodman LCC, Erickson H (2022) P. FtsZ is essential until the late stage of constriction. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2022.03.01.482533\u003c/span\u003e\u003cspan address=\"10.1101/2022.03.01.482533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColtharp C, Buss J, Plumer TM, Xiao J (2016) Defining the rate-limiting processes of bacterial cytokinesis. Proc Natl Acad Sci U S A 113:E1044\u0026ndash;E1053\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBisson-Filho AW et al (2017) Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division. Sci (1979) 355:739\u0026ndash;743\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Lyu Z, Miguel A, Mcquillen R, Huang KC (2017) GTPase activity \u0026ndash; coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. 747:744\u0026ndash;747\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBattistuzzi FU, Hedges SB (2009) A major clade of prokaryotes with ancient adaptations to life on land. Mol Biol Evol 26:335\u0026ndash;343\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoksharova OA, Babykin MM (2011) Cyanobacterial cell division: Genetics and comparative genomics of cyanobacterial cell division. Russ J Genet 47:255\u0026ndash;261\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandakovic D et al (2016) CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Front Microbiol 7:1\u0026ndash;11\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu R et al (2017) Three-dimensional superresolution imaging of the FtsZ ring during cell division of the cyanobacterium prochlorococcus. \u003cem\u003emBio\u003c/em\u003e 8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang JY, Lin GM, Xing WY, Zhang CC (2018) Diversity of growth patterns probed in live cyanobacterial cells using a fluorescent analog of a peptidoglycan precursor. Front Microbiol 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakr S, Jeanjean R, Zhang CC, Arcondeguy T (2006) Inhibition of cell division suppresses heterocyst development in Anabaena sp. strain PCC 7120. J Bacteriol 188:1396\u0026ndash;1404\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValladares A, Picossi S, Corrales-Guerrero L, Herrero A (2023) The role of SepF in cell division and diazotrophic growth in the multicellular cyanobacterium Anabaena sp. strain PCC 7120. Microbiol Res 277\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos-Le\u0026oacute;n F, Mariscal V, Fr\u0026iacute;as JE, Flores E, Herrero A (2015) Divisome-dependent subcellular localization of cell-cell joining protein SepJ in the filamentous cyanobacterium Anabaena. Mol Microbiol 96:566\u0026ndash;580\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpringstein BL, Weissenbach J, Koch R, St\u0026uuml;cker F, Stucken K (2020) The role of the cytoskeletal proteins MreB and FtsZ in multicellular cyanobacteria. FEBS Open Bio 10:2510\u0026ndash;2531\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchindelin J et al (2012) Fiji: An open-source platform for biological-image analysis. \u003cem\u003eNature Methods\u003c/em\u003e vol. 9 676\u0026ndash;682 Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.2019\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrauss MP et al (2012) 3D-SIM Super Resolution Microscopy Reveals a Bead-Like Arrangement for FtsZ and the Division Machinery: Implications for Triggering Cytokinesis. 10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBisson-Filho AW et al (2017) Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division. Sci (1979) 355:739\u0026ndash;743\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlivares J, Gonz\u0026aacute;lez A, Andrade D, V\u0026aacute;squez M (2023) Vertical Immobilization Method for Time-Lapse Microscopy Analysis in Filamentous Cyanobacteria. J Vis Exp. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3791/65612\u003c/span\u003e\u003cspan address=\"10.3791/65612\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsawa M, Erickson HP (2006) FtsZ from divergent foreign bacteria can function for cell division in Escherichia coli. J Bacteriol 188:7132\u0026ndash;7140\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore DA, Whatley ZN, Joshi CP, Osawa M, Erickson H (2017) P. Probing for binding regions of the FtsZ protein surface through site-directed insertions: Discovery of fully functional FtsZ-fluorescent proteins. J Bacteriol 199\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWestlund E et al (2023) Application of nanotags and nanobodies for live cell single-molecule imaging of the Z-ring in Escherichia coli. Curr Genet 69:153\u0026ndash;163\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCameron TA, Margolin W (2023) Construction and Characterization of Functional FtsA Sandwich Fusions for Studies of FtsA Localization and Dynamics during Escherichia coli Cell Division. J Bacteriol 205\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyu Z et al (2022) FtsN maintains active septal cell wall synthesis by forming a processive complex with the septum-specific peptidoglycan synthases in E. coli. Nat Commun 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCamargo S et al (2019) ZipN is an essential FtsZ membrane tether and contributes to the septal localization of SepJ in the filamentous cyanobacterium Anabaena. Sci Rep 9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng Z et al (2017) An amidase is required for proper intercellular communication in the filamentous cyanobacterium \u003cem\u003eAnabaena\u003c/em\u003e sp. PCC 7120. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 114, E1405\u0026ndash;E1412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing W-Y et al (2021) HetF Protein Is a New Divisome Component in a Filamentous and Developmental Cyanobacterium. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mBio\u003c/span\u003e\u003cspan address=\"10.1128/mBio\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValbuena FM et al (2020) A photostable monomeric superfolder green fluorescent protein. Traffic 21:534\u0026ndash;544\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYag\u0026uuml;e P et al (2023) FtsZ phosphorylation pleiotropically affects Z-ladder formation, antibiotic production, and morphogenesis in Streptomyces coelicolor. Antonie van Leeuwenhoek Int J Gen Mol Microbiol 116:1\u0026ndash;19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider D, Fuhrmann E, Scholz I, Hess WR, Graumann PL (2007) Fluorescence staining of live cyanobacterial cells suggest non-stringent chromosome segregation and absence of a connection between cytoplasmic and thylakoid membranes. BMC Cell Biol 8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyagishima SY, Wolk PP, Osteryoung KW (2005) Identification of cyanobacterial cell division genes by comparative and mutational analyses. Mol Microbiol 56:126\u0026ndash;143\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain IH, Vijayan V, O\u0026rsquo;Shea EK (2012) Spatial ordering of chromosomes enhances the fidelity of chromosome partitioning in cyanobacteria. Proc Natl Acad Sci U S A 109:13638\u0026ndash;13643\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong G et al (2010) Elevated ATPase Activity of KaiC Applies a Circadian Checkpoint on Cell Division in Synechococcus elongatus. Cell 140:529\u0026ndash;539\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartins BMC, Tooke AK, Thomas P, Locke JC (2018) W. Cell size control driven by the circadian clock and environment in cyanobacteria SYSTEMS BIOLOGY BIOPHYSICS AND COMPUTATIONAL BIOLOGY. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.17863/CAM.31834\u003c/span\u003e\u003cspan address=\"10.17863/CAM.31834\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKushige H et al (2013) Genome-wide and heterocyst-specific circadian gene expression in the filamentous cyanobacterium Anabaena sp. strain PCC 7120. J Bacteriol 195:1276\u0026ndash;1284\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026ouml;derstr\u0026ouml;m B, Chan H, Shilling PJ, Skoglund U, Daley DO (2018) Spatial separation of FtsZ and FtsN during cell division. Mol Microbiol 107:387\u0026ndash;401\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMerino-Salom\u0026oacute;n A et al Crosslinking by ZapD drives the assembly of short, discontinuous FtsZ filaments into ring-like structures in solution. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2023.01.12.523557\u003c/span\u003e\u003cspan address=\"10.1101/2023.01.12.523557\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErickson HP, Taylor DW, Taylor KA, Bramhill D (1996) \u003cem\u003eBacterial Cell Division Protein FtsZ Assembles into Protofilament Sheets and Minirings, Structural Homologs of Tubulin Polymers\u003c/em\u003e. \u003cem\u003eProc. Natd. Acad. Sci. USA\u003c/em\u003e vol. 93\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerez AJ et al (2019) Movement dynamics of divisome proteins and PBP2x: FtsW in cells of Streptococcus pneumoniae. Proc Natl Acad Sci U S A 116:3211\u0026ndash;3220\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQuardokus EM, Din N, Brun YV (2001) Cell cycle and positional constraints on FtsZ localization and the initiation of cell division in Caulobacter crescentus. Mol Microbiol 39:949\u0026ndash;959\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitley KD et al (2021) FtsZ treadmilling is essential for Z-ring condensation and septal constriction initiation in Bacillus subtilis cell division. Nat Commun 12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColtharp C, Buss J, Plumer TM, Xiao J (2016) Defining the rate-limiting processes of bacterial cytokinesis. Proc Natl Acad Sci U S A 113:E1044\u0026ndash;E1053\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStewart I, Schluter PJ, Shaw GR (2006) Cyanobacterial lipopolysaccharides and human health - A review. \u003cem\u003eEnvironmental Health: A Global Access Science Source\u003c/em\u003e vol. 5 Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1476-069X-5-7\u003c/span\u003e\u003cspan address=\"10.1186/1476-069X-5-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColeman GA et al (2021) A rooted phylogeny resolves early bacterial evolution. Sci (1979) 372\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu S, Lutkenhaus J (2017) Assembly and activation of the Escherichia coli divisome. \u003cem\u003eMolecular Microbiology\u003c/em\u003e vol. 105 177\u0026ndash;187 Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mmi.13696\u003c/span\u003e\u003cspan address=\"10.1111/mmi.13696\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGamba P, Veening JW, Saunders NJ, Hamoen LW, Daniel RA (2009) Two-step assembly dynamics of the Bacillus subtilis divisome. J Bacteriol 191:4186\u0026ndash;4194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdams DW, Errington J (2009) Bacterial cell division: Assembly, maintenance and disassembly of the Z ring. \u003cem\u003eNature Reviews Microbiology\u003c/em\u003e vol. 7 642\u0026ndash;653 Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrmicro2198\u003c/span\u003e\u003cspan address=\"10.1038/nrmicro2198\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar K, Mella-Herrera RA, Golden JW (2010) Cyanobacterial heterocysts. Cold Spring Harb Perspect Biol 2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Zhou F, Wang S, Xu X (2017) Processing of PatS, a morphogen precursor, in cell extracts of Anabaena sp. PCC 7120. FEBS Lett 591:751\u0026ndash;759\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandakovic D et al (2016) CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Front Microbiol 7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePcc S, Sakr S, Jeanjean R, Zhang C, Arcondeguy T (2006) Inhibition of Cell Division Suppresses Heterocyst Development in. 188:1396\u0026ndash;1404\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMethod DNAPEG, Gietz RD, Woods RA (1998) 4 Transformation of Yeast bv the Lithium Acetate /. Single-Stranded Carrier. 26\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibson DG (2011) Enzymatic assembly of overlapping DNA fragments. Methods in Enzymology, vol 498. Academic Press Inc., pp 349\u0026ndash;361\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElhai J, Wolk CP (1988) Conjugal Transfer of DNA to Cyanobacteria. Methods Enzymol 167:747\u0026ndash;754\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai Y, Wolk CP (1990) Use of a condtionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinats and to entrap insertion sequnces. J Bacteriol 172:3138\u0026ndash;3145\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang P et al (2010) Robust growth of escherichia coli. Curr Biol 20:1099\u0026ndash;1103\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcdonald JC \u003cem\u003eFabrication of Microfluidic Systems in Poly(Dimethylsiloxane)\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMangeol P, Prevo B, Peterman EJG (2016) KymographClear and KymographDirect: Two tools for the automated quantitative analysis of molecular and cellular dynamics using kymographs. Mol Biol Cell 27:1948\u0026ndash;1957\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoulouras G et al (2018) EasyFRAP-web: A web-based tool for the analysis of fluorescence recovery after photobleaching data. Nucleic Acids Res 46:W467\u0026ndash;W472\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrull A, Buchholz T-O, Jug F \u003cem\u003eNoise2Void-Learning Denoising from Single Noisy Images\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://celltrackingchallenge.net/\u003c/span\u003e\u003cspan address=\"http://celltrackingchallenge.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakovetsky R, Piche N, Marsh M (2018) Dragonfly as a Platform for Easy Image-based Deep Learning Applications. Microsc Microanal 24:532\u0026ndash;533\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4660361/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4660361/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eZ-ring formation by FtsZ in the midcell is a key event in bacterial cell division. Results obtained with different super-resolution techniques have shown that the Z-ring is discontinuous, while live cell imaging has shown that FtsZ moves by treadmilling. In multicellular cyanobacteria, there have been no studies on the structure or dynamics of the Z-ring. In this study, we generated fully segregant mutants that express FtsZ fusions with fluorescent tags under the control of the native promoter in \u003cem\u003eAnabaena\u003c/em\u003e sp., in which the Z-ring resembles a pearl necklace of dynamic arrangement with mobilization of FtsZ on the seconds scale. Division along filaments is asynchronous; however, manipulating the light conditions improves cell synchronization. Using correlative microscopy, we demonstrate that the DNA remains in the septum during constriction, therefore, the nucleoid occlusion mechanism does not apply here. To the best of our knowledge, this is the first live imaging of Z-ring behavior using fully segregated FtsZ mutants in a multicellular bacterial system.\u003c/p\u003e","manuscriptTitle":"The Z-Ring in Multicellular Cyanobacteria has a dynamic pearl necklace arrangement","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-23 12:40:09","doi":"10.21203/rs.3.rs-4660361/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c76a1ca6-a975-4134-9b4c-d9ea40bb1c65","owner":[],"postedDate":"August 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":36238198,"name":"Biological sciences/Microbiology/Bacteria/Bacterial development"},{"id":36238199,"name":"Biological sciences/Molecular biology/Cell division"},{"id":36238200,"name":"Biological sciences/Microbiology/Cellular microbiology"}],"tags":[],"updatedAt":"2024-09-23T10:20:37+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-23 12:40:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4660361","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4660361","identity":"rs-4660361","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}