L- Asparaginase activity of endophytic fungi isolated from Orobanche spp. In Iran

L- Asparaginase activity of endophytic fungi isolated from Orobanche spp. In Iran | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article L- Asparaginase activity of endophytic fungi isolated from Orobanche spp. In Iran Robabeh Gholizadeh, Roghayeh Hemmati This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7090039/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This research focuses on evaluating endophytes as sources of bioactive compounds to identify microorganisms capable of producing the anti-cancer enzyme L-asparaginase. The plant Orobanche spp. was selected as the host, from which various compounds such as phenylthanoide glycosides, steroids, terpenoids, organic acids and their derivatives, ligands, alkaloids and flavonoids have been extracted. Endophytic fungi were isolated using standard surface sterilization techniques. Initial screening for L-asparaginase production was conducted using a qualitative assay on a modified Czapek dox agar medium. Enzyme production was identified by the formation of pink halos around the fungal colonies on the agar medium. This color change resulted from the hydrolysis of asparagine into aspartic acid and ammonia, which caused the phenol red indicator to shift from yellow (under acidic conditions) to pink (under alkaline conditions). L-asparaginase activity was also quantified using Nessler's method. The results revealed that among 34 identified endophytic morphotypes, 20 exhibited L-asparaginase production, with activities ranging from 0.701 to 3.10 µmol⁻¹ mL⁻¹ min⁻¹Furthermore, four isolates with high L-asparaginase activity were identified, exhibiting activities between 1.50 and 3.10 µmol⁻¹ mL⁻¹ min⁻¹Endophytic fungi were identified based on morphological characteristics and phylogenetic analysis of DNA sequence data, including ribosomal ITS regions and TEF1 genes. The L-asparaginase-producing species belonged to the genera Alternaria, Fusarium, Trichoderma, Penicillium, and Macrophomina. This study demonstrated that endophytic fungi isolated from Orobanche spp. possess a significant capacity for the production of L-asparaginase and can be used as an alternative source for the production of this enzyme on an industrial scale. Biological sciences/Biochemistry Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Microbiology Biological sciences/Plant sciences Anti-cancer Broom rape Enzymes Fungal endophytes Fusarium Trichoderma spp Figures Figure 1 Figure 2 Introduction The endophytic fungi are fungi colonizing the intercellular and intracellular spaces of the host plant tissue without causing harm to the host plants. These fungi naturally exist in the plant tissues and do not show any apparent pathological symptoms. The compounds produced by the plant, such as flavonoids and phenols, attract fungi present in the rhizosphere to penetrate into plant tissues (Ahmad et al. 2020 ). To maintain a stable symbiotic relationship, endophytic fungi produce a diverse array of secondary metabolites. These fungi, due to their remarkable biosynthetic capabilities,, are now considered as a rich source of new natural molecules with wide applications in health and medicine (Strobel and daisy 2003 ). Among these are the alkaloids, flavonoids, quinones, steroids, and terpenoids. Recently, endophytic fungi have been considered as one of the strong focuses in research over a considerable period for their potential as candidates for newer and sustainable antibiotics, antioxidants, anti-tumour and antiviral agents ( Hashem et al. 2023 ). These fungi are also known as potential sources for producing various enzymes applied in industries and the health sectors. Lactase, lipase, pectinase, amylase, and protease are just a few examples of enzymes from these types of fungi. Due to their natural and robust nature, enzymes extracted from these fungi find application in various industries, importantly in the pharmaceutical industry (Ancheeva et al. 2020 ). L-asparaginase is a key drug in the treatment of acute lymphoblastic leukemia (ALL). It depletes leukemic cells of an essential nutrient by converting L-asparagine into ammonia and L-aspartate (Moubasher et al. 2022 ). L-asparagine is essential for the growth and dissemination of leukemic cells, but when assayed through L- asparaginase, it decreases concentration in blood which prevent cancerous cell ahead-running. Researchers discovered the enzyme in guinea pig serum. After observing its ability to combat leukemia in laboratory, mice medical professionals received approval to use it to treat childhood acute lymphoblastic leukemia (Asthana and Azmi 2003 ). Doctors rely on L-asparaginase from E. coli, but its bacterial origin may lead to some undesirable side effects. To solve this issue, scientists recommend using L-asparaginase from fungi. Because fungi are eukaryotes like humans and their enzymes might be gentler for patients. Some plant species with cancer-fighting qualities also contain asparaginase enzymes produced by fungi that live within them (Bahavana and Prakash 2019). Sarquis (2004) reported the production of this enzyme from fungi such as Penicillium, Aspergillus, Fusarium, and some yeast species. Manasa ( 2014 ) screened various endophytic fungi including Fusarium, Alternaria, Cladosporium, Phoma, Curvularia, and Pimpenellae isolated from the medicinal plant thyme for the production of L-asparaginase enzyme and observed satisfactory results. Orobanche spp. is a fleshy-stemmed holoparasitic plant about 20–30 cm tall with scale-like leaves without roots. it is a root parasite which means that all of its nutrients come directly from the host plants. There are about 133 species of broomrape in the world, which mostly hail from the Middle East and Mediterranean region (Piwowarczyk et al. 2015 ). It is native to 80 countries, especially in Mediterranean climates and similar regions such as California or right under Tropic of Cancer such as Western Australia (Piwowarczyk et al. 2015 ). This species of broomrape is a heavy seed producer, generating as many as 250,000 seeds per plant and wreaking havoc on vegetable and fruit crops over an estimated agricultural area equivalent to about 4 or even more likely at least 5 percent. Those seeds germinate when they detect the exudates emitted from roots of host plants (Abang et al. 2007 ). In Europe, America, and Asia, on the other hand, certain broomrape types are used for medicinal purposes to cure ailments such as skin ulcers and diarrhea in infants. In addition, they are taken as nutritious vegetables with great economic importance in the United States; however, their cultivation has been opposed due to product contamination (Qu et al. 2015 ). From this plant, compounds like phenylthanoic glycosides, steroids, terpenoids, and alkaloids have been isolated (Gao 2018). There is no report of studying the potential of endophytic fungi from broomrape for the production of L-asparaginase. Materials and methods Separation of Endophytic Fungi During the summer of 2023, 300 samples of healthy plants of Orobanche spp, were collected from the summer fields of North West Iran. To isolate endophytic fungi, each sample was first washed with tap water to separate soil particles attached to the roots and then its whole stem including flowers, were cut in five mm pieces, individually surface-disinfested by immersing them in a solution of 1% sodium hypochlorite to remove epiphytic microorganisms and rinsed with sterilized water. After drying on sterile filter paper, the pieces were put on PDA (Potato Dextrose Agar) containing streptomycin sulphate (20 mg/L) and incubated at 25 ºC and darkness for 20 days (Theantana et al. 2009 ). Identification and screening of endophytes that produce L-asparaginase. Modified Czapek Dox agar (McDox) was used to investigate fungi for the production of L-asparaginase. For this experiment, a 5-mm mycelial plug of the fungus was inoculated onto the McDox medium containing agar powder (20 g/L), glucose (2 g/L), L-asparagine (10 g/L), KH₂PO₄ (1.52 g/L), KCl (0.52 g/L), MgSO₄7H₂O (0.52 g/L), Cu(NO₃)₂·3H₂O (0.001 g/L), ZnSO₄7H₂O (0.001 g/L), and FeSO₄7H₂O ( 0.001 g/L). In addition, 0.3 mL of 2.5% phenol red dye was added to the medium as an indicator. Controls were prepared by inoculating mycelial plugs onto McDox agar without L-asparagine. All plates were incubated at 28 ± 2°C for 5 days. After the incubation period, the diameter of the pink zone that indicates L-asparaginase production was measured. The above-mentioned method helps in determination and screening of the potential of fungi regarding the production of L-asparaginase, which could be useful in further studies (Chow and Ting 2015 ). Investigating the function of L-Asparaginase enzyme in selected endophytes The selected fungal isolates were cultured in 30 ml of McDox broth medium for five consecutive days at 28 ± 2°C with shaking conditions at a speed of 120 rpm. A volume of 100 microliters of the culture medium containing the enzyme was extracted and transferred to the microcentrifuge tubes. For the preparation of test, 100 µl Tris HCl buffer (pH 7.2), 200 µl asparagine solution (0.04 M) and 100 µl sterile distilled water was added to the sample. The mixture was incubated at 37 ± 2°C for one hour. The reaction was stopped by adding 100 µl of trichloroacetic acid (TCA) at a final concentration of 1.5 M. Thereafter, 100 µl of the mixture was added to new tubes with 750 µl of sterile distilled water and 300 µl of Nessler's reagent. After incubating the tube mixtures for 20 min at 2 ± 28°C, absorbance was measured at a wavelength of 450 nm. A unit of L-asparaginase activity is defined as the amount of enzyme that catalyzes the production of 1 µl of ammonia per minute at 37 ± 2°C (Tan et al. 2005 ). Statistical evaluation This experiments were conducted as a completely randomized design (CRD) and with three replications for each of the investigated parameters The data were statistically analyzed using the software Statistical Package for the Social Sciences (SPSS) version 20.0. To analyze the data, one-way analysis of variance (ANOVA) along with Tukey's mean comparison test (Tukey's HSD) was used at a significance level of P < 0.05. Identification of L-asparaginase-generating endophytic species Genomic DNA extraction was performed using a modified CTAB method based on the protocol of ( Doyle et al. 1990). Fungal mycelia were collected and ground after growing in PDB liquid culture medium for one week (120 rpm). DNA extraction was done using CTAB buffer containing 2-mercaptoethanol. The samples were incubated for 45 minutes at 65°C. To remove proteins, chloroform-isoamyl alcohol mixture (24:1) was used. After centrifugation (12000 rpm for 10 minutes), the aqueous phase was separated and DNA was precipitated with cold isopropanol. After washing with 70% ethanol, the DNA precipitate was dissolved in 70 microliters of distilled water. Polymerase chain reaction (PCR) for genomic DNA amplification with a 25 µl reaction mixture containing 1 µl of each primer ITS1 (5'- TCCGTAGGTGAACCTGCGG-3'), ITS4 (3'-TCCTCCGCTTATTGATATGC-5') and TEF1-α (EF1 GAYTTCATCAAGAACATGAT), (EF2GACGTTGAADCCRACRTTGTC) β-tubulin (Bt2α GGTAACCAAATCGGTGCTGCTTTC), (Bt2b ACCCTCAGTGACCCTTGG), 2 µl of genomic DNA (40 ng ), 12.5 microliters of Mix Master amplicon Red x2 and 8.5 microliters of double distilled water. became. The PCR program consisted of initial denaturation at 95°C for 5 min, 35 cycles with denaturation (95°, 30 s), primer annealing (50–65°, 30 s) and extension (72°, 55 s), and final extension. It was at 72 degrees for 10 minutes. PCR products were electrophoresed on 1% agarose gel, stained with Gel Red and imaged by Gel Documentation system (Chow and Ting 2015 ). Sequencing was done by Sanger method in Macrogen (South Korea) and the sequences were edited with ChromasPro software and analyzed by BLAST in NCBI. The final sequences were registered in GenBank and the accession number was obtained ( http://blast.ncbi.nlm.nih.gov/BLAST.cgi ) Results Isolation of endophytes In this study, 300 samples of Orobanche spp were transferred to the laboratory and the stem and flower parts were separated from each other and each was cultivated separately. 83 isolates were isolated from the stem and 42 isolates were isolated from the flower. The isolates were divided into 34 morphotypes, each morphotype having similar morphological characteristics. For futher experiments, representative of the morphotypes were used. Identification of L-asparaginase producing endophytes and their activities From a total of 34 endophytes (morphotypes), 20 morphotypes were able to produce L-asparaginase. For these positive isolates, the formation of a pink zone was clearly observed, which was the result of L-asparaginase production by the endophytes. This enzyme hydrolyzes asparagine to aspartic acid and ammonia, and as a result, the color of the phenol red indicator changes from yellow (in acidic conditions) to pink (in alkaline conditions) (Fig. 1 ). Each of the morphotypes produced different sizes of pink area diameter, which ranged from 0.3 to 3.50 cm and the median was 1.4 cm. Positive endophytes produced asparaginase activity in the range of 0.701 to 3.10 unit/mL-1 (Table 1 ). among these endophytes, four were identified as endophytes with high asparaginase activity (1.50–3.10 unit/mL-1). while 16 endophytes (sh4, sh23, sh74, sh51k, sh672A, sh20B, sh25, shA03, sh99, shGG, sh672B, sh166, sh49, sh4A, sh72, sh78) had relatively high asparaginase activity (0.701–0.980 unit/mL-1) ( Table 1 ). Isolates shAAA and shAA extracted from the stem of Orobanche spp. are among the 20 identified endophytes with high L-asparaginase activities. In contrast, shGG and SH672B, which were isolated from flower parts, showed the lowest L-asparaginase activity (Fig. 2 ). These results clearly indicate the existence of a specific trend in the production of L-asparaginase enzyme in different parts of plants. Table 1 Asparaginase activities (mL⁻¹·min⁻¹) of 20 fungal endophytes isolated from Orobanche spp. Mean and standard deviation are provided. Means with different letters indicate statistically significant differences as determined by Tukey's Studentized Range Test (HSD0.05). Plant host Orobanche spp Endophytic isolate Mean asparaginase activity (mL⁻¹·min⁻¹) Standard deviation Tukey grouping SH4 0.85 0/5727 bc SH23 0.824 0/5190 df SH74 0.78 0/5515 bk SH51k 0.839 0.5918 tu SH672A 0.932 0.6519 Im SH20A 1.1 0.7764 kf SH25 0.955 0.6752 bn SHA03 0.724 0.5062 kn SH99 0.809 0.5685 bm SHGG 0.746 0.5275 gm SH72 0.98 0.6887 rs SH78 0.9 0.6286 rm SH672 0.701 0.4730 gz SH166 0.9 0.6229 gn SH49 0.93 0.6576 fm SH4A 0.833 0.5854 bg SHAAA 2.8 1.9671 nb SH20B 1.5 1.060 sh SHAA 3.1 2.1778 vb SH49B 1.9 1.3194 Ip In this study, a simple regression analysis was conducted to examine the correlation between two testing methods: qualitative (measurement of pink area diameter) and quantitative (activities of L-asparaginase). The results of this analysis indicate that the correlation coefficient (r) is equal to 0.37, which suggests a weak relationship between the diameter of the pink areas on the agar plates and the quantitative activities of L-asparaginase. Additionally, the reported p < 0.25 indicates that this coefficient is not significantly different from zero. These results are in agreement with previous observations, which show that among 20 positive endophytes, 5 had high L-asparaginase activities, but there was no significant correlation with the diameter of the pink areas. Isolate shaa, with the highest L-asparaginase activity of (3.1 unit/mL-1) had a diameter of 1.8 cm, while the sh4a, with a diameter of 3.50 cm, has only 0.850 unit/mL-1 L-asparaginase activity. Characterization of endophytes that produce L-asparaginase The identification of L-asparaginase-producing endophytes was based on the sequencing results of 20 selected isolates, which were analyzed using the sequences retrieved from the NCBI database. 20 endophytes producing L-asparaginase were identified as species belonging to Fusarium (2 morphotype), Penicillium (2 morphotype), Trichoderma (2 morphotype), Alternaria (4 morphotype), Aspergillus (2 morphotype) and Macrophomina (1 morphotype) (Table 2 ). The morphological appearance and characteristics of the colonies of five fungi producing active L-asparaginase are as follows: ShAA isolate, identified as Fusarium proliferatum , has light purple colonies in PDA culture medium. The hyphae of this isolate were sparse, its macroconidia are thick-walled and elongated, while microconidia are club-shaped and lack transverse walls. The shAAA isolate was identified as Alternaria brassicicola , with colonies appearing gray to dark brown on PDA culture medium. The hyphae of this fungus are brown and septate, while the conidia are produced in chains. Isolate sh20b, recognized as Trichoderma viride , has colonies that range from dark green to light green. Its thin walled hyphae are typically brown to dark green, with conidia generally produced in chains. sh49b was identified as Fusarium oxysporum , with colonies that are white to light pink in PDA (Potato Dextrose Agar) culture medium. The hyphae of this fungus are narrow and septate, and forming a network; macroconidia and microconidia are produced in CLA (Carnation Leaf Agar) culture medium. Finally, isolate shA03, known as Penicillium simplicissimum , colonies that range from light green to dark green, with narrow hyphae forming a network, and the surface of the colonies is fluffy and hairy. Table 2 GenBank accession numbers for partial ITS and TEF1-α sequences of reference species used in phylogenetic analyses: marked taxa(∞) were utilized for partial sequencing of β-tubulin Isolate GenBank Accession Numbers Closest related species Percentage of similarity ITS TEF1-α/ beta- tubulin SH4 PV926797 Fusarium clavum 100 SH23 PV927073 Alternation alternata 100 SH74 PV929796 Alternaria tenuissima 100 SH51k PV929794 Fusarium nygamai 99 SH672A PV927074 Aspergillus flavus ∞ 100 SH20A PV927075 Alternaria solani 100 SH25 PV927076 Alternaria longipes 100 SHA03 PV927077 Penicillium simplicissimum ∞ 100 SH99 PV931816 Fusarium poae 99 SHGG PV927079 Fusarium graminearum 100 SH72 PV927078 Penicillium chrysogenum∞ 100 SH78 PV929795 Fusarium acuminatum 100 SH672 PV929762 Trichoderma harzianum 100 SH166 PV927080 Fusarium solani 98 SH49 PV927081 Fusarium verticillioides 100 SH4A PV927082 Macrophomina phaseolina 100 SHAAA PV927084 Alternaria brassicicola 100 SH20B PV927104 Trichoderma viride 100 SHAA PV927106 Fusarium proliferatum 98 SH49B PV927107 Fusarium oxysporum 100 Discussion Orobanche spp. has been identified as a host of endophytes with L-asparaginase activities, which is essential for tumor control. This is the first report of L-asparaginase-producing fungal endophytes for Orobanche species. The results of this study supports the hypothesis that this plant can serve as a potential host for endophytes with medicinal properties. Although we did not confirm whether this results from the co-evolution of the host plant with endophytes, many studies have observed similar trends. Thus, this hypothesis remains strong, as suggested in various sources (Hatamzadeh et al. 2020 ). In the plate test, L-asparaginase-producing endophytes were identified by the formation of a pink area around the colonies. This enzyme increases the pH of the culture medium by decomposing L-asparagine into ammonia. This change in pH can be detected using phenol red, which acts as a pH indicator (Van Trimpont et al. 2022 ). The isolates that were unable to produce the L-asparaginase enzyme maintained yellow color of the agar medium. The correlation coefficient (r), used to examine the relationship between the diameter of the pink area and asparaginase activity, indicated that there is no significant correlation between these two variables (Shrivastava et al. 2016 ). This result has also been confirmed in many other studies. For this reason, screening tests are typically combined with quantitative assays to enable the selection of positive isolates from the initial test that show greater potential for future studies. Species of Alternaria, Fusarium, Penicillium and Trichoderma are well-established as reliable producers of a variety of bioactive compounds, including alkaloids and antibiotics. However, information regarding the production of L-asparaginase by these endophytes remains unavailable (Elgorban et al. 2019 ). In this study, we include L-asparaginase production in the list of compounds produced by these species. In particular, Fusarium proliferatum (shAA), which is recognized as one of the best producers of this enzyme from Orobanche spp., is of interest. The production of L-asparaginase enzyme is recognized as a common characteristic in different Fusarium species. This enzyme has been identified in species such as F. proliferatum , F. fujikuroi , F. oxysporum and F. verticillioides from various plants, especially from the Asteraceae family, including Anthemis altissima and Achillea millefolium , as well as from medicinal plants known for their anticancer properties (Elshafei and El-Ghonemy 2015 , Hatamzadeh et al. 2020 ). Various values of L-asparaginase activity from different Fusarium isolates have been reported, ranging from 0.308 to 2.071 units/ml, and these values are consistent with previous reports that ranged from 0.08 to 3.14 units/ml (Hatamzadeh et al. 2020 ). ). Several other studies have further confirmed robust L-asparaginase activities in Fusarium species (Bhavana et al. 2019 , 2020 Chua et al. 2024 ). In this research, Fusarium proliferatum was identified as the best producer of L-asparaginase, with an activity level reaching 3.1 units/ml. The bioactive activity of L-asparaginases produced by endophytes can be tested against various types of cancer cell lines to determine their potential as anticancer agents. Therefore, we suggest that this type of analysis should be considered in future research. Conclusion The Orobanche spp. is recognized as a host for various species of fungal endophytes capable of producing L-asparaginase. Among these isolates, a significant number of Fusarium species have demonstrated L-asparaginase activities. In particular, Fusarium proliferatum (shaa) exhibited the highest level of activity, which is reported for the first time in this study. In the future, there is potential for isolating and purifying various compounds to investigate the potential and antitumor activities of L-asparaginase. The results of this research can serve as a fundamental basis for further studies in the field of endophytic bioactivity of the Orobanche spp. These findings may also contribute to the discovery and development of new drugs for anti-tumor treatments. Declarations Funding statement: This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. However, the authors acknowledge the support provided by the University of Zanjan through access to laboratory facilities, greenhouse resources, and other research facilities. Data availability statement: "The datasets generated and/or analyzed during the current study are available in GenBank, with the corresponding accession numbers provided in Table 2." Author Contribution R.G. has conducted the laboratory experiments, and she also has written the manuscript, and R.H. has supervised this project. Both writers reviewed the manuscript. References Abang M M, Bayaa B, Abu-Irmaileh B, Yahyaoui A(2007) A participatory farming system approach for sustainable broomrape (Orobanche spp.) management in the Near East and North Africa. Crop Protection. 26(12):1723-32. https://doi.org/10.1016/j.cropro.2007.03.005 Ahmad I, del Mar Jiménez-Gasco M, Luthe D S, Shakeel S N, Barbercheck M E(2020) Endophytic metarhizium robertsii promotes maize growth, suppresses insect growth, and alters plant defense gene expression. Biological Control. 1;144:104167. https://doi.org/10.1016/j.biocontrol.2019.104167 Ancheeva E, Daletos G, Proksch P(2020) Bioactive secondary metabolites from endophytic fungi. Current medicinal chemistry. 11:1836-54. https://doi.org/10.1016/B978-0-444-63601-0.00005-3 Asthana N, Azmi W(2003) Microbial L-asparaginase: a potent antitumour enzyme. Indian J Biotechnol. 2:184-94. Bhavana N S, Prakash H S, Nalini M S (2019) Antioxidative and L-asparaginase potentials of fungal endophytes from Rauvolfia densiflora (Apocynaceae), an ethnomedicinal species of the western ghats. Czech Mycology. 1;7(2). https://doi.org/10.33585/cmy.71205 Bhavana N S, Prakash H S, Nalini M S (2020) Fungal Endophytes from Tabernaemontana heyneana Wall.(Apocynaceae), their Molecular Characterization, L-asparaginase and Antioxidant Activities. Jordan Journal of Biological Sciences. 1;13(4). Chow Y, Ting A S (2015) Endophytic L-asparaginase-producing fungi from plants associated with anticancer properties. Journal of Advanced Aesearch. 1;6(6):869-76. https://doi.org/10.1016/j.jare.2014.07.005 Chow Y, Ting A S(2015) Endophytic L-asparaginase-producing fungi from plants associated with anticancer properties. Journal of advanced research. 1;6(6):869-76. https://doi.org/10.1016/j.jare.2014.07.005 Chua R W, Song K P, Ting A S(2024) Antioxidant and L-asparaginase activities of culturable endophytic fungi from ornamental Dendrobium orchids. Letters in Applied Microbiology. 77(3):ovad096 Elgorban A M, Bahkali A H, Al Farraj D A, Abdel-Wahab M A (2019 ) Natural products of Alternaria sp., an endophytic fungus isolated from Salvadora persica from Saudi Arabia. Saudi journal of biological sciences. Jul 1;26(5):1068-77. https://doi.org/10.1016/j.sjbs.2018.04.010 Elshafei A M, El-Ghonemy D H ( 2015) Screening and media optimization for enhancing L-asparaginase production, an anticancer agent, from different filamentous fungi in solid state fermentation. British Biotechnology Journal. 10;9(3):1-5. Gao W, Wang Y S, Qu ZY, Hwang E, Ngo H T, Wang Y P, Bae J, Yi T H (2018) Orobanche cernua loefling attenuates ultraviolet B‐mediated photoaging in human dermal fibroblasts. Photochemistry and Photobiology.94(4):733-43. Hashem A H, Attia M S, Kandil E K, Fawzi M M, Abdelrahman A S, Khader M S, Khodaira M A, Emam A E, Goma M A, Abdelaziz A M(2023) Bioactive compounds and biomedical applications of endophytic fungi: a recent review. Microbial Cell Factories. 6;22(1):107. Hatamzadeh S, Rahnama K, Nasrollahnejad S, Fotouhifar K B, Hemmati K, White J F, Taliei F( 2020) Isolation and identification of L-asparaginase-producing endophytic fungi from the Asteraceae family plant species of Iran. 14;8:e8309. https://doi.org/ 10.7717/peerj.8309 Havana N S, Prakash H S, Nalini MS(2019 ) Antioxidative and L-asparaginase potentials of fungal endophytes from Rauvolfia densiflora (Apocynaceae), an ethnomedicinal species of the Western Ghats. Czech Mycology. 1;7(2). https://doi.org/10.33585/cmy.71205 Manasa C, Nalini M S (2014) L‐Asparaginase Activity of Fungal Endophytes from Tabernaemontana heyneana Wall.(Apocynaceae), Endemic to the Western Ghats (India). International scholarly research notices. (1):925131. Moubasher H A, Balbool B A, Helmy Y A, Alsuhaibani A M, Atta A A, Sheir D H, Abdel-Azeem A M(2022) Insights into asparaginase from endophytic fungus Lasiodiplodia theobromae: purification, characterization and antileukemic activity. International journal of Environmental Research and Public Health. 7;19(2):680. Piwowarczyk R, Madeja J, Nobis M(2015) Pollen morphology of the Central european broomrapes (Orobanchaceae: Orobanche, Phelipanche and Orobanchella) and its taxonomical implications. Plant Systematics and Evolution. 301:795-808. Qu Z Y, Zhang Y W, Yao C L, Jin Y P, Zheng P H, Sun C H, Liu J X, Wang, Y S, Wang Y P(2015) Chemical constituents from Orobanche cernua Loefling. Biochemical Systematics and Ecology. 1;60:199-203. https://doi.org/10.1016/j.bse.2015.04.028 Rana K L, Kour D, Sheikh I, Yadav N, Yadav A N, Kumar V, Singh B P, Dhaliwal H S, Saxena AK(2019) Biodiversity of endophytic fungi from diverse niches and their biotechnological applications. Advances in endophytic fungal research: present status and future challenges. 105-44. https://doi.org/10.1007/978-3-030-03589-1_6 Sarquis M I, Oliveira E M, Santos A S, Costa GL( 2004 ) Production of L-asparaginase by filamentous fungi. Memorias do Instituto Oswaldo Cruz..99:489-92. Shrivastava A, Khan AA, Khurshid M, Kalam MA, Jain SK, Singhal PK( 2016) Recent developments in L-asparaginase discovery and its potential as anticancer agent. Critical reviews in oncology/hematology. 1;100:1-0. Strobel G, Daisy B(2003) Bioprospecting for microbial endophytes and their natural products. Microbiology and molecular biology reviews. 4:491-502. https://doi.org/10.1128/MMBR.67.4.491–502.2003 Tan ML, Sulaiman SF, Najimuddin N, Samian MR, Tengku Muhammad TS (2005) Methanolic extract of Pereskia bleo (Kunth) DC. (Cactaceae) induces apoptosis in breast carcinoma, T47-D cell line. J Ethnopharmacol.96:287–94. https://doi.org/10.1016/j.jep.2004.09.025 Theantana T, Hyde KD, Lumyong S(2009) Asparaginase production by endophytic fungi from Thai medicinal plants: cytotoxicity properties. Int J Integr Biol.7:1–8. Van Trimpont M, Peeters E, De Visser Y, Schalk AM, Mondelaers V, De Moerloose B, Lavie A, Lammens T, Goossens S, Van Vlierberghe P( 2022) Novel insights on the use of L-asparaginase as an efficient and safe anti-cancer therapy. Cancers. 11;14(4):902. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7090039","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":504188592,"identity":"08fd91e3-d4a3-4e6b-887e-757dde84bfbc","order_by":0,"name":"Robabeh Gholizadeh","email":"","orcid":"","institution":"University of Zanjan","correspondingAuthor":false,"prefix":"","firstName":"Robabeh","middleName":"","lastName":"Gholizadeh","suffix":""},{"id":504188593,"identity":"9fb53cc0-fd4b-4b5f-bbbf-035c6617c5f4","order_by":1,"name":"Roghayeh Hemmati","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYDACCQgpB+PzEKklQcKYZC0MiQ1Eu8t8dvPRDT9/WKTPn91jwPCjhkHGnJBmmTvH0m72JEjkNs45Y8DYc4yBR+YAIXdJ5Jjd4AFqaZbIMWDgbWDgkSDkMAmJ/G83/yRIpLMBtTD+JU5LDtttoC0JPEAtzETakmZ2WyZNwnCGRFrBYZljEsRoSX52841Nnbz8jOSND9/U2NgT1IICDsASwygYBaNgFIwCCgEAJoczSJoVsLgAAAAASUVORK5CYII=","orcid":"","institution":"University of Zanjan","correspondingAuthor":true,"prefix":"","firstName":"Roghayeh","middleName":"","lastName":"Hemmati","suffix":""}],"badges":[],"createdAt":"2025-07-10 07:23:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7090039/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7090039/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90168909,"identity":"406f4e53-bf2c-4d01-9758-89ebee6c96c9","added_by":"auto","created_at":"2025-08-29 10:52:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":155876,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eFungal endophytes producing L-asparaginase were identified based on the formation of pink area (A) and the endophyte with the highest enzyme activity along with L-asparaginase control (B). The cultures were 5 days old.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7090039/v1/e678b5b14f5d969931cae813.png"},{"id":90168913,"identity":"6f41c4b2-b842-4cfe-88e9-d86496581727","added_by":"auto","created_at":"2025-08-29 10:52:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":28229,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eL-asparaginase activities of fungal endophytes isolated from Orobanche spp. One-way ANOVA and Tukey’s HSD test were employed. Means with different letters are significantly different at P \u0026lt; 0.05. Error bars represent the standard deviation values of the mean\u003c/em\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7090039/v1/895a4e12d05968ba669aeeea.png"},{"id":92839611,"identity":"19deb2fb-c8d4-4591-a5f0-2019417ef075","added_by":"auto","created_at":"2025-10-06 08:39:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":773996,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7090039/v1/8a7b430f-3c34-45f9-9bef-04b339e9c741.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"L- Asparaginase activity of endophytic fungi isolated from Orobanche spp. In Iran","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe endophytic fungi are fungi colonizing the intercellular and intracellular spaces of the host plant tissue without causing harm to the host plants. These fungi naturally exist in the plant tissues and do not show any apparent pathological symptoms. The compounds produced by the plant, such as flavonoids and phenols, attract fungi present in the rhizosphere to penetrate into plant tissues (Ahmad et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). To maintain a stable symbiotic relationship, endophytic fungi produce a diverse array of secondary metabolites. These fungi, due to their remarkable biosynthetic capabilities,, are now considered as a rich source of new natural molecules with wide applications in health and medicine (Strobel and daisy \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Among these are the alkaloids, flavonoids, quinones, steroids, and terpenoids. Recently, endophytic fungi have been considered as one of the strong focuses in research over a considerable period for their potential as candidates for newer and sustainable antibiotics, antioxidants, anti-tumour and antiviral agents ( Hashem et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). These fungi are also known as potential sources for producing various enzymes applied in industries and the health sectors. Lactase, lipase, pectinase, amylase, and protease are just a few examples of enzymes from these types of fungi. Due to their natural and robust nature, enzymes extracted from these fungi find application in various industries, importantly in the pharmaceutical industry (Ancheeva et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eL-asparaginase is a key drug in the treatment of acute lymphoblastic leukemia (ALL). It depletes leukemic cells of an essential nutrient by converting L-asparagine into ammonia and L-aspartate (Moubasher et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). L-asparagine is essential for the growth and dissemination of leukemic cells, but when assayed through L- asparaginase, it decreases concentration in blood which prevent cancerous cell ahead-running. Researchers discovered the enzyme in guinea pig serum. After observing its ability to combat leukemia in laboratory, mice medical professionals received approval to use it to treat childhood acute lymphoblastic leukemia (Asthana and Azmi \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Doctors rely on L-asparaginase from E. coli, but its bacterial origin may lead to some undesirable side effects. To solve this issue, scientists recommend using L-asparaginase from fungi. Because fungi are eukaryotes like humans and their enzymes might be gentler for patients. Some plant species with cancer-fighting qualities also contain asparaginase enzymes produced by fungi that live within them (Bahavana and Prakash 2019). Sarquis (2004) reported the production of this enzyme from fungi such as Penicillium, Aspergillus, Fusarium, and some yeast species. Manasa (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) screened various endophytic fungi including Fusarium, Alternaria, Cladosporium, Phoma, Curvularia, and Pimpenellae isolated from the medicinal plant thyme for the production of L-asparaginase enzyme and observed satisfactory results.\u003c/p\u003e\u003cp\u003eOrobanche spp. is a fleshy-stemmed holoparasitic plant about 20\u0026ndash;30 cm tall with scale-like leaves without roots. it is a root parasite which means that all of its nutrients come directly from the host plants. There are about 133 species of broomrape in the world, which mostly hail from the Middle East and Mediterranean region (Piwowarczyk et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). It is native to 80 countries, especially in Mediterranean climates and similar regions such as California or right under Tropic of Cancer such as Western Australia (Piwowarczyk et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This species of broomrape is a heavy seed producer, generating as many as 250,000 seeds per plant and wreaking havoc on vegetable and fruit crops over an estimated agricultural area equivalent to about 4 or even more likely at least 5 percent. Those seeds germinate when they detect the exudates emitted from roots of host plants (Abang et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). In Europe, America, and Asia, on the other hand, certain broomrape types are used for medicinal purposes to cure ailments such as skin ulcers and diarrhea in infants. In addition, they are taken as nutritious vegetables with great economic importance in the United States; however, their cultivation has been opposed due to product contamination (Qu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). From this plant, compounds like phenylthanoic glycosides, steroids, terpenoids, and alkaloids have been isolated (Gao 2018). There is no report of studying the potential of endophytic fungi from broomrape for the production of L-asparaginase.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eSeparation of Endophytic Fungi\u003c/p\u003e\u003cp\u003eDuring the summer of 2023, 300 samples of healthy plants of Orobanche spp, were collected from the summer fields of North West Iran. To isolate endophytic fungi, each sample was first washed with tap water to separate soil particles attached to the roots and then its whole stem including flowers, were cut in five mm pieces, individually surface-disinfested by immersing them in a solution of 1% sodium hypochlorite to remove epiphytic microorganisms and rinsed with sterilized water. After drying on sterile filter paper, the pieces were put on PDA (Potato Dextrose Agar) containing streptomycin sulphate (20 mg/L) and incubated at 25 \u0026ordm;C and darkness for 20 days (Theantana et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIdentification and screening of endophytes that produce L-asparaginase.\u003c/p\u003e\u003cp\u003eModified Czapek Dox agar (McDox) was used to investigate fungi for the production of L-asparaginase. For this experiment, a 5-mm mycelial plug of the fungus was inoculated onto the McDox medium containing agar powder (20 g/L), glucose (2 g/L), L-asparagine (10 g/L), KH₂PO₄ (1.52 g/L), KCl (0.52 g/L), MgSO₄7H₂O (0.52 g/L), Cu(NO₃)₂\u0026middot;3H₂O (0.001 g/L), ZnSO₄7H₂O (0.001 g/L), and FeSO₄7H₂O ( 0.001 g/L). In addition, 0.3 mL of 2.5% phenol red dye was added to the medium as an indicator. Controls were prepared by inoculating mycelial plugs onto McDox agar without L-asparagine. All plates were incubated at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for 5 days. After the incubation period, the diameter of the pink zone that indicates L-asparaginase production was measured. The above-mentioned method helps in determination and screening of the potential of fungi regarding the production of L-asparaginase, which could be useful in further studies (Chow and Ting \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eInvestigating the function of L-Asparaginase enzyme in selected endophytes\u003c/p\u003e\u003cp\u003eThe selected fungal isolates were cultured in 30 ml of McDox broth medium for five consecutive days at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C with shaking conditions at a speed of 120 rpm. A volume of 100 microliters of the culture medium containing the enzyme was extracted and transferred to the microcentrifuge tubes. For the preparation of test, 100 \u0026micro;l Tris HCl buffer (pH 7.2), 200 \u0026micro;l asparagine solution (0.04 M) and 100 \u0026micro;l sterile distilled water was added to the sample. The mixture was incubated at 37\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for one hour. The reaction was stopped by adding 100 \u0026micro;l of trichloroacetic acid (TCA) at a final concentration of 1.5 M. Thereafter, 100 \u0026micro;l of the mixture was added to new tubes with 750 \u0026micro;l of sterile distilled water and 300 \u0026micro;l of Nessler's reagent. After incubating the tube mixtures for 20 min at 2\u0026thinsp;\u0026plusmn;\u0026thinsp;28\u0026deg;C, absorbance was measured at a wavelength of 450 nm. A unit of L-asparaginase activity is defined as the amount of enzyme that catalyzes the production of 1 \u0026micro;l of ammonia per minute at 37\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C (Tan et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eStatistical evaluation\u003c/p\u003e\u003cp\u003eThis experiments were conducted as a completely randomized design (CRD) and with three replications for each of the investigated parameters The data were statistically analyzed using the software Statistical Package for the Social Sciences (SPSS) version 20.0. To analyze the data, one-way analysis of variance (ANOVA) along with Tukey's mean comparison test (Tukey's HSD) was used at a significance level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003eIdentification of L-asparaginase-generating endophytic species\u003c/p\u003e\u003cp\u003eGenomic DNA extraction was performed using a modified CTAB method based on the protocol of ( Doyle et al. 1990). Fungal mycelia were collected and ground after growing in PDB liquid culture medium for one week (120 rpm). DNA extraction was done using CTAB buffer containing 2-mercaptoethanol. The samples were incubated for 45 minutes at 65\u0026deg;C. To remove proteins, chloroform-isoamyl alcohol mixture (24:1) was used. After centrifugation (12000 rpm for 10 minutes), the aqueous phase was separated and DNA was precipitated with cold isopropanol. After washing with 70% ethanol, the DNA precipitate was dissolved in 70 microliters of distilled water. Polymerase chain reaction (PCR) for genomic DNA amplification with a 25 \u0026micro;l reaction mixture containing 1 \u0026micro;l of each primer ITS1 (5'- TCCGTAGGTGAACCTGCGG-3'), ITS4 (3'-TCCTCCGCTTATTGATATGC-5') and TEF1-α (EF1 GAYTTCATCAAGAACATGAT), (EF2GACGTTGAADCCRACRTTGTC) β-tubulin (Bt2α GGTAACCAAATCGGTGCTGCTTTC), (Bt2b ACCCTCAGTGACCCTTGG), 2 \u0026micro;l of genomic DNA (40 ng ), 12.5 microliters of Mix Master amplicon Red x2 and 8.5 microliters of double distilled water. became. The PCR program consisted of initial denaturation at 95\u0026deg;C for 5 min, 35 cycles with denaturation (95\u0026deg;, 30 s), primer annealing (50\u0026ndash;65\u0026deg;, 30 s) and extension (72\u0026deg;, 55 s), and final extension. It was at 72 degrees for 10 minutes. PCR products were electrophoresed on 1% agarose gel, stained with Gel Red and imaged by Gel Documentation system (Chow and Ting \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Sequencing was done by Sanger method in Macrogen (South Korea) and the sequences were edited with ChromasPro software and analyzed by BLAST in NCBI. The final sequences were registered in GenBank and the accession number was obtained (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://blast.ncbi.nlm.nih.gov/BLAST.cgi\u003c/span\u003e\u003cspan address=\"http://blast.ncbi.nlm.nih.gov/BLAST.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIsolation of endophytes\u003c/p\u003e\u003cp\u003eIn this study, 300 samples of \u003cem\u003eOrobanche\u003c/em\u003e spp were transferred to the laboratory and the stem and flower parts were separated from each other and each was cultivated separately. 83 isolates were isolated from the stem and 42 isolates were isolated from the flower. The isolates were divided into 34 morphotypes, each morphotype having similar morphological characteristics. For futher experiments, representative of the morphotypes were used.\u003c/p\u003e\u003cp\u003eIdentification of L-asparaginase producing endophytes and their activities\u003c/p\u003e\u003cp\u003eFrom a total of 34 endophytes (morphotypes), 20 morphotypes were able to produce L-asparaginase. For these positive isolates, the formation of a pink zone was clearly observed, which was the result of L-asparaginase production by the endophytes. This enzyme hydrolyzes asparagine to aspartic acid and ammonia, and as a result, the color of the phenol red indicator changes from yellow (in acidic conditions) to pink (in alkaline conditions) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Each of the morphotypes produced different sizes of pink area diameter, which ranged from 0.3 to 3.50 cm and the median was 1.4 cm. Positive endophytes produced asparaginase activity in the range of 0.701 to 3.10 unit/mL-1 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). among these endophytes, four were identified as endophytes with high asparaginase activity (1.50\u0026ndash;3.10 unit/mL-1). while 16 endophytes (sh4, sh23, sh74, sh51k, sh672A, sh20B, sh25, shA03, sh99, shGG, sh672B, sh166, sh49, sh4A, sh72, sh78) had relatively high asparaginase activity (0.701\u0026ndash;0.980 unit/mL-1) ( Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Isolates shAAA and shAA extracted from the stem of \u003cem\u003eOrobanche\u003c/em\u003e spp. are among the 20 identified endophytes with high L-asparaginase activities. In contrast, shGG and SH672B, which were isolated from flower parts, showed the lowest L-asparaginase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These results clearly indicate the existence of a specific trend in the production of L-asparaginase enzyme in different parts of plants.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAsparaginase activities (mL⁻\u0026sup1;\u0026middot;min⁻\u0026sup1;) of 20 fungal endophytes isolated from Orobanche spp. Mean and standard deviation are provided. Means with different letters indicate statistically significant differences as determined by Tukey's Studentized Range Test (HSD0.05).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePlant host\u003c/p\u003e\u003cp\u003eOrobanche spp\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eEndophytic isolate\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMean asparaginase\u003c/p\u003e\u003cp\u003eactivity\u003c/p\u003e\u003cp\u003e(mL⁻\u0026sup1;\u0026middot;min⁻\u0026sup1;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eStandard\u003c/p\u003e\u003cp\u003edeviation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTukey\u003c/p\u003e\u003cp\u003egrouping\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.85\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0/5727\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ebc\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.824\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0/5190\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003edf\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0/5515\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ebk\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH51k\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.839\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.5918\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003etu\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH672A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.932\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6519\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIm\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH20A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.7764\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ekf\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.955\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6752\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ebn\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSHA03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.724\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.5062\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ekn\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.809\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.5685\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ebm\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSHGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.746\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.5275\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003egm\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6887\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ers\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6286\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003erm\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH672\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.701\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.4730\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003egz\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6229\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003egn\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.93\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.6576\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003efm\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH4A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.833\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.5854\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ebg\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSHAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e2.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.9671\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003enb\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH20B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.060\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003esh\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSHAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e2.1778\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003evb\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSH49B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1.3194\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eIp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eIn this study, a simple regression analysis was conducted to examine the correlation between two testing methods: qualitative (measurement of pink area diameter) and quantitative (activities of L-asparaginase). The results of this analysis indicate that the correlation coefficient (r) is equal to 0.37, which suggests a weak relationship between the diameter of the pink areas on the agar plates and the quantitative activities of L-asparaginase. Additionally, the reported p\u0026thinsp;\u0026lt;\u0026thinsp;0.25 indicates that this coefficient is not significantly different from zero. These results are in agreement with previous observations, which show that among 20 positive endophytes, 5 had high L-asparaginase activities, but there was no significant correlation with the diameter of the pink areas. Isolate shaa, with the highest L-asparaginase activity of (3.1 unit/mL-1) had a diameter of 1.8 cm, while the sh4a, with a diameter of 3.50 cm, has only 0.850 unit/mL-1 L-asparaginase activity.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eCharacterization of endophytes that produce L-asparaginase\u003c/p\u003e\u003cp\u003eThe identification of L-asparaginase-producing endophytes was based on the sequencing results of 20 selected isolates, which were analyzed using the sequences retrieved from the NCBI database. 20 endophytes producing L-asparaginase were identified as species belonging to \u003cem\u003eFusarium\u003c/em\u003e (2 morphotype), \u003cem\u003ePenicillium\u003c/em\u003e (2 morphotype), \u003cem\u003eTrichoderma\u003c/em\u003e (2 morphotype), \u003cem\u003eAlternaria\u003c/em\u003e (4 morphotype), \u003cem\u003eAspergillus\u003c/em\u003e (2 morphotype) and \u003cem\u003eMacrophomina\u003c/em\u003e (1 morphotype) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The morphological appearance and characteristics of the colonies of five fungi producing active L-asparaginase are as follows: ShAA isolate, identified as \u003cem\u003eFusarium proliferatum\u003c/em\u003e, has light purple colonies in PDA culture medium. The hyphae of this isolate were sparse, its macroconidia are thick-walled and elongated, while microconidia are club-shaped and lack transverse walls. The shAAA isolate was identified as \u003cem\u003eAlternaria brassicicola\u003c/em\u003e, with colonies appearing gray to dark brown on PDA culture medium. The hyphae of this fungus are brown and septate, while the conidia are produced in chains. Isolate sh20b, recognized as \u003cem\u003eTrichoderma viride\u003c/em\u003e, has colonies that range from dark green to light green. Its thin walled hyphae are typically brown to dark green, with conidia generally produced in chains. sh49b was identified as \u003cem\u003eFusarium oxysporum\u003c/em\u003e, with colonies that are white to light pink in PDA (Potato Dextrose Agar) culture medium. The hyphae of this fungus are narrow and septate, and forming a network; macroconidia and microconidia are produced in CLA (Carnation Leaf Agar) culture medium. Finally, isolate shA03, known as \u003cem\u003ePenicillium simplicissimum\u003c/em\u003e, colonies that range from light green to dark green, with narrow hyphae forming a network, and the surface of the colonies is fluffy and hairy.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eGenBank accession numbers for partial ITS and TEF1-α sequences of reference species used in phylogenetic analyses: marked taxa(\u0026infin;) were utilized for partial sequencing of β-tubulin\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eIsolate\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGenBank Accession Numbers\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eClosest related species\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ePercentage of\u003c/p\u003e\u003cp\u003esimilarity\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eITS TEF1-α/ beta- tubulin\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV926797\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium clavum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927073\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAlternation alternata\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV929796\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAlternaria tenuissima\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH51k\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV929794\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium nygamai\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH672A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927074\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAspergillus flavus \u0026infin;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH20A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927075\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAlternaria solani\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927076\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAlternaria longipes\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHA03\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927077\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003ePenicillium simplicissimum \u0026infin;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV931816\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium poae\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927079\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium graminearum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH72\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927078\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003ePenicillium chrysogenum\u0026infin;\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV929795\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium acuminatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH672\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV929762\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eTrichoderma harzianum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927080\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium solani\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927081\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium verticillioides\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH4A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927082\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eMacrophomina phaseolina\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHAAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927084\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eAlternaria brassicicola\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH20B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927104\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eTrichoderma viride\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927106\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium proliferatum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSH49B\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePV927107\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cem\u003eFusarium oxysporum\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOrobanche spp. has been identified as a host of endophytes with L-asparaginase activities, which is essential for tumor control. This is the first report of L-asparaginase-producing fungal endophytes for Orobanche species. The results of this study supports the hypothesis that this plant can serve as a potential host for endophytes with medicinal properties. Although we did not confirm whether this results from the co-evolution of the host plant with endophytes, many studies have observed similar trends. Thus, this hypothesis remains strong, as suggested in various sources (Hatamzadeh et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the plate test, L-asparaginase-producing endophytes were identified by the formation of a pink area around the colonies. This enzyme increases the pH of the culture medium by decomposing L-asparagine into ammonia. This change in pH can be detected using phenol red, which acts as a pH indicator (Van Trimpont et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The isolates that were unable to produce the L-asparaginase enzyme maintained yellow color of the agar medium. The correlation coefficient (r), used to examine the relationship between the diameter of the pink area and asparaginase activity, indicated that there is no significant correlation between these two variables (Shrivastava et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This result has also been confirmed in many other studies. For this reason, screening tests are typically combined with quantitative assays to enable the selection of positive isolates from the initial test that show greater potential for future studies. Species of \u003cem\u003eAlternaria, Fusarium, Penicillium\u003c/em\u003e and \u003cem\u003eTrichoderma\u003c/em\u003e are well-established as reliable producers of a variety of bioactive compounds, including alkaloids and antibiotics. However, information regarding the production of L-asparaginase by these endophytes remains unavailable (Elgorban et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this study, we include L-asparaginase production in the list of compounds produced by these species. In particular, \u003cem\u003eFusarium proliferatum\u003c/em\u003e (shAA), which is recognized as one of the best producers of this enzyme from Orobanche spp., is of interest. The production of L-asparaginase enzyme is recognized as a common characteristic in different Fusarium species. This enzyme has been identified in species such as \u003cem\u003eF. proliferatum\u003c/em\u003e, \u003cem\u003eF. fujikuroi\u003c/em\u003e, \u003cem\u003eF. oxysporum\u003c/em\u003e and \u003cem\u003eF. verticillioides\u003c/em\u003e from various plants, especially from the Asteraceae family, including \u003cem\u003eAnthemis altissima\u003c/em\u003e and \u003cem\u003eAchillea millefolium\u003c/em\u003e, as well as from medicinal plants known for their anticancer properties (Elshafei and El-Ghonemy \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Hatamzadeh et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Various values of L-asparaginase activity from different \u003cem\u003eFusarium\u003c/em\u003e isolates have been reported, ranging from 0.308 to 2.071 units/ml, and these values are consistent with previous reports that ranged from 0.08 to 3.14 units/ml (Hatamzadeh et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). ). Several other studies have further confirmed robust L-asparaginase activities in \u003cem\u003eFusarium\u003c/em\u003e species (Bhavana et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2020\u003c/span\u003e Chua et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In this research, \u003cem\u003eFusarium proliferatum\u003c/em\u003e was identified as the best producer of L-asparaginase, with an activity level reaching 3.1 units/ml. The bioactive activity of L-asparaginases produced by endophytes can be tested against various types of cancer cell lines to determine their potential as anticancer agents. Therefore, we suggest that this type of analysis should be considered in future research.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe \u003cem\u003eOrobanche\u003c/em\u003e spp. is recognized as a host for various species of fungal endophytes capable of producing L-asparaginase. Among these isolates, a significant number of \u003cem\u003eFusarium\u003c/em\u003e species have demonstrated L-asparaginase activities. In particular, \u003cem\u003eFusarium proliferatum\u003c/em\u003e (shaa) exhibited the highest level of activity, which is reported for the first time in this study. In the future, there is potential for isolating and purifying various compounds to investigate the potential and antitumor activities of L-asparaginase. The results of this research can serve as a fundamental basis for further studies in the field of endophytic bioactivity of the \u003cem\u003eOrobanche\u003c/em\u003e spp. These findings may also contribute to the discovery and development of new drugs for anti-tumor treatments.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding statement:\u003c/h2\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. However, the authors acknowledge the support provided by the University of Zanjan through access to laboratory facilities, greenhouse resources, and other research facilities.\u003c/p\u003e\n\u003cp\u003eData availability statement:\u003c/p\u003e\n\u003cp\u003e\u0026quot;The datasets generated and/or analyzed during the current study are available in GenBank, with the corresponding accession numbers provided in Table\u0026nbsp;2.\u0026quot;\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eR.G. has conducted the laboratory experiments, and she also has written the manuscript, and R.H. has supervised this project. Both writers reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eAbang M M, Bayaa B, Abu-Irmaileh B, Yahyaoui A(2007) A participatory farming system approach for sustainable broomrape (Orobanche spp.) management in the Near East and North Africa. Crop Protection. 26(12):1723-32.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.cropro.2007.03.005\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eAhmad I, del Mar Jim\u0026eacute;nez-Gasco M, Luthe D S, Shakeel S N, Barbercheck M E(2020) Endophytic metarhizium robertsii promotes maize growth, suppresses insect growth, and alters plant defense gene expression. Biological Control. 1;144:104167.\u003c/em\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u0026nbsp;\u003c/span\u003e\u003cem\u003ehttps://doi.org/10.1016/j.biocontrol.2019.104167\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eAncheeva E, Daletos G, Proksch P(2020) Bioactive secondary metabolites from endophytic fungi. Current medicinal chemistry. 11:1836-54.\u0026nbsp;\u003c/em\u003e\u003cem\u003e\u0026nbsp;https://doi.org/10.1016/B978-0-444-63601-0.00005-3\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eAsthana N, Azmi W(2003) Microbial L-asparaginase: a potent antitumour enzyme. Indian J Biotechnol. 2:184-94.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eBhavana N S, Prakash H S, Nalini M \u0026nbsp;S (2019) Antioxidative and L-asparaginase potentials of fungal endophytes from Rauvolfia densiflora (Apocynaceae), an ethnomedicinal species of the western ghats. Czech Mycology. 1;7(2).\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.33585/cmy.71205\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eBhavana N S, Prakash H S, Nalini M S (2020) Fungal Endophytes from Tabernaemontana heyneana Wall.(Apocynaceae), their Molecular Characterization, L-asparaginase and Antioxidant Activities. Jordan Journal of Biological Sciences. 1;13(4).\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eChow Y, Ting A S (2015) Endophytic L-asparaginase-producing fungi from plants associated with anticancer properties. Journal of Advanced Aesearch. 1;6(6):869-76.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.jare.2014.07.005\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eChow Y, Ting A S(2015) Endophytic L-asparaginase-producing fungi from plants associated with anticancer properties. Journal of advanced research. 1;6(6):869-76.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.jare.2014.07.005\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eChua R W, Song K P, Ting A S(2024) Antioxidant and L-asparaginase activities of culturable endophytic fungi from ornamental Dendrobium orchids. Letters in Applied Microbiology. 77(3):ovad096\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eElgorban A M, Bahkali A H, Al Farraj D A, Abdel-Wahab M A\u003c/em\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/em\u003e\u003cem\u003e(2019 ) Natural products of Alternaria sp., an endophytic fungus isolated from Salvadora persica from Saudi Arabia. Saudi journal of biological sciences. Jul 1;26(5):1068-77.\u003c/em\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u0026nbsp;\u003c/span\u003e\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.sjbs.2018.04.010\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eElshafei A M, El-Ghonemy D H ( 2015) Screening and media optimization for enhancing L-asparaginase production, an anticancer agent, from different filamentous fungi in solid state fermentation. British Biotechnology Journal. 10;9(3):1-5.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eGao W, Wang Y S, Qu ZY, Hwang E, Ngo H T, Wang Y P, Bae J, Yi T H (2018) Orobanche cernua loefling attenuates ultraviolet B‐mediated photoaging in human dermal fibroblasts. Photochemistry and Photobiology.94(4):733-43.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eHashem A H, Attia M S, Kandil E K, Fawzi M M, Abdelrahman A S, Khader M S, Khodaira M A, Emam A E, Goma M A, Abdelaziz A M(2023) Bioactive compounds and biomedical applications of endophytic fungi: a recent review. Microbial Cell Factories. 6;22(1):107.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eHatamzadeh S, Rahnama K, Nasrollahnejad S, Fotouhifar K B, Hemmati K, White J F, Taliei F( 2020) Isolation and identification of L-asparaginase-producing endophytic fungi from the Asteraceae family plant species of Iran. 14;8:e8309.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/ 10.7717/peerj.8309\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eHavana N S, Prakash H S, Nalini MS(2019 ) Antioxidative and L-asparaginase potentials of fungal endophytes from Rauvolfia densiflora (Apocynaceae), an ethnomedicinal species of the Western Ghats. Czech Mycology. 1;7(2).\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.33585/cmy.71205\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eManasa C, Nalini M S (2014) L‐Asparaginase Activity of Fungal Endophytes from Tabernaemontana heyneana Wall.(Apocynaceae), Endemic to the Western Ghats (India). International scholarly research notices. (1):925131.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eMoubasher H A, Balbool B A, Helmy Y A, Alsuhaibani A M, Atta A A, Sheir D H, Abdel-Azeem A M(2022) Insights into asparaginase from endophytic fungus Lasiodiplodia theobromae: purification, characterization and antileukemic activity. International journal of Environmental Research and Public Health. 7;19(2):680.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003ePiwowarczyk R, Madeja J, Nobis M(2015) Pollen morphology of the Central european broomrapes (Orobanchaceae: Orobanche, Phelipanche and Orobanchella) and its taxonomical implications. Plant Systematics and Evolution. 301:795-808.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eQu Z Y, Zhang Y W, Yao C L, Jin Y P, Zheng P H, Sun C H, Liu J X, Wang, Y S, Wang Y P(2015) Chemical constituents from Orobanche cernua Loefling. Biochemical Systematics and Ecology. 1;60:199-203.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.bse.2015.04.028\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eRana K L, Kour D, Sheikh I, Yadav N, Yadav A N, Kumar V, Singh B P, Dhaliwal H S, Saxena AK(2019) Biodiversity of endophytic fungi from diverse niches and their biotechnological applications. Advances in endophytic fungal research: present status and future challenges. 105-44.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1007/978-3-030-03589-1_6\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eSarquis M I, Oliveira E M, Santos A S, Costa GL( 2004 ) Production of L-asparaginase by filamentous fungi. Memorias do Instituto Oswaldo Cruz..99:489-92.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eShrivastava A, Khan AA, Khurshid M, Kalam MA, Jain SK, Singhal PK(\u003c/em\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/em\u003e\u003cem\u003e2016) Recent developments in L-asparaginase discovery and its potential as anticancer agent. Critical reviews in oncology/hematology. 1;100:1-0.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eStrobel G, Daisy B(2003) Bioprospecting for microbial endophytes and their natural products. Microbiology and molecular biology reviews. 4:491-502.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1128/MMBR.67.4.491\u0026ndash;502.2003\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eTan ML, Sulaiman SF, Najimuddin N, Samian MR, Tengku Muhammad TS (2005) Methanolic extract of Pereskia bleo (Kunth) DC. (Cactaceae) induces apoptosis in breast carcinoma, T47-D cell line. J Ethnopharmacol.96:287\u0026ndash;94.\u0026nbsp;\u003c/em\u003e\u003cem\u003ehttps://doi.org/10.1016/j.jep.2004.09.025\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eTheantana T, Hyde KD, Lumyong S(2009) Asparaginase production by endophytic fungi from Thai medicinal plants: cytotoxicity properties. Int J Integr Biol.7:1\u0026ndash;8.\u003c/em\u003e\u003c/li\u003e\n \u003cli dir=\"LTR\"\u003e\u003cem\u003eVan Trimpont M, Peeters E, De Visser Y, Schalk AM, Mondelaers V, De Moerloose B, Lavie A, Lammens T, Goossens S, Van Vlierberghe P(\u003c/em\u003e\u003cem\u003e\u003cspan dir=\"RTL\"\u003e \u003c/span\u003e\u003c/em\u003e\u003cem\u003e2022) Novel insights on the use of L-asparaginase as an efficient and safe anti-cancer therapy. Cancers. 11;14(4):902.\u003c/em\u003e\u003cem\u003e\u003c/em\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Anti-cancer, Broom rape, Enzymes, Fungal endophytes, Fusarium, Trichoderma spp","lastPublishedDoi":"10.21203/rs.3.rs-7090039/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7090039/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eThis research focuses on evaluating endophytes as sources of bioactive compounds to identify microorganisms capable of producing the anti-cancer enzyme L-asparaginase. The plant Orobanche spp. was selected as the host, from which various compounds such as phenylthanoide glycosides, steroids, terpenoids, organic acids and their derivatives, ligands, alkaloids and flavonoids have been extracted. Endophytic fungi were isolated using standard surface sterilization techniques. Initial screening for L-asparaginase production was conducted using a qualitative assay on a modified Czapek dox agar medium. Enzyme production was identified by the formation of pink halos around the fungal colonies on the agar medium. This color change resulted from the hydrolysis of asparagine into aspartic acid and ammonia, which caused the phenol red indicator to shift from yellow (under acidic conditions) to pink (under alkaline conditions). L-asparaginase activity was also quantified using Nessler's method. The results revealed that among 34 identified endophytic morphotypes, 20 exhibited L-asparaginase production, with activities ranging from 0.701 to 3.10 µmol⁻¹ mL⁻¹ min⁻¹Furthermore, four isolates with high L-asparaginase activity were identified, exhibiting activities between 1.50 and 3.10 µmol⁻¹ mL⁻¹ min⁻¹Endophytic fungi were identified based on morphological characteristics and phylogenetic analysis of DNA sequence data, including ribosomal ITS regions and TEF1 genes. The L-asparaginase-producing species belonged to the genera Alternaria, Fusarium, Trichoderma, Penicillium, and Macrophomina. This study demonstrated that endophytic fungi isolated from Orobanche spp. possess a significant capacity for the production of L-asparaginase and can be used as an alternative source for the production of this enzyme on an industrial scale.\u003c/em\u003e\u003c/p\u003e","manuscriptTitle":"L- Asparaginase activity of endophytic fungi isolated from Orobanche spp. In Iran","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-29 10:52:42","doi":"10.21203/rs.3.rs-7090039/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"127ef8c2-e93a-45d4-a762-a8234830d2a3","owner":[],"postedDate":"August 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":53569387,"name":"Biological sciences/Biochemistry"},{"id":53569388,"name":"Biological sciences/Biological techniques"},{"id":53569389,"name":"Biological sciences/Biotechnology"},{"id":53569390,"name":"Biological sciences/Microbiology"},{"id":53569391,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2025-10-06T08:39:36+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-29 10:52:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7090039","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7090039","identity":"rs-7090039","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}