Full text
65,947 characters
· extracted from
preprint-html
· click to expand
A porcine germ cell depletion model to investigate the role of germ cells in gonadal development | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results A porcine germ cell depletion model to investigate the role of germ cells in gonadal development Chi-Hun Park , Young-Hee Jeoung , Sai Goutham Reddy Yeddula , JiTao Wang , Bhanu P. Telugu doi: https://doi.org/10.1101/2025.06.25.661527 Chi-Hun Park 1 Division of Animal Sciences, University of Missouri , Columbia MO 65211 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Young-Hee Jeoung 1 Division of Animal Sciences, University of Missouri , Columbia MO 65211 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sai Goutham Reddy Yeddula 1 Division of Animal Sciences, University of Missouri , Columbia MO 65211 Find this author on Google Scholar Find this author on PubMed Search for this author on this site JiTao Wang 1 Division of Animal Sciences, University of Missouri , Columbia MO 65211 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bhanu P. Telugu 1 Division of Animal Sciences, University of Missouri , Columbia MO 65211 Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: telugub{at}umsystem.edu Abstract Full Text Info/History Metrics Preview PDF Abstract The molecular mechanisms regulating the germ cell and gonadal somatic cell development are complex and are still poorly understood in non-rodent mammals. The Nanos family gene- NANOS3 is expressed in the migrating primordial germ cells (PGC) and has key roles in germ cell survival in several species. Herein, we investigated the role of NANOS3 in pigs-an animal model of dual agricultural and biomedical importance. Consistent with prior reports, we found that disruption of NANOS3 expression did not affect PGC specification. Similarly, migration of PGC to the genital ridge occurs normally, but soon followed by an increase in apoptosis and a loss of undifferentiated state by embryonic (e) day 20. Although NANOS3 -/- gonads initiate development as ovaries or testes, they displayed structural defects. This is especially pronounced in the ovaries after the sex determination period (e35). Notably, we identified defects in pregranulosa and theca cell development at a single-cell resolution, suggesting that germ cells are important for gonadal somatic cell development. This germ cell depletion model therefore offers novel insights into the potential role of germ cells in the emergence of gonadal somatic lineages. Introduction Germ cells are unique cell types that emerge de novo during embryonic development and serve as the foundation for genetic transfer to the next generation. In eutherian mammals during the early pre-gastrulation stage of embryonic development, a small subset of primordial germ cells (PGC) arises from the nascent mesoderm called the “primitive streak” in the posterior region of the embryo by upregulation of key “specification” ( PRDM1, PRDM14, SOX17, TFAP2C ) factors ( Saitou, 2009 ). These factors result in suppression of the somatic cell fate, upregulation of the pluripotent factors, and erasure of the imprints, which are reestablished in a sex-specific manner at later stages of gonadal development. The PGC subsequently embark on migration to the genital ridge-the future gonad ( Sasaki & Matsui, 2008 ). In the genital ridges of males, expression of the SRY gene in the coelomic epithelial cells results in the upregulation of SOX9 and a deterministic differentiation to pre-Sertoli cells in the embryonic testes. Conversely, lack of SRY expression in females (no Y chromosome) will result in the default pathway, which is the expression of FOXL2 and differentiation towards the pre-granulosa cells. The pre-Sertoli or pre-granulosa cells in conjunction with the post-migratory PGC organize into primitive sex cords, which remain intact in testes and form the seminiferous tubules or undergo nest breakdown and become primordial follicles in the ovaries. The PGC subsequently undergo differentiation into gonocytes in the testes or enter into meiosis and undergo arrest at the prophase stage of meiosis-I and become a primary oocyte in the resulting ovaries, respectively. Taken together, the development of gonads is a well-orchestrated event and is a result of synchronous and coordinated development of germ cells and their supporting somatic “nurse” cells ( Licatalosi, 2016 ; Saga, 2008 ). There are several evolutionarily conserved genes and gene families that play a critical role in germ cell development. One such evolutionarily conserved family is NANOS. The NANOS gene family encode RNA-binding proteins, which serve as translational regulators and are involved in multiple processes of germ cell development including the cell cycle, maintenance of pluripotency, epithelial–mesenchymal transition, and germ cell survival ( Haraguchi et al , 2003 ). There are three Nanos paralogs, Nanos1 , Nanos2 , and Nanos3 in mice and other eutherian mammals. The Nanos proteins have a typical carboxy-terminal zinc finger motif (CCHC) 2 , which is a highly conserved protein domain that mediates binding with different molecular interaction partners such as the C-terminal RNA-binding domain of Pumilio ( Sonoda & Wharton, 1999 ) as well as with the CCR4–NOT deadenylase complex ( Bhandari et al , 2014 ). In mice, Nanos2 binds to the CCR4–NOT complex through CNOT1, whereas Nanos3 does this mainly via direct recruitment of the CCR4-POP2-NOT deadenylase ( Suzuki et al , 2014 ). Unlike Nanos2 and Nanos3 , which are expressed exclusively in germ cells and have a role in germ cell development ( Tsuda et al , 2003 ), mouse Nanos1 is not expressed in germ cells and is dispensable for germ cell development ( Haraguchi et al ., 2003 ). The primary function of Nanos2 and Nanos3 in germline cells is to suppress apoptosis by repressing the translation of the pro-apoptotic Bcl-2 Associated X-protein ( BAX ) gene ( Suzuki et al , 2008 ). Targeted disruption of Nanos2 in mice leads to infertility exclusively in the male germline, whereas Nanos3 -deficient mice exhibit both male and female infertility ( Suzuki et al , 2007 ; Tsuda et al ., 2003 ). Both Nanos-2 and -3 have orthologs in mammals. Several recent reports from non-rodent studies confirmed their similar conserved and essential role in germ cell development. For example, consistent with the knockout phenotype of Nanos2 -null mice, NANOS2 -deficient pigs, goats, and cattle exhibited a loss in male germ cells, but females with deficiencies in these genes remain fertile ( Ciccarelli et al , 2020 ; Park et al , 2017 ). A deficiency in NANOS3 gene manifests as infertility in fetal bovine ovaries ( Ideta et al , 2016 ; Mueller et al , 2023 ) and the postnatal pig ovary and testis ( Kogasaka et al , 2022 ). Another study has reported that knockdown of NANOS3 in human embryonic stem cells resulted in a reduction in germ cell numbers during differentiation in vitro ( Julaton & Reijo Pera, 2011 ). These findings clearly demonstrate that NANOS3 is essential for germ cell development in both sexes. Although the loss of NANOS3 in large animal models leads to germ cell depletion and sterility in the postnatal period ( Kogasaka et al ., 2022 ), the role of NANOS3 during PGC migration, colonization and gonadal development, including somatic cell differentiation have not been examined systematically and remain unexplored ( Guigon & Magre, 2006 ; Rios-Rojas et al , 2015 ). In this study, we generated NANOS3 -deficient pig fetuses and investigated how the loss of germ cells influences gonadal development and more importantly the gonadal supporting cell differentiation. Extending on previous studies, our results identified the essential role of the NANOS3 gene in germ cell survival, and the influence of germ cell depletion on gonadal somatic cell differentiation ( Kogasaka et al ., 2022 ). Our analysis uncovered insights into the transcriptomic features of NANOS3 -/- fetal gonads with cell type-specific developmental defects. These observations provide a basis for future studies on the influence of germ cell depletion on ovarian and testicular development in this and other mammalian species. Results Functional disruption of NANOS3 results in the apoptosis of porcine PGC during migration We sought to investigate whether functional disruption of NANOS3 leads to apoptosis of PGC during migration. To address this question, we utilized both male and female biallelic NANOS3 -/- embryonic fibroblasts that contained an in-frame premature stop codon in the NANOS3 gene as nuclear donors in SCNT to generate XX and XY NANOS3 -/- fetuses ( Figure 1A ). Following a round of SCNT, at e21, the pregnant surrogate was humanely euthanized to recover 6 NANOS3 -/- (4 for XY and 2 for XX) and 4 WT EGFP control XY cloned fetuses ( Figure 1B and Figure S1C, D, and Table S3). Additionally, AI was performed with semen from EGFP Tg boar, and 3 age matched WT GFP XX fetuses were recovered for comparison. As expected, loss of NANOS3 did not result in any overt morphological abnormalities as evident from measurements of the crown-rump length (CRL) and weights of the fetuses, in comparison to their WT counterparts ( Figure 1C ). Download figure Open in new tab Figure 1. NANOS3 is required for survival of primordial germ cells during migration (A) Schematic description of the embryo production strategy. (B) Photographs of WT GFP and NANOS3 −/− fetuses followed by SCNT. Bar, 1 mm. (C) Generation of NANOS3 −/− cloned embryos at e21. Crown-rump length (CRL) and body weight of the resulting fetuses. Data are presented as the mean ± S.E. (D) Immunofluorescence staining (bar; 50µm, right) confirmed that the migrating primordial germ cells were POU5F1 positive in the dorsal mesentery zoomed in area from the dotted boxes in the Hematoxylin-eosin (H&E) stained whole fetus (bar; 1mm, left). (E) Double immunostaining with POU5F1 (red) and CS3 (green) to detect apoptotic PGC. The number of CS3+ PGC (arrowheads) was increased in NANOS3 −/− embryos. Nuclei were counterstained with DAPI (gray). Bar, 50µm. (F) The number of apoptotic PGC (POU5F1+/CS3+) was determined by manually counting cells in serial sections (n=4). (G) Expression levels for representative pluripotent genes. ** P < .01, *** P < .001. Error bars represent means ± S.E. To assess the impact of NANOS3 deficiency on migratory PGC, we examined the histological sections for the distribution of cKIT and POU5F1 + (or OCT3/4-a marker for PGC) cells in e21 fetuses (Figure S1E). In the NANOS3 -/- fetuses, we found POU5F1+ PGC along the dorsal mesentery - their migratory route ( Figure 1D ). This indicates that the PGC specification and migration was not impacted by the disruption of NANOS3 (Figure S1D)( Kanamori et al , 2019 ). Next, we investigated whether the rate of apoptosis is higher among the migratory PGC in NANOS3 -/- fetuses. To address this, we performed immunostaining for cleaved CASPASE3 (CS3), a marker for apoptosis, in combination with POU5F1 ( Figure 1E ). We noticed that the proportion of migratory POU5F1+ cells in NANOS3 -/- fetuses (XY: 34.8 ± 7.5; XX: 33.8 ± 5.2) remained comparable to that of the controls (XY: 38 ± 11.0; XX: 37.5 ± 2.6). However, there was an increase in the number of CS3+ apoptotic cells in NANOS3 -/- fetuses (XY: 7.0 ± 1.6; XX: 6.5 ± 1.9) compared to the WT controls (XY: 1.3 ± 0.9; XX: 1.0 ± 0.6; P < 0.05). While CS3+ cells were abundant in the NANOS3 -/- fetuses, only a few cells exhibited colocalized expression of POU5F1 and CS3 (XX, 1.8 and XY, 0.75 on average) ( Figure 1F ). This reinforces that the population of PGC undergoing apoptosis downregulate POU5F1 expression. To follow-up on these preliminary findings, we performed magnetic activated cell sorting (MACS) enrichment of male WT and NANOS3 -/- fetuses (n=2, each) using SSEA1 antibody-coupled microbeads, followed by co-staining with POU5F1 and CS3 and flow cytometry analysis. There is an approximately 5-fold increase in the number of CS3+ apoptotic cells within the SSEA1+ population of the mutant embryos compared to the WT controls. These results indicate that the loss of NANOS3 results in a loss of POU5F1 and pluripotent gene expression followed by an increase in apoptosis (CS3+ cells) ( Gkountela et al , 2013 ; Julaton & Reijo Pera, 2011 ) (Figure1G). Loss of germ cells in NANOS3 -/- gonads following sex differentiation Next, we investigated whether the functional inactivation of NANOS3 results in a complete loss of germ cells following the sex determination phase when the bipotential gonads commit to either an ovarian or a testis fate ( Parma et al , 1999 ). To address this, we generated XX and XY NANOS3 -/- fetuses via SCNT and compared them to age-matched WT controls at e35 (Figure S2A). Following a round of SCNT, 8 XX and 14 XY fetuses were recovered (Figure S2B). We also recovered developmentally delayed fetuses as assessed by CRL, a common outcome following SCNT. The age-matched “normal” fetuses displayed no differences in weight compared to WT (Figure S2C). The testes exhibited a bean-like appearance with major surface arteries, and were easily distinguishable from the ovaries, which appeared partially twisted and stretched ( Coveney et al , 2008 ), indicating that the gonads developed normally into the testis or ovary in a sex-specific manner ( Figure 2A ). The isolated gonads similarly displayed no differences in the size or weight between the WT and NANOS3 mutants ( Figure 2B ). Download figure Open in new tab Figure 2. The absence of NANOS3 causes a complete loss of germ cells following sex determination (A) Photographs of the WT and NANOS3 −/− gonads at e35. NANOS3 −/− gonads appear to have normal morphology. The testes exhibited a bean-like appearance, along with the arteries, and were easily distinguishable from the ovaries, which appeared partially twisted and stretched. Bar, 1mm (B) Bar graphs illustrate gonad size and weight, as indicated. (C) Immunofluorescence for the early germ cell markers, DAZL (green) POU5F1 (red)-top and TFAP2C (green) SSEA1 (red)-bottom, indicated the absence of germ cells in NANOS3 −/− ovary and testis. Nuclei counterstained with DAPI (gray) in merged image. Bars, 50 μm. (D) Photographs of WT and delayed/normal mutant fetuses (top) and representative images (bottom) immunostained with SOX17, which marked germ cells (arrowheads, inlet) and endothelial cells (arrow). (E) The total number of SOX17+ germ cells were obtained from counting in slides (n=3). ** P < .01. Error bars represent means ± S.E. To confirm the germ cell depletion in e35 fetuses (CRL: 38 mm), we investigated for the expression of definitive germ cell-related proteins in the gonads, including the markers for early germ cells, POU5F1, TFAP2C (also known as AP2γ), SSEA1, and DAZL (late germ cells) ( Figure 2C ). As expected, none of these markers were detected in e35 NANOS3 -/- gonads, confirming the definitive loss of early and late germ cells. To further confirm the presence or loss of PGC, immunohistochemistry with an antibody to SOX17 (with nuclear localization) was performed. The SOX17+ germ cells exhibit large nuclei characteristic of germ cells. Using these criteria, the number of germ cells from each gonad was counted in three independent high-power fields (HPF) ( Figure 2D ). In e35 WT ovaries, an average of 23 germ cells per HPF (400 total, 5%) were observed with a significant majority (92.3%) showing strong immunoreactivity for the SOX17 ( Figure 2E ). Interestingly, sporadic SOX17 negative germ cells (1.6%) were identified in two NANOS3 -/- ovaries (7 cells per HPF, 420) from developmentally delayed fetuses (CRL: < 30 mm) ( Figure 2D ) corresponding to e30 in development. However, no surviving germ cells were found by e35 (CRL: 38 mm). Only endothelial cells were positive for SOX17 (Figure S2D). From these results, it is clear that few germ cells colonized the gonads from e30 fetuses, and by e35, have either undergone apoptosis or lost pluripotency and germ cell identity (differentiation) ( Hayashi et al , 2004 ) in both the ovaries and testes. Histological architecture of NANOS3 -/- gonads was altered In the WT ovaries and testes, the primary sex cords (ovigerous nests/cords and testicular cords, respectively) were well organized containing germ cells, and were surrounded by the stromal/interstitial cells ( Karl & Capel, 1998 ) ( Figure 3A ). However, the ovaries and testes in NANOS3 -/- fetuses were disorganized, and appeared as epithelial monolayers with enlarged cells and abundant finely granular cytoplasm, potentially undergoing degeneration ( Figure 3A ) ( Ideta et al ., 2016 ). In the NANOS3 -/- testes, the testicular cords were intact, however, the cords lacked a lumen. We investigated further whether the defects in the cord structure were due to apoptosis or reduced proliferation in the developing gonads, both of which are critical processes involved in cellular homeostasis. We performed immunostaining with the proliferation marker Ki-67 along with DBA (germ cell marker) antibodies ( Figure 3B ). Interestingly, we identified a significant increase in the number of proliferating cells (Ki-67+) both in the NANOS3 −/− ovaries and testes, compared to the control WT gonads ( Figure 3C ). We also performed co-immunostaining with CS3 an apoptotic marker, and CDH2-a marker for supporting cells. A key observation was an increase in the number of CDH2+ supporting cells throughout the NANOS3 −/− gonads, compared to the WT counterparts ( Figure 3D ). Additionally, CS3+ apoptotic cells were significantly higher in the NANOS3 −/− testes and ovaries (5% of the total cells per visual field), compared to the WT controls (<1% of the total cells) (Table S4); however, the apoptosis was restricted to the interstitial/stroma region in mutant gonads. Taken together, the somatic cells proliferate in the absence of NANOS3 but cannot structurally organize into sex cords in the absence of germ cells, potentially due to missing cell types (germ cells) to rebuild ( Gurtner et al , 2008 ). Download figure Open in new tab Figure 3. Excessive cell proliferation and apoptosis in NANOS3 −/− gonads (A) H&E stained histological image of the WT and NANOS3 −/− gonads at e35. Germ cells (arrowheads) along with primary sex cords were formed in WT gonads, whereas the NANOS3 −/− gonads showed loss of germ cells along with disarranged cellular layers in ovaries or with undeveloped tubular structures in testes, which are outlined in dotted white line. Bar 50 µm. (B) Whole mount immunostaining with DBA (green) and Ki67 (red). In the wild type, cells co-expressing DBA (green) and Ki67 were detected in ovaries and testes. DBA expression was not detected in NANOS3 −/− gonads, whereas NANOS3 −/− gonads have more Ki67-expressing cells than those of WT control. Bar 100 µm. (C) The total number of Ki67-expressing cells were obtained from counting in slides (n=3). ** P < .01, *** P < .001. Error bars represent means ± S.E. (D) Immunostaining with CS3 (green) and CDH2 (red). Sex cords and unorganized epithelial sheets were detected by immunostaining for CDH2 in all samples. Nuclei were counterstained with DAPI (gray). Bar, 100 μm. Single-cell transcriptomic profiling of fetal ovaries and testes of WT and NANOS3 - /- mutants To better characterize the mutant phenotypes in the ovaries and testes at a single-cell resolution, we performed high-throughput snRNA-seq of ovaries and testes after sex determination (e35) from NANOS3 -/- and WT controls by using the 10x Genomics platform (Figure S3A, B). UMAP analysis revealed that ovarian cells from WT (n=4090) and NANOS3 -/- (n=3309) exhibited little overlap, whereas testicular cells from WT (n=5485) and NANOS3 -/- (n=7027) had a greater overlap (Figure 4A). Using the k-means clustering (Figure 4B), the data was partitioned into the following primary gonadal cell lineages based on well-established markers ( Uhlen et al , 2005 ): coelomic epithelial cells ( CE ; GATA4+, ARX+, LHX9+ high , HHLA2+ ), which differentiate into the bipotential early supporting gonadal cells ( ESGC s; NR5A1+ high , LHX9+ high , WT1+ high , WNT6+ high ) that give rise to granulosa and Sertoli cells, mesenchymal interstitial/stroma cells ( ARX+, TCF21+, PDGFRA+, COUP-TFII, NR2F2+ ), germ cells ( GC ; DDX4+ ), Leydig and theca ( STAR+ ) cells, and a relatively small cluster of immune ( CD167+ ) cells in the testes and ovaries, respectively (Figure. 4C). We also evaluated a heatmap of known marker expression across the major cell types (Figure. 4D, E). Among them, CE, interstitial/stromal, and immune cells strongly overlapped, whereas the supporting and interstitial cell populations from WT and mutants from both sexes exhibited minimal overlap within the UMAP space (Figure 4A). In the absence of germ cells in the NANOS3 -/- gonads, we observed distinct changes in WNT6+ ESGCs. Specifically, the ratio of WNT6+ ESGCs in NANOS3 -/- gonads was higher than in WT (19.4% of NANOS3 -/- vs 3% of WT ovaries and 22% of NANOS3 -/- vs 9% of WT testes in population) (Figure. 4F). This is a novel finding not previously reported within these models. The DDX4+ germ cells clustered distantly from the somatic clusters in the WT gonads in both the sexes, which were absent in the NANOS3 -/- gonads (Figure 4B). Based on the expression patterns of the germline-specific genes ( Saitou & Miyauchi, 2016 ), two types of germ cells were identified in the ovaries (Figure 4B). A small fraction (4.2%) of early-stage germ cells ( eGCs ), expressing high levels of pluripotency and early germ cell-specific markers including POU5F1, NANOG, SALL4, PRDM1 (also called BLIMP1), PRDM14 , TFAP2C ( Houmard et al, 2009 ), DDX4, DAZL, PIWIL1 and PIWIL2 ( Juliano et al , 2011 ). The second type of germ cells were termed meiotic germ cells ( mGCs ; 11.4%) expressing high levels of the retinoid acid (RA)-induced pre-meiotic genes, STRA8 and ZGLP1 ( Endo et al , 2015 ; Nagaoka et al , 2020 ), and meiosis initiation genes, PIWIL4, SYCP1, SYCP2, PAX7, and TDRD6 ( Garcia-Alonso et al , 2022 ), with concomitant downregulation of early germ cell markers (Figure. 4D). In the testes, 6.3% of the cells were classified as eGC expressing POU5F1 and TFAP2C , and rare RA-responsive meiotic genes including STRA8 (Figure. 4E). The testicular eGC overlapped with ovarian eGCs, and as expected clustered distantly from mGCs (Figure. 4G). This data further confirms the mitotic and pre-meiotic population of eGCs, and the mGCs undergoing a mitotic-to-meiotic transition ( Li et al , 2017 ). Further, we investigated the percentage of germ cells (CDH1+) undergoing mitosis in WT ovaries and testes as shown by colocalization with the Ki-67 (Figure 4H). The analysis confirmed that the total number of double positive (CDH1+/Ki-67+) cells was higher in testes (73%, 36 of 49) than in the ovaries (16%, 14 of 87; Figure 4I). These percentages of actively proliferating germ cells are in agreement with our transcriptome analyses. Expression dynamics reveals impaired somatic cell lineages in NANOS3 -/- ovaries and testes in the absence of germ cells To further resolve the observed cell-type composition differences in NANOS3 -/- gonads, we further classified the cells into 16 clusters (hereafter abbreviated as “C”) in ovaries, and 19 C in testes using the known markers from previous studies ( Garcia-Alonso et al ., 2022 ) and based on DEGs (Figure 5A and 5B; Table S5). The molecular phenotype of these various clusters was shown in Table S4. Salient observations from these clustering data for WT and mutant gonads are listed below. Coelomic epithelial (CE) cells In the case of ovaries, the CE cells (C2, C10, C11) were defined by their expression of ERBB4, MAMDC2, SBSPON, SOX6, WNT5A , and HHLA2, which could be subdivided into two clusters: a mitotic (C2) and non-dividing (C10, C11) epithelium. The mitotic CE is enriched for proliferation genes such as TOP2A, RACGAP1, PRC1, BIRC5 ( Gao et al , 2021 ; Morris et al , 2022 ; Yang et al , 2018 ), and are likely the primary source of gonadal somatic cells in ovarian development (Figure 5). The ratio of mitotic and non-dividing CE cells in the NANOS3 -/- ovary (10.7% and 9.3%) was comparable to the WT control (11.9% and 8.8%, respectively). In the testis, only 2% of the cells are CE (C18). This indicates that the expansion of proliferating CEs occurs in the ovaries and are distinct from the tunica albuginea somatic cells ( Mork et al , 2012 ; Rastetter et al , 2014 ) in the testis expressing GATA2, KRT19, UPK3B , which were defined as gonadal ridge epithelial-like cells ( Hummitzsch et al , 2013 ). Pregranulosa and Sertoli cells The ESGC (C1, C3, and C6) constitute the largest proportion of cells in both the WT (32.8%) and mutant (47.8%) ovaries, and express factors such as RSPO1, KDR, CDH2, KITLG, PTPRN2, and LHCGR , illustrating their identity as gonadal early supporting progenitors. Of note, there were two distinct supporting cell populations in the ovaries. The first population is WNT6+ (C5 and C12) cells, which make up for a significant majority of cells in the mutant ovaries (24.5%) and shared partial similarity with ESGCs (Figure 4, Figure S1E). This observation is suggestive of an earlier induction of the molecular networks underlying the initial commitment of ESGCs to the granulosa fate, termed the “transitional” cells. The second population is LGR5+ (C15) cortical preGCs, which are present exclusively in the WT ovaries (4.8%), and are distinguished by their expression of steroidogenic enzymes ( HSD17B3, NR5A2, INHBA ) and their regulators ( PTPN5, FSHR, and KCNK13 ) ( Gustin et al , 2016 ; Wamaitha et al , 2023 ). In addition, DEGs in the WNT6+ and LGR5+ cells showed enrichment for GO terms related to the WNT signal pathway, ubiquitin mediated proteolysis, growth hormone synthesis, FOXO-mediated transcription among top-enriched gene sets (Table S5). In the testes, the bipotent cells (C3) possess a PDGFRA + interstitial and supporting SOX9 + cell identity which are distinct from the ovaries. As expected, the largest population in testes was SOX9+ Sertoli cells, which shared markers with their counterparts-preGCs in the ovaries, including, LRG5, HSD17B3, and CDH2 (Figure 5E). Contrary to the ovarian phenotype, there were minimal differences in the Sertoli cell population between the WT (36%) and mutant testes (30%). Theca and Leydig cells In the ovaries, fewer theca cells were observed in NANOS3 -/- ovaries (0.2%) compared to the controls (1.4%). The PDGFRA+ and NR2F2+ (C4, C7, C9, C13) interstitial stromal progenitors can be further categorized into the steroidogenic (C4 and C7) and fibroblast-like (C9, C13) populations. This includes the C4 cluster, which has a small fraction of STAR+ theca cells ( Fan et al , 2019 ) enriched for steroidogenic genes (e.g., CYP11A1, CYP17A1, LHCGR, INSL3, FDX1, LDLR, GLDN ). Similar to theca cells, STAR+ Leydig (C14) cells were readily identifiable in WT and mutant testes, but the proportion was not different between them (6.0% and 8.4%, respectively) (Figure 5E). Among the testicular somatic cells, the ratio of SOX9+ (C10) supporting cells and PDGFRA+ (C11) interstitial proliferating cells (e.g., TOP2A ) in the mutant gonads were two times higher than that in the WT (6.7% Vs 3.6% and 7.4% Vs 3.3%) respectively consistent with the previous results ( Figure 3B ). From these results, we conclude that germ cells contribute to the differentiation of somatic lineage (preGC and theca) in the ovary. However, despite some changes in cellular composition, the differentiation of Sertoli and Leydig cells in the mutant testes remain unaffected in the absence of germ cells. These observations point to a unique sexually divergent regulatory mechanism underlying male and female gonadal supporting cell development, highlighting a profound influence of germ cells on ovarian cell lineage specialization. Discussion Germ cells have a unique lifecycle including- de novo specification from the incipient mesoderm, an arduous and perilous journey to their future home – the genital ridge, cooperative organization with the EGCCs into sex cords, and differentiation and development into primary oocytes or gonocytes, in ovaries and testes respectively. However, the underlying mechanisms for germ cell and supporting gonadal somatic cell development, and how they influence each other in the maturation and higher order organization into primitive sex cords remain yet to be fully elucidated in non-rodent species mammals. Historically, while the livestock species, specifically the domestic pig has been considered as an ideal alternative, the lack of genetic engineering tools has hindered their use as models for mechanistic studies. The recent development of genome editors, including the CRISPR/Cas has proven to be a gamechanger for the field. The editors can introduce site-specific breaks in the DNA, which can be leveraged for generating transgenic pigs with precision. Coupled with advances in sequencing at single cell resolution and improvements in bioanalytical tools, it is now possible to use these models to either fill-in the gaps emanating from research in rodents or serve as an alternative. In this study, taking advantage of the progress in genetic engineering, we set out to investigate the effects of germ cell depletion in early gonadal development especially in the context of supporting somatic cell development. This study demonstrated that disrupted NANOS3 expression led to the loss of germ cells postmigration, defects in the somatic cells especially in the ovary, and overall disorganization of sex cords in both gonads. Our snRNA seq data provided novel evidence that germ cells are essential for gonadal somatic differentiation during ovarian development. Investigating the protective role of NANOS3 in fetal germ cells in pigs Apoptosis is a crucial mechanism underlying many genetic forms (including nanos genes) of germ cell loss in mice and other animal models ( Aitken et al , 2011 ). We observed that normal numbers of migrating PGC were present in the NANOS3 deficient concepti at e21. However, there was an increased rate of apoptosis and decreased expression of pluripotency markers compared to WT ( Figure 1 ). Thus, it is clear that disrupted NANOS3 expression did not interfere with PGC specification and proliferation, but it became indispensable for germ cell viability during migration via suppression of apoptosis ( Tsuda et al ., 2003 ). Moreover, our results support the notion that NANOS3 expression may maintain an undifferentiated state of early fetal germ cells ( Julaton & Reijo Pera, 2011 ; Wang & Lin, 2004 ; Yamaji et al , 2010 ). Although our results are suggestive and only observed at the gene expression level, this observation implies that NANOS3 may be involved in regulating POU5F1 expression ( Gkountela et al ., 2013 ; Julaton & Reijo Pera, 2011 ). Thus, further investigation is warranted to probe the possible role of NANOS3 in self-renewal and maintenance of early pig germ cells. We further focused on addressing the developmental defects in the mutant gonads after the sex determining period (e35). Consistent with prior studies, our results showed that NANOS3 deficiency leads to a progressive and complete loss of germ cells in both sexes and continues up until after sex differentiation ( Ideta et al ., 2016 ; Mueller et al ., 2023 ; Tsuda et al ., 2003 ). Intriguingly, we found that a small proportion of NANOS3 -depleted germ cells survived and colonized the genital ridges, as previously described ( Tsuda et al ., 2003 ). Although the BAX-dependent or independent apoptosis is associated with germ cell loss in such models, it remains unclear as to the exact mechanisms of germ cell loss and the fates of a few germ cells that survive after reaching the genital ridge ( Suzuki et al ., 2008 ). It is possible that a few surviving germ cells will undergo apoptosis at a later stage or potentially lose pluripotency and differentiate into other lineages ( Hayashi et al ., 2004 ). Impact of germ cell loss on the differentiation of supporting cell lineage in fetal gonads The influence of germ cells on somatic cell differentiation in the ovarian development has been reported in invertebrate species ( Slanchev et al , 2005 ) but has not been investigated and/or reported in mammals. Reports from NANOS2 or NANOS3 deficient pigs in which germ cells have been depleted have grossly normal testis at birth; however, exhibit severe hypoplasia in postnatal periods due to lack of spermatogenesis. In these animals, there is evidence of intact seminiferous tubules with functional Sertoli and Leydig cells ( Ideta et al ., 2016 ; Mueller et al ., 2023 ; Park et al ., 2017 ). In contrast, the ovaries exhibited defects in follicular structures, with few, if any, true follicles. These observations support the notion that the germ-soma interaction is required for ovarian differentiation and folliculogenesis in the postnatal period ( Fukuda et al , 2021 ). In the present study, NANOS3 -/- (e35) ovaries and testes exhibited defects in the cords, with testis showing a lack of lumen, and ovaries containing a sheet of epithelial cells ( Ideta et al ., 2016 ). These structural alterations suggest that the intercellular interactions mediated by cell-cell contacts and/or paracrine factors may play a pivotal role in the organization of complex gonadal structures following CE ingression ( Guigon & Magre, 2006 ; Nicholas et al , 2010 ). Our single nuclear RNA-Seq data highlighted the distinct transcriptomic features of the major gonadal populations including germ cells, interstitial/stromal (Leydig/theca), gonadal progenitors, and supporting (granulosa/Sertoli) cell lineages. Several observations are worth mentioning: first, our data indicated that testicular and ovarian cells shared cell type specific markers, despite having distinct developmental pathways. This observation suggests that they retain similar function and characteristics to their roles in the reproductive system through a parallel developmental path. Second, LGR5+ preGC cells were low in NANOS3 -/- ovaries, and instead WNT6+ transitional cells harboring both supporting and stromal identity were enriched in NANOS3 -/- ovaries. In addition, STAR+ theca cells were found in WT ovaries but are lower in mutants, likely suggesting that signals from pregranulosa cells may regulate their differentiation and development ( Schmahl et al , 2008 ). Although the transcriptome feature was similar between WT and mutant ovaries, the disorganized cord structure may be a consequence of defects in somatic cells downstream of the germ cell loss in NANOS3 -/- gonads. Although, the degree to which these mechanisms mirror the differentiation of granulosa cells in ovaries—a process central to the formation of follicles—is still being explored. Evidence from this study suggests a role for germ cells in directing the fate of supporting progenitor cells in developing ovaries after sex determination. Intriguingly, such compositional changes in their testicular counterparts, i.e., the Sertoli and Leydig cells, have not been observed in mutant testes. The observed female biased defects reflect that the mechanism and factor(s) involved in cell fate commitment are differentially controlled between the sexes at the sex-determining stage. As to possible mechanisms underlying the sexual dimorphism, differences in the cell cycle stages in fetal germ cells between the sexes may be the underlying cause, as has been shown in re-aggregation experiments. The disruption of somatic cell differentiation observed in our NANOS3 mutant ovaries is a yet undescribed phenotype and the causative phenomenon still needs to be clarified. Going further, elucidation of mechanisms and factors involved in specification and maintenance of female supporting cell fate may provide novel insights into sex differentiation. Because the ovarian cord formation is conserved in mammalian germ cell development ( Pepling et al , 1999 ), the identification of genetic components and molecular mechanisms of fetal stage germ and somatic cell structures may better translate to understanding human gonadal development. Conclusions The cell fate commitment of germ cells and gonadal somatic cells in early development are incompletely characterized and, still, only poorly understood. This study demonstrated that disrupted NANOS3 expression led to the loss of germ cells postmigration, defects in somatic cell development, and disorganization of sex cords in the developing gonads. Our snRNA seq data provided novel evidence that germ cells are essential for gonadal somatic differentiation during ovarian development. Our data from a germ cell depletion pig model may potentially be used for further elucidating the influence of germ cells on the somatic differentiation during gonadal development. While a strong effort was made to characterize the developmental defects due to NANOS3 deficiency, our experiments also allowed us to provide comprehensive single-cell transcriptomics resources for gonadal development thereby enhancing our knowledge. Materials and methods All chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless stated otherwise. All experiments involving live animals were performed as per the approved guidelines of the University of Missouri, Institutional Animal Care and Use Committee protocol # 45081. Generation of homozygous NANOS3 -null and age-matched WT fetuses To generate NANOS3 null ( NANOS3 -/- ) XX and XY fetuses, we utilized the sequence validated biallelic NANOS3 -/- embryonic fibroblasts that contained an in-frame premature stop codon in NANOS3 as nuclear donors for somatic cell nuclear transfer (SCNT) (Figure S1A) ( Park et al , 2022 ). The introduction of the stop codon results in the production of a truncated NANOS3 protein lacking the indispensable zinc finger-containing domains, rendering the protein non-functional (Figure S1B). To generate age matched wild type (WT) control embryos, we utilized either the fetal fibroblasts for SCNT, or artificial insemination (AI) of a gilt in standing estrus with semen from the EGFP transgenic (Tg) line (NSRRC Strain # 0016). Timed euthanasia of the surrogates following embryo transfer or AI was performed to recover NANOS3 -/- or WT fetuses for phenotypic analysis. For SCNT, briefly, cumulus-oocyte-complexes (COC) were purchased from a commercial supplier (De Soto Biosciences, Seymour, TN, USA). Following in vitro maturation for 40-44 h, the cumulus cells were removed from the oocytes by gentle pipetting in a 0.1% (w/v) hyaluronidase solution. NANOS3 -/- or WT embryonic fibroblasts were synchronized to the G1/G0 phase by serum deprivation (DMEM with 0.1% FBS) for 96 h. The oocytes were enucleated by aspirating the polar body and the MII metaphase plates with a micropipette (Humagen, Charlottesville, VA, USA) in 0.1% DPBS supplemented with 5 μg/mL of cytochalasin B. After enucleation, one donor cell was placed into the perivitelline space of an enucleated oocyte. The cell– oocyte couplets were fused by applying two direct current (DC) pulses (1 s interval) of 2.0 kV/cm for 30 μs using an ECM 2001 Electroporation System (BTX, Holliston, MA). After fusion, the reconstructed oocytes were activated by a DC pulse of 1.0 kV/cm for 60 μs, followed by post-activation in 2 mM 6-dimethylaminopurine for 3 h ( Park et al , 2021 ). After overnight culture in MU4 medium with a histone deacetylase inhibitor Scriptaid (0.5 μM), the reconstructed zygotes were cultured in MU4 in low oxygen (5% O 2 and 5% CO 2 in 90% N 2 ) for embryo transfer ( Chen et al , 2021 ; Park et al ., 2021 ). The cloned embryos were surgically transferred into the oviduct of estrus synchronized recipients on the first day of standing estrus. Timed euthanasia of the surrogates following embryo transfer or AI was performed to recover NANOS3 -/- or WT fetuses for phenotypic analysis. Genotyping and sexing analysis Extraembryonic membranes from the fetuses were utilized for isolating DNA by using a DNA isolation micro-Kit (Norgen) according to the manufacturer’s instructions. Genotyping and sexing were performed via PCR by using either KOD Hot start mastermix (Novagen) or Bioline Taq under the following conditions: denaturation and polymerase activation step of 95°C /3 min, 35 cycles of 95°C /20 s, 60°C /10 s, 70°C /10 s, and the final extension step of 70°C /5 min. The sex of WT controls was determined by genotyping by using the pig Y chromosome, SRY , as previously described ( Park et al , 2012 ). The primers used were: 5’- CTGGGATGCAAGTGGAAAAT -3′ (forward) and 5′- GGCTTTCTGTTCCTGAGCAC -3′ (reverse); the PCR program used was 5 min 95°C, 34 cycles 95°C /1 min, 60°C /30 s, 72°C / 2 min, 72°C /10 min, and the PCR products were resolved on a 1.5% agarose gel. The PCR products were purified using NucleoSpin gel and PCR clean-up kit (Machery Nagel, Bethlehem, PA), and were subjected to Sanger sequencing (using the forward PCR primer; Table S1). Histology and immunofluorescence At embryonic day (e) 21 and 35, whole concepti and gonads from the fetuses were recovered, respectively, and were fixed in 4% paraformaldehyde (PFA) in PBS at 4°C overnight followed by long-term storage in 70% ethanol at 4°C. Conceptus or fetal gonads were dehydrated, paraffin embedded and sectioned for immunohistological analysis. For immunofluorescence, heat-induced epitope retrieval was conducted in sodium citrate buffer (10 mM sodium citrate, 0.05% Tween-20, pH 6) at 95°C for 20 min. Subsequently, the sections were permeabilized with 1% Triton X-100/PBS for 15 min and blocked with superblock (Fisher Scientific) or 5% BSA for 1 h prior to antibody incubation. Primary and secondary antibodies used for immunofluorescence are listed in Table S2. Incubation with the primary antibodies was performed at 4°C overnight. The next day, cells were washed and incubated with fluorescent (TRITC, Cy3 Alexa fluorophore 488, 555, 568 and/or 647; eBioscience, Abcam, Thermo Fisher Scientific)-conjugated secondary antibody for 1 h at room temperature (RT). Slides were then washed three times with 0.1% Tween-20/PBS. The nuclei were counterstained with 5 mg /L DAPI (Fisher Scientific) during the final washing series. Slides were mounted with diamond antifade mounting solution and stored at −20°C until imaging. Bright-field images of the embryos and the gonads were acquired by using Leica DFC 500 and DFC 7000T cameras. Fluorescence images were photographed by using a Leica DM 4000B microscope using the Leica Application Suite Advanced Fluorescence software (Leica Microsystems, Wetzlar, Germany). Quantitative analysis of apoptotic population The apoptotic population within the gonads was examined by semiquantitative evaluation of the expression of cleaved-CASPASE3 (CS3) and POU5F1, which are apoptotic and germ cell markers, respectively. Ki67 immunohistochemistry was performed to determine proliferating cells in the ovary and testis. The apoptosis/ proliferation indexes were calculated by dividing the number of CS3 positive (+) or Ki67+ cells by the total number of cells in randomly selected fields. The average values of cells in the knockout gonads were compared to the WT control, and statistically analyzed. Flow cytometry analysis Whole concepti were dissociated by using gentleMACS™ Dissociator (Miltenyi Biotec, Cat#130-093-235) with 0.25% trypsin/EDTA at 37°C for 5–15 min and bound with Anti-CD15 (SSEA1) MicroBeads (Biolegend) and subjected to FACS Frotessa cytometry (BioRad). FACS data was analyzed by Flowjo software. Single-Nuclei Isolation, sequencing using 10x Genomics protocol and data analysis Whole gonads were washed in ice-cold 100% MeOH and stored at - 80°C for single-nuclei extraction. Single nuclei were isolated from around 20-30 mg of three pooled gonads from each group by using a Singulator 100 machine (S2Genomics, Livermore, CA), following the manufacturer’s instructions. After isolation, nuclei preparations were centrifuged at 500 g for 5 min and resuspended in 2 mL of a buffer supplemented with 1 U/µL of RNAse inhibitor (Fisher). Nuclei stained with Trypan blue were inspected under an inverted microscope manually. Nuclei concentration was estimated by DAPI staining on a Countess II FL automated cell counter ⩾ 2 times for each sample (Figure S3 A,B ( Becht et al , 2018 ; Raudvere et al , 2019 ; Zhang et al , 2023 ). Libraries were constructed by following the manufacturer’s protocol with reagents supplied in the 10x Genomics Chromium Next Gel Bead-in-Emulsion (GEMs) Single Cell 3′ Kit. Single nuclear sequencing was performed by the Informatics Research Core Facility, University of Missouri, Columbia. The data was pre-processed with the CellRanger software (v7.0.0), including demultiplexing, fastq file generation, read alignment, and UMI counting ( Zheng et al , 2017 ). The WT and NANOS3 -/-datasets were integrated for each sex separately. The obtained data were analyzed and visualized by using the 10x Genomics Loupe Browser v6.5.0 software (10x Genomics Inc.). We analyzed the expression of known markers for the expected cell types and assigned identities to the clusters. Differentially expressed genes (DEG) between WT and NANOS3 -/- were used as input for gene ontology enrichment analysis by web-based g:Profiler ( Raudvere et al , 2019 ). Data Availability A total of 4 snRNA-seq data sets generated for this article can be accessed via NCBI Sequence Read Archive (SRA) with the accession number PRJNA1161363. Statistical analysis The statistical analysis was performed by using GraphPad Prism software 9.0 (GraphPad Software, La Jolla, CA, USA). The data was expressed as mean ± SD. For normally distributed data, t-test was used for comparison between 2 independent samples, and one-way analysis of variance (ANOVA) was used for comparisons of multi-samples. A P-value of <0.05 was considered as statistically significant. The number of replicates in each experimental setting and statistical significance are shown in each figure legend. Conflict of interest B.P.T. is a founder and serves as a consultant for RenOVAte Biosciences Inc, (RBI). All remaining authors declare no competing or conflicts of interest. Author contributions C.P. and B.P.T. conceived the project and designed the experiments; C.P., Y.J., S.G.Y., and J.W. established and performed characterization of the phenotype; C.P., and S.G.Y. generated the libraries and transcriptomic analysis; C.P. wrote the initial draft; B.P.T. revised the manuscript based on the input from all authors. All authors approved the final draft for submission. Acknowledgments This research was supported by investigator start-up funds and by Genus PlC, a publicly listed animal genetics company. The funder was not involved in the study design, collection, analysis, interpretation of data, the writing of this article or the decision to submit it for publication. References ↵ Aitken RJ , Findlay JK , Hutt KJ , Kerr JB ( 2011 ) Apoptosis in the germ line . Reproduction 141 : 139 – 150 OpenUrl Abstract / FREE Full Text ↵ Becht E , McInnes L , Healy J , Dutertre CA , Kwok IWH , Ng LG , Ginhoux F , Newell EW ( 2018 ) Dimensionality reduction for visualizing single-cell data using UMAP . Nat Biotechnol ↵ Bhandari D , Raisch T , Weichenrieder O , Jonas S , Izaurralde E ( 2014 ) Structural basis for the Nanos-mediated recruitment of the CCR4-NOT complex and translational repression . Genes Dev 28 : 888 – 901 OpenUrl Abstract / FREE Full Text ↵ Chen PR , Redel BK , Kerns KC , Spate LD , Prather RS ( 2021 ) Challenges and Considerations during In Vitro Production of Porcine Embryos . Cells 10 ↵ Ciccarelli M , Giassetti MI , Miao D , Oatley MJ , Robbins C , Lopez-Biladeau B , Waqas MS , Tibary A , Whitelaw B , Lillico S et al. ( 2020 ) Donor-derived spermatogenesis following stem cell transplantation in sterile NANOS2 knockout males . Proc Natl Acad Sci U S A 117 : 24195 – 24204 OpenUrl Abstract / FREE Full Text ↵ Coveney D , Cool J , Oliver T , Capel B ( 2008 ) Four-dimensional analysis of vascularization during primary development of an organ, the gonad . Proc Natl Acad Sci U S A 105 : 7212 – 7217 OpenUrl Abstract / FREE Full Text ↵ Endo T , Romer KA , Anderson EL , Baltus AE , de Rooij DG , Page DC ( 2015 ) Periodic retinoic acid-STRA8 signaling intersects with periodic germ-cell competencies to regulate spermatogenesis . Proc Natl Acad Sci U S A 112 : E2347 – 2356 OpenUrl Abstract / FREE Full Text ↵ Fan X , Bialecka M , Moustakas I , Lam E , Torrens-Juaneda V , Borggreven NV , Trouw L , Louwe LA , Pilgram GSK , Mei H et al. ( 2019 ) Single-cell reconstruction of follicular remodeling in the human adult ovary . Nat Commun 10 : 3164 OpenUrl CrossRef PubMed ↵ Fukuda K , Muraoka M , Kato Y , Saga Y ( 2021 ) Decoding the transcriptome of pre-granulosa cells during the formation of primordial follicles in the mousedagger . Biol Reprod 105 : 179 – 191 OpenUrl CrossRef PubMed ↵ Gao HS , Lin SY , Han X , Xu HZ , Gao YL , Qin ZY ( 2021 ) Casein kinase 1 (CK1) promotes the proliferation and metastasis of glioma cells via the phosphatidylinositol 3 kinase-matrix metalloproteinase 2 (AKT-MMP2) pathway . Ann Transl Med 9 : 659 OpenUrl CrossRef PubMed ↵ Garcia-Alonso L , Lorenzi V , Mazzeo CI , Alves-Lopes JP , Roberts K , Sancho-Serra C , Engelbert J , Mareckova M , Gruhn WH , Botting RA et al. ( 2022 ) Single-cell roadmap of human gonadal development . Nature 607 : 540 – 547 OpenUrl CrossRef PubMed ↵ Gkountela S , Li Z , Vincent JJ , Zhang KX , Chen A , Pellegrini M , Clark AT ( 2013 ) The ontogeny of cKIT+ human primordial germ cells proves to be a resource for human germ line reprogramming, imprint erasure and in vitro differentiation . Nat Cell Biol 15 : 113 – 122 OpenUrl CrossRef PubMed Web of Science ↵ Guigon CJ , Magre S ( 2006 ) Contribution of germ cells to the differentiation and maturation of the ovary: insights from models of germ cell depletion . Biol Reprod 74 : 450 – 458 OpenUrl CrossRef PubMed Web of Science ↵ Gurtner GC , Werner S , Barrandon Y , Longaker MT ( 2008 ) Wound repair and regeneration . Nature 453 : 314 – 321 OpenUrl CrossRef PubMed Web of Science ↵ Gustin SE , Hogg K , Stringer JM , Rastetter RH , Pelosi E , Miles DC , Sinclair AH , Wilhelm D , Western PS ( 2016 ) WNT/beta-catenin and p27/FOXL2 differentially regulate supporting cell proliferation in the developing ovary . Dev Biol 412 : 250 – 260 OpenUrl CrossRef PubMed ↵ Haraguchi S , Tsuda M , Kitajima S , Sasaoka Y , Nomura-Kitabayashid A , Kurokawa K , Saga Y ( 2003 ) nanos1: a mouse nanos gene expressed in the central nervous system is dispensable for normal development . Mech Dev 120 : 721 – 731 OpenUrl CrossRef PubMed Web of Science ↵ Hayashi Y , Hayashi M , Kobayashi S ( 2004 ) Nanos suppresses somatic cell fate in Drosophila germ line . Proc Natl Acad Sci U S A 101 : 10338 – 10342 OpenUrl Abstract / FREE Full Text ↵ Houmard B , Small C , Yang L , Naluai-Cecchini T , Cheng E , Hassold T , Griswold M ( 2009 ) Global gene expression in the human fetal testis and ovary . Biol Reprod 81 : 438 – 443 OpenUrl PubMed ↵ Hummitzsch K , Irving-Rodgers HF , Hatzirodos N , Bonner W , Sabatier L , Reinhardt DP , Sado Y , Ninomiya Y , Wilhelm D , Rodgers RJ ( 2013 ) A new model of development of the mammalian ovary and follicles . PLoS One 8 : e55578 OpenUrl CrossRef PubMed ↵ Ideta A , Yamashita S , Seki-Soma M , Yamaguchi R , Chiba S , Komaki H , Ito T , Konishi M , Aoyagi Y , Sendai Y ( 2016 ) Generation of exogenous germ cells in the ovaries of sterile NANOS3-null beef cattle . Sci Rep 6 : 24983 OpenUrl CrossRef PubMed ↵ Julaton VT , Reijo Pera RA ( 2011 ) NANOS3 function in human germ cell development . Hum Mol Genet 20 : 2238 – 2250 OpenUrl CrossRef PubMed Web of Science ↵ Juliano C , Wang J , Lin H ( 2011 ) Uniting germline and stem cells: the function of Piwi proteins and the piRNA pathway in diverse organisms . Annu Rev Genet 45 : 447 – 469 OpenUrl CrossRef PubMed Web of Science ↵ Kanamori M , Oikawa K , Tanemura K , Hara K ( 2019 ) Mammalian germ cell migration during development, growth, and homeostasis . Reprod Med Biol 18 : 247 – 255 OpenUrl CrossRef PubMed ↵ Karl J , Capel B ( 1998 ) Sertoli cells of the mouse testis originate from the coelomic epithelium . Dev Biol 203 : 323 – 333 OpenUrl CrossRef PubMed Web of Science ↵ Kogasaka Y , Murakami S , Yamashita S , Kimura D , Furumoto Y , Iguchi K , Sendai Y ( 2022 ) Generation of germ cell-deficient pigs by NANOS3 knockout . J Reprod Dev 68 : 361 – 368 OpenUrl CrossRef PubMed ↵ Li L , Dong J , Yan L , Yong J , Liu X , Hu Y , Fan X , Wu X , Guo H , Wang X et al. ( 2017 ) Single-Cell RNA-Seq Analysis Maps Development of Human Germline Cells and Gonadal Niche Interactions . Cell Stem Cell 20 : 891 – 892 OpenUrl CrossRef PubMed ↵ Licatalosi DD ( 2016 ) Roles of RNA-binding Proteins and Post-transcriptional Regulation in Driving Male Germ Cell Development in the Mouse . Adv Exp Med Biol 907 : 123 – 151 OpenUrl CrossRef PubMed ↵ Mork L , Maatouk DM , McMahon JA , Guo JJ , Zhang P , McMahon AP , Capel B ( 2012 ) Temporal differences in granulosa cell specification in the ovary reflect distinct follicle fates in mice . Biol Reprod 86 : 37 OpenUrl CrossRef PubMed ↵ Morris ME , Meinsohn MC , Chauvin M , Saatcioglu HD , Kashiwagi A , Sicher NA , Nguyen N , Yuan S , Stavely R , Hyun M et al. ( 2022 ) A single-cell atlas of the cycling murine ovary . Elife 11 ↵ Mueller ML , McNabb BR , Owen JR , Hennig SL , Ledesma AV , Angove ML , Conley AJ , Ross PJ , Van Eenennaam AL ( 2023 ) Germline ablation achieved via CRISPR/Cas9 targeting of NANOS3 in bovine zygotes . Front Genome Ed 5 : 1321243 OpenUrl CrossRef PubMed ↵ Nagaoka SI , Nakaki F , Miyauchi H , Nosaka Y , Ohta H , Yabuta Y , Kurimoto K , Hayashi K , Nakamura T , Yamamoto T et al. ( 2020 ) ZGLP1 is a determinant for the oogenic fate in mice . Science 367 ↵ Nicholas CR , Haston KM , Pera RA ( 2010 ) Intact fetal ovarian cord formation promotes mouse oocyte survival and development . BMC Dev Biol 10 : 2 OpenUrl CrossRef PubMed ↵ Park CH , Jeong YH , Jeong YI , Lee SY , Jeong YW , Shin T , Kim NH , Jeung EB , Hyun SH , Lee CK et al. ( 2012 ) X-linked gene transcription patterns in female and male in vivo, in vitro and cloned porcine individual blastocysts . PLoS One 7 : e51398 OpenUrl CrossRef PubMed ↵ Park CH , Jeoung YH , Uh KJ , Park KE , Bridge J , Powell A , Li J , Pence L , Zhang L , Liu T et al. ( 2021 ) Extraembryonic Endoderm (XEN) Cells Capable of Contributing to Embryonic Chimeras Established from Pig Embryos . Stem Cell Reports 16 : 212 – 223 OpenUrl CrossRef PubMed ↵ Park CH , Jeoung YH , Zhang L , Yeddula SGR , Park KE , Waters J , Telugu BP ( 2022 ) Establishment, characterization, and validation of novel porcine embryonic fibroblasts as a potential source for genetic modification . Front Cell Dev Biol 10 : 1059710 OpenUrl CrossRef PubMed ↵ Park KE , Kaucher AV , Powell A , Waqas MS , Sandmaier SE , Oatley MJ , Park CH , Tibary A , Donovan DM , Blomberg LA et al. ( 2017 ) Generation of germline ablated male pigs by CRISPR/Cas9 editing of the NANOS2 gene . Sci Rep 7 : 40176 OpenUrl CrossRef PubMed ↵ Parma P , Pailhoux E , Cotinot C ( 1999 ) Reverse transcription-polymerase chain reaction analysis of genes involved in gonadal differentiation in pigs . Biol Reprod 61 : 741 – 748 OpenUrl CrossRef PubMed Web of Science ↵ Pepling ME , de Cuevas M , Spradling AC ( 1999 ) Germline cysts: a conserved phase of germ cell development? Trends Cell Biol 9 : 257 – 262 OpenUrl CrossRef PubMed Web of Science ↵ Rastetter RH , Bernard P , Palmer JS , Chassot AA , Chen H , Western PS , Ramsay RG , Chaboissier MC , Wilhelm D ( 2014 ) Marker genes identify three somatic cell types in the fetal mouse ovary . Dev Biol 394 : 242 – 252 OpenUrl CrossRef PubMed ↵ Raudvere U , Kolberg L , Kuzmin I , Arak T , Adler P , Peterson H , Vilo J ( 2019 ) g:Profiler: a web server for functional enrichment analysis and conversions of gene lists (2019 update) . Nucleic Acids Res 47 : W191 – W198 OpenUrl CrossRef PubMed ↵ Rios-Rojas C , Bowles J , Koopman P ( 2015 ) On the role of germ cells in mammalian gonad development: quiet passengers or back-seat drivers? Reproduction 149 : R181 – 191 OpenUrl Abstract / FREE Full Text ↵ Saga Y ( 2008 ) Mouse germ cell development during embryogenesis . Curr Opin Genet Dev 18 : 337 – 341 OpenUrl CrossRef PubMed Web of Science ↵ Saitou M ( 2009 ) Germ cell specification in mice . Curr Opin Genet Dev 19 : 386 – 395 OpenUrl CrossRef PubMed Web of Science ↵ Saitou M , Miyauchi H ( 2016 ) Gametogenesis from Pluripotent Stem Cells . Cell Stem Cell 18 : 721 – 735 OpenUrl CrossRef PubMed ↵ Sasaki H , Matsui Y ( 2008 ) Epigenetic events in mammalian germ-cell development: reprogramming and beyond . Nat Rev Genet 9 : 129 – 140 OpenUrl CrossRef PubMed Web of Science ↵ Schmahl J , Rizzolo K , Soriano P ( 2008 ) The PDGF signaling pathway controls multiple steroid-producing lineages . Genes Dev 22 : 3255 – 3267 OpenUrl Abstract / FREE Full Text ↵ Slanchev K , Stebler J , de la Cueva-Mendez G , Raz E ( 2005 ) Development without germ cells: the role of the germ line in zebrafish sex differentiation . Proc Natl Acad Sci U S A 102 : 4074 – 4079 OpenUrl Abstract / FREE Full Text ↵ Sonoda J , Wharton RP ( 1999 ) Recruitment of Nanos to hunchback mRNA by Pumilio . Genes Dev 13 : 2704 – 2712 OpenUrl Abstract / FREE Full Text ↵ Suzuki A , Niimi Y , Saga Y ( 2014 ) Interaction of NANOS2 and NANOS3 with different components of the CNOT complex may contribute to the functional differences in mouse male germ cells . Biol Open 3 : 1207 – 1216 OpenUrl Abstract / FREE Full Text ↵ Suzuki A , Tsuda M , Saga Y ( 2007 ) Functional redundancy among Nanos proteins and a distinct role of Nanos2 during male germ cell development . Development 134 : 77 – 83 OpenUrl Abstract / FREE Full Text ↵ Suzuki H , Tsuda M , Kiso M , Saga Y ( 2008 ) Nanos3 maintains the germ cell lineage in the mouse by suppressing both Bax-dependent and -independent apoptotic pathways . Dev Biol 318 : 133 – 142 OpenUrl CrossRef PubMed Web of Science ↵ Tsuda M , Sasaoka Y , Kiso M , Abe K , Haraguchi S , Kobayashi S , Saga Y ( 2003 ) Conserved role of nanos proteins in germ cell development . Science 301 : 1239 – 1241 OpenUrl Abstract / FREE Full Text ↵ Uhlen M , Bjorling E , Agaton C , Szigyarto CA , Amini B , Andersen E , Andersson AC , Angelidou P , Asplund A , Asplund C et al. ( 2005 ) A human protein atlas for normal and cancer tissues based on antibody proteomics . Mol Cell Proteomics 4 : 1920 – 1932 OpenUrl Abstract / FREE Full Text ↵ Wamaitha SE , Nie X , Pandolfi EC , Wang X , Yang Y , Stukenborg JB , Cairns BR , Guo J , Clark AT ( 2023 ) Single-cell analysis of the developing human ovary defines distinct insights into ovarian somatic and germline progenitors . Dev Cell 58 : 2097 – 2111 e2093 OpenUrl CrossRef PubMed ↵ Wang Z , Lin H ( 2004 ) Nanos maintains germline stem cell self-renewal by preventing differentiation . Science 303 : 2016 – 2019 OpenUrl Abstract / FREE Full Text ↵ Yamaji M , Tanaka T , Shigeta M , Chuma S , Saga Y , Saitou M ( 2010 ) Functional reconstruction of NANOS3 expression in the germ cell lineage by a novel transgenic reporter reveals distinct subcellular localizations of NANOS3 . Reproduction 139 : 381 – 393 OpenUrl Abstract / FREE Full Text ↵ Yang XM , Cao XY , He P , Li J , Feng MX , Zhang YL , Zhang XL , Wang YH , Yang Q , Zhu L et al. ( 2018 ) Overexpression of Rac GTPase Activating Protein 1 Contributes to Proliferation of Cancer Cells by Reducing Hippo Signaling to Promote Cytokinesis . Gastroenterology 155 : 1233 – 1249 e1222 OpenUrl CrossRef PubMed ↵ Zhang S , Li X , Lin J , Lin Q , Wong KC ( 2023 ) Review of single-cell RNA-seq data clustering for cell-type identification and characterization . RNA 29 : 517 – 530 OpenUrl Abstract / FREE Full Text ↵ Zheng GX , Terry JM , Belgrader P , Ryvkin P , Bent ZW , Wilson R , Ziraldo SB , Wheeler TD , McDermott GP , Zhu J et al. ( 2017 ) Massively parallel digital transcriptional profiling of single cells . Nat Commun 8 : 14049 OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted June 27, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following A porcine germ cell depletion model to investigate the role of germ cells in gonadal development Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share A porcine germ cell depletion model to investigate the role of germ cells in gonadal development Chi-Hun Park , Young-Hee Jeoung , Sai Goutham Reddy Yeddula , JiTao Wang , Bhanu P. Telugu bioRxiv 2025.06.25.661527; doi: https://doi.org/10.1101/2025.06.25.661527 Share This Article: Copy Citation Tools A porcine germ cell depletion model to investigate the role of germ cells in gonadal development Chi-Hun Park , Young-Hee Jeoung , Sai Goutham Reddy Yeddula , JiTao Wang , Bhanu P. Telugu bioRxiv 2025.06.25.661527; doi: https://doi.org/10.1101/2025.06.25.661527 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7619) Biochemistry (17641) Bioengineering (13865) Bioinformatics (41860) Biophysics (21408) Cancer Biology (18545) Cell Biology (25434) Clinical Trials (138) Developmental Biology (13357) Ecology (19863) Epidemiology (2067) Evolutionary Biology (24288) Genetics (15587) Genomics (22466) Immunology (17701) Microbiology (40301) Molecular Biology (17142) Neuroscience (88441) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4814) Physiology (7633) Plant Biology (15108) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9811) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.