Community composition of arbuscular mycorrhizal fungi in Ontario tallgrass prairies of differing disturbance histories

Community composition of arbuscular mycorrhizal fungi in Ontario tallgrass prairies of differing disturbance histories | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Community composition of arbuscular mycorrhizal fungi in Ontario tallgrass prairies of differing disturbance histories Ada C. Jarosch, Sarah N. Allan Maloney, Nimalka M. Weerasuriya, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9149922/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 9 You are reading this latest preprint version Abstract Arbuscular mycorrhizal fungi (AMF), in the phylum Glomeromycota, form symbiotic relationships with most vascular plants, including grasses. Tallgrass prairies (TGPs) are an endangered habitat in Ontario; some undisturbed fragments remain and there have been efforts to restore disused agricultural land to prairie. The objective of this study was to investigate differences in the community composition of arbuscular mycorrhizal fungi between disturbed and undisturbed TGP at five locations across southwestern Ontario. The V4 variable region of the small ribosomal subunit was amplified from DNAs extracted from soil samples, and sequence analysis yielded operational taxonomic units (OTUs) representing twelve genera of Glomeromycota. There was a significant difference in the community composition of the AMF communities in undisturbed TGP remnants and restored TGP that had been previously disturbed, with an overall greater community diversity and evenness in the undisturbed than previously disturbed sites. Ambispora fennica , three OTUs of Diversispora and four OTUs of Glomus were found to be potential indicator taxa of undisturbed TGPs and, overall, Glomus was significantly more abundant in undisturbed than disturbed sites. In contrast, two other OTUs of Diversispora , two of Entrophospora and one of Septoglomus were found to be potential indicator taxa of disturbed TGPs. These finding have implications for success of TGP restoration and should be considered in future efforts. AMF community metabarcoding disturbance mycorrhizal ecology Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Arbuscular mycorrhizal fungi (AMF), in the phylum Glomeromycota, are obligate symbionts and form mutualistic relationships with a variety of terrestrial plants (Schüßler et al. 2001 ). It is well known that AMF play a key role in the health and growth of plant communities, including economically significant crop plants (Sousa 2023 ). Associations with AMF have been shown to increase reproductive success and offspring survival in plants (Alam et al. 2023 ; Koide and Dickie 2002 ). Plants associated with AMF also have increased tolerance to heavy metals, pathogenic fungi and nematodes (Allen et al. 1995 ; Johnson et al. 1997 ; van der Heijden et al. 1998 ; Jeffries et al. 2003 ; Vandenkoornhuyse et al. 2002 ; Ma et al. 2022 ). Plant community composition is suggested to influence AM fungal communities (van der Heijdan et al. 1998; Eom et al. 2000 ). Community composition of AMF can be related to host species, season, and life stage of host plant (Eom et al. 2000 ; Bever et al. 2001 ; Husband et al. 2002 ; Vandenkoornhuyse et al. 2002 ; Mony et al. 2021 ), as well as the type of plant community, such as grassland or tropical forest (Liu et al. 2023 ). However, it has also been found that plant communities can be influenced by AM fungal communities in return (van der Heijden et al. 1998 ). It was found that restoration of native plants may be highly dependent on the reintroduction of native AMF species (Stover et al. 2018 ). The importance of AMF for plant success is widely accepted but research on the diversity and dynamics of AMF communities is ongoing. Tallgrass prairies (TGPs) are an endangered type of plant community across North America (Samson and Knopf 1996 ). TGPs are dominated by warm-season C4 grasses, such as Big Bluestem ( Andropogon gerardii ) and Indiangrass ( Sorghastrum nutans ) (Rodger 1998 ), which have high mycorrhizal dependence (Hartnett and Wilson 1999 ; McCain et al. 2011 ). These dominant grasses require AMF relationships to receive essential nutrients including water (Proudel et al. 2021). Former TGPs in Southern Ontario were dominated by these and other bunch-grasses and had tremendous diversity of broad-leaved herbaceous plants, many of them restricted to TGP habitat and found nowhere else in Canada (Snyder et al. 2019 ). The two main threats to tallgrass prairies are habitat loss and the introduction of non-native species (Rowe et al. 2013 ). Approximately 78% of the 2.2 million hectares of the Carolinian zone (Ecoregion 7E) in Ontario has been converted to agriculture and an additional 7% to roads and urban areas; most of the remaining natural area is forest (Crins et al. 2009 ). The fertile soils and lack of trees made tallgrass prairies a prime target for conversion to agriculture and urban development (Rodger 1998 ). The largest remaining fragments are located in and near the city of Windsor and Walpole Island (Bkejwanong) First Nation. Presently these areas represent less than 1% of original TGP found in Southern Ontario (Rodger 1998 ). Current prairie restoration efforts are managed by the Ontario Ministry of Natural Resources and Forestry (MNRF), the Nature Conservancy of Canada (NCC) and by smaller agencies like the rare Charitable Research Reserve ( http://raresites.org/ ). Multiple threatened and endangered species of plants and animals live in the remaining TGP sites such as Eastern Prairie White Fringed-orchid ( Platanthera leucophaea ), Small Fringed Lady’s-slipper ( Cypripedium candidum ), Butler’s garter snakes ( Thamnophis butleri ), and spotted turtles ( Clemmys guttata ) (Ontario Ministry of the Environment, Conservation, and Parks 2023). However, these restoration efforts have focused primarily on the above ground plant communities while microbial soil communities have not been addressed, although prairie restoration efforts associated with the Herb Gray Parkway in Windsor included moving soil monoliths from remnants that were to be lost to the restored sites in an attempt to bring the indigenous microbial and fungal communities (The Rt. Hon. Herb Gray Parkway 2011). Restoration studies have investigated the use of commercial AM fungal inoculum versus AM fungal inoculum from native TGPs, and they suggest that inoculum from native TGPs—although more difficult obtain—may improve restoration attempts (Smith et al. 1998 ; Paluch et al. 2013 ; Middleton et al. 2015 ). Studies based on agricultural practices have focused on mechanical disturbance such as tillage, as it greatly disrupts the AMF hyphal networks (Stockinger et al. 2014 ). Soil disturbance damages the external mycelial network and causes a decrease in the level of AMF colonization within plant roots (Jansa et al. 2003 ; Mirás-Avalos et al. 2011 ; Zubek et al. 2022 ). Overall, disturbed and undisturbed sites have different communities of AMF (Galvez et al. 2001 ; Jansa et al. 2002 ; Li et al. 2007 ; Lumini et al. 2010 ; Mirás-Avalos et al. 2011 ; Stover et al. 2012 ; Bainard et al. 2015 ). Soil disturbance also decreases the overall biomass of AMF in roots and soil (Miller et al. 1995 ; Schnoor et al. 2011 ; Thomopoulos et al. 2023 ). Both spore density and hyphal length are negatively affected by tillage (Boddington and Dodd 2000 ; Jansa et al. 2002 ; Oehl et al. 2003 ; Galvez et al. 2001 ; Li et al. 2007 ; Thomopoulos et al. 2023 ). Infectivity of AMF and subsequent nutrient uptake by their host plants is reduced by the disruption of the hyphal network (Jasper et al. 1989 ; Evans and Miller 1990 ; Miller et al. 1995 ; Kabir et al. 1999 ; Mirás-Avalos et al. 2011 ). Tillage not only influences AMF but also affects the soil. Tillage decreases aggregate stability by severing mycelia and causing a decrease in the production of glomalin (Wright and Upadhyaya 1996; Kabir et al. 1999 ; Thomopoulos et al. 2023 ). In general, disturbance from agriculture, including tillage, negatively impacts AMF communities. Previous studies on the effect of disturbance on AMF have primarily focused on agricultural disturbance (such as tillage) because AMF are important associates of crop plants. Thus, the ecology and recovery of AMF following land use change (prairie restoration) is not well understood. It is well documented that tillage and other physical soil disturbance significantly decrease the total AMF biomass present in the soil (Miller et al. 1995 ; Schnoor et al. 2011 ; Thomopoulos et al. 2023 ). Previous studies have observed immediate effects of tillage on mycorrhizae (Boddington and Dodd 2000 ; Galvez et al. 2023; García de León et al. 2018 ) but have not observed the effects long term. In this study we investigated the differences in the AMF community between historically disturbed (e.g., restored prairie sites previously used for agriculture) and undisturbed (remnant TGP) ecosystems. The objective of this study was to assess differences in the community composition of AMF between disturbed and undisturbed TGPs at five locations in southwestern Ontario and identify AMF taxa that may act as potential indicators of ecosystem disturbance. This information is applicable to TGP restoration efforts as research suggests diversity within the AMF community affects native plant communities (Stover et al. 2018 ). Materials and Methods Sample Locations and Soil Sampling Soil samples were collected in 2009 and 2014 from 13 sites across five locations (Fig. 1 ). At each site, samples were taken in June or July and again in October (Table 1 ). Each site was classified as disturbed (6 total) or undisturbed (7 total) based on the known usage history (Table 1 ). Sampling sites were not paired based on location. Six quadrats (1 m 2 ) were selected as subsamples to characterize each habitat, and five soil cores (2.5 cm x 20 cm) were collected from each quadrat and then pooled, homogenized, and frozen at -20 ºC. A 20 g subsample of each sample was suspended in 200 mL of 0.1 M sodium pyrophosphate (Na₄P₂O₇) and wet-sieved through 1.18 mm, 250 µm and 53 µm mesh sizes, Table 1 Locations size and disturbance history of thirteen tallgrass prairie sample sites from five locations across Southern Ontario. Sampling Location Site Site Code Size (ha) Disturbance History Disturbance Group Sampling Dates WIFN1 Prairie WIFN1 0.96 Never tilled Undisturbed Jun/Oct 2009 a Oct 2014 Walpole Island WIFN2 Prairie WIFN2 1.9 1940 Undisturbed Jun/Oct 2009 a Oct 2014 First Nation WIFN3 Prairie WIFN3 13 ≤ 1943 Undisturbed Jun/Oct 2009 a Oct 2014 WIFN4 Restoration WIFN4 0.3 1990 Disturbed Jun/Oct 2009 a WIFN5 Restoration WIFN5 1.67 2006 Disturbed Jun/Oct 2009 a Oct 2014 Ojibway Prairie Prairie 1 OPC1 105 total 1770 Undisturbed Jul/Oct 2014 Nature Reserve Prairie 2 OPC2 1770 Undisturbed Jul/Oct 2014 FRS23 Prairie FRS23 1.75 Unknown Undisturbed Jul/Oct 2014 Herb Gray FRS32 Prairie FRS32 1.59 Unknown Undisturbed Jul/Oct 2014 Parkway FRS27 Restoration FRS27 4.54 2009 Disturbed Jul/Oct 2014 FRS28 Restoration FRS28 7.7 2009 Disturbed Jul/Oct 2014 rare Charitable Research Reserve Blair Flats Restoration Rare 17.4 2009 Disturbed Jul/Oct 2014 Norfolk County De Maere Restoration DMP 20.9 2010 Disturbed Jul/Oct 2014 b a Chokroborty-Hoque (2011) b Catomeris ( 2015 ) rinsed with deionized water, and organic material (spores, hyphae, roots, and organic particles) retained on all sieves was collected, freeze dried, and ground in a mortar and pestle using liquid nitrogen. Molecular Analysis Genomic DNA was extracted from soil samples using a soil Microbe DNA MicroPrep™ kit (Zymo Research, Irvine, CA). Subsamples (0.25 g) of the washed, ground soil organic fractions were used as the substrate for DNA extraction. Each sampling site had six separate DNA extracts, one from each quadrat. For all sites except DMP, DNA extracts from each quadrat and sampling time were PCR amplified separately and then the PCR products pooled by site and sampling time for each barcode. For DMP, which was part of a separate study on the impacts of nitrogen addition on the AMF community (Catomeris 2015 ), PCR products of each plot and sampling time were barcoded separately. For this study, only the DMP control plots with no nitrogen addition were used. There were eight control plots in the original study but two were randomly selected and removed for even sampling design. Genomic DNA samples were amplified using a Glomeromycota-specific primer pair AMV4.5N-F (AAACTCGTAGTTGAATTTCG) and AMDG-R (CCCAACTATCCCTATTAATCAT) that targets the V4 variable region of the small ribosomal subunit (Sato et al. 2005 ). The 5’ ends of the forward and reverse primers were modified to include the forward or reverse Illumina adapter, a 4 bp linker (NNNN), and an 8 bp barcode sequence that allowed recognition of products from different samples following Illumina sequencing (Gloor et al. 2010 ). PCR products were submitted to the London Regional Genomics Centre (Robarts Research Institute, London, ON) for sequencing using the Illumina MiSeq platform using a 2 ⋅ 300 v3 kit (Illumina, San Diego, CA). Data Analysis The raw read files were demultiplexed in DADA2 (Callahan et al. 2016 ) with the addition of a trunclen parameter [truncLen = c(200,190]. Sequences flagged as chimeras were removed using the ‘consensus’ method. Taxonomy was assigned using the SILVA v132 reference files (Quast et al. 2013) and amplified sequence variants (ASVs, or groups of identical sequences) identified as belonging to Glomeromycota were retained. Phylogenetic trees were generated using neighbor-joining in MEGA 11 (Tamura et al. 2021 ). ASVs with less than 0.5% distance and forming terminal clusters in the tree were grouped to create operational taxonomic units (OTUs). The OTU sequences were compared to reference sequences from GenBank and the AMF database https://globalamfungi.com/ (Větrovský et al. 2023 ) using BLASTn (Altschul et al. 1990 ), aligned with selected reference sequences, and analyzed in maximum likelihood trees with 10,000 ultrafast bootstraps in IQ-Tree v3.01 (Wong et al. 2025 ) for further identification. Taxonomy follows Tedersoo et al. ( 2024 ) and Hyde et al. ( 2024 ), and OTUs are further referenced to the closest "virtual taxon" recognized in the MaarjAM database of Glomeromycota sequences ( https://maarjam.ut.ee/ ; Öpik et al. 2010 ). Raw and processed sequence files are deposited as ENA PRJEB103838, and alignments and phylogenetic trees deposited to Figshare (doi: 10.6084/m9.figshare.31299373 ). Statistical analysis was done using R (R Core Team, 2025 ) with packages phyloseq (McMurdie and Holmes 2013 ) and vegan (Oksanen et al. 2025 ). R package ALDEx2 was used to determine if there was a significant difference between the samples collected in June/July and October. The vegdist function in the R package vegan was used to calculate dissimilarity indices for the community data from each site (Oksanen et al. 2025 ). This dissimilarity matrix was then used to perform a permutational multivariate analysis of variance (PERMANOVA) to determine if there was a significant difference in composition between the disturbed and undisturbed site conditions. Principal coordinate analysis (PCoA) was then used to visualize clustering of sample site by disturbance history. Differences in average alpha diversity between the previously disturbed and undisturbed sites and in relative abundance of each taxon identified between the previously disturbed and undisturbed sites were evaluated using a t-test separately for each measure used. The multipatt function in the R package indicspecies (De Cáceres and Legendre, 2009 ) was used to generate indicator values (IndVals) and identify OTUs that were significant in either the disturbed or undisturbed conditions. Results The merged and quality-filtered sequences yielded 765,446 total reads. From this dataset, 672 Glomeromycota ASVs were identified, which clustered into 213 OTUs following phylogenetic grouping. Using ANOVA-Like Differential Expression (ALDEx), no significant difference was found between the composition of samples taken in the June/July collection and samples taken in the October collection across each site ( F (1,25) = 1.46, p = 0.137), so samples collected in the summer and fall were combined for each site in further analyses. There was no significant difference in richness between the disturbed sites and undisturbed sites ( t (11) =-0.91, p = 0.383; Fig. 2 ). Community diversity was significantly greater in undisturbed sites than restored, previously disturbed sites, as measured by Shannon's ( t (11) =-2.73, p = 0.019), Simpson's ( t (11) =-2.92, p = 0.014), and Fisher's indices ( t (11) =-2.23, p = 0.049). Restored fields WIFN4 and WIFN5 had the highest Shannon’s diversity of all disturbed sites; both sites were cultivated for fewer than five years before being passively allowed to return to prairie and are located near remnant prairies. The rare site—recently intentionally restored from long-term traditional agriculture—had the lowest richness and diversity of all sites (Fig. 2 ). Pielou’s evenness was calculated for each site and averaged for each disturbance condition. Evenness was significantly greater at undisturbed sites than previously disturbed sites ( t (11) =-2.97, p = 0.013). A PERMANOVA test indicated a significant difference in community composition between the disturbed and undisturbed sampling locations (pseudo- F (1,11) = 2.40, R 2 = 0.179, p = 0.020). Principal coordinate analysis (PCoA) supported the clustering of sample sites by disturbance history (Fig. 3 ). The exception to this was the restored field site WIFN4. This site was classified as disturbed, having been most recently used for agriculture in 1990, approximately 20 years earlier than the other disturbed sites considered here, but it clustered with the undisturbed sites. Twelve genera of Glomeromycota were found (Table 2 ). Dominant genera included Diversispora with 42.4% of all reads across all sites, Entrophospora (formerly known as Claroideoglomus ) with 22.6%, Glomus (19.4%), and Septoglomus (7.6%). Nine of the thirteen sites, both disturbed and undisturbed, were dominated by sequences identified as Diversispora , ranging in relative abundance at these sites from 30–72%. Three disturbed sites were dominated by sequences identified as Entrophospora , including FRS27 (58.6%), FRS28 (43.5%) and WIFN5 (33.4%); Entrophospora was generally more abundant in disturbed than undisturbed sites, but not significantly so (Welch’s t (6.23) = 1.93, p = 0.0996). One undisturbed site (FRS23) was dominated by sequences identified as Septoglomus (32.1%). Sequences identified as Glomus were co-dominant in undisturbed sites, where their relative abundance ranged from 10.1–36.9%, whereas their relative abundance in disturbed sites ranged from 5.3–23.3%; Glomus sequences Table 2 Relative abundance (%) of OTUs grouped by genera within each sampling site, with three most abundant taxa at each site shown in bold and total reads (thousands) for each site. Site codes from Table 1 . Genus \ Site Undisturbed Disturbed Total WIFN1 WIFN2 WIFN3 OPC1 OPC2 FRS23 FRS32 WIFN4 WIFN5 FRS27 FRS28 Rare DMP (%) Acaulospora 0.11 0.22 0.02 0.00 1.52 0.00 1.01 0.00 0.05 0.00 0.00 0.26 0.00 0.107 Ambispora 0.48 1.13 0.08 0.52 2.90 6.02 0.53 0.49 0.00 0.00 0.00 0.00 0.00 0.446 Diversispora 65.01 43.20 53.52 29.77 31.42 26.51 44.86 39.98 30.31 11.45 28.43 72.14 69.26 42.415 Entrophospora 3.75 4.37 4.17 17.29 13.37 17.08 22.44 16.49 33.43 58.60 43.52 15.13 4.85 22.604 Funneliformis 0.26 1.34 1.57 4.27 7.11 7.12 2.31 6.44 2.34 4.36 2.25 0.00 0.00 2.115 Gigaspora 0.00 0.00 0.00 0.05 0.05 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.002 Glomus 23.66 36.93 26.31 26.82 20.97 10.11 16.30 14.87 23.37 9.52 16.04 5.31 8.58 19.364 Pacispora 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 1.04 0.122 Paraglomus 0.09 0.61 0.25 1.21 0.66 0.64 0.85 0.13 0.72 4.85 6.69 1.42 11.32 3.557 Rhizophagus 1.26 2.18 1.16 6.83 1.08 0.16 0.39 0.58 1.43 2.81 0.42 0.16 0.32 1.070 Scutellospora 0.00 0.00 0.00 0.07 1.26 0.26 0.00 0.00 0.12 0.00 0.00 0.34 4.34 0.570 Septoglomus 5.38 10.00 12.93 13.18 19.66 32.11 11.32 21.01 8.23 8.42 2.65 5.24 0.30 7.628 SUM (reads x 10 3 ) 100 (78) 100 (85) 100 (58) 100 (11) 100 (17) 100 (21) 100 (18) 100 (35) 100 (102) 100 (32) 100 (197) 100 (22) 100 (90) 100 (765) were significantly more abundant in undisturbed than disturbed sites ( t (11) =-2.36, p = 0.038). Paraglomus was co-dominant at De Maere Prairie (11.3%), but all other genera were uncommon to rare, with total reads ranging from 2.1% ( Funneliformis ) to 0.002% ( Gigaspora ). There were five OTUs identified as indicator taxa for the disturbed conditions and eight OTUs identified as indicator taxa for the undisturbed conditions (Fig. 4 ). Indicator taxa for disturbed prairies were Diversispora (OTU 28, VTX0035; OTU 33, cf. VTX00054), Entrophospora (OTU 148, cf. VTX00225), Entrophospora lamellosa (OTU 154, VTX00193), and Septoglomus (OTU 178, cf. VTX00063). Indicator taxa for undisturbed prairies were Glomus (OTU 67, cf. VTX00214; OTU 80, VTX00202; OTU 65, VTX00234; OTU 88, VTX00323), Diversispora (OTU 32, VTX00380; OTU 38, cf. VTX00263; and OTU 44, cf. VTX00263), and Ambispora fennica (OTU 3, VTX00283). Discussion Based on past research (Jansa et al. 2002 ; Lumini et al. 2010 ; Stover et al. 2012 ), it was predicted that the AMF communities found in disturbed TGPs would be different than the AMF communities found in undisturbed TGPs and that undisturbed TGPs would have higher community diversity (but not OTU richness) than disturbed TGPs. Our results supported these predictions. Agricultural tillage and mechanical disturbance have been shown to disrupt not only the connection of the AMF hyphal network to a single host plant but to all potential host plants that interact with the hyphal web (Jasper et al. 1989 ; Liu et al. 2023 ; Smith and Read 2008 ). As a result of this type of disturbance, AMF infectivity decreases and the total amount of active hyphae also decreases, as the damaged hyphal network must recolonize the host roots (Kabir et al. 1999 ; Galvez et al. 2011; Mirás-Avalos et al. 2011 ). Principal coordinates analysis showed that sites mostly grouped by disturbance condition, with one distinct outlier (Fig. 3 ). The outlier, restored field WIFN4, was classified as a disturbed site based on the land use history but grouped more closely with the undisturbed sites. The agriculture at this site ended in 1990 and it has since been restored to prairie (Table 1 ). One interpretation of this finding is that the ~ 20 years that elapsed between the last agricultural usage was sufficient for AMF communities to transition back towards the composition characteristic of undisturbed TGPs. This conclusion is supported by previous studies (Basiru and Hijri 2022 ; Hamel et al. 1994 ; Li et al. 2007 ), which found that disturbed AMF communities can transition back to their native composition over time. The restored field WIFN4 is also geographically close to WIFN1 prairie as a possible source of mycorrhizal inoculum; however, the adjacent WIFN5 restored field (disturbed) and WIF2 prairie (undisturbed) did not cluster in a similar way. Within the undisturbed prairie sites, the three prairies on Walpole Island clustered separately from a cluster of the four undisturbed prairies in the Windsor area (Fig. 3 ). These groups suggest that geographic location may be one driver of AMF community similarity, as has been found in other studies (da Nóbrega Veras et al. 2025 ; Xu et al. 2016 ). Some of the observed clustering patterns may be explained by the difference in colonization strategies of AMF species. Early colonizers tend to be generalist species that are better adapted to rapidly colonize disturbed environments. Furthermore, species that reproduce via spores may have a greater chance of persisting in the environment post-disturbance, allowing for faster recolonization (Cahyaningtyas and Ezawa 2023 ; Hamel et al. 1994 ; Hart and Reader 2004 ; Mathimaran et al. 2005 ). There is research that also suggests some AMF species can survive disturbances sheltered within the host plant and recolonize post-disturbance by regrowing from within the host’s root (Cahyaningtyas and Ezawa 2023 ; Hart and Reader 2004 ). Other clustering patterns may be attributed to the greater taxonomic diversity of plants present at the undisturbed sites, compared to the high dominance of species such as Solidago altissima, Melilotus alba , and Trifolium repens in the disturbed sites (Eom et al. 2000 ; Stover et al. 2012 ; Mony et al. 2021 ). Diversity of AMF communities, but not species richness, was greater at undisturbed sites, indicating that evenness is a key difference between the disturbed and undisturbed conditions. This is, in part, due to plant species dominance in the disturbed sites, which leads to lower evenness of species distribution within the AMF community. Four OTUs identified as the genus Glomus (OTU 67, cf. VTX00214; OTU 80, VTX00202; OTU 65, VTX00234; OTU 88, VTX00323) were found to be indicators of undisturbed TGP sites. There are 30 defined genera within the formerly inclusive genus Glomus , some of which are associated with agricultural disturbance (Tedersoo et al. 2024 ). However, since we lack information to recognize these segregate genera, unless an OTU of Glomus is identified to the species level, it is difficult to draw accurate conclusions about its ecology. There is new evidence from Delavaux et al. ( 2025 ) that the family Glomeraceae is a disturbance sensitive group and we found Glomus to be significantly more abundant in undisturbed prairie sites than disturbed ones. What is known about reproduction in Glomus species is that they demonstrate blastic expansion of hyphal tips prior to spore development (Schüßler and Walker 2010 ). The hyphal networks are sensitive to mechanical disturbances and, if disrupted prior to spore formation, reproduction would cease. This is consistent with most Glomus OTUs being associated with undisturbed TGP sites that did not experience mechanical disturbances such as tillage. Three OTUs identified as members of the genus Diversispora were identified as indicator taxa for undisturbed TGP sites, whereas two were indicators of disturbed sites. This may be due to variation in morphological characteristics of the spores and reproductive strategies within the genus. Spores produced by Diversispora species lack a rigid laminate layer and are more likely to flatten under pressure (Schüßler and Walker 2010 ). If the spores produced by species in this genus are more fragile than those of other taxa, mechanical disturbance, such as tillage, is likely to hinder their reproduction in disturbed environments. As with Glomus , it is difficult to draw more specific conclusions about the effects of disturbance on Diversispora without species level identifications. Further research is needed to identify species and their reproductive patterns within Diversispora and how the morphological traits may influence species disturbance tolerance. Future investigations using a more phylogenetically informative marker than the short V4 region of 18S that was used may find a stronger phylogenetic signal correlated with the disturbance-sensitive OTUs within Diversispora or Glomus . Ambispora fennica was also identified as an indicator taxon associated with undisturbed TGP sites. This genus reproduces via a sporiferous saccule that expands blastically from a branched network of reproductive hyphae (Walker et al. 2007 ). As with Glomus , Ambispora species are sensitive to mechanical disturbance that disrupts the reproductive hyphae and are thus more common in the undisturbed TGPs. A study by van der Hyde et al. (2017), found that Ambisporaceae is on average less tolerant to disturbance than other AMF families, but more research is needed to confirm these findings. Two OTUs of the genus Entrophospora were identified as indicators of disturbed TGPs. Entrophospora species are considered generalists (Błaszkowski et al. 2022 ). They can colonize disturbed environments rapidly, which is consistent with Entrophospora being found in greater abundance at disturbed TGP sites than undisturbed TGP sites (Błaszkowski et al. 2022 ; Delavaux et al. 2025 ; García de León et al. 2018 ). One of the OTUs found as indicator taxa for the disturbed TGP sites was identified as Entrophospora lamellosa , a species that was first found associated with beach grasses in the Great Lakes region, including Ontario (Dalpé et al. 1992). This species is known to sporulate abundantly, which likely aids in the fast recolonization of disturbed environments (Dalpé et al. 1992). Another disturbance-associated OTU was identified as Septoglomus . There is evidence that species in this genus, such as Septoglomus viscosum , are disturbance resistant and can efficiently recolonize from within the root of the host plant (Redecker et al. 2013). These findings have implications for current and future restoration efforts and indicate that land use history could be used to predict AMF community composition. Understanding what species are associated with disturbed and undisturbed TGPs could be used in future restoration efforts such as determining which AMF inoculum would be beneficial for a prairie restoration project. If native AMF taxa are introduced to a TGP site, it could aid the establishment of native plants, such as C4 grasses, that rely on mycorrhizal relationships (Hartnett and Wilson 1999 ; Hopkins and Bennett 2023 ; McCain et al. 2011 ). Koziol et al. ( 2023b ) found that when AMF inoculum was applied in high densities at prairie restoration sites, the benefit to native plant abundance, richness, and diversity persisted for the first four years. Furthermore, the addition of AMF has been found to add the establishment of late successional species in grasslands and deter non-native species competition (Duell et al. 2022 ; Koziol et al. 2023a ). The conservation and restoration of the TGP fragments in Ontario should be prioritized as they are home to many unique species, both above and below ground, and are vulnerable to disturbance due to land use change. Declarations Research Funding This research did receive funding. Sarah N. Allan Maloney received funding from rare Ecological Reserve. Nimalka M. Weerasuriya received funding from rare Ecological Reserve. R. Greg Thorn received funding from Natural Sciences and Engineering Research Council of Canada (NSERC). Author Contribution RGT conceived the research, which was carried out by SNAM with assistance by CRJ and NMW. Analyses were conducted by SNAM, ACJ, NMW and RGT, figures prepared by ACJ and NMW, and the manuscript was written by ACJ, NMW and RGT. All authors reviewed the manuscript. Acknowledgement We thank Aniruddho Chokroborty-Hoque and Catriona Catomeris for collecting soil samples later processed by SNAM, Jenna Quinn and Clint Jacobs for permissions to collect samples at rare Ecological Reserve and Walpole Island (Bkejwanong) First Nation, respectively, the Ministry of Transportation Ontario, the Ministry of Natural Resources and Forestry, the Right Honourable Herb Gray Parkway, the Ojibway Prairie Provincial Nature Reserve, funding from NSERC to RGT and from rare Ecological Reserve to SNAM and NMW, and Zoë Lindo (Biology, University of Western Ontario) for a pre-submission review. Data Availability Raw and processed sequence files are deposited as ENA PRJEB103838, and alignments and phylogenetic trees deposited to Figshare (doi: 10.6084/m9.figshare.31299373). References Alam MZ, Choudhury TR, Mridha MAU (2023) Arbuscular mycorrhizal fungi enhance biomass growth, mineral content, and antioxidant activity in tomato plants under drought stress. J Food Qual 2023:2581608. https://doi.org/10.1155/2023/2581608 Allan SN (2017) Disturbance and the Community Composition of Arbuscular Mycorrhizal Fungi in Ontario Tallgrass Prairies. MSc Thesis, University of Western Ontario Allen EB, Allen MF, Helm DJ et al (1995) Patterns and regulation of mycorrhizal plant and fungal diversity. Plant Soil 170:47–62 Altschul SF, Gish W, Miller W et al (1990) Basic Local Alignment Search Tool. J Mol Biol 215:403–410. https://doi:10.1016/S0022-2836(05)80360-2 Asemaninejad A, Weerasuriya N, Gloor GB et al (2016) New primers for discovering fungal diversity using nuclear large ribosomal DNA. PLoS ONE 11:e0159043. https://doi.org/10.1371/journal.pone.0159043 Bainard LD, Dai M, Gomez EF et al (2015) Arbuscular mycorrhizal fungal communities are influenced by agricultural land use and not soil type among the Chernozem great groups of the Canadian Prairies. Plant Soil 387:351–362. https://doi.org/10.1007/s11104-014-2288-1 Basiru S, Hijri M (2022) The potential applications of commercial arbuscular mycorrhizal fungal inoculants and their ecological consequences. Microorganisms 10:1897. https://doi.org/10.3390/microorganisms10101897 Bever JD, Schultz PA, Pringle A, Morton JB (2001) Arbuscular mycorrhizal fungi: More diverse than meets the eye and the ecological tale of why. BioScience 51:923–931. https://doi.org/10.1641/0006-3568( 2001)051[0923:AMFMDT]2.0.CO;2 Błaszkowski J, Sánchez-García M, Niezgoda P et al (2022) A new order Entrophosporales and three new Entrophospora species in Glomeromycota. Front Microbiol 13:962856. https://doi.org/10.3389/fmicb.2022.962856 Boddington CL, Dodd JC (2000) The effect of agricultural practices on the development of indigenous arbuscular mycorrhizal fungi. I. Field studies in an Indonesian ultisol. Plant Soil 218:137–144. https://doi.org/10.1023/A:1014966801446 Cahyaningtyas A, Ezawa T (2023) Disturbance tolerance of arbuscular mycorrhizal fungi: characterization of life-history strategies along a disturbance gradient in a coastal dune ecosystem. Plant Soil 495:535–549. https://doi.org/10.1007/s11104-023-06337-4 Callahan BJ, McMurdie PJ, Rosen MJ et al (2016) DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13:581–583. https://doi.org/10.1038/nmeth.3869 Catomeris C (2015) Arbuscular mycorrhizal fungal community response to increased nitrogen deposition in a restored tallgrass prairie. BSc Thesis, University of Western Ontario Chokroborty-Hoque A (2011) Arbuscular mycorrhizal fungal communities in tallgrass prairies at Walpole Island Ontario. MSc Thesis, University of Western Ontario Crins W, Gray PA, Uhlig P, Wester MC (2009) The ecosystems of Ontario Part 1: Ecozones and Ecoregions. Ministry of Natural Resources. https://files.ontario.ca/mnrf-ecosystemspart1-accessible-july2018-en-2020-01-16.pdf Dalpe Y, Koske RE, Tews LL (1992) Glomus lamellosum sp.nov.: A new Glomaceae associated with beach grass. Mycotaxon 63:289–293 da Nóbrega Veras JS, Mendes-Alvarenga RL, de Souza Rodrigues GRL et al (2025) Spatial and environmental factors influence AMF assemblages across the Brazilian Atlantic Forest - a biodiversity hotspot. Eur J Res 144:121–131. https://doi.org/10.1007/s10342-024-01745-2 De Cáceres M, Legendre P (2009) Associations between species and groups of sites: indices and statistical inference. Ecology 90:3566–3574. https://doi:10.1890/08-1823.1 de Sousa RN (2023) Arbuscular mycorrhizal fungi in agriculture: new insights. IntechOpen. https://doi.org/10.5772/intechopen.104271 Delavaux CS, Aellen A, Stürmer SL et al (2025) Uncovering diversity within the Glomeromycota: novel clades family distributions and land use sensitivity. Ecol Evol 15:70597. https://doi.org/10.1002/ece3.70597 Duell EB, Hickman KR, Wilson GWT, Zhang Y (2022) Inoculation with native grassland soils improves native plant species germination in highly disturbed soil. Grassl Res 1:75–83. https://doi.org/10.1002/glr2.12018 Eom AH, Hartnett DC, Wilson GWT (2000) Host plant species effects on arbuscular mycorrhizal fungal communities in tallgrass prairie. Oecologia 122:435–444. https://doi.org/10.1007/s004420050050 Evans DG, Miller MH (1990) The role of the external mycelial network in the effect of soil disturbance upon vesicular-arbuscular mycorrhizal colonization of maize. New Phytol 114:65–71. https://doi.org/10.1111/j.1469-8137.1990.tb00374.x Galvez L, Douds DD, Drinkwater LE, Wagoner P (2001) Effects of tillage and farming system upon VAM fungus populations and mycorrhizas and nutrient uptake of maize. Plant Soil 228:299–308. https://doi.org/10.1023/A:1004810116854 Gangwar RK, Makádi M, Bresilla B et al (2022) Effects of land uses and soil types on microbial activity and community structure. Int Agrophys 36:323–336. https://doi.org/10.31545/intagr/155096 García de León D, Davison J, Moora M et al (2018) Anthropogenic disturbance equalizes diversity levels in arbuscular mycorrhizal fungal communities. Glob Chang Biol 24:2649–2659. https://doi.org/10.1111/gcb.14131 Gloor GB, Hummelen R, Macklaim JM et al (2010) Microbiome profiling by illumina sequencing of combinatorial sequence-tagged PCR products. PLoS ONE 5:e15406. https://doi.org/10.1371/journal.pone.0015406 Hamel C, Dalpé Y, Lapierre C et al (1994) Composition of the vesicular-arbuscular mycorrhizal fungi population in an old meadow as affected by pH phosphorus and soil disturbance. Agric Ecosyst Environ 49:223–231. https://doi.org/10.1016/0167-8809(94)90051-5 Han Q, Li Z, Jiang Y et al (2025) Effects of grassland degradation on diversity of arbuscular mycorrhizal fungi of a pioneer plant. Int Microbiol 28:603–621. https://doi.org/10.1007/s10123-024-00564-0 Hart MM, Reader RJ (2004) Do arbuscular mycorrhizal fungi recover from soil disturbance differently? Trop Ecol 45:97–111. https://doi.org/10.1016/j.apsoil.2018.07.008 Hartnett DC, Wilson GWT (1999) Mycorrhizae influence plant community structure and diversity in tallgrass prairie. Ecology 80:1187–1195. https://doi.org/10.1890/0012-9658(1999 )080[1187:MIPCSA]2.0.CO;2 Hopkins JR, Bennett AE (2023) Spore traits mediate disturbance effects on arbuscular mycorrhizal fungal community composition and mutualisms. Ecology 104:e4016. https://doi.org/10.1002/ecy.4016 Husband R, Herre EA, Turner SL et al (2002) Molecular diversity of arbuscular mycorrhizal fungi and patterns of host association over time and space in a tropical forest. Mol Ecol 11:2669–2678. https://doi.org/10.1046/j.1365-294X.2002.01647.x Hyde KD, Noorabadi MT, Thiyagaraja V et al (2024) The 2024 outline of fungi and funguslike taxa. Mycosphere 15:5146–6239. https://doi.org/10.5943/mycosphere/15/1/25 Jansa J, Mozafar A, Anken T et al (2002) Diversity and structure of AMF communities as affected by tillage in a temperate soil. Mycorrhiza 12:225–234. https://doi.org/10.1007/s00572-002-0163-z Jansa J, Mozafar A, Kuhn G et al (2003) Soil tillage affects the community structure of mycorrhizal fungi in maize roots. Ecol Appl 13:1164–1176. https://doi.org/10.1890/1051-0761(2003 )13[1164:STATCS]2.0.CO;2 Jasper DA, Abbott LK, Robson AD (1989) Soil disturbance reduces the infectivity of external hyphae of vesicular-arbuscular mycorrhizal fungi. New Phytol 112:93–99. https://doi.org/10.1111/j.1469-8137.1989.tb00313.x Jeffries P, Gianinazzi S, Perotto S et al (2003) The contribution of arbuscular mycorrhizal fungi in sustainable maintenance of plant health and fertility. Biol Fertil Soils 37:1–16. https://doi.org/10.1007/s00374-002-0546-5 Johnson NC, Graham JH, Smith FA (1997) Functioning of mycorrhizal associations along the mutualism-parasitism continuum. New Phytol 135:575–586. https://doi.org/10.1046/j.1469-8137.1997.00729.x Kabir Z, O’Halloran IP, Hamel C (1999) Combined effects of soil disturbance and fallowing on plant and fungal components of mycorrhizal corn (Zea mays L). Soil Biol Biochem 31:307–314. https://doi.org/10.1016/S0038-0717(98)00124-2 Koide RT, Dickie IA (2002) Effects of mycorrhizal fungi on plant populations. Plant Soil 244:307–317. https://doi.org/10.1023/A:1020204004844 Koziol L, McKenna TP, Bever JD (2023a) Native microbes amplify native seedling establishment and diversity while inhibiting a non-native grass. Plants 12:1184. https://doi.org/10.3390/plants12051184 Koziol L, McKenna TP, Crews TE, Bever JD (2023b) Native arbuscular mycorrhizal fungi promote native grassland diversity and suppress weeds 4 years following inoculation. Restor Ecol 31:13772. https://doi.org/10.1111/rec.13772 Li L, Tao L, Zhao Z (2007) Differences of arbuscular mycorrhizal fungal diversity and community; between a cultivated land an old field and a never cultivated field in a hot and arid ecosystem of southwest China. Mycorrhiza 17:655–665. https://doi.org/10.1007/s00572-007-0143-4 Liu S, Vasar M, Öpik M, Koorem K (2023) Disturbance induces similar shifts in arbuscular mycorrhizal fungal communities from grassland and arable field soils. Mycorrhiza 33:153–164. https://doi.org/10.1007/s00572-023-01108-6 Lumini E, Orgiazzi A, Borriello R et al (2010) Disclosing arbuscular mycorrhizal fungal biodiversity in soil through a land-use gradient using a pyrosequencing approach. Environ Microbiol 12:2165–2179. https://doi.org/10.1111/j.1462-2920.2009.02099.x Ma Y, Ankit A, Tiwari J, Bauddh K (2022) Plant-mycorrhizal fungi interactions in phytoremediation of geogenic contaminated soils. Front Microbiol 13:843415–843415. https://doi.org/10.3389/fmicb.2022.843415 Mathimaran N, Ruh R, Vullioud P et al (2005) Glomus intraradices dominates arbuscular mycorrhizal communities in a heavy textured agricultural soil. Mycorrhiza 16:61–66. https://doi.org/10.1007/s00572-005-0014-9 McCain KNS, Wilson GWT, Blair JM (2011) Mycorrhizal suppression alters plant productivity and forb establishment in a grass-dominated prairie restoration. Plant Ecol 212:1675–1685. https://doi.org/10.1007/s11258-011-9940-0 McMurdie M, Holmes S (2013) phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8:e61217. http://dx.plos.org/10.1371/journal.pone.0061217 Middleton EL, Richardson S, Koziol L et al (2015) Locally adapted arbuscular mycorrhizal fungi improve vigor and resistance to herbivory of native prairie plant species. Ecosphere 6:276. http://dx.doi.org/10.1890/ES15-00152.1 Miller MH, McGonigle TP, Addy HD (1995) Functional ecology of vesicular arbuscular mycorrhizas as influenced by phosphate fertilization and tillage in an agricultural ecosystem. Crit Rev Biotechnol 15:241–255. https://doi.org/10.3109/07388559509147411 Mirás-Avalos JM, Antunes PM, Koch A et al (2011) The influence of tillage on the structure of rhizosphere and root associated arbuscular mycorrhizal fungal communities. Pedobiologia 54:235–241. https://doi.org/10.1016/j.pedobi.2011.03.005 Mony C, Gaudu V, Ricono C et al (2021) Plant neighbours shape fungal assemblages associated with plant roots: A new understanding of niche-partitioning in plant communities. Funct Ecol 35:1768–1782. https://doi.org/10.1111/1365-2435.13804 Oehl F, Sieverding E, Ineichen K et al (2003) Impact of land use intensity on the species diversity of arbuscular mycorrhizal fungi in agroecosystems of central Europe. Appl Environ Microbiol 69:2816–2824. https://doi.org/10.1128/AEM.69.5.2816-2824.2003 Oksanen J, Simpson G, Blanchet F et al (2025) vegan: Community Ecology Package. R package version 2.6-4. https://CRAN.R-project.org/package=vegan Ontario Ministry of the Environment Conservation and Parks (2023) Species at risk in Ontario. https://www.ontario.ca/page/species-risk-ontario Öpik M, Vanatoa A, Vanatoa E et al (2010) The online database MaarjAM reveals global and ecosystemic distribution patterns in arbuscular mycorrhizal fungi (Glomeromycota). New Phytol 188:223–224. https://doi.org/10.1111/j.1469-8137.2010.03334.x Paluch EC, Thomsen MA, Volk TJ (2013) Effects of resident soil fungi and land use history outweigh those of commercial mycorrhizal inocula: Testing a restoration strategy in unsterilized soil. Restor Ecol 21:380–389. https://doi.org/10.1111/j.1526-100X.2012.00894.x Poudel M, Mendes R, Costa LAS et al (2021) The role of plant-associated bacteria, fungi, and viruses in drought stress mitigation. Front Microbiol 12. https://doi:10.3389/fmicb.2021.743512 R Core Team (2025) R: A language and environment for statistical computing. R Foundation for Statistical Computing Vienna Austria. https://www.R-project.org/ Redecker D, Hijri I, Wiekmen A (2003) Molecular identification of arbuscular mycorrhizal fungi in roots: perspectives and problems. Folia Geobot 38:113–124. https://doi.org/10.1007/BF02803144 Rodger L (1998) Tallgrass communities of southern Ontario; a recovery plan. World Wildlife Fund Canada and the Ontario Ministry of Natural Resources. https://tallgrassontario.org/wp-site/wp-content/uploads/2018/07/TallgrassRecoveryPlan.pdf Rowe HI, Fargione J, Holland JD (2013) Prairie restorations can protect remnant tallgrass prairie plant communities. Am Midl Nat 170:26–38. https://doi.org/10.1674/0003-0031-170.1.26 Samson FB, Knopf FL (1996) Prairie conservation: preserving North America’s most endangered ecosystem. Island, Washington DC USA Sato K, Suyama Y, Saito M, Sugawara K (2005) A new primer for discrimination of arbuscular mycorrhizal fungi with polymerase chain reaction-denature gradient gel electrophoresis. Grassl Sci 51:179–181. https://doi.org/10.1111/j.1744-697X.2005.00023.x Schnoor TK, Martensson L, Olsson PA (2011) Soil disturbance alters plant community composition and decreases mycorrhizal carbon allocation in a sandy grassland. Oecologia 167:809–819. https://doi.org/10.1007/s00442-011-2020-2 Schüßler A, Walker C (2010) The Glomeromycota: a species list with new families. http://www.amf-phylogeny.com/ Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum the Glomeromycota: phylogeny and evolution. Mycol Res 105:1413–1421. https://doi.org/10.1017/S0953756201005196 Smith MR, Charvat I, Jacobson RL (1998) Arbuscular mycorrhizae promote establishment of prairie species in a tallgrass prairie restoration. Can J Bot 76:1947–1954. https://doi.org/10.1139/b98-205 Smith SE, Read DJ (2008) Mycorrhizal symbiosis, 3rd edn. Academic, Cambridge UK Snyder S, Lebedyk D, Stuart D et al (2019) Tallgrass Communities of Southern Ontario Conservation Plan: 2019 Update and Recovery Plan. Ontario Ministry of Natural Resources and Forestry. https://tallgrassontario.org/wp-site/wp-content/uploads/2021/05/2019-Update-to-the-Ontario-Tallgrass-Conservation-Plan-revision-1.pdf Soteras F, Grilli G, Cofré MN et al (2015) Arbuscular mycorrhizal fungal composition in high montane forests with different disturbance histories in central Argentina. Appl Soil Ecol 85:30–37. https://doi.org/10.1016/j.apsoil.2014.09.004 Stockinger H, Peyret-Guzzon M, Koegel S et al (2014) The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field. PLoS ONE 9:e107783. https://doi:10.1371/journal.pone.0107783 Stover HJ, Naeth MA, Boldt-Burisch K (2018) Soil disturbance changes arbuscular mycorrhizal fungi richness and composition in a fescue grassland in Alberta Canada. Appl Soil Ecol 131:29–37. https://doi.org/10.1016/j.apsoil.2018.07.008 Stover H, Thorn RG, Bowles JM et al (2012) Arbuscular mycorrhizal fungi and vascular plant species abundance and community structure in tallgrass prairies with varying agricultural disturbance histories. Appl Soil Ecol 60:61–70. https://doi.org/10.1016/j.apsoil.2012.02.016 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022–3027. https://doi.org/10.1093/molbev/msab120 Tedersoo L, Magurno F, Alkahtani S, Mikryukov V (2024) ໿Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes). MycoKeys 107:273–325. https://doi.org/10.3897/mycokeys.107.125549 The Rt Hon. Herb Gray Parkway (2011). Environment. Retrieved from https://www.hgparkway.com/node/4 Thomopoulos S, Elsgaard L, Munkholm LJ, Ravnskov S (2023) Evaluation of the relation between soil biomass of arbuscular mycorrhizal fungi and glomalin-related soil protein in conservation agriculture. Soil Biol Biochem 187:109222. https://doi.org/10.1016/j.soilbio.2023.109222 n der Heijden MGA, Klironomos JN, Ursic M et al (1998) Mycorrhizal fungal diversity determines plant diversity ecosystem variability and productivity. Nature 396:69–72. https://doi.org/10.1038/23932 n der Heyde M, Ohsowski B, Abbott LK, Hart M (2017) Arbuscular mycorrhizal fungus responses to disturbance are context-dependent. Mycorrhiza 27:431–440. https://doi.org/10.1007/s00572-016-0759-3 Vandenkoornhuyse P, Husband R, Daniell TJ et al (2002) Arbuscular mycorrhizal community composition associated with two plant species in a grassland ecosystem. Mol Ecol 11:1555–1564. https://doi.org/10.1046/j.1365-294X.2002.01538.x Větrovský T, Kolaříková Z, Lepinay C et al (2023) GlobalAMFungi: a global database of arbuscular mycorrhizal fungal occurrences from high-throughput sequencing metabarcoding studies. New Phytol 240:2151–2163. https://doi.org/10.1111/nph.19283 Walker C, Vestberg M, Schüßler A (2007) Nomenclatural clarification in Glomeromycota. Mycol Res 111:253–256. https://doi.org/10.1016/j.mycres.2007.02.009 Wong TKF, Ly-Trong N, Ren H (2025) IQ-TREE 3: Phylogenomic Inference Software using Complex Evolutionary Models. Preprint at https://doi.org/10.32942/X2P62N Wright SF, Upadhyaya A (1998) A survey of soils for aggregate stability and glomalin a glycoprotein produced by hyphae of arbuscular mycorrhizal fungi. Plant Soil 198:97–107. https://doi.org/10.1023/A:1004347701584 Xu T, Veresoglou SD, Chen Y et al (2016) Plant community geographic distance and abiotic factors play different roles in predicting AMF biogeography at the regional scale in northern China. Environ Microbiol Rep 8:1048–1057. https://doi.org/10.1111/1758-2229.12485 Zubek S, Kapusta P, Rożek K et al (2022) Fungal root colonization and arbuscular mycorrhizal fungi diversity in soils of grasslands with different mowing intensities. Appl Soil Ecol 172:104358. https://doi.org/10.1016/j.apsoil.2021.104358 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 06 May, 2026 Reviews received at journal 30 Apr, 2026 Reviews received at journal 30 Apr, 2026 Reviewers agreed at journal 03 Apr, 2026 Reviewers agreed at journal 02 Apr, 2026 Reviewers invited by journal 01 Apr, 2026 Editor assigned by journal 01 Apr, 2026 Submission checks completed at journal 30 Mar, 2026 First submitted to journal 17 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9149922","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":616923815,"identity":"886a8e57-e8b0-4482-b057-fa1b7d3c8fc1","order_by":0,"name":"Ada C. Jarosch","email":"","orcid":"","institution":"Western University","correspondingAuthor":false,"prefix":"","firstName":"Ada","middleName":"C.","lastName":"Jarosch","suffix":""},{"id":616923816,"identity":"2bed2f04-a68b-4c02-9e7d-e4f2f764ef9e","order_by":1,"name":"Sarah N. Allan Maloney","email":"","orcid":"","institution":"Western University","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"N. Allan","lastName":"Maloney","suffix":""},{"id":616923817,"identity":"a29a14e7-1495-4686-b3fc-7b44bd2d8ebc","order_by":2,"name":"Nimalka M. Weerasuriya","email":"","orcid":"","institution":"Western University","correspondingAuthor":false,"prefix":"","firstName":"Nimalka","middleName":"M.","lastName":"Weerasuriya","suffix":""},{"id":616923818,"identity":"121517da-37c8-4da5-88e8-420618e46b14","order_by":3,"name":"Clinton R. Jacobs","email":"","orcid":"","institution":"University of Windsor","correspondingAuthor":false,"prefix":"","firstName":"Clinton","middleName":"R.","lastName":"Jacobs","suffix":""},{"id":616923819,"identity":"316498be-ecaa-456b-b949-7925d7ed7975","order_by":4,"name":"R. Greg Thorn","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAp0lEQVRIiWNgGAWjYHACNhAhR4oOZrAWY9K1JDYQrcG8f/2xBx/33EnfcCP5AMOPGiK0yNx4zG4449mz3A030hIYe44RoUVC4jCbNM+Bw7kbbucYMEOCgkgt6QZgLf+I0cLfDNaSANbC2EaULcxmkjMOHDacef9ZwsHePqJsOfhM4sOBw/J8Zw4ffPDjGxFaGCQSEOwDxGhgYOAnUt0oGAWjYBSMYAAAJb025s4yoAMAAAAASUVORK5CYII=","orcid":"","institution":"Western University","correspondingAuthor":true,"prefix":"","firstName":"R.","middleName":"Greg","lastName":"Thorn","suffix":""}],"badges":[],"createdAt":"2026-03-17 14:24:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9149922/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9149922/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106244765,"identity":"d66d3de4-4287-4c36-bb7a-289479ecd005","added_by":"auto","created_at":"2026-04-06 15:42:43","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":478351,"visible":true,"origin":"","legend":"\u003cp\u003eFive sample locations comprising thirteen tallgrass prairie sites in Southern Ontario with the number of prairie sites sampled at each location indicated. Map modified from Google Maps (2026).\u003c/p\u003e","description":"","filename":"image1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9149922/v1/368f65976edd0ed1735b7598.jpg"},{"id":106403239,"identity":"73a95152-18ed-47cf-be03-e6f3ed3c36e3","added_by":"auto","created_at":"2026-04-08 09:13:57","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":295286,"visible":true,"origin":"","legend":"\u003cp\u003eRichness and alpha diversity measures by sample location with disturbance condition for observed number of OTUs (richness) Shannon’s diversity index and Fisher’s diversity index. For site codes refer to Table 1.\u003c/p\u003e","description":"","filename":"image2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9149922/v1/d724952aa5438ad4b795f347.jpg"},{"id":106244767,"identity":"d7a96aaa-38a2-4d01-9eff-b991dd480fe0","added_by":"auto","created_at":"2026-04-06 15:42:43","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":219601,"visible":true,"origin":"","legend":"\u003cp\u003ePrincipal Coordinates Analysis (PCoA) analysis showing disturbed (red circles) and undisturbed (black triangles) groups with sites labeled and 95% confidence ellipses calculated in \u003cem\u003evegan\u003c/em\u003e; WIFN4 restored field was classified as disturbed but grouped with undisturbed sites. For site codes refer to Table 1.\u003c/p\u003e","description":"","filename":"image3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9149922/v1/6977f33beb6af14e62666f2a.jpg"},{"id":106244768,"identity":"ce7dcf15-b675-468a-bbb6-4b9381086698","added_by":"auto","created_at":"2026-04-06 15:42:43","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":224812,"visible":true,"origin":"","legend":"\u003cp\u003ePlot of taxa found to be significant indicators of disturbed and undisturbed sites.\u003c/p\u003e","description":"","filename":"image4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9149922/v1/c5b654e80ef00c272b9439d4.jpg"},{"id":106405777,"identity":"6360a326-19da-401f-bcf1-e27e41fb9198","added_by":"auto","created_at":"2026-04-08 09:28:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2138373,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9149922/v1/06ea81b2-8792-4a69-b6ce-6d3849c796ec.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Community composition of arbuscular mycorrhizal fungi in Ontario tallgrass prairies of differing disturbance histories","fulltext":[{"header":"Introduction","content":"\u003cp\u003eArbuscular mycorrhizal fungi (AMF), in the phylum Glomeromycota, are obligate symbionts and form mutualistic relationships with a variety of terrestrial plants (Sch\u0026uuml;\u0026szlig;ler et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). It is well known that AMF play a key role in the health and growth of plant communities, including economically significant crop plants (Sousa \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Associations with AMF have been shown to increase reproductive success and offspring survival in plants (Alam et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Koide and Dickie \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Plants associated with AMF also have increased tolerance to heavy metals, pathogenic fungi and nematodes (Allen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Johnson et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; van der Heijden et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Jeffries et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Vandenkoornhuyse et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePlant community composition is suggested to influence AM fungal communities (van der Heijdan et al. 1998; Eom et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Community composition of AMF can be related to host species, season, and life stage of host plant (Eom et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Bever et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Husband et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Vandenkoornhuyse et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Mony et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), as well as the type of plant community, such as grassland or tropical forest (Liu et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, it has also been found that plant communities can be influenced by AM fungal communities in return (van der Heijden et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). It was found that restoration of native plants may be highly dependent on the reintroduction of native AMF species (Stover et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The importance of AMF for plant success is widely accepted but research on the diversity and dynamics of AMF communities is ongoing.\u003c/p\u003e \u003cp\u003eTallgrass prairies (TGPs) are an endangered type of plant community across North America (Samson and Knopf \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). TGPs are dominated by warm-season C4 grasses, such as Big Bluestem (\u003cem\u003eAndropogon gerardii\u003c/em\u003e) and Indiangrass (\u003cem\u003eSorghastrum nutans\u003c/em\u003e) (Rodger \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e1998\u003c/span\u003e), which have high mycorrhizal dependence (Hartnett and Wilson \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; McCain et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). These dominant grasses require AMF relationships to receive essential nutrients including water (Proudel et al. 2021). Former TGPs in Southern Ontario were dominated by these and other bunch-grasses and had tremendous diversity of broad-leaved herbaceous plants, many of them restricted to TGP habitat and found nowhere else in Canada (Snyder et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The two main threats to tallgrass prairies are habitat loss and the introduction of non-native species (Rowe et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Approximately 78% of the 2.2\u0026nbsp;million hectares of the Carolinian zone (Ecoregion 7E) in Ontario has been converted to agriculture and an additional 7% to roads and urban areas; most of the remaining natural area is forest (Crins et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The fertile soils and lack of trees made tallgrass prairies a prime target for conversion to agriculture and urban development (Rodger \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). The largest remaining fragments are located in and near the city of Windsor and Walpole Island (Bkejwanong) First Nation. Presently these areas represent less than 1% of original TGP found in Southern Ontario (Rodger \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e1998\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrent prairie restoration efforts are managed by the Ontario Ministry of Natural Resources and Forestry (MNRF), the Nature Conservancy of Canada (NCC) and by smaller agencies like the \u003cem\u003erare\u003c/em\u003e Charitable Research Reserve (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://raresites.org/\u003c/span\u003e\u003cspan address=\"http://raresites.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Multiple threatened and endangered species of plants and animals live in the remaining TGP sites such as Eastern Prairie White Fringed-orchid (\u003cem\u003ePlatanthera leucophaea\u003c/em\u003e), Small Fringed Lady\u0026rsquo;s-slipper (\u003cem\u003eCypripedium candidum\u003c/em\u003e), Butler\u0026rsquo;s garter snakes (\u003cem\u003eThamnophis butleri\u003c/em\u003e), and spotted turtles (\u003cem\u003eClemmys guttata\u003c/em\u003e) (Ontario Ministry of the Environment, Conservation, and Parks 2023). However, these restoration efforts have focused primarily on the above ground plant communities while microbial soil communities have not been addressed, although prairie restoration efforts associated with the Herb Gray Parkway in Windsor included moving soil monoliths from remnants that were to be lost to the restored sites in an attempt to bring the indigenous microbial and fungal communities (The Rt. Hon. Herb Gray Parkway 2011). Restoration studies have investigated the use of commercial AM fungal inoculum versus AM fungal inoculum from native TGPs, and they suggest that inoculum from native TGPs\u0026mdash;although more difficult obtain\u0026mdash;may improve restoration attempts (Smith et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Paluch et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Middleton et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudies based on agricultural practices have focused on mechanical disturbance such as tillage, as it greatly disrupts the AMF hyphal networks (Stockinger et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Soil disturbance damages the external mycelial network and causes a decrease in the level of AMF colonization within plant roots (Jansa et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Mir\u0026aacute;s-Avalos et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zubek et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Overall, disturbed and undisturbed sites have different communities of AMF (Galvez et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Jansa et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Lumini et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Mir\u0026aacute;s-Avalos et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Stover et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Bainard et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Soil disturbance also decreases the overall biomass of AMF in roots and soil (Miller et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Schnoor et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Thomopoulos et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Both spore density and hyphal length are negatively affected by tillage (Boddington and Dodd \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Jansa et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Oehl et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Galvez et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Thomopoulos et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Infectivity of AMF and subsequent nutrient uptake by their host plants is reduced by the disruption of the hyphal network (Jasper et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Evans and Miller \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Miller et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Kabir et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Mir\u0026aacute;s-Avalos et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Tillage not only influences AMF but also affects the soil. Tillage decreases aggregate stability by severing mycelia and causing a decrease in the production of glomalin (Wright and Upadhyaya 1996; Kabir et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Thomopoulos et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In general, disturbance from agriculture, including tillage, negatively impacts AMF communities.\u003c/p\u003e \u003cp\u003ePrevious studies on the effect of disturbance on AMF have primarily focused on agricultural disturbance (such as tillage) because AMF are important associates of crop plants. Thus, the ecology and recovery of AMF following land use change (prairie restoration) is not well understood. It is well documented that tillage and other physical soil disturbance significantly decrease the total AMF biomass present in the soil (Miller et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Schnoor et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Thomopoulos et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Previous studies have observed immediate effects of tillage on mycorrhizae (Boddington and Dodd \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Galvez et al. 2023; Garc\u0026iacute;a de Le\u0026oacute;n et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) but have not observed the effects long term. In this study we investigated the differences in the AMF community between historically disturbed (e.g., restored prairie sites previously used for agriculture) and undisturbed (remnant TGP) ecosystems. The objective of this study was to assess differences in the community composition of AMF between disturbed and undisturbed TGPs at five locations in southwestern Ontario and identify AMF taxa that may act as potential indicators of ecosystem disturbance. This information is applicable to TGP restoration efforts as research suggests diversity within the AMF community affects native plant communities (Stover et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample Locations and Soil Sampling\u003c/h2\u003e \u003cp\u003eSoil samples were collected in 2009 and 2014 from 13 sites across five locations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). At each site, samples were taken in June or July and again in October (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Each site was classified as disturbed (6 total) or undisturbed (7 total) based on the known usage history (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Sampling sites were not paired based on location. Six quadrats (1 m\u003csup\u003e2\u003c/sup\u003e) were selected as subsamples to characterize each habitat, and five soil cores (2.5 cm x 20 cm) were collected from each quadrat and then pooled, homogenized, and frozen at -20 \u0026ordm;C.\u003c/p\u003e \u003cp\u003eA 20 g subsample of each sample was suspended in 200 mL of 0.1 M sodium pyrophosphate (Na₄P₂O₇) and wet-sieved through 1.18 mm, 250 \u0026micro;m and 53 \u0026micro;m mesh sizes,\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLocations size and disturbance history of thirteen tallgrass prairie sample sites from five locations across Southern Ontario.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSampling Location\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSite\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSite Code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (ha)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDisturbance History\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbance Group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSampling Dates\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWIFN1 Prairie\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWIFN1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.96\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNever tilled\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJun/Oct 2009\u003csup\u003ea\u003c/sup\u003e Oct 2014\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWalpole Island\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWIFN2 Prairie\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWIFN2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1940\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJun/Oct 2009\u003csup\u003ea\u003c/sup\u003e Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFirst Nation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWIFN3 Prairie\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWIFN3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;1943\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJun/Oct 2009\u003csup\u003ea\u003c/sup\u003e Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWIFN4 Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWIFN4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1990\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJun/Oct 2009\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWIFN5 Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWIFN5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2006\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJun/Oct 2009\u003csup\u003ea\u003c/sup\u003e Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOjibway Prairie\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrairie 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOPC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e105 total\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1770\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNature Reserve\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrairie 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOPC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1770\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFRS23 Prairie\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFRS23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUnknown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHerb Gray\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFRS32 Prairie\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFRS32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eUnknown\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParkway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFRS27 Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFRS27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFRS28 Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFRS28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erare\u003c/em\u003e Charitable Research Reserve\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBlair Flats Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRare\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e17.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNorfolk County\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDe Maere Restoration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDMP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eJul/Oct 2014\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003ea\u003c/sup\u003e Chokroborty-Hoque (2011)\u003c/p\u003e \u003cp\u003e \u003csup\u003eb\u003c/sup\u003e Catomeris (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e)\u003c/p\u003e \u003cp\u003erinsed with deionized water, and organic material (spores, hyphae, roots, and organic particles) retained on all sieves was collected, freeze dried, and ground in a mortar and pestle using liquid nitrogen.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMolecular Analysis\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was extracted from soil samples using a soil Microbe DNA MicroPrep\u0026trade; kit (Zymo Research, Irvine, CA). Subsamples (0.25 g) of the washed, ground soil organic fractions were used as the substrate for DNA extraction. Each sampling site had six separate DNA extracts, one from each quadrat. For all sites except DMP, DNA extracts from each quadrat and sampling time were PCR amplified separately and then the PCR products pooled by site and sampling time for each barcode. For DMP, which was part of a separate study on the impacts of nitrogen addition on the AMF community (Catomeris \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), PCR products of each plot and sampling time were barcoded separately. For this study, only the DMP control plots with no nitrogen addition were used. There were eight control plots in the original study but two were randomly selected and removed for even sampling design.\u003c/p\u003e \u003cp\u003eGenomic DNA samples were amplified using a Glomeromycota-specific primer pair AMV4.5N-F (AAACTCGTAGTTGAATTTCG) and AMDG-R (CCCAACTATCCCTATTAATCAT) that targets the V4 variable region of the small ribosomal subunit (Sato et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The 5\u0026rsquo; ends of the forward and reverse primers were modified to include the forward or reverse Illumina adapter, a 4 bp linker (NNNN), and an 8 bp barcode sequence that allowed recognition of products from different samples following Illumina sequencing (Gloor et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). PCR products were submitted to the London Regional Genomics Centre (Robarts Research Institute, London, ON) for sequencing using the Illumina MiSeq platform using a 2 \u0026sdot; 300 v3 kit (Illumina, San Diego, CA).\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eData Analysis\u003c/h2\u003e \u003cp\u003eThe raw read files were demultiplexed in DADA2 (Callahan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) with the addition of a \u003cem\u003etrunclen\u003c/em\u003e parameter [truncLen\u0026thinsp;=\u0026thinsp;c(200,190]. Sequences flagged as chimeras were removed using the \u0026lsquo;consensus\u0026rsquo; method. Taxonomy was assigned using the SILVA v132 reference files (Quast et al. 2013) and amplified sequence variants (ASVs, or groups of identical sequences) identified as belonging to Glomeromycota were retained. Phylogenetic trees were generated using neighbor-joining in MEGA 11 (Tamura et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). ASVs with less than 0.5% distance and forming terminal clusters in the tree were grouped to create operational taxonomic units (OTUs). The OTU sequences were compared to reference sequences from GenBank and the AMF database \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://globalamfungi.com/\u003c/span\u003e\u003cspan address=\"https://globalamfungi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (Větrovsk\u0026yacute; et al. \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) using BLASTn (Altschul et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1990\u003c/span\u003e), aligned with selected reference sequences, and analyzed in maximum likelihood trees with 10,000 ultrafast bootstraps in IQ-Tree v3.01 (Wong et al. \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) for further identification. Taxonomy follows Tedersoo et al. (\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and Hyde et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), and OTUs are further referenced to the closest \"virtual taxon\" recognized in the MaarjAM database of Glomeromycota sequences (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://maarjam.ut.ee/\u003c/span\u003e\u003cspan address=\"https://maarjam.ut.ee/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; \u0026Ouml;pik et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Raw and processed sequence files are deposited as ENA PRJEB103838, and alignments and phylogenetic trees deposited to Figshare (doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.6084/m9.figshare.31299373\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.31299373\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStatistical analysis was done using R (R Core Team, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) with packages phyloseq (McMurdie and Holmes \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and vegan (Oksanen et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). R package ALDEx2 was used to determine if there was a significant difference between the samples collected in June/July and October. The \u003cem\u003evegdist\u003c/em\u003e function in the R package vegan was used to calculate dissimilarity indices for the community data from each site (Oksanen et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). This dissimilarity matrix was then used to perform a permutational multivariate analysis of variance (PERMANOVA) to determine if there was a significant difference in composition between the disturbed and undisturbed site conditions. Principal coordinate analysis (PCoA) was then used to visualize clustering of sample site by disturbance history. Differences in average alpha diversity between the previously disturbed and undisturbed sites and in relative abundance of each taxon identified between the previously disturbed and undisturbed sites were evaluated using a t-test separately for each measure used. The \u003cem\u003emultipatt\u003c/em\u003e function in the R package indicspecies (De C\u0026aacute;ceres and Legendre, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) was used to generate indicator values (IndVals) and identify OTUs that were significant in either the disturbed or undisturbed conditions.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe merged and quality-filtered sequences yielded 765,446 total reads. From this dataset, 672 Glomeromycota ASVs were identified, which clustered into 213 OTUs following phylogenetic grouping. Using ANOVA-Like Differential Expression (ALDEx), no significant difference was found between the composition of samples taken in the June/July collection and samples taken in the October collection across each site (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1,25)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.46, p\u0026thinsp;=\u0026thinsp;0.137), so samples collected in the summer and fall were combined for each site in further analyses.\u003c/p\u003e \u003cp\u003eThere was no significant difference in richness between the disturbed sites and undisturbed sites (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-0.91, p\u0026thinsp;=\u0026thinsp;0.383; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Community diversity was significantly greater in undisturbed sites than restored, previously disturbed sites, as measured by Shannon's (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-2.73, p\u0026thinsp;=\u0026thinsp;0.019), Simpson's (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-2.92, p\u0026thinsp;=\u0026thinsp;0.014), and Fisher's indices (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-2.23, p\u0026thinsp;=\u0026thinsp;0.049). Restored\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003efields WIFN4 and WIFN5 had the highest Shannon\u0026rsquo;s diversity of all disturbed sites; both sites were cultivated for fewer than five years before being passively allowed to return to prairie and are located near remnant prairies. The \u003cem\u003erare\u003c/em\u003e site\u0026mdash;recently intentionally restored from long-term traditional agriculture\u0026mdash;had the lowest richness and diversity of all sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Pielou\u0026rsquo;s evenness was calculated for each site and averaged for each disturbance condition. Evenness was significantly greater at undisturbed sites than previously disturbed sites (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-2.97, p\u0026thinsp;=\u0026thinsp;0.013). A PERMANOVA test indicated a significant difference in community composition between the disturbed and undisturbed sampling locations (pseudo-\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1,11)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.40, R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.179, p\u0026thinsp;=\u0026thinsp;0.020). Principal coordinate analysis (PCoA) supported the clustering of sample sites by disturbance history (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The exception to this was the restored field site WIFN4. This site was classified as disturbed, having been most recently used for agriculture in 1990, approximately 20 years earlier than the other disturbed sites considered here, but it clustered with the undisturbed sites.\u003c/p\u003e \u003cp\u003eTwelve genera of Glomeromycota were found (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Dominant genera included \u003cem\u003eDiversispora\u003c/em\u003e with 42.4% of all reads across all sites, \u003cem\u003eEntrophospora\u003c/em\u003e (formerly known as \u003cem\u003eClaroideoglomus\u003c/em\u003e) with 22.6%, \u003cem\u003eGlomus\u003c/em\u003e (19.4%), and \u003cem\u003eSeptoglomus\u003c/em\u003e (7.6%). Nine of the thirteen sites, both disturbed and undisturbed, were dominated by sequences identified as \u003cem\u003eDiversispora\u003c/em\u003e, ranging in relative abundance at these sites from 30\u0026ndash;72%. Three disturbed sites were dominated by sequences identified as \u003cem\u003eEntrophospora\u003c/em\u003e, including FRS27 (58.6%), FRS28 (43.5%) and WIFN5 (33.4%); \u003cem\u003eEntrophospora\u003c/em\u003e was generally more abundant in disturbed than undisturbed sites, but not significantly so (Welch\u0026rsquo;s \u003cem\u003et\u003c/em\u003e\u003csub\u003e(6.23)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.93, p\u0026thinsp;=\u0026thinsp;0.0996). One undisturbed site (FRS23) was dominated by sequences identified as \u003cem\u003eSeptoglomus\u003c/em\u003e (32.1%). Sequences identified as \u003cem\u003eGlomus\u003c/em\u003e were co-dominant in undisturbed sites, where their relative abundance ranged from 10.1\u0026ndash;36.9%, whereas their relative abundance in disturbed sites ranged from 5.3\u0026ndash;23.3%; \u003cem\u003eGlomus\u003c/em\u003e sequences\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eRelative abundance (%) of OTUs grouped by genera within each sampling site, with three most abundant taxa at each site shown in bold and total reads (thousands) for each site. Site codes from Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"15\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eGenus \\ Site\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"7\" nameend=\"c8\" namest=\"c2\"\u003e \u003cp\u003eUndisturbed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c14\" namest=\"c9\"\u003e \u003cp\u003eDisturbed\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eWIFN1\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eWIFN2\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eWIFN3\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003eOPC1\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003eOPC2\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eFRS23\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003eFRS32\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eWIFN4\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eWIFN5\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eFRS27\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eFRS28\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eRare\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eDMP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAcaulospora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.107\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAmbispora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.446\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDiversispora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e65.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e43.20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e53.52\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e29.77\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e31.42\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e26.51\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e44.86\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e39.98\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e30.31\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e11.45\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e28.43\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e72.14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e69.26\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e42.415\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEntrophospora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e17.29\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e17.08\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e22.44\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e16.49\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e33.43\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e58.60\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e43.52\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e15.13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e4.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e22.604\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFunneliformis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e6.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e4.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e2.115\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGigaspora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGlomus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e23.66\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e36.93\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e26.31\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e26.82\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e20.97\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003e16.30\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e14.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cb\u003e23.37\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cb\u003e9.52\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u003cb\u003e16.04\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u003cb\u003e5.31\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e8.58\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cb\u003e19.364\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePacispora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e1.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.122\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eParaglomus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e4.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e6.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e1.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cb\u003e11.32\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e3.557\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRhizophagus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e2.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1.070\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eScutellospora\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e4.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e0.570\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eSeptoglomus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5.38\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e10.00\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e12.93\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e19.66\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003e32.11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e11.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003e21.01\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e8.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e8.42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e2.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e5.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e7.628\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSUM\u003c/p\u003e \u003cp\u003e(reads x 10\u003csup\u003e3\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 (78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100 (85)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100 (58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100 (11)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100 (17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100 (21)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100 (18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e100 (35)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e100 (102)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e100 (32)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e100 (197)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e100 (22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e100 (90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e100 (765)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ewere significantly more abundant in undisturbed than disturbed sites (\u003cem\u003et\u003c/em\u003e\u003csub\u003e(11)\u003c/sub\u003e=-2.36, p\u0026thinsp;=\u0026thinsp;0.038). \u003cem\u003eParaglomus\u003c/em\u003e was co-dominant at De Maere Prairie (11.3%), but all other genera were uncommon to rare, with total reads ranging from 2.1% (\u003cem\u003eFunneliformis\u003c/em\u003e) to 0.002% (\u003cem\u003eGigaspora\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eThere were five OTUs identified as indicator taxa for the disturbed conditions and eight OTUs identified as indicator taxa for the undisturbed conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Indicator taxa for disturbed prairies were \u003cem\u003eDiversispora\u003c/em\u003e (OTU 28, VTX0035; OTU 33, cf. VTX00054), \u003cem\u003eEntrophospora\u003c/em\u003e (OTU 148, cf. VTX00225), \u003cem\u003eEntrophospora lamellosa\u003c/em\u003e (OTU 154, VTX00193), and \u003cem\u003eSeptoglomus\u003c/em\u003e (OTU 178, cf. VTX00063). Indicator taxa for undisturbed prairies were \u003cem\u003eGlomus\u003c/em\u003e (OTU 67, cf. VTX00214; OTU 80, VTX00202; OTU 65, VTX00234; OTU 88, VTX00323), \u003cem\u003eDiversispora\u003c/em\u003e (OTU 32, VTX00380; OTU 38, cf. VTX00263; and OTU 44, cf. VTX00263), and \u003cem\u003eAmbispora fennica\u003c/em\u003e (OTU 3, VTX00283).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eBased on past research (Jansa et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Lumini et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Stover et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), it was predicted that the AMF communities found in disturbed TGPs would be different than the AMF communities found in undisturbed TGPs and that undisturbed TGPs would have higher community diversity (but not OTU richness) than disturbed TGPs. Our results supported these predictions. Agricultural tillage and mechanical disturbance have been shown to disrupt not only the connection of the AMF hyphal network to a single host plant but to all potential host plants that interact with the hyphal web (Jasper et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Smith and Read \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). As a result of this type of disturbance, AMF infectivity decreases and the total amount of active hyphae also decreases, as the damaged hyphal network must recolonize the host roots (Kabir et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Galvez et al. 2011; Mir\u0026aacute;s-Avalos et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePrincipal coordinates analysis showed that sites mostly grouped by disturbance condition, with one distinct outlier (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The outlier, restored field WIFN4, was classified as a disturbed site based on the land use history but grouped more closely with the undisturbed sites. The agriculture at this site ended in 1990 and it has since been restored to prairie (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). One interpretation of this finding is that the ~\u0026thinsp;20 years that elapsed between the last agricultural usage was sufficient for AMF communities to transition back towards the composition characteristic of undisturbed TGPs. This conclusion is supported by previous studies (Basiru and Hijri \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Hamel et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), which found that disturbed AMF communities can transition back to their native composition over time. The restored field WIFN4 is also geographically close to WIFN1 prairie as a possible source of mycorrhizal inoculum; however, the adjacent WIFN5 restored field (disturbed) and WIF2 prairie (undisturbed) did not cluster in a similar way. Within the undisturbed prairie sites, the three prairies on Walpole Island clustered separately from a cluster of the four undisturbed prairies in the Windsor area (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These groups suggest that geographic location may be one driver of AMF community similarity, as has been found in other studies (da N\u0026oacute;brega Veras et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Xu et al. \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSome of the observed clustering patterns may be explained by the difference in colonization strategies of AMF species. Early colonizers tend to be generalist species that are better adapted to rapidly colonize disturbed environments. Furthermore, species that reproduce via spores may have a greater chance of persisting in the environment post-disturbance, allowing for faster recolonization (Cahyaningtyas and Ezawa \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Hamel et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Hart and Reader \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Mathimaran et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). There is research that also suggests some AMF species can survive disturbances sheltered within the host plant and recolonize post-disturbance by regrowing from within the host\u0026rsquo;s root (Cahyaningtyas and Ezawa \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Hart and Reader \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Other clustering patterns may be attributed to the greater taxonomic diversity of plants present at the undisturbed sites, compared to the high dominance of species such as \u003cem\u003eSolidago altissima, Melilotus alba\u003c/em\u003e, and \u003cem\u003eTrifolium repens\u003c/em\u003e in the disturbed sites (Eom et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Stover et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Mony et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Diversity of AMF communities, but not species richness, was greater at undisturbed sites, indicating that evenness is a key difference between the disturbed and undisturbed conditions. This is, in part, due to plant species dominance in the disturbed sites, which leads to lower evenness of species distribution within the AMF community.\u003c/p\u003e \u003cp\u003eFour OTUs identified as the genus \u003cem\u003eGlomus\u003c/em\u003e (OTU 67, cf. VTX00214; OTU 80, VTX00202; OTU 65, VTX00234; OTU 88, VTX00323) were found to be indicators of undisturbed TGP sites. There are 30 defined genera within the formerly inclusive genus \u003cem\u003eGlomus\u003c/em\u003e, some of which are associated with agricultural disturbance (Tedersoo et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). However, since we lack information to recognize these segregate genera, unless an OTU of \u003cem\u003eGlomus\u003c/em\u003e is identified to the species level, it is difficult to draw accurate conclusions about its ecology. There is new evidence from Delavaux et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) that the family Glomeraceae is a disturbance sensitive group and we found \u003cem\u003eGlomus\u003c/em\u003e to be significantly more abundant in undisturbed prairie sites than disturbed ones. What is known about reproduction in \u003cem\u003eGlomus\u003c/em\u003e species is that they demonstrate blastic expansion of hyphal tips prior to spore development (Sch\u0026uuml;\u0026szlig;ler and Walker \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The hyphal networks are sensitive to mechanical disturbances and, if disrupted prior to spore formation, reproduction would cease. This is consistent with most \u003cem\u003eGlomus\u003c/em\u003e OTUs being associated with undisturbed TGP sites that did not experience mechanical disturbances such as tillage.\u003c/p\u003e \u003cp\u003eThree OTUs identified as members of the genus \u003cem\u003eDiversispora\u003c/em\u003e were identified as indicator taxa for undisturbed TGP sites, whereas two were indicators of disturbed sites. This may be due to variation in morphological characteristics of the spores and reproductive strategies within the genus. Spores produced by \u003cem\u003eDiversispora\u003c/em\u003e species lack a rigid laminate layer and are more likely to flatten under pressure (Sch\u0026uuml;\u0026szlig;ler and Walker \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). If the spores produced by species in this genus are more fragile than those of other taxa, mechanical disturbance, such as tillage, is likely to hinder their reproduction in disturbed environments. As with \u003cem\u003eGlomus\u003c/em\u003e, it is difficult to draw more specific conclusions about the effects of disturbance on \u003cem\u003eDiversispora\u003c/em\u003e without species level identifications. Further research is needed to identify species and their reproductive patterns within \u003cem\u003eDiversispora\u003c/em\u003e and how the morphological traits may influence species disturbance tolerance. Future investigations using a more phylogenetically informative marker than the short V4 region of 18S that was used may find a stronger phylogenetic signal correlated with the disturbance-sensitive OTUs within \u003cem\u003eDiversispora\u003c/em\u003e or \u003cem\u003eGlomus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eAmbispora fennica\u003c/em\u003e was also identified as an indicator taxon associated with undisturbed TGP sites. This genus reproduces via a sporiferous saccule that expands blastically from a branched network of reproductive hyphae (Walker et al. \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). As with \u003cem\u003eGlomus\u003c/em\u003e, \u003cem\u003eAmbispora\u003c/em\u003e species are sensitive to mechanical disturbance that disrupts the reproductive hyphae and are thus more common in the undisturbed TGPs. A study by van der Hyde et al. (2017), found that Ambisporaceae is on average less tolerant to disturbance than other AMF families, but more research is needed to confirm these findings.\u003c/p\u003e \u003cp\u003eTwo OTUs of the genus \u003cem\u003eEntrophospora\u003c/em\u003e were identified as indicators of disturbed TGPs. \u003cem\u003eEntrophospora\u003c/em\u003e species are considered generalists (Błaszkowski et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). They can colonize disturbed environments rapidly, which is consistent with \u003cem\u003eEntrophospora\u003c/em\u003e being found in greater abundance at disturbed TGP sites than undisturbed TGP sites (Błaszkowski et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Delavaux et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Garc\u0026iacute;a de Le\u0026oacute;n et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). One of the OTUs found as indicator taxa for the disturbed TGP sites was identified as \u003cem\u003eEntrophospora lamellosa\u003c/em\u003e, a species that was first found associated with beach grasses in the Great Lakes region, including Ontario (Dalp\u0026eacute; et al. 1992). This species is known to sporulate abundantly, which likely aids in the fast recolonization of disturbed environments (Dalp\u0026eacute; et al. 1992). Another disturbance-associated OTU was identified as \u003cem\u003eSeptoglomus\u003c/em\u003e. There is evidence that species in this genus, such as \u003cem\u003eSeptoglomus viscosum\u003c/em\u003e, are disturbance resistant and can efficiently recolonize from within the root of the host plant (Redecker et al. 2013).\u003c/p\u003e \u003cp\u003eThese findings have implications for current and future restoration efforts and indicate that land use history could be used to predict AMF community composition. Understanding what species are associated with disturbed and undisturbed TGPs could be used in future restoration efforts such as determining which AMF inoculum would be beneficial for a prairie restoration project. If native AMF taxa are introduced to a TGP site, it could aid the establishment of native plants, such as C4 grasses, that rely on mycorrhizal relationships (Hartnett and Wilson \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Hopkins and Bennett \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; McCain et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Koziol et al. (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2023b\u003c/span\u003e) found that when AMF inoculum was applied in high densities at prairie restoration sites, the benefit to native plant abundance, richness, and diversity persisted for the first four years. Furthermore, the addition of AMF has been found to add the establishment of late successional species in grasslands and deter non-native species competition (Duell et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Koziol et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2023a\u003c/span\u003e). The conservation and restoration of the TGP fragments in Ontario should be prioritized as they are home to many unique species, both above and below ground, and are vulnerable to disturbance due to land use change.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eResearch Funding\u003c/h2\u003e\n\u003cp\u003eThis research did receive funding.\u0026nbsp;\u003c/p\u003e\n\u003cul type=\"disc\"\u003e\n \u003cli\u003eSarah N. Allan Maloney received funding from \u003cem\u003erare\u003c/em\u003e Ecological Reserve.\u003c/li\u003e\n \u003cli\u003eNimalka M. Weerasuriya received funding from \u003cem\u003erare\u003c/em\u003e Ecological Reserve.\u003c/li\u003e\n \u003cli\u003eR. Greg Thorn received funding from Natural Sciences and Engineering Research Council of Canada (NSERC).\u003c/li\u003e\n\u003c/ul\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eRGT conceived the research, which was carried out by SNAM with assistance by CRJ and NMW. Analyses were conducted by SNAM, ACJ, NMW and RGT, figures prepared by ACJ and NMW, and the manuscript was written by ACJ, NMW and RGT. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank Aniruddho Chokroborty-Hoque and Catriona Catomeris for collecting soil samples later processed by SNAM, Jenna Quinn and Clint Jacobs for permissions to collect samples at rare Ecological Reserve and Walpole Island (Bkejwanong) First Nation, respectively, the Ministry of Transportation Ontario, the Ministry of Natural Resources and Forestry, the Right Honourable Herb Gray Parkway, the Ojibway Prairie Provincial Nature Reserve, funding from NSERC to RGT and from rare Ecological Reserve to SNAM and NMW, and Zo\u0026euml; Lindo (Biology, University of Western Ontario) for a pre-submission review.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eRaw and processed sequence files are deposited as ENA PRJEB103838, and alignments and phylogenetic trees deposited to Figshare (doi: 10.6084/m9.figshare.31299373).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlam MZ, Choudhury TR, Mridha MAU (2023) Arbuscular mycorrhizal fungi enhance biomass growth, mineral content, and antioxidant activity in tomato plants under drought stress. J Food Qual 2023:2581608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2023/2581608\u003c/span\u003e\u003cspan address=\"10.1155/2023/2581608\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllan SN (2017) Disturbance and the Community Composition of Arbuscular Mycorrhizal Fungi in Ontario Tallgrass Prairies. MSc Thesis, University of Western Ontario\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllen EB, Allen MF, Helm DJ et al (1995) Patterns and regulation of mycorrhizal plant and fungal diversity. Plant Soil 170:47\u0026ndash;62\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAltschul SF, Gish W, Miller W et al (1990) Basic Local Alignment Search Tool. J Mol Biol 215:403\u0026ndash;410. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/S0022-2836(05)80360-2\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/S0022-2836(05)80360-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsemaninejad A, Weerasuriya N, Gloor GB et al (2016) New primers for discovering fungal diversity using nuclear large ribosomal DNA. PLoS ONE 11:e0159043. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0159043\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0159043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBainard LD, Dai M, Gomez EF et al (2015) Arbuscular mycorrhizal fungal communities are influenced by agricultural land use and not soil type among the Chernozem great groups of the Canadian Prairies. Plant Soil 387:351\u0026ndash;362. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104-014-2288-1\u003c/span\u003e\u003cspan address=\"10.1007/s11104-014-2288-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasiru S, Hijri M (2022) The potential applications of commercial arbuscular mycorrhizal fungal inoculants and their ecological consequences. Microorganisms 10:1897. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms10101897\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10101897\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBever JD, Schultz PA, Pringle A, Morton JB (2001) Arbuscular mycorrhizal fungi: More diverse than meets the eye and the ecological tale of why. BioScience 51:923\u0026ndash;931. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1641/0006-3568(\u003c/span\u003e\u003cspan address=\"10.1641/0006-3568(\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e2001)051[0923:AMFMDT]2.0.CO;2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBłaszkowski J, S\u0026aacute;nchez-Garc\u0026iacute;a M, Niezgoda P et al (2022) A new order Entrophosporales and three new Entrophospora species in Glomeromycota. Front Microbiol 13:962856. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2022.962856\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2022.962856\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoddington CL, Dodd JC (2000) The effect of agricultural practices on the development of indigenous arbuscular mycorrhizal fungi. I. Field studies in an Indonesian ultisol. Plant Soil 218:137\u0026ndash;144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1014966801446\u003c/span\u003e\u003cspan address=\"10.1023/A:1014966801446\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCahyaningtyas A, Ezawa T (2023) Disturbance tolerance of arbuscular mycorrhizal fungi: characterization of life-history strategies along a disturbance gradient in a coastal dune ecosystem. Plant Soil 495:535\u0026ndash;549. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11104-023-06337-4\u003c/span\u003e\u003cspan address=\"10.1007/s11104-023-06337-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCallahan BJ, McMurdie PJ, Rosen MJ et al (2016) DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13:581\u0026ndash;583. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.3869\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.3869\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCatomeris C (2015) Arbuscular mycorrhizal fungal community response to increased nitrogen deposition in a restored tallgrass prairie. BSc Thesis, University of Western Ontario\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChokroborty-Hoque A (2011) Arbuscular mycorrhizal fungal communities in tallgrass prairies at Walpole Island Ontario. MSc Thesis, University of Western Ontario\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrins W, Gray PA, Uhlig P, Wester MC (2009) The ecosystems of Ontario Part 1: Ecozones and Ecoregions. Ministry of Natural Resources. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://files.ontario.ca/mnrf-ecosystemspart1-accessible-july2018-en-2020-01-16.pdf\u003c/span\u003e\u003cspan address=\"https://files.ontario.ca/mnrf-ecosystemspart1-accessible-july2018-en-2020-01-16.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalpe Y, Koske RE, Tews LL (1992) Glomus lamellosum sp.nov.: A new Glomaceae associated with beach grass. Mycotaxon 63:289\u0026ndash;293\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda N\u0026oacute;brega Veras JS, Mendes-Alvarenga RL, de Souza Rodrigues GRL et al (2025) Spatial and environmental factors influence AMF assemblages across the Brazilian Atlantic Forest - a biodiversity hotspot. Eur J Res 144:121\u0026ndash;131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10342-024-01745-2\u003c/span\u003e\u003cspan address=\"10.1007/s10342-024-01745-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe C\u0026aacute;ceres M, Legendre P (2009) Associations between species and groups of sites: indices and statistical inference. Ecology 90:3566\u0026ndash;3574. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1890/08-1823.1\u003c/span\u003e\u003cspan address=\"https://doi:10.1890/08-1823.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Sousa RN (2023) Arbuscular mycorrhizal fungi in agriculture: new insights. IntechOpen. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/intechopen.104271\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.104271\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelavaux CS, Aellen A, St\u0026uuml;rmer SL et al (2025) Uncovering diversity within the Glomeromycota: novel clades family distributions and land use sensitivity. Ecol Evol 15:70597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ece3.70597\u003c/span\u003e\u003cspan address=\"10.1002/ece3.70597\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuell EB, Hickman KR, Wilson GWT, Zhang Y (2022) Inoculation with native grassland soils improves native plant species germination in highly disturbed soil. Grassl Res 1:75\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/glr2.12018\u003c/span\u003e\u003cspan address=\"10.1002/glr2.12018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEom AH, Hartnett DC, Wilson GWT (2000) Host plant species effects on arbuscular mycorrhizal fungal communities in tallgrass prairie. Oecologia 122:435\u0026ndash;444. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s004420050050\u003c/span\u003e\u003cspan address=\"10.1007/s004420050050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEvans DG, Miller MH (1990) The role of the external mycelial network in the effect of soil disturbance upon vesicular-arbuscular mycorrhizal colonization of maize. New Phytol 114:65\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.1990.tb00374.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.1990.tb00374.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalvez L, Douds DD, Drinkwater LE, Wagoner P (2001) Effects of tillage and farming system upon VAM fungus populations and mycorrhizas and nutrient uptake of maize. Plant Soil 228:299\u0026ndash;308. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1004810116854\u003c/span\u003e\u003cspan address=\"10.1023/A:1004810116854\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGangwar RK, Mak\u0026aacute;di M, Bresilla B et al (2022) Effects of land uses and soil types on microbial activity and community structure. Int Agrophys 36:323\u0026ndash;336. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.31545/intagr/155096\u003c/span\u003e\u003cspan address=\"10.31545/intagr/155096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a de Le\u0026oacute;n D, Davison J, Moora M et al (2018) Anthropogenic disturbance equalizes diversity levels in arbuscular mycorrhizal fungal communities. Glob Chang Biol 24:2649\u0026ndash;2659. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/gcb.14131\u003c/span\u003e\u003cspan address=\"10.1111/gcb.14131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGloor GB, Hummelen R, Macklaim JM et al (2010) Microbiome profiling by illumina sequencing of combinatorial sequence-tagged PCR products. PLoS ONE 5:e15406. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0015406\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0015406\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamel C, Dalp\u0026eacute; Y, Lapierre C et al (1994) Composition of the vesicular-arbuscular mycorrhizal fungi population in an old meadow as affected by pH phosphorus and soil disturbance. Agric Ecosyst Environ 49:223\u0026ndash;231. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0167-8809(94)90051-5\u003c/span\u003e\u003cspan address=\"10.1016/0167-8809(94)90051-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Q, Li Z, Jiang Y et al (2025) Effects of grassland degradation on diversity of arbuscular mycorrhizal fungi of a pioneer plant. Int Microbiol 28:603\u0026ndash;621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10123-024-00564-0\u003c/span\u003e\u003cspan address=\"10.1007/s10123-024-00564-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHart MM, Reader RJ (2004) Do arbuscular mycorrhizal fungi recover from soil disturbance differently? Trop Ecol 45:97\u0026ndash;111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2018.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2018.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHartnett DC, Wilson GWT (1999) Mycorrhizae influence plant community structure and diversity in tallgrass prairie. Ecology 80:1187\u0026ndash;1195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1890/0012-9658(1999\u003c/span\u003e\u003cspan address=\"10.1890/0012-9658(1999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)080[1187:MIPCSA]2.0.CO;2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHopkins JR, Bennett AE (2023) Spore traits mediate disturbance effects on arbuscular mycorrhizal fungal community composition and mutualisms. Ecology 104:e4016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ecy.4016\u003c/span\u003e\u003cspan address=\"10.1002/ecy.4016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHusband R, Herre EA, Turner SL et al (2002) Molecular diversity of arbuscular mycorrhizal fungi and patterns of host association over time and space in a tropical forest. Mol Ecol 11:2669\u0026ndash;2678. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-294X.2002.01647.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-294X.2002.01647.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHyde KD, Noorabadi MT, Thiyagaraja V et al (2024) The 2024 outline of fungi and funguslike taxa. Mycosphere 15:5146\u0026ndash;6239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5943/mycosphere/15/1/25\u003c/span\u003e\u003cspan address=\"10.5943/mycosphere/15/1/25\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJansa J, Mozafar A, Anken T et al (2002) Diversity and structure of AMF communities as affected by tillage in a temperate soil. Mycorrhiza 12:225\u0026ndash;234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-002-0163-z\u003c/span\u003e\u003cspan address=\"10.1007/s00572-002-0163-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJansa J, Mozafar A, Kuhn G et al (2003) Soil tillage affects the community structure of mycorrhizal fungi in maize roots. Ecol Appl 13:1164\u0026ndash;1176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1890/1051-0761(2003\u003c/span\u003e\u003cspan address=\"10.1890/1051-0761(2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e)13[1164:STATCS]2.0.CO;2\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJasper DA, Abbott LK, Robson AD (1989) Soil disturbance reduces the infectivity of external hyphae of vesicular-arbuscular mycorrhizal fungi. New Phytol 112:93\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.1989.tb00313.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.1989.tb00313.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeffries P, Gianinazzi S, Perotto S et al (2003) The contribution of arbuscular mycorrhizal fungi in sustainable maintenance of plant health and fertility. Biol Fertil Soils 37:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00374-002-0546-5\u003c/span\u003e\u003cspan address=\"10.1007/s00374-002-0546-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson NC, Graham JH, Smith FA (1997) Functioning of mycorrhizal associations along the mutualism-parasitism continuum. New Phytol 135:575\u0026ndash;586. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1469-8137.1997.00729.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1469-8137.1997.00729.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabir Z, O\u0026rsquo;Halloran IP, Hamel C (1999) Combined effects of soil disturbance and fallowing on plant and fungal components of mycorrhizal corn (Zea mays L). Soil Biol Biochem 31:307\u0026ndash;314. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0038-0717(98)00124-2\u003c/span\u003e\u003cspan address=\"10.1016/S0038-0717(98)00124-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoide RT, Dickie IA (2002) Effects of mycorrhizal fungi on plant populations. Plant Soil 244:307\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1020204004844\u003c/span\u003e\u003cspan address=\"10.1023/A:1020204004844\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoziol L, McKenna TP, Bever JD (2023a) Native microbes amplify native seedling establishment and diversity while inhibiting a non-native grass. Plants 12:1184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants12051184\u003c/span\u003e\u003cspan address=\"10.3390/plants12051184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoziol L, McKenna TP, Crews TE, Bever JD (2023b) Native arbuscular mycorrhizal fungi promote native grassland diversity and suppress weeds 4 years following inoculation. Restor Ecol 31:13772. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/rec.13772\u003c/span\u003e\u003cspan address=\"10.1111/rec.13772\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Tao L, Zhao Z (2007) Differences of arbuscular mycorrhizal fungal diversity and community; between a cultivated land an old field and a never cultivated field in a hot and arid ecosystem of southwest China. Mycorrhiza 17:655\u0026ndash;665. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-007-0143-4\u003c/span\u003e\u003cspan address=\"10.1007/s00572-007-0143-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu S, Vasar M, \u0026Ouml;pik M, Koorem K (2023) Disturbance induces similar shifts in arbuscular mycorrhizal fungal communities from grassland and arable field soils. Mycorrhiza 33:153\u0026ndash;164. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-023-01108-6\u003c/span\u003e\u003cspan address=\"10.1007/s00572-023-01108-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLumini E, Orgiazzi A, Borriello R et al (2010) Disclosing arbuscular mycorrhizal fungal biodiversity in soil through a land-use gradient using a pyrosequencing approach. Environ Microbiol 12:2165\u0026ndash;2179. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1462-2920.2009.02099.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1462-2920.2009.02099.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Y, Ankit A, Tiwari J, Bauddh K (2022) Plant-mycorrhizal fungi interactions in phytoremediation of geogenic contaminated soils. Front Microbiol 13:843415\u0026ndash;843415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2022.843415\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2022.843415\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMathimaran N, Ruh R, Vullioud P et al (2005) Glomus intraradices dominates arbuscular mycorrhizal communities in a heavy textured agricultural soil. Mycorrhiza 16:61\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-005-0014-9\u003c/span\u003e\u003cspan address=\"10.1007/s00572-005-0014-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCain KNS, Wilson GWT, Blair JM (2011) Mycorrhizal suppression alters plant productivity and forb establishment in a grass-dominated prairie restoration. Plant Ecol 212:1675\u0026ndash;1685. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11258-011-9940-0\u003c/span\u003e\u003cspan address=\"10.1007/s11258-011-9940-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcMurdie M, Holmes S (2013) phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8:e61217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.plos.org/10.1371/journal.pone.0061217\u003c/span\u003e\u003cspan address=\"http://dx.plos.10.1371/journal.pone.0061217\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiddleton EL, Richardson S, Koziol L et al (2015) Locally adapted arbuscular mycorrhizal fungi improve vigor and resistance to herbivory of native prairie plant species. Ecosphere 6:276. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1890/ES15-00152.1\u003c/span\u003e\u003cspan address=\"10.1890/ES15-00152.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller MH, McGonigle TP, Addy HD (1995) Functional ecology of vesicular arbuscular mycorrhizas as influenced by phosphate fertilization and tillage in an agricultural ecosystem. Crit Rev Biotechnol 15:241\u0026ndash;255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3109/07388559509147411\u003c/span\u003e\u003cspan address=\"10.3109/07388559509147411\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMir\u0026aacute;s-Avalos JM, Antunes PM, Koch A et al (2011) The influence of tillage on the structure of rhizosphere and root associated arbuscular mycorrhizal fungal communities. Pedobiologia 54:235\u0026ndash;241. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pedobi.2011.03.005\u003c/span\u003e\u003cspan address=\"10.1016/j.pedobi.2011.03.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMony C, Gaudu V, Ricono C et al (2021) Plant neighbours shape fungal assemblages associated with plant roots: A new understanding of niche-partitioning in plant communities. Funct Ecol 35:1768\u0026ndash;1782. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1365-2435.13804\u003c/span\u003e\u003cspan address=\"10.1111/1365-2435.13804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOehl F, Sieverding E, Ineichen K et al (2003) Impact of land use intensity on the species diversity of arbuscular mycorrhizal fungi in agroecosystems of central Europe. Appl Environ Microbiol 69:2816\u0026ndash;2824. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.69.5.2816-2824.2003\u003c/span\u003e\u003cspan address=\"10.1128/AEM.69.5.2816-2824.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOksanen J, Simpson G, Blanchet F et al (2025) vegan: Community Ecology Package. R package version 2.6-4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://CRAN.R-project.org/package=vegan\u003c/span\u003e\u003cspan address=\"https://CRAN.R-project.org/package=vegan\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOntario Ministry of the Environment Conservation and Parks (2023) Species at risk in Ontario. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ontario.ca/page/species-risk-ontario\u003c/span\u003e\u003cspan address=\"https://www.ontario.ca/page/species-risk-ontario\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;pik M, Vanatoa A, Vanatoa E et al (2010) The online database MaarjAM reveals global and ecosystemic distribution patterns in arbuscular mycorrhizal fungi (Glomeromycota). New Phytol 188:223\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2010.03334.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2010.03334.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaluch EC, Thomsen MA, Volk TJ (2013) Effects of resident soil fungi and land use history outweigh those of commercial mycorrhizal inocula: Testing a restoration strategy in unsterilized soil. Restor Ecol 21:380\u0026ndash;389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1526-100X.2012.00894.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1526-100X.2012.00894.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoudel M, Mendes R, Costa LAS et al (2021) The role of plant-associated bacteria, fungi, and viruses in drought stress mitigation. Front Microbiol 12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3389/fmicb.2021.743512\u003c/span\u003e\u003cspan address=\"https://doi:10.3389/fmicb.2021.743512\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR Core Team (2025) R: A language and environment for statistical computing. R Foundation for Statistical Computing Vienna Austria. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.R-project.org/\u003c/span\u003e\u003cspan address=\"https://www.R-project.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRedecker D, Hijri I, Wiekmen A (2003) Molecular identification of arbuscular mycorrhizal fungi in roots: perspectives and problems. Folia Geobot 38:113\u0026ndash;124. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02803144\u003c/span\u003e\u003cspan address=\"10.1007/BF02803144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodger L (1998) Tallgrass communities of southern Ontario; a recovery plan. World Wildlife Fund Canada and the Ontario Ministry of Natural Resources. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://tallgrassontario.org/wp-site/wp-content/uploads/2018/07/TallgrassRecoveryPlan.pdf\u003c/span\u003e\u003cspan address=\"https://tallgrassontario.org/wp-site/wp-content/uploads/2018/07/TallgrassRecoveryPlan.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRowe HI, Fargione J, Holland JD (2013) Prairie restorations can protect remnant tallgrass prairie plant communities. Am Midl Nat 170:26\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1674/0003-0031-170.1.26\u003c/span\u003e\u003cspan address=\"10.1674/0003-0031-170.1.26\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamson FB, Knopf FL (1996) Prairie conservation: preserving North America\u0026rsquo;s most endangered ecosystem. Island, Washington DC USA\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato K, Suyama Y, Saito M, Sugawara K (2005) A new primer for discrimination of arbuscular mycorrhizal fungi with polymerase chain reaction-denature gradient gel electrophoresis. Grassl Sci 51:179\u0026ndash;181. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1744-697X.2005.00023.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1744-697X.2005.00023.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchnoor TK, Martensson L, Olsson PA (2011) Soil disturbance alters plant community composition and decreases mycorrhizal carbon allocation in a sandy grassland. Oecologia 167:809\u0026ndash;819. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00442-011-2020-2\u003c/span\u003e\u003cspan address=\"10.1007/s00442-011-2020-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026uuml;\u0026szlig;ler A, Walker C (2010) The Glomeromycota: a species list with new families. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.amf-phylogeny.com/\u003c/span\u003e\u003cspan address=\"http://www.amf-phylogeny.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSch\u0026uuml;\u0026szlig;ler A, Schwarzott D, Walker C (2001) A new fungal phylum the Glomeromycota: phylogeny and evolution. Mycol Res 105:1413\u0026ndash;1421. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0953756201005196\u003c/span\u003e\u003cspan address=\"10.1017/S0953756201005196\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith MR, Charvat I, Jacobson RL (1998) Arbuscular mycorrhizae promote establishment of prairie species in a tallgrass prairie restoration. Can J Bot 76:1947\u0026ndash;1954. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1139/b98-205\u003c/span\u003e\u003cspan address=\"10.1139/b98-205\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith SE, Read DJ (2008) Mycorrhizal symbiosis, 3rd edn. Academic, Cambridge UK\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSnyder S, Lebedyk D, Stuart D et al (2019) Tallgrass Communities of Southern Ontario Conservation Plan: 2019 Update and Recovery Plan. Ontario Ministry of Natural Resources and Forestry. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://tallgrassontario.org/wp-site/wp-content/uploads/2021/05/2019-Update-to-the-Ontario-Tallgrass-Conservation-Plan-revision-1.pdf\u003c/span\u003e\u003cspan address=\"https://tallgrassontario.org/wp-site/wp-content/uploads/2021/05/2019-Update-to-the-Ontario-Tallgrass-Conservation-Plan-revision-1.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoteras F, Grilli G, Cofr\u0026eacute; MN et al (2015) Arbuscular mycorrhizal fungal composition in high montane forests with different disturbance histories in central Argentina. Appl Soil Ecol 85:30\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2014.09.004\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2014.09.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStockinger H, Peyret-Guzzon M, Koegel S et al (2014) The largest subunit of RNA polymerase II as a new marker gene to study assemblages of arbuscular mycorrhizal fungi in the field. PLoS ONE 9:e107783. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1371/journal.pone.0107783\u003c/span\u003e\u003cspan address=\"https://doi:10.1371/journal.pone.0107783\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStover HJ, Naeth MA, Boldt-Burisch K (2018) Soil disturbance changes arbuscular mycorrhizal fungi richness and composition in a fescue grassland in Alberta Canada. Appl Soil Ecol 131:29\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2018.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2018.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStover H, Thorn RG, Bowles JM et al (2012) Arbuscular mycorrhizal fungi and vascular plant species abundance and community structure in tallgrass prairies with varying agricultural disturbance histories. Appl Soil Ecol 60:61\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2012.02.016\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2012.02.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022\u0026ndash;3027. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msab120\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msab120\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTedersoo L, Magurno F, Alkahtani S, Mikryukov V (2024) ໿Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes). MycoKeys 107:273\u0026ndash;325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3897/mycokeys.107.125549\u003c/span\u003e\u003cspan address=\"10.3897/mycokeys.107.125549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThe Rt Hon. Herb Gray Parkway (2011). Environment. Retrieved from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.hgparkway.com/node/4\u003c/span\u003e\u003cspan address=\"https://www.hgparkway.com/node/4\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomopoulos S, Elsgaard L, Munkholm LJ, Ravnskov S (2023) Evaluation of the relation between soil biomass of arbuscular mycorrhizal fungi and glomalin-related soil protein in conservation agriculture. Soil Biol Biochem 187:109222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.soilbio.2023.109222\u003c/span\u003e\u003cspan address=\"10.1016/j.soilbio.2023.109222\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003en der Heijden MGA, Klironomos JN, Ursic M et al (1998) Mycorrhizal fungal diversity determines plant diversity ecosystem variability and productivity. Nature 396:69\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/23932\u003c/span\u003e\u003cspan address=\"10.1038/23932\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003en der Heyde M, Ohsowski B, Abbott LK, Hart M (2017) Arbuscular mycorrhizal fungus responses to disturbance are context-dependent. Mycorrhiza 27:431\u0026ndash;440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-016-0759-3\u003c/span\u003e\u003cspan address=\"10.1007/s00572-016-0759-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVandenkoornhuyse P, Husband R, Daniell TJ et al (2002) Arbuscular mycorrhizal community composition associated with two plant species in a grassland ecosystem. Mol Ecol 11:1555\u0026ndash;1564. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-294X.2002.01538.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-294X.2002.01538.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVětrovsk\u0026yacute; T, Kolař\u0026iacute;kov\u0026aacute; Z, Lepinay C et al (2023) GlobalAMFungi: a global database of arbuscular mycorrhizal fungal occurrences from high-throughput sequencing metabarcoding studies. New Phytol 240:2151\u0026ndash;2163. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.19283\u003c/span\u003e\u003cspan address=\"10.1111/nph.19283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWalker C, Vestberg M, Sch\u0026uuml;\u0026szlig;ler A (2007) Nomenclatural clarification in Glomeromycota. Mycol Res 111:253\u0026ndash;256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mycres.2007.02.009\u003c/span\u003e\u003cspan address=\"10.1016/j.mycres.2007.02.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong TKF, Ly-Trong N, Ren H (2025) IQ-TREE 3: Phylogenomic Inference Software using Complex Evolutionary Models. Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.32942/X2P62N\u003c/span\u003e\u003cspan address=\"10.32942/X2P62N\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWright SF, Upadhyaya A (1998) A survey of soils for aggregate stability and glomalin a glycoprotein produced by hyphae of arbuscular mycorrhizal fungi. Plant Soil 198:97\u0026ndash;107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1004347701584\u003c/span\u003e\u003cspan address=\"10.1023/A:1004347701584\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu T, Veresoglou SD, Chen Y et al (2016) Plant community geographic distance and abiotic factors play different roles in predicting AMF biogeography at the regional scale in northern China. Environ Microbiol Rep 8:1048\u0026ndash;1057. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1758-2229.12485\u003c/span\u003e\u003cspan address=\"10.1111/1758-2229.12485\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZubek S, Kapusta P, Rożek K et al (2022) Fungal root colonization and arbuscular mycorrhizal fungi diversity in soils of grasslands with different mowing intensities. Appl Soil Ecol 172:104358. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.apsoil.2021.104358\u003c/span\u003e\u003cspan address=\"10.1016/j.apsoil.2021.104358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"AMF, community metabarcoding, disturbance, mycorrhizal ecology","lastPublishedDoi":"10.21203/rs.3.rs-9149922/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9149922/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eArbuscular mycorrhizal fungi (AMF), in the phylum Glomeromycota, form symbiotic relationships with most vascular plants, including grasses. Tallgrass prairies (TGPs) are an endangered habitat in Ontario; some undisturbed fragments remain and there have been efforts to restore disused agricultural land to prairie. The objective of this study was to investigate differences in the community composition of arbuscular mycorrhizal fungi between disturbed and undisturbed TGP at five locations across southwestern Ontario. The V4 variable region of the small ribosomal subunit was amplified from DNAs extracted from soil samples, and sequence analysis yielded operational taxonomic units (OTUs) representing twelve genera of Glomeromycota. There was a significant difference in the community composition of the AMF communities in undisturbed TGP remnants and restored TGP that had been previously disturbed, with an overall greater community diversity and evenness in the undisturbed than previously disturbed sites. \u003cem\u003eAmbispora fennica\u003c/em\u003e, three OTUs of \u003cem\u003eDiversispora\u003c/em\u003e and four OTUs of \u003cem\u003eGlomus\u003c/em\u003e were found to be potential indicator taxa of undisturbed TGPs and, overall, \u003cem\u003eGlomus\u003c/em\u003e was significantly more abundant in undisturbed than disturbed sites. In contrast, two other OTUs of \u003cem\u003eDiversispora\u003c/em\u003e, two of \u003cem\u003eEntrophospora\u003c/em\u003e and one of \u003cem\u003eSeptoglomus\u003c/em\u003e were found to be potential indicator taxa of disturbed TGPs. These finding have implications for success of TGP restoration and should be considered in future efforts.\u003c/p\u003e","manuscriptTitle":"Community composition of arbuscular mycorrhizal fungi in Ontario tallgrass prairies of differing disturbance histories","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-06 15:42:27","doi":"10.21203/rs.3.rs-9149922/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-05-06T22:12:38+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-30T12:59:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-30T06:57:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"44053820063043792874568727044321042961","date":"2026-04-03T04:13:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"37187516310753429054456706737963813465","date":"2026-04-02T04:48:03+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-01T10:34:47+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-01T08:19:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-30T21:30:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mycorrhiza","date":"2026-03-17T14:09:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"214024b5-7ab4-4c9e-8df0-dc8c2db25cab","owner":[],"postedDate":"April 6th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"Revision requested","date":"2026-05-06T22:12:38+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-30T12:59:07+00:00","index":12,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-30T06:57:48+00:00","index":11,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-05-06T22:23:53+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-06 15:42:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9149922","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9149922","identity":"rs-9149922","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}