Full text
104,192 characters
· extracted from
preprint-html
· click to expand
Genome-guided manipulation of regulators of morphogenesis in a C. albicans strain with low virulence is not sufficient to trigger a high-virulence phenotype | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Genome-guided manipulation of regulators of morphogenesis in a C. albicans strain with low virulence is not sufficient to trigger a high-virulence phenotype Ricardo Fróis-Martins , Sarah Mertens , View ORCID Profile Van Du T. Tran , Corinne Maufrais , View ORCID Profile Christophe d’Enfert , View ORCID Profile Dominique Sanglard , Salomé LeibundGut-Landmann doi: https://doi.org/10.1101/2025.07.16.665085 Ricardo Fróis-Martins 1 Section of Immunology, Vetsuisse Faculty, University of Zurich , Zurich, Switzerland 2 Institute of Experimental Immunology, University of Zurich , Zurich, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sarah Mertens 1 Section of Immunology, Vetsuisse Faculty, University of Zurich , Zurich, Switzerland 2 Institute of Experimental Immunology, University of Zurich , Zurich, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Van Du T. Tran 3 Vital-IT, SIB Swiss Institute of Bioinformatics , Lausanne, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Van Du T. Tran Corinne Maufrais 4 Institut Pasteur, Université Paris Cité, INRAE USC2019, Unité Biologie et Pathogénicité Fongiques , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christophe d’Enfert 4 Institut Pasteur, Université Paris Cité, INRAE USC2019, Unité Biologie et Pathogénicité Fongiques , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christophe d’Enfert Dominique Sanglard 5 Institute of Microbiology, University of Lausanne and University Hospital Center , Lausanne, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Dominique Sanglard Salomé LeibundGut-Landmann 1 Section of Immunology, Vetsuisse Faculty, University of Zurich , Zurich, Switzerland 2 Institute of Experimental Immunology, University of Zurich , Zurich, Switzerland 6 Medical Research Council Centre for Medical Mycology at the University of Exeter, Department of Biosciences, Faculty of Health and Life Sciences , Exeter, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: salome.leibundgut-landmann{at}uzh.ch Abstract Full Text Info/History Metrics Preview PDF ABSTRACT As a member of the microbiome, C. albicans colonizes the oral cavity and other mucosal surfaces of the human body. While commensalism is tightly controlled by the host immune system, the fungal determinants enabling the fungus to colonize the host mucosa without causing tissue damage and inflammation remain less clear. In search of genetic determinants that may underly the commensal lifestyle of the low-virulent C. albicans isolate 101, we identified a small sequence duplication in one of the BRG1 allele resulting in a truncated loss-of-function allele ( BRG1 TRUNC ). Replacing BRG1 TRUNC by the full-length allele ( BRG1 FL ) resulted in a modest increase in filamentation, but did not alter the phenotype of the fungus in the oral mucosa of experimentally colonized mice. Spontaneous outgrowth of highly virulent variants of the 101 strain with the BRG1 TRUNC alleles replaced by a full-length allele identified the Cyr1-cAMP-PKA signalling pathway as a modulator of fungal virulence. Although the Glu-to-Lys mutation in CYR1 ( CYR1 E1541K ), which converts Cyr1 into a hyperactive adenylate cyclase, greatly increased filamentation, the expression of hyphae-associated genes, and host cell damage when tested in vitro , it was insufficient to increase virulence of C. albicans strain 101 in the oral mucosa in vivo , irrespective of the BRG1 status. Together, this highlights that the low-virulent nature of strain 101 is firmly anchored and cannot be overcome by manipulating BRG1 and CYR1, two genes with known roles in C. albicans virulence. IMPORTANCE During homeostasis, the fungus Candida albicans establishes mutualistic interactions with its human host. It can however also adopt a pathogenic state and cause infections with diverse clinical manifestions that pose a significant challenge for diagnosis and therapy. Understanding the fungal determinants that underlie C. albicans colonization under steady state conditions may thus provide new avenues for modulating the fungus-host interaction in candidiasis patients to restore homeostasis. Here, we report gene variants that distinguish high-virulent from low-virulent C. albicans . Gene-exchange mutants provided evidence for the contribution of a BRG1 loss-of-function allele and a CYR1 gain-of-function mutation toward fungal pathogenicity. However, in vivo in an experimental model of C. albicans oral colonization, none of these gene variants individually or in combination were sufficient to change the virulence profile of the fungus. These findings indicate that C. albicans mucosal colonization is regulated by a complex gene network rather than by single genetic determinants. INTRODUCTION Candida albicans is a common member of the microbiome in the oral cavity, the gastrointestinal tract, and the female reproductive tract ( 1 ). Despite its primarily commensal lifestyle, C. albicans can become pathogenic and is therefore also referred to as a pathobiont. Under conditions of compromised host immunity or upon dysbiosis, it can cause superficial infections that manifest as oral and vaginal thrush ( 2 , 3 ). In rare cases, such as in neutropenic individuals, C. albicans translocates across the epithelial barrier and disseminates via the bloodstream to cause systemic disease, which is associated with a high mortality rate due to liver, spleen and kidney failure, and/or fungal meningitis ( 2 ). The pathogenic impact of C. albicans further extends to non-infectious diseases such as inflammatory bowel disease and ethanol-induced liver disease ( 4 – 8 ). Treatment options are limited and the rise in antifungal resistance jeopardises the effectiveness of the few available antifungal drugs ( 9 ). A better understanding of the mechanisms governing fungal pathogenicity is needed to guide new approaches for disease prevention and therapy by targetting fungal pathogenicity determinants rather than aiming at eradicating the oragnisms with fungicidal drugs. A hallmark of C. albicans pathogenicity is its capacity to undergo morphological changes and switch between yeast and hyphal forms. While originally, the yeast form was primarily associated with colonization and the hyphal morphotype with pathogenicity, this dichotomy has been challenged by the observation that both, yeast-locked and hyperfilamentous mutants are avirulent in experimental infection models ( 10 – 12 ). Moreover, we and others have recently found that homeostatic colonization of the oro-gastrointestinal tract also depends on the capacity of C. albicans to filament, while yeast-locked mutants are bad colonizers ( 10 , 12 , 13 ). Therefore, dynamic morphological changes are critical for both, fungal colonization and disease. Limiting the degree of filamentation and the processes associated with filamentation is essential for stable colonization during steady state and for tissue homeostasis ( 13 , 14 ) C. albicans filamentation is regulated by environmental cues that are integrated by diverse signal transduction pathways, including the MAPK pathway, the Rim101 pathway, and the cAMP-dependent potein kinase A (PKA) pathway ( 15 , 16 ). The adenylate cyclase Cyr1 plays a central role in translating environmental cues into PKA activation, in part by Ras-dependendent mechanisms ( 17 ). Cyr1 converts ATP into the secondary messenger cAMP, which leads to PKA activation and in turn phosphorylation of the master regulator of the yeast-to-hyphae transition, Efg1 ( 18 ). Activated Efg1 not only drives the core filamentation response in C. albicans but also induces expression of numerous virulence genes, including HWP1, ALS3 , and ECE1 . These hyphae-associated genes mediate fungal adhesion, tissue invasion, and host cell lysis, key processes in the interaction of the fungus with the host culminating in infection and tissue damage ( 19 – 21 ). To limit the expression of these virulence traits , C. albicans possesses hyphal repressors such as Nrg1, a DNA-binding protein repressing filamentous growth via the Tup1 pathway ( 22 , 23 ). The expression of NRG1 itself is regulated by Brg1, which influences the stability of NRG1 transcripts, thus controlling hyphae formation and virulence via a feedback circuit ( 11 ). C. albicans exhibits a large intraspecies diversity ( 24 ) with strain-specific differences at the genomic, genetic, and epigenetic levels translating into phenotypic variations ( 25 , 26 ). As such, the C. albicans species comprises a large spectrum of isolates differing in their intrinsic degree of virulence, which in turn is further modulated by environmental and host factors. Most experimental studies have been conducted with strain SC5314, although this strain is not fully representative of the species due to its intrinsic high virulent properties ( 25 , 26 ). When experimentally administered to mice, it causes an acute inflammatory response and is rapidly cleared ( 27 ). More recently, different groups including our own started to explore the nature of low-virulent strains and their behavior at the host interface ( 25 , 28 , 29 ). Pinpointing the molecular basis underlying the phenotypic differences between strains is challenging given the number of genetic differences that often separate natural isolates of C. albicans ( 30 ). The oral isolate 101 is a low-virulent strain suitable for studying long-term fungal mucosal colonization. It persistently colonizes the oral mucosa of immunocompetent and non-antibiotically treated mice without causing tissue damage and inflammation, reminiscent of C. albicans homeostatic colonization in humans. Yet, T cell and IL-17 deficiency causes overgrowth of isolate 101 leading to symptoms reminiscent of oral thrush ( 25 , 31 , 32 ). The intrinsically low-virulent nature of the strain is explained by the strong attenuation of key virulence genes, including those linked to filamentation owing to high expression of the transcriptional repressor gene NRG1 ( 14 ). Deletion or repression of NRG1 rendered strain 101 more virulent by derepressing the hyphal program ( 14 ). In search of genetic determinants underlying the elevated expression of NRG1 in strain 101, we identified a truncated BRG1 allele that was not present in other low-virulent C. albicans isolates. We defined the role of the truncated allele in fungal pathogenicity in vitro and in vivo . Furthermore, we found that strain 101 spontaneously acquires mutations in the RAS/cAMP-PKA pathway, which derepressed several virulent traits. The strong induction of filamentation, ECE1 expression and epithelial damage observed under in vitro conditions was however not paralleled by increased pathogenicity in vivo . Instead, strain 101 variants preserved a largely low-virulent behavior in the murine oral mucosa, highlighting that the low-virulent nature of strain 101 is firmly anchored and cannot be overcome by manipulating individual genes associated with virulence. RESULTS The truncated BRG1 allele identified in the low-virulent strain 101 is unable to drive virulence of strain SC5314 In search of mutations that may underly the low-virulent phenotype of strain 101, we established and annotated the full genome of strain 101 (Bioproject PRJNA923600). The 101 genome was resolved into 2 separate haplotypes (Bioprojects PRJNA1074522 and PRJNA1074523; see Material and Methods for details) with each 8 large contigs corresponding to the 8 chromosomes of the reference SC5314. The 2 haplotypes contained 5829 and 5816 annotated genes, which is lower than SC5314 (6213 annotated genes) but principally due to the absence of annotations for ORF smaller than 500 bp in the 101 haplotypes. The two 101 haplotypes exhibit low homozygosity (approximately 11’000 SNPs between each haplotype). While focusing on known C. albicans genes affecting virulence and/or filamentation, we identified using haplotype alignment a 209 base pair duplication at the 3’ end of the BRG1 gene in one of the haplotypes, creating a truncated protein due to a frameshift ( Figure 1A ). Amplification by PCR of BRG1 alleles in strain 101 confirmed the presence of two distinct alleles that differ in length ( Figure 1B ). The gene duplication responsible for the truncated BRG1 allele in strain 101 ( BRG1 TRUNC ) is unique across >250 whole-genome (short-read) sequenced isolates. Download figure Open in new tab Figure 1. The truncated BRG1 allele identified in the low-virulent strain 101 is unable to drive virulence of strain SC5314. A.-B. Two different BRG1 alleles are present in strain 101. A. Alignment of the BRG1 region of the two haplotypes of strain 101 compared to the BRG1 locus (C1_05140W_A) of SC5314 as reference (yellow highlighted)).. BRG1 open reading frames (ORF) are indicated by yellow arrows below each aligned nucleotide sequence. SC5314 BRG1 region The polymorphisms between the different BRG1 alleles are indicated by black bars in the greyed nucleotide sequences The repeated regions (indicated by red rectangles) results in a 200-bp increase of PCR product for allele BRG1-TRUNC (see planel B).Alignment was obtained with Geneious Prime (Biomatters, Ltd.). B. PCR amplification of BRG1 alleles in 101 and visualization of two different band sizes (1.5 and 1.3 kb). Primers BRG1-5 and BRG1-3 that were used in PCR are showed in Panel A and are located at the boundaries of the BRG1 orf, resulting in 1.5 and 1.3 kb products for BRG1-TRUNC and BRG1-FL, respectively, which is consistent with gel electrophoresis. Left lane: molecular weight standard (Benchtop 1 kb DNA Ladder, Promega). C.-G. C. albicans strains SC5314_ BRG1 / BRG1 , SC5314_ brg1 Δ/Δ, SC5314_ brg1 Δ/ BRG1 FL , SC5314_ brg1 Δ/ BRG1 TRUNC , and 101 were assessed for their phenotype in vitro . C. Colony morphology of the strains grown on Spider agar for 7 days at 35°C . D. Representative images of filamenting strains upon contact with a monolayer of TR146 keratinocytes for 3.5 hours at 37°C, 5% CO 2 . E. Quantification of the filament length. Each symbol represents the mean filament length of 20 – 30 filaments per field. Data are pooled from two independent experiments with 15-20 visual fields analyzed per strain each. The mean ± SEM is indicated. F. LDH released from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. Data are pooled from two independent experiments with 4 wells per strain each. The mean ± SEM is indicated. G. ECE1 , HWP1 , and ALS3 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. Statistical significance was determined using one-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S1 . The second haplotype retained a full length copy of the BRG1 gene in strain 101 (termed BRG1-FL in the following), which slightly differs from the two revised BRG1 alleles of strain SC5314 ( Suppl. Figure S1 ). Notably, our phasing of single nucleotide polymorphisms and analysis of insertion-deletion data at the BRG1 locus for 182 C. albicans genome-sequenced isolates (Ropars et al., 2018) revealed a frameshift in the BRG1 haplotypes of strain SC5314 (Assembly 22). Correction of this frameshift as well as glutamine-rich coding regions led to two Brg1 proteins with C-terminal sequences identical to that in the Brg1-FL protein of strain 101 ( Suppl. Figure S1 ). The same was observed for strains CEC3672 and CEC3678 that will be described below. Given the role of Brg1 as a transcription factor associated with C. albicans virulence and biofilm formation acting as negative regulator of Nrg1 ( 11 , 33 ) and because of the causal link between the degree of NRG1 expression and the low-virulent phenotype of strain 101 ( 14 ), we decided to experimentally investigate the functional role of the newly identified truncated BRG1 allele in C. albicans pathogenicity. Download figure Open in new tab Figure S1 (related to Figure 1). Alignment of Brg1 proteins from C. albicans strains SC5314, 101 and CEC3672. For strains SC5314 and CEC3672, BRG1 haplotypes were inferred from SNP data obtained for 182 genome-sequenced strains ( 24 ) using PHASE 2.0 as previously described (Wickramasinghe et al ., 2024). Haplotypes were subsequently edited to consider insertion and deletion events identified using GATK ( 24 ). For strain 101, BRG1 haplotypes were obtained based on the genome assembly produced in this study. The deduced aminoacid sequences for the 6 BRG1 haplotypes were aligned using MUSCLE ( 83 ) and colored using JalView ( 84 ). The level of conservation of the aminoacids across the 6 sequences is shown with a descending coloring ranging from dark blue to white. The aminoacid C-terminal extension shared by all Brg1 proteins and lacking in the Brg1 protein deduced from Assembly 22 of the C. albicans SC5314 genome is boxed in red. Data obtained for strain CEC3678 are not shown as they are identical to those obtained for strain CEC3672. We started by introducing the truncated allele, or the full length allele from strain 101 ( BRG1 FL ) as a control, into a BRG1 null mutant of strain SC5314 (SC5314_ brg1 ΔIΔ). BRG1 expression levels were restored irrespective of the allele ( Suppl. Figure S2A ). While full deletion of BRG1 strongly impacted filamentation, introduction of one copy of the full-length BRG1 allele of strain 101 into SC5314_ brg1 Δ I Δ was sufficient to restore filamentation on Spider agar ( Figure 1C ), indicating that BRG1 FL of strain 101 is fully functional. In contrast, the truncated BRG1 allele of strain 101 was unable to do so ( Figure 1C ). Likewise, the filamentation defect of strain SC5314_ brg1 Δ I Δ when placed in contact with keratinocytes in FCS-containing medium was restored upon introduction of BRG1 FL in this strain while it was not restored upon introduction of BRG1 TRUNC ( Figure 1D-E ). Introduction of the BRG1 TRUNC allele into wild-type SC5314, replacing one full-length allele while leaving intact the second full-length allele, did not compromise filamentation under the same assay conditions, indicating that the BRG1 TRUNC allele did not act as a dominant-negative allele ( Suppl. Figure S2B ). Download figure Open in new tab Figure S2 (related to Figure 1). The truncated BRG1 allele identified in the low-virulent strain 101 is unable to drive virulence in strain SC5314. A. BRG1 expression levels in C. albicans strains 101 wild type, SC5314_ BRG1 / BRG1 , SC5314_ brg1 Δ/Δ, SC5314_ brg1 Δ/ BRG1 FL , SC5314_ brg1 Δ/ BRG1 TRUNC after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. C.-E. C. albicans strains SC5314 wild type and SC5314_ BRG1 / BRG1 TRUNC were assessed for their phenotype in vitro . C. Quantification of filament length of strain put in contact with TR146 cells. Each symbol represents the mean filament length of 20 – 30 filaments per visual field. Data are pooled from two independent experiments with 10-12 visual fields analyzed per strain each. The mean ± SD is indicated. D. LDH release from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. Data are pooled from two independent experiments with 4 wells per strain each. The mean ± SEM is indicated. E. ECE1 , HWP1 , ALS3 and NRG1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean is indicated. Statistical significance was determined using one-way ANOVA (C) or student’s t -test (D-F).. ***p<0.001, ****p<0.0001. In line with the requirement of strong filamentation for epithelial cell damage induction by C. albicans SC5314 ( 19 ), introducing the BRG1 TRUNC allele into SC5314_ brg1 Δ/Δ partially restored the high degree of damage in TR146 keratinocytes that was elicited in response to strains containing one or two copies of the full-length allele ( Figure 1F ). Again, in a mutant strain containing both, a BRG1 TRUNC and a full length BRG1 allele, the truncated allele did not alter the effect of the full-length allele ( Suppl. Figure S2C ). The dependence of the virulence phenotype on BRG1 integrity extended to the expression of fungal virulence genes, including the candidalysin-encoding ECE1 gene as well as the adhesin-coding genes ALS3 and HWP1 , all among the genes that were defined to constitute the core filamentation response ( 34 ). While the introduction of BRG1 FL into SC5314_ brg1 ΔIΔ restored expression levels similar to those in wild-type SC5314, the BRG1 TRUNC allele led to only limited expression of hyphae-associated genes ( Figure 1G ). In presence of a full length gene copy, introduction of BRG1 TRUNC had not impact on virulence gene expression, again confirming that he truncated allele was not dominant-negative ( Suppl. Figure S2D ). Together, these results demonstrate that the truncated BRG1 allele identified in the low-virulent strain 101 was dysfunctional in C. albicans . Although our experiments demonstrate that it does not act as a dominant negative allele in the high-virulent strain SC5314, we speculate that in a low-virulent strain such as strain 101, it may impact the strain’s virulence, even in presence of an intact full-length allele. Restoring the full-length BRG1 allele in the low-virulent strain 101 is insufficient to increase the strain’s virulence After having found that the truncated BRG1 allele of strain 101 is hypomorphic, while the full-length allele is fully functional in the context of the highly virulent strain SC5314 ( Figure 1 ), we speculated that replacing the truncated allele in strain 101 with a second copy of the full length allele may induce virulence traits in this low-virulent strain. Notably, a strain 101 derivative bearing two BRG1 FL alleles did not show any change in colony morphology on Spider agar, when compared to the parental strain 101 bearing a BRG1 TRUNC allele and a BRG1 FL allele ( Figure 2A , top and Suppl. Fig. S3 ). Likewise, the replacement of the BRG1 TRUNC allele by the BRG1 FL allele did not increase the degree of filamentation of strain 101 when placed in contact to TR146 keratinocytes in FCS-containing medium ( Figure 2B , C ). Growth on YCB/BSA agar, which also triggers filamentation (embedded growth), indicated that the allele replacement did however have a small impact on fungal morphogenesis ( Figure 2A , bottom ). Moreover, longer incubation on Spider agar at 37°C also revealed the mildly enhanced filamenting capacity of the mutant ( Figure 2D ). However, the effect was not paralleled by a restoration of virulence. Epithelial cell damage induction, which serves as a good correlate for C. albicans pathogenicity in barrier tissues ( 25 ), was not enhanced by replacement of the BRG1 TRUNC allele by the BRG1 FL allele in strain 101 ( Figure 2E ). Likewise, expression of the core virulence genes ECE1 , HWP1 , and ALS3 was not enhanced and NRG1 levels remained highly expressed ( Figure 2F ). Together, these findings indicate that replacing the hypomorphic BRG1 TRUNC allele in strain 101 by a fully functional copy of BRG1 was not sufficient to alter the strain’s pathogenicity with respect to damage induction and virulence gene expression and only exerted a very limited effect on morphology when grown under in vitro conditions. Download figure Open in new tab Figure 2. Restoring the full-length BRG1 allele in low-virulent strain 101 is insufficient to increase the strain’s virulence when tested in vitro . C. albicans strains 101_ BRG1 FL / BRG1 TRUNC , 101_ BRG1 FL / BRG1 FL , 101_ BRG1 FL / BRG1 FL (*), and SC5314 wild type were assessed for their phenotype in vitro . A. Colony morphology of the strains grown on Spider agar (top) or on YCB/BSA agar (bottom) for 7 days at 35°C . B. Representative images of filamenting strains upon contact with a monolayer of TR146 keratinocytes for 3.5 hours at 37°C, 5% CO 2 . C. Quantification of the filament length. Each symbol represents the mean filament length of 20 – 30 filaments per visual field. Data are pooled from two independent experiments with 10-12 visual fields analyzed per strain each. The mean ± SEM is indicated. D. Colony morphology of the indicated strains grown on Spider agar for 5 weeks at 37°C, 5% CO 2 . E. LDH release from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. Data are pooled from two independent experiments with 4 wells per strain each. The mean ± SEM is indicated. F. ECE1 , HWP1 , ALS3 , and NRG1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. G. Close-up of a colony of 101_ BRG1 FL / BRG1 FL on Spider agar showing signs of filamentation in a subcolony. In C, D, F and G, statistical significance was determined using one-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S2 . Spontaneous mutants convert the low-virulent strain 101 in a highly virulent variant While performing in vitro experiments with strains 101_ BRG1 FL / BRG1 TRUNC and 101_ BRG1 FL / BRG1 FL shown in Figure 2A-F , we observed that the latter strain, when grown on Spider agar, displayed some spikes at the border of the colony, resembling hyphal outgrowth ( Figure 2G ). Material from the spike was collected and diluted to obtain single colonies. This strain, termed 101_ BRG1 FL / BRG1 FL (*) displayed a highly filamentous morphology under all conditions tested. On Spider agar, in suspension and in contact to keratinocytes, the strain closely resembled the high virulent strain SC5314 ( Figure 2A-C and Suppl. Fig. S3 ). It also elicited a strong LDH release response in TR146 cells ( Figure 2E ), and it displayed a gene expression profile confusingly similar to that of strain SC5314 ( Figure 2F ). Together, these findings indicate that a low-virulent strain can convert into a highly virulent variant as inferred from in vitro conditions. To further investigate the pathogenicity of the spontaneously outgrown 101_ BRG1 FL / BRG1 FL (*) strain at the interface with the host, we made use of our experimental model of oral colonization in mice. In this model, C. albicans efficiently establishes colonization of the epithelium, as can be assessed by quantification of the fungal burden in the tongue and by histological analysis of the tongue epithelium ( 25 ). Highly virulent strains such as SC5314 swiftly induce a strong inflammatory response upon invasion of fungal hyphae into the nucleated layers of the epithelium (stratum granulosum, stratum spinosum) where they stimulate cytokine and chemokine production, which in turn results in massive accumulations of inflammatory cells. This massive response, which peaks on day 1-2 post-infection, leads to clearance of the fungus within 3-5 days ( 27 , 35 , 36 ). In contrast, low virulence strains such as 101 reside predominantly in the stratum corneum and elicit a non-inflammatory homeostatic response that is characterized by tissue-resident Th17 cells ( 13 , 25 ). C. albicans -specific Th17 cells mediate immunosurveillance to prevent fungal overgrowth, without eliminating the fungus, thereby allowing long-lasting colonization, which mimics C. albicans colonization in humans. This model is therefore ideally suited for assessing and distinguishing high and low pathogenic isolates of C. albicans ( 25 ). We colonized wild type C57BL/6 mice with strain 101 carrying one or two BRG1 FL alleles as well as the spontaneously outgrown 101_ BRG1 FL / BRG1 FL (*) strain in comparison to SC5314. All strains colonized the tongue with comparable efficiency ( Figure 3A ). Reminiscent of what we observed in vitro , virulence factor genes were strongly induced and NRG1 expression repressed in 101_ BRG1 FL / BRG1 FL (*), but not in 101_ BRG1 FL / BRG1 TRUNC or 101_ BRG1 FL / BRG1 FL ( Figure 3B ). Strong induction of virulence factor gene expression correlated with the activation of a pronounced inflammatory response. Large agglomerates of inflammatory cells accumulated in the tongue epithelium of mice colonized with high-virulent isolates within as little as 1 day after infection ( Figure 3C ). Concomittantly, we observed expression of inflammatory cytokines in the colonized tissue ( Figure 3D ). Again, this response was limited to the spontaneously arisen high virulent mutant and its extent was comparable to that of the well-charachterized strain SC5314. Reminiscent of what is known for other high-virulent strains including SC5314, strain 101_ BRG1 FL / BRG1 FL (*) did not persist, but was rapidly cleared from the tongue epithelium, despite its origin from the persistent colonizer 101 ( Figure 3E ). Together, this indicates that spontaneous changes converted a low-virulent strain into a high virulent one that phenocopies the prototypical high-virulent strain SC5314 in all parameters tested. Download figure Open in new tab Figure 3. Restoring the full-length BRG1 allele in low-virulent strain 101 is insufficient to increase the strain’s virulence in vivo . C57BL/6 mice were colonized with C. albicans strains 101_ BRG1 FL / BRG1 TRUNC , 101_ BRG1 FL / BRG1 FL , 101_ BRG1 FL / BRG1 FL (*), and SC5314 wild type for 1 day (A-D) or 7 days (E-G). A. Tongue fungal burden on day 1 after colonization. DL, detection limit. B. ECE1 and NRG1 expression levels in the tongue tissue on day 1 after colonization. C. PAS-stained histology sections of the tongue on day 1 after colonization. D. Cytokine expression levels in the tongue tissue on day 1 after colonization. E. Tongue fungal burden on day 7 after colonization. DL, detection limit. F. PAS-stained histology sections of the tongue on day 7 after colonization. G. ECE1 , ALS3 , HWP1 and NRG1 expression levels in the tongue tissue on day 7 after colonization. In A, B, D, E, G, and H, each symbol represents one animal. Data are pooled from at least two independent experiments except for SC5314 in B and D. The mean ± SEM is indicated. Statistical significance was determined using two-way ANOVA. (B, D, E) or unpaired Student’s t test (G). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S3 . The mutant of 101 carrying two full-lenth BRG1 alleles could not be distinguished from its parental carrying only one fully functional BRG1 allele in terms of its behavior in the murine tongue tissue based on fungal burden, histology, and expression of fungal virulence genes and host genes on day 1 post-infection ( Figure 3A-D ). Accordingly, the strain persisted in the tongue as did the parental 101_ BRG1 FL / BRG1 TRUNC with high fungal burden one week after infection ( Figure 3E , F ). Of note, no significant differences were detected in the expression of ECE1 , HWP1 , and ALS3 in the tongue colonized with strain 101_ BRG1 FL / BRG1 FL in comparison to the parental 101_ BRG1 FL / BRG1 TRUNC on day 7 post-infection ( Figure 3G ). CYR1 E1541K induces the expression of virulence traits in the low-virulent strain 101 We hypothesized that the high virulence of strain 101_ BRG1 FL / BRG1 FL (*) was the result of spontaneous mutations arising during growth of strain 101_ BRG1 FL / BRG1 FL on Spider medium. To identify such mutation(s), whole genome sequencing of 101_ BRG1 FL / BRG1 FL (*) was performed and the genome was compared to that of the initial parent strain, 101_ BRG1 FL / BRG1 FL . Among the detected changes ( Suppl. Figure S4 and Suppl. Table S1 ), we noticed a non-synonymous point mutation in the gene encoding the adenlyl cyclase Cyr1 that leads to a Glu to Lys substitution in a conserved C-terminal motif close to the protein’s catalytic domain (position 1541). As an integral part of the cAMP-PKA pathway, Cyr1 regulates C. albicans morphogenesis ( 18 ). In response to environmental cues, it generates short-lived intracellular cAMP spikes. The Glu to Lys substitution at position 1541 of Cyr1 has been described previously to render the enzyme hyperactive and to cause constitutive filamentous growth of C. albicans even under non-hyphae-inducing conditions ( 37 ). Download figure Open in new tab Figure S3 (related to Figure 2). Restoring the full-length BRG1 allele in low-virulent strain 101 is insufficient to increase the strain’s virulence. C. albicans strains 101_ BRG1 FL / BRG1 TRUNC , 101_ BRG1 FL / BRG1 FL , 101_ BRG1 FL / BRG1 FL (*), and SC5314 wild type were assessed for their phenotype in vitro . A. Colony morphology of the strains grown on Spider agar (top and middle row) or on YCB/BSA agar (bottome row) for 7 days at 35°C. Download figure Open in new tab Figure S4 (related to Figure 3). Strategy to introduce the CYR1 E1541K mutation in parental strain 101 using CRISP/Cas9. First, the guided RNA was produced followed by introduction of the repair fragment that harbors the CYR1 single mutation. Then C. albicans strains were transformed by electroporation. Display of the sequence analysis demonstrated successful introduction of CYR1 single mutation. To assess whether the CYR1 E1541K point mutation was indeed responsible of the high-virulence phenotype of the spontaneously outgrown strain 101_ BRG1 FL / BRG1 FL (*), we used CRISPR/Cas9 to introduce the mutation directly into the wild type 101 strain ( Suppl. Figure S4 ). Modification of one allele was sufficient to drive a strong filamentation phenotype on Spider agar ( Figure 4A ) and in contact with TR146 keratinocytes ( Figure 4B , Suppl. Figure S5A ). Increased filamentation was accompanied by repression of NRG1 and strong induction of hyphae associated genes to levels approximating or even exceeding those measured in SC5314 ( Figure 4C , Suppl. Figure S5B ). Despite strong filamentation and high levels of ECE1 expression, the 101_ CYR1 E1541K mutant did not phenocopy strain SC5314 regarding epithelial cell damage induction( Figure 4D ). Download figure Open in new tab Figure S5 (related to Figure 4). CYR1 E1541K induces the expression of virulence traits in the low-virulent strain 101. A. Representative images of filamentation C. albicans strains 101 wild type, 101_ CYR1 E1541K , and 101_ CYR1 E1541K/E1541K and SC5314 wild type put in contact with a monolayer of TR146 keratinocytes for 3.5 – 4 hours at 37°C, 5% CO 2 . B. HWP1 , ALS3 , and NRG1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. C. HWP1 and NRG1 expression levels in the tongue tissue of C57BL/6 mice on day 1 after colonization with 101 wild type or 101_ CYR1 E1541K . Data are pooled from two independent experiments. The mean ± SEM is indicated. Statistical significance was determined using one-way ANOVA (B) or unpaired Student’s t test (C). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 Download figure Open in new tab Figure 4. CYR1 E1541K induces the expression of virulence traits in the low virulent strain 101. A.-D. C. albicans strains 101 wild type, 101_ CYR1 E1541K , and 101_ CYR1 E1541K/E1541K were assessed for their phenotype in vitro . A. Colony morphology of the strains grown on Spider agar for 5 days at 35°C . B. Filamentation of the strains upon contact with a monolayer of TR146 keratinocytes for 3.5 hours at 37°C, 5% CO 2 . Each symbol represents the mean filament length of 20 – 30 filaments per visual field. Each symbol represents the mean filament length of 20 – 30 filaments per visual field. The mean ± SEM is indicated. C. ECE1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. D. LDH release from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. Data are pooled from two independent experiments. The mean ± SEM is indicated. E.-G. C57BL/6 mice were colonized with C. albicans strains 101 wild type or 101_ CYR1 E1541K and tongue fungal burden (E), PAS-stained histology sections of the tongue (F), and ECE1 expression levels in the tongue tissue were analyzed on day 1 and day 7 after colonization. Each symbol represents one mouse. Data are pooled from two independent experiments. The mean ± SEM is indicated. DL, detection limit. H.-K. C. albicans strains 101_ BRG1 FL/ BRG1 FL , 101_ BRG1 FL/ BRG1 FL CYR1 E1541K (clone #1 and clone #2), and SC5314 wild type were assessed for their phenotype in vitro . H. Colony morphology of the strains grown on Spider agar for 5 days at 37 °C . I. Filamentation of the strains put in contact with a monolayer of TR146 keratinocytes for 3.5 hours at 37°C, 5% CO 2 . Each symbol represents the mean filament length of 20 – 30 filaments per visual field. The mean ± SEM is indicated. J. ECE1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. K. LDH release from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. . L.-N. C57BL/6 mice were colonized with C. albicans strains 101_ BRG1 FL/FL and 101_ BRG1 FL/FL CYR1 E1541K (clone 1). L. Tongue fungal burden on day 1 and day 7 after colonization. DL, detection limit. F. PAS-stained histology sections of the tongue on day 1 and day 7 after colonization. G. ECE1 expression levels in the tongue tissue on day 7 after colonization. Each symbol represents one mouse. Data are pooled from two independent experiments. The mean ± SEM is indicated. Statistical significance was determined using one-way ANOVA (B-D and I-K) or unpaired Student’s t test (E-E, G, L-N). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S4 and Figure S5. The lack of high damage induction in vitro correlated with the inability of the 101_ CYR1 E1541K mutant to drive inflammation in vivo in the oral mucosa of experimentally colonized mice ( Figure 4E-F ), as it is typical for highly virulent strains such as SC5314 ( Figure 3A-D ). The morphology of the 101_ CYR1 E1541K mutant in the murine tongue tissue was indistinguishable from that of the parental 101 wild type strain, although quantification of filament length is impossible on tissue sections ( Figure 4F ). Likewise, the expression of hyphae-associated genes by the CYR1 E1541K mutant in comparison to the parental 101 wild type strain was not enhanced in the tongue tissue ( Figure 4G ). We were unable to test the homozygous CYR1 E1541K mutant in vivo because this strain formed aggregates as a result of hyperfilamentous phenotype, which precluded reproducible colonization of the murine oral mucosa. By day 7, when high virulent strains such as SC5314 are cleared from the experimentally infected tongue ( 25 ), fungal counts of the 101_ CYR1 E1541K mutant were still high and indistinguishable from those of the parental wild type strain ( Figure 4E ). Fungal elements exhibited a mixed morphology. In very rare occasions we found larger fungal accumulations at the tongue surface, which in some instances also conincided with small inflammatory foci in the epithelium, whereby this was only the case for the CYR1 E1541K bearing mutant but not the wild type 101 strain ( Figure 4F ). This observation coincided with a small trend towards higher ECE1 and reduced NRG1 expression in the tongue tissue ( Figure 4G and Suppl. Fig 5C ). The lack of virulence of the 101_ CYR1 E1541K strain in vivo led us to question wether the full virulence-inducing potential of the hyperactive CYR1 E1541K gene variant was dependent on the presence of two intact BRG1 alleles, as the high-virulent CYR1 E1541K -carrying mutant originally emerged from the 101_ BRG1 FL / BRG1 FL strain ( Figure 2G ). We therefore introduced the CYR1 E1541K mutation into this strain to obtain a reconstituted mutant. This resulted in a strain that largely phenocopied 101_ CYR1 E1541K . It exhibited strongly enhanced filamentation in both Spider agar and in contact with TR146 keratinocytes and it strongly expressed hypae-induced genes ( Figure 4H-J , Suppl. Figure S6A ). However, these changes did not translate in enhanced keratinocyte damage induction if compared to the parental strain 101_ BRG1 FL / BRG1 FL ( Figure 5K ). Likewise, in the oral mucosa of experimentally colonized mice, the CYR1 E1541K variant did not exert a stronger virulence-inducing effect when introduced into 101_ BRG1 FL / BRG1 FL than in the wild type 101 background ( Figure 5L-N ). Download figure Open in new tab Figure S6 (related to Figure 4). CYR1 E1541K -induced virulence traits are independent of the BRG1 locus, and insufficient to elicit full virulence of strain 101 in the oral mucosa. A. Representative images of filamentation C. albicans strains 101_ BRG1 FL/ BRG1 FL , 101_ BRG1 FL/ BRG1 FL CYR1 E1541K (clone 1 and clone 2), and SC5314 wild type upon contact with a monolayer of TR146 keratinocytes for 3.5 – 4 hours at 37°C, 5% CO 2 . . B. HWP1 , ALS3 and NRG1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. C. HWP1 , ALS3 and NRG1 expression levels in the tongue tissue of C57BL/6 mice on day 7 after colonization with 101_ BRG1 FL/ BRG1 FL or 101_ BRG1 FL/ BRG1 FL CYR1 E1541K (clone 1). Each symbol represents one mouse. Data are pooled from two independent experiments. The mean ± SEM is indicated. Statistical significance was determined using one-way ANOVA (B) or unpaired Student’s t test (C). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Download figure Open in new tab Figure 5. The capacity of the hyperactive CYR1 E1541K point mutation to de-repress filamentation and hyphae-associated gene expression in low-virulent C. albicans is strain-independent. C. albicans strains CEC3672, CEC3672_ CYR1 E1541K , CEC3678 and CEC3678_ CYR1 E1541K were assessed for their phenotype in vitro . A. Colony morphology of the strains grown on Spider agar for 5 days at 37 °C . B. Filamentation of the strains put in contact with a monolayer of TR146 keratinocytes for 3.5 hours at 37°C, 5% CO 2 . C. ECE1 , HWP1 , ALS3 and NRG1 expression levels by the fungal strains after exposure to TR146 keratinocytes for 24 hours at 37°C, 5% CO 2 . Each symbol represents one sample. Data are from one representative out of two independent experiments with three samples per strain each. The mean ± SD is indicated. D. LDH release from TR146 keratinocytes after exposure to the fungal strains for 24 hours at 37°C, 5% CO 2 . Each symbol represents one well. Data are from one representative out of two independent experiments. The mean ± SD is indicated. Statistical significance was determined using unpaired Student’s t test comparing each mutant with the corresponding parental strain. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See also Figure S6 Together, the results from these in vitro and in vivo experiments indicate that the hyperactive variant of Cyr1 had indeed the potential to derepress some virulence traits under strong hyphae-inducing conditions such as those used for our in vitro assays, but it was insufficient to fully overcome the low-virulent nature of strain 101 under within-host conditions, independently of the functionality of BRG1 . The capacity of the hyperactive CYR1 E1541K point mutation to de-repress filamentation and hyphae-associated gene expression in low-virulent C. albicans is strain-independent To obtain further insights into the impact of the strain background on the potential of the CYR1 E1541K mutation to modulate C. albicans virulence, we turned to other low-virulent isolates. Strains CEC3672 and CEC3678 ( 38 ) both carry two full-length BRG1 alleles, including the C-terminal extension, encoding Brg1 proteins almost identical to those encoded in the SC5314 genome ( Suppl. Figure S1 ). These isolates exhibit a low-virulent phenotype closely comparable to that of strain 101 regarding filamentation, damage induction in keratinocytes, eliciting damage-associated cytokine release and colonization dynamics and efficiency of mice oral mucosa ( 13 ). Introducing the CYR1 E1541K point mutation in these low-virulent isolates induced filamentation as we previously observed for strain 101, both on Spider agar and when placed in contact with keratinocytes ( Figure 5A , B , compare to Figure 4A , B, H, I ). Likewise, the expression of hyphae-associated genes was enhanced, although not as consistently as observed in case of strain 101 ( Figure 5C , compare to Figure 4C , J and Suppl. Figure S5B , S6B ). Keratinocyte damage was also increased in response to CEC3672 and CEC3678 carrying the hypervirulent CYR1 variant in comparison to the corresponding parental strains, whereby the degree of the effect was strain dependent ( Figure 5D , compare to Figure 4D , K ). Together, these data indicate that the Glu-to-Lys mutation in Cyr1 rendered the adenylate cyclase hyperactive ( 37 ), which led to de-repression of filamentation and enhanced expression of hyphae-associated genes in multiple normally low-virulent isolates, although the point mutation was insufficient to induce full-blown virulence characterized by induction of high cellular damage and elicitation of an inflammatory response at the host interface, as inferred from our results with the 101_ CYR1 E1541K strain. The Ras1/cAMP-PKA pathway promotes virulence in intrinsically low-virulent strains Although the spontaneously acquired Cyr1 E1541K mutation did not explain the entire high-virulent phenotype of strain 101_ BRG1 FL / BRG1 FL (*), it has a remarkable capacity to alter the phenotype of several low-virulent isolates. We wondered whether the modulation of the cAMP pathway was a unique event, or may occur more frequently. Prolonged growth on Spider agar spawned several filamentation events in both strain 101 as well as the 101_ BRG1 FL / BRG1 FL mutant ( Figure 6A ). Clones generated from these spontaneously outgrown colonies confirmed the hyperfilamentous phenotype ( Figure 6B ). We then performed whole genome sequencing of 5 of the isolated clones to identify mutations in comparison to their parental strains. Interestingly, all identified mutations were in RAS1 ( Figure 6C , Suppl. Table S2 ), a gene encoding a GTPase that mediates Cyr1 activation in response to serum and N-acetylglucosamine stimulation through interaction with the N-terminal Ras Association domain of Cyr1 ( 39 ). Several of the identified mutations have been previously reported to render C. abicans and/or human Ras hyperactive ( 40 – 42 ). Together the data demonstrates that genes of the cAMP-PKA pathway are hotspots for spontaneously acquired mutations that confer pronounced virulence traits to C. albicans . Download figure Open in new tab Figure 6. The Ras1-cAMP pathway promotes virulence in intrinsically low-virulent strains. A. C. albicans strain 101 wild type and 101_ BRG1 FL / BRG1 FL were plated on Spider agar for 7 days at 35 °C B. Colony morphology of clones that were isolated from spontaneously outgrown filaments (A) when grown on YEPD or Spider agar, as indicated. C. Mutations in RAS1 identified in the clones shown in (B). DISCUSSION Candida albicans is a prominent human pathobiont associated with diseases that vary in severity from mild superficial forms to fatal systemic infections. Despite the pathogenic potential of C. albicans , in a first place it is a harmless colonizer of mucosal tissues that does not damage the host, but instead rather enhance the hosts resistance to infection ( 5 ). The precise mechanisms enabling the C. albicans to thrive as a resident of the mycobiota remain to be fully clarified. Studying low virulence isolates and their interaction with the host has advanced the understanding of how C. albicans establishes colonization and avoids tissue damage and inflammation to preserve homeostasis ( 13 , 14 , 25 ). Here, we explored how the transcription factor Brg1 and the Cyr1 adenylate cyclase modulate virulence properties of the low-virulent C. albicans strain 101. While introduction of allele variants of the BRG1 and CYR1 genes into strain 101, either indivually or in combination, increased the strain’s virulence properties in vitro , it was not sufficient to render strain 101 virulent in the oral mucosal tissue of experimentally colonized mice. These findings underscore the tight restriction of the virulence gene network in C. albicans that guarantees homeostatic colonization in the immunocompetent host. Our data also demonstrate that filamentation and hyphae-associated gene expression under in vitro conditions is insufficient to predict fungal virulence in vivo , further highlighting the intricate regulation of fungal virulence traits at the host interface. The newly assembled high quality genomic sequence of strain 101 enabled us conducting a comparative genome analysis of strains SC5314 and 101, which drew our attention to a rare truncated BRG1 allele in strain 101. Brg1 regulates the NRG1 hyphal repressor gene via mRNA destabilization ( 11 ) and chromatin remodelling ( 43 ). Our previous findings that NRG1 expression levels are decisive for the low-virulent phenotype of strain 101 ( 14 ) led us to explore the functionally of truncated BRG1 allele. Indeed the truncated BRG1 allele was functionally defective. Replacing the truncated BRG1 allele of strain 101 with a copy of the functional allele, leading to strain 101 having two full-length, functional alleles, resulted in modest increase of virulence in vitro , however insufficient to increase virulence in the oral mucosa in vivo . These data is consistent with previous reports of allelic differences in individual genes capable to modulate C. albicans pathogenicity ( 44 , 45 ). The lack of full induction of virulence may at least in part be explained by the complex regulation of Brg1 ( 46 , 47 ). We did only replace the dysfunctional BRG1 allele with the functional allele, without directly modulating the expression levels of the gene. We did only replace the dyfunctional BRG1 ORF with the full length BRG1 ORF from strain 101, without directly modulating the expression levels. This ORF is almost identical to one of the two ORFs encoded by the first BRG1 allele in strain SC5314 but differs by several aminoacids from that encoded by the second allele. We cannot exclude that the two SC5314 Brg1 proteins have different functionalities that are required for high virulence. Aiming to explain the acquired virulence phenotype of 101_ BRG1 FL/FL (*), reminiscent of the high-virulent strain SC5314, we identified a gain-of-function mutation in Cyr1, Cyr1 E1541K , previously described to render Cyr1 hyperactive and thereby to promote constitutive filamentation of strain SC5314, even under non-hyphae-inducing conditions ( 37 ). However, in the background of strain 101, the Cyr1 E1541K point mutation was insufficient to fully derepress the virulent traits, irrespective of the BRG1 status of the strain, indicating that other, so far unidentified mutations may also contribute to the conversion of a low in a high virulent strain. As a matter of fact, 101_ BRG1 FL/FL (*) contains in addition to the Cyr1 E1541K point mutation eight additional non-synonymous changes in ORFs ( Suppl. Table S1 ), which may contribute to the low to high virulence of this isolate. The CYR1 E1541K dependent increase in virulence was also observed in other low-virulent strains of C. albicans , albeit to variable degrees. As such, the consequences of the CYR1 E1541K mutation appear to be strain-dependent. Strain-specific regulation of the activity of Cyr1 may include the availability of ATP (the substrate for the generation of cAMP), which is regulated by mitochondrial activity, or differential expression of proteins such as Pde2 ( 17 ). We also observed a difference in the impact of CYR1 E1541K on fungal virulence in vitro and in vivo , indicating that the environmental cues inducing filamentation and the hyphae-associated virulence program differ in cell culture and inside mammalian tissues. As such, the degree to which the cAMP-PKA pathway is required for filamentation may also differ under in vivo and in vitro conditions ( 48 ). In the mucosal tissue, the treshold to de-repress the low-virulence program is particularly high and requires an intricate sequence of events that unfold over extended periods of time (Fróis-Martins et al., under revision). Cyr1 hyperactivation appears not to be strong enough to override the negative regulation of filamenation and hyphae-associated genes by Tup1 and Nrg1 ( 16 ). C. albicans is able to colonize different types of host tissue such as the gut that present distinct environmental context ( 1 , 49 ). For instance, bacterial peptidoglycan-like molecules, which are abundant in the intestine, were shown to induce filamentation by directly binding to Cyr1 ( 50 ). We only evaluated the oral mucosa, therefore we cannot exclude a different effect of the Cyr1 point mutation on the fungal phenotype in other tissue comparments. In addition to the initially identified spontaneous high-virulent mutant 101_ BRG1 FL/FL (*), we recovered additional spontaneous mutants outgrowing from strain 101, which all exhibited mutations in the N-terminal part of the RAS1 gene known to freeze the protein in a permanently active state ( 51 , 52 ) Ras1 acts upstream of Cyr1 to induce filamentation ( 17 ). In addition, Ras1 can also induce filamentation independently of Cyr1 by activating Cdc24, which in turn activates the Cph1 transcription factor involved in the filamentation program ( 53 ). The observation that all spontaneously developed variants exhibited mutations affecting the cAMP-PKA pathway raises important questions regarding the driving force inducing these mutations. An environmental cue specific to the conditions under which the fungus was cultured may specifically target the cAMP-PKA pathway, or the cAMP-PKA signaling cascade may serve as a preferential target due to its central role in facilitating environmental adaptation without significantly jeopardizing the fungus’ survival. Together, we demonstrate that strain 101 tightly regulates fungal virulence traits. Additional allele variants may contribute to the inherently low-virulent properties, and replacing an individual gene turned out to be insufficient to overcome the firmly anchored strain-intrinsic colonizer program, which supports the maintenance of homeostasis in the colonized mucosal tissue. In addition to the strain-intrinsic properties of a strain, the functional state of a strain also depends on the environmental conditions. When exposed to hyphae-inducing conditions, such as those characteristic of the macrophage phagosome or in the epithelium of the IL-17 deficient host, even low-virulent strains can gradually express increased virulence features ( 54 – 56 ) (Fróis-Martins et al., under revision). We observed the similar phenomenon when growing strain 101 on Spider agar thereby further demonstrating the strong adaptatability of C. albicans to its environment. MATERIALS AND METHODS Fungal strains Strains used in this study are listed in Table 1 . All strains were maintained on YPD agar for short term and in glycerol-supplemented medium at -80°C for long-term storage. Cultures were inoculated at OD 600 = 0.1 in YPD medium (using a pre-culture to adjust the OD 600 ) and grown at 30°C and 180 rpm for 15-18 hours. At the end of the culture period, yeast cells were washed in PBS and their concentration was determined by spectrophotometry, whereby 1 OD 600 = 10 7 yeast cells. View this table: View inline View popup Table 1. C. albicans strains used in this study. View this table: View inline View popup Table 2: primer list Identification of the truncated BRG1 allele PCR of BRG1 alleles on strain 101 was accomplished with primers BRG1-5 and BRG1-3 and analysed by gel electrophoresis on 1% agarose. The BRG1 truncated allele ( BRG1 TRUNC ) shows a reduced size (1.3 kb) as compared to the full-length BRG1 allele (1.5 kb; BRG1 FL ). Mutant generation BRG1 TRUNC and BRG1 FL revertants in the SC5314 background: BRG1 revertants were constructed with a brg1 Δ/Δ mutant available from the Hohmann mutant collection (DSY5875) ( 59 ). A PCR fusion strategy was used to amplify BRG1 alleles fused to the NAT1 selection marker. The BRG1 alleles with 500 bp promoter from 101 were first amplified with primers BRG1-P1 and BRG1-NAT1-5R (overlapping primer with NAT1 ). Next, the NAT1 marker was amplified from pJK795 with BRG1-NAT1-5F and BRG1-NAT1-3R. Finally, the BRG1 dowstream sequence (500 bp) was amplified with primers BRG1-P2 and BRG1-NAT1-3F (overlapping primer with NAT1 ). After PCR fragment purification, equimolar amounts of the 3 fragments were used with nested primers BRG1-P3B and BRG1-P4 in a fusion PCR to results in a 4 kb fragment. This fragment was used to transform DSY5875 in order to replace the deleted BGR1 loci with 101 BRG1 alleles. This was achieved by a RNA-protein complexes (RNPs) approach as reported in Grahl et al. ( 60 ) that employs reconstituted purified Cas9 protein in complex with scaffold and gene-specific guide RNAs. A gRNA specific for the BRG1 promoter (TGGGTGTAGAGAAACGATGT) upstream of the fusion PCR construct was designed in silico using Geneious Prime and obtained from IDT (Integrated DNA Technologies, Inc.) as CRISPR guide RNA (crRNA), which contains 20-bp homologous to the target gene fused to the scaffold sequence. RNPs were created using the Alt-R CRISPR-Cas9 system from IDT. Briefly, The BRG1 crRNA and tracrRNA (a universal transactivating CRISPR RNA) were first dissolved in RNase-free distilled water (dH 2 O) at 100 µM and stored at -80°C. The complete guide RNA was generated by mixing equimolar concentrations (4 µM final) of the gene-specific crRNA and tracrRNA to obtain a final volume of 3.6 µl per transformation. The mix was incubated at 95°C for 5 min and cool down to room temperature. The Cas9 nuclease 3NLS (60 µM stock from IDT) was diluted to 4 µM in dH 2 O at a volume of 3 µl per transformation. RNPs were assembled by mixing guide RNAs (3.6 µl of gene-specific crRNA/tracrRNA) with 3 µl of diluted Cas9 protein, followed by incubation at room temperature for 5 min. Transformation of C. albicans was carried out by electroporation and used 6.6 µl of gene-specific RNPs, 40 µl of C. albicans cells and 1-2 µg of the BRG1 fusion PCR (up to 3.4 µl volume). Transformants were selected onto YEPD plates with nourseothricin (200 µg/mL) for 3 days at 35°C. After transformants selection, identification of the specific 101 BRG1 alleles introduced in DSY5875 were verified by targeted sequencing analysis. DSY5877 contained the BRG1 FL allele replacing the HIS3 selective marker in DSY5875, while DSY5880 contained the BRG1 TRUNC allele replacing the LEU2 selective marker in the same strain. A wild type BRG1 allele was also replaced by BRG1 TRUNC allele in SC5413. For this, construction of the repair fragment followed the above-mentioned fusion PCR approach. Two guides specific for BRG1 in SC5314 including 5-BRG1-guide-SC (TGGGAAAGAAGAGATTTACA) and 3-BRG1-guide-SC (TTTAAAAAGCATCAATCAAT) were used in the RNP complexes construction. A minor adaptation was that the RNPs were concentrated by 2-fold and mixed each (3,3 µl) with the BRG1 repair fragment for electroporation. Transformants were analysed by targeted sequence analysis and yielded DSY5720. BRG1 TRUNC and BRG1 FL revertants in the 101 background: In order to replace specific BRG1 alleles in the 101 background, two different guides fusion were designed including 5-BRG1-guide-mut-allele (TATTTATAATGTAACAAGTA) and 3-BRG1-guide-mut-allele (CTGCACTGAGATATAAAAAG) that were used in the RNP complexes construction. The RNPs were concentrated by 2-fold and mixed each (3,3 µl) with the BRG1 repair fragment for electroporation. Transformants were analysed by targeted sequence analysis and yielded DSY5710 and DSY5713 containing each BRG1 FL / BRG1 TRUNC alleles and BRG1 FL / BRG1 FL alleles, respectively. Generation of Cyr1 E1541K mutants: The introduction of the E1541K mutation in Cyr1 was realized with a transient guide RNA expression following published protocols ( 61 ) . First, the guide expression was constructed with 2 overlapping PCRs obtained with primers pairs SNR52/F-Cyr1_guide Rev and sgRNA/R-Cyr1_guide For using pV1093 ( 62 ) as template. Fusion PCR between the two fragments was performed with primers SNR52/N and sgRNA/N. Next, the repair fragment (containing the Cyr1 E1541K mutation without PAM sites) was obtained by mixing primers Cyr1-A and Cyr1-B followed by self priming and 20 PCR cycles. The two PCR were then mixed with pV1025 previously digested by Sac I and Kpn I to transform strains 101, CEC3672 and CEC3678 ( 14 ) by electroporation. Transformants were selected onto YEPD plates with nourseothricin (200 µg/mL) for 3 days at 35°C. Targeted sequencing of transformants yielded heterozygous (DSY5731, DSY5791, DSY5774) and homozygous (DSY5730, DSY5732) Cyr1 E1541K mutants. In order to introduce the E1541K mutation in the background of isolate DSY5713, pV1025 was first modified by replacing SAT1 by HYGR (hygromycin resistance). This was achieved by PCR amplification of HYGR from PYM70 ( 63 ) with primers HYGR-NotI et HYGR-NheI and insertion in pV1025 at the Not I and Nhe I restriction site thus yielding pDS2168. This plasmid was digested by Kpn I and Eco RV in the above-described transformation procedure. After transformants selection, targeted sequencing yielded heterozygous Cyr1 E1541K mutants DSY5862 and DSY5863. Genome assembly and annotation of strain 101 High quality genomic DNA was prepared according to published procedures ( 64 ) . High molecular weight DNA was sheared with Megaruptor (Diagenode, Denville, NJ, USA) to obtain 10-15 kb fragments. After shearing the DNA size distribution was checked on a Fragment Analyzer (Advanced Analytical Technologies, Ames, IA, USA). The sheared DNA (1.8 µg) was used to prepare a SMRTbell library with the PacBio SMRTbell Express Template Prep Kit 2.0 (Pacific Biosciences, Menlo Park, CA, USA) according to the manufacturer’s recommendations. The resulting library was size-selected on a Blue Pippin system (Sage Science, Inc. Beverly, MA, USA) for molecules larger than 6 kb. It was sequenced with v2.2/v2.0 chemistry and adaptive loading on a PacBio Sequel II instrument (Pacific Biosciences, Menlo Park, CA, USA) with 30h movie length, pre-extension time of 2h using one SMRT cell 8M. Genome assembly was conducted with hifiasm (v0.16.1-r375) ( 65 ), and the resulting contigs were benchmarked against the C. albicans SC5314 reference (A22-s07-m01-r145) using MUMmer (v3.0) ( 66 ), QUAST ( 67 ) and BUSCO (v5.4.2) ( 68 ) to assess completeness, contiguity and gene content. Ab initio gene prediction was performed with AUGUSTUS (v3.4.0) ( 69 ), and annotations were refined by mapping to closest orthologs from the OMA Knowledgebase using OMA Fast Mapping ( 70 ). Protein-coding gene models underwent manual curation in Geneious Prime ( www.geneious.com ) to resolve ambiguities and validate exon–intron boundaries. Non-coding RNA loci were identified with Infernal (v1.1.4) ( 71 ) against the Rfam database (v14.8) ( 68 ). Genome feature files (GFF) and sequence files (FASTA) were manipulated and formatted using EMBOSS (v6.6.0) ( 72 ) and integrated into the final annotation with MAKER (v2.31.9) ( 73 ). The complete diploid assembly and raw sequencing reads are available under NCBI BioProject PRJNA923600. Genome-wide mutant analysis Spontaneous filamenting mutants were subjected to genome sequence analysis by comparison with the newly genome-annotated genome of strain 101. Genomic DNA from isolates DSY5722, DSY5846 and DSY5848 (DSY5713 as parent) and isolates DSY5840, DSY5842 and DSY5844 (101 as parent) was first obtained by a spheroplasting method ( 74 ). Genomic libraries were prepared from 100 ng of DNA with the Illumina DNA Prep Kit (Illumina) and Unique Dual Indexed oligonucleotides (IDT). PCR amplification was performed for 5 cycles. Libraries were quantified by a fluorimetric method and their quality assessed on a Fragment Analyzer (Agilent Technologies). Sequencing was performed as a 2x150 cycles paired run either on a MiSeq v2 flow cell (DSY5713 and DSY5722) or a NovaSeq 6000 v1.5 flow cell (Illumina) (DSY5846, DSY5848, DSY5840, DSY5842 and DSY5844). Sequencing data were demultiplexed using the bcl2fastq2 Conversion Software (v. 2.20, Illumina). Data can be obtained under Bioproject PRJNA1147312. Single nucleotide polymorphism (SNP) analysis was conducted to compare the isolates DSY5713 and spontaneous filamenting mutant DSY5722 using the SC5314 reference genome (A22-s07-m01-r145) as a reference. Raw sequencing reads from both isolates were aligned to the SC5314 genome using Bowtie2 (v2.3.4.1) ( 75 ) . Variant calling was performed with FreeBayes (v1.2.0) ( 76 ), a haplotype-based variant detector, to identify SNPs and small insertions or deletions. The resulting variant call format (VCF) files from both isolates were normalized and filtered using SAMtools (v1.10) ( 77 ) and VCFtools (v0.1.15) ( 78 ) to enable accurate comparative analysis. Finally, the functional impact of the identified variants was assessed using SnpEff (v4.3) ( 79 ), which annotated the variants based on gene models and predicted their potential effects on protein function. SNPs specific to DSY5722 were filtered from those present in the parent DSY5713 ( Suppl. Table S1 ). SNP analysis from isolates DSY5846, DSY5848, DSY5840, DSY5842 and DSY5844 was performed with CLC Genomics Workbench (v24) and the variant detection tools using the annotated genome from isolate 101. After read mapping to the 101 genome, variants differing from those present in DSY5713 and DSY5722 were filtered using the variant filtering tool in CLC Genomics Workbench ( Suppl. Table S2 ). Growth curve assays C. albicans was inoculated at OD 600 = 0.1 in 200 μl YPD or F12 cell culture medium (see below) in a 96well plate and grown in Synergy H1 plate reader (Bio Tek) for 24 hours at 30°C with double orbital shaking (3 mm amplitude) and OD600 measurements every 15 minutes that were preceded by a 10 s linear shaking pulse (1 mm amplitude). Colony morphology assays For assessing filamentation on spider agar (10 g D-Mannitol, Sigma, Cat.no. M4125, 10g nutrient broth no.1, Sigma, Cat.no. 70122, 2g K 2 HPO 4, Sigma, Cat.no. 795496 and 13.5g agar, Sigma, Cat.no. A1296 per 1L H 2 O), 3 µl of a yeast cell suspension at 10 5 cells/ml were spotted and plates were incubated for specific timing and tempratures as indicated in Figure legends. In some experiments, plates were incubated in presence of 5% CO 2 . Filamentation was assessed on YEPD agar (yeast Extract Peptone Dextrose (YEPD) (1% Bacto peptone, Difco Laboratories, Basel, Switzerland), 0.5% yeast extract (Difco) and 2% glucose (Fluka, Buchs, Switzerland) 2% agar (Difco) and YCB/BSA agar (1.17% Yeast Carbon Base (Becton Dickinson), 2% BSA (Sigma). Overnight cultures in YEPB were diluted in water to obtain single colonies. Plates were incubated at 35°C for 5- to 7 days. YCB/GlcNAC contained 1.17% Yeast Carbon Base and 2% N-Acetyl-D-glucosamine (Sigma) and 2% agar when indicated. Keratinocyte cell culture The human oral keratinocyte cell line TR146 ( 80 ) was grown in DMEM medium (Sigma, Cat.no. D5796) supplemented with 10% FCS, 1% Penicillin and 1% Streptomycin at 37°C and 5% CO2. For RNA isolation and filamentation assay, cells were seeded at 1 x 10 5 cells/well in 24-well tissue culture plates and for cell damage assay at 4 x 10 4 cells/well in 96-well tissue culture plates, respectively, and grown to confluent monolayers for 2 days prior to infection as described below for the individual assays. 1 day prior to the experiment, the DMEM medium was replaced by F12 medium (Hams’s Nutrient Mixture F12 medium (Gibco, Cat.no. 21765029) supplemented with 1% FCS). Filamentation assay Monolayers of TR146 cells in 24-well tissue culture plates prepared as described above were infected with 5 x 10 4 yeast cells per well in a 24-well plate and incubated for 3.5 hours at 37°C and 5% CO 2 . Cells were fixed in 2 % PFA a for 20 minutes at 4°C. The PFA was then exchanged by PBS for imaging with an EVOS FL Auto microscope (Life Technologies). Filament length was determined with Image J. 20-30 filaments were analyzed per imaged fields, whereby 10 fields were imaged per well and 2 wells were analyzed per strain. Cell damage assay Damage induction in TR146 cells by C. albicans was performed as described ( 81 ). Briefly, cell monolayers in 96-well tissue culture plates prepared as described above were infected with 2 x 10 4 yeast cells per well and incubated for 24 hours at 37°C and 5% CO2. Control wells were incubated with medium only or with 1% Triton-X-100 to determine 100% damage. LDH release into the supernatant was quantified with the LDH cytotoxicity kit (Roche) according to the manufacturer’s instructions. RNA isolation from infected keratinocyte cultures Monolayers of TR146 cells in 24-well tissue culture plates prepared as described above were infected with 1 x10 5 yeast cells per well. After 24 h of incubation at 37°C and 5% CO2, the medium was removed, cell were frozen on liquid nitrogen and stored at -80°C until further processing. RNA was isolated with the RNeasy Mini Kit (Quiagen). Briefly, the cells were lyzed in RLT lysis buffer and homogenized with 0.5 mm glass beads (Sigma, Cat.no. G1277) using a Tissue Lyzer (Qiagen) 7 times for 2 minutes at 30 Hz interrupted by 30sec cooling periods on ice. Cell debris were removed by centrifugation. One volume of 75% ethanol was admixed, and each sample was transferred to a RNeasy spin column. The loaded columns were washed using RW1 buffer and RPE buffer. RNA was eluted in 30 μl RNAse-free water. Animals WT C57BL/6j mice were purchased by Janvier Elevage and kept in specific pathogen-free conditions at the Institute of Laboratory Animals Science (LASC, University of Zurich, Zurich, Switzerland). Female mice were used at 8-14 weeks inage-matched groups. Infected and uninfected animals were kept separately to avoid cross-contamination. Ethics statement All mouse experiments in this study were conducted in strict accordance with the guidelines of the Swiss Animals Protection Law and were performed under the protocols approved by the Veterinary office of the Canton Zurich, Switzerland (license number 167/2018 and 141/2021). Oral colonization of mice with C. albicans Mice were infected sublingually with 2.5 x 10 6 C. albicans yeast cells as described ( 82 ), without immunosuppression. In brief, mice were anesthetized by injection of 100 mg/kg Ketamin and 20 mg/kg Xylazin in sterile saline i.p. administered in three doses. C. albicans was administered by depositing a 2.5 mg cotton ball that was soaked in 100 µl suspension at 5 x 10 7 yeast cells/ml under the tongue for 80-90 minutes. Mice were kept on a heating mat at 35 - 37°C during the entire period of anesthesia, administered with 10 ml/kg sterile saline to stabilize the circulation, and vitamin A ointment was applied to avoid drying out of the eyes. Determination of fungal burden For determination of the fungal burden, the tongue of euthanized animals was removed, homogenized in sterile 0.05 % NP40 in H 2 O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 µg/ml Ampicillin. Histology Tongue tissue was fixed in 4% PBS-buffered paraformaldehyde overnight and embedded in paraffin. Sagittal sections (9µm) were stained with Periodic-acidic Schiff (PAS) reagent and counterstained with Haematoxilin and mounted with Pertex (Biosystem) according to standard protocols. Images were acquired with a digital slide scanner (NanoZoomer 2.0-HT, Hamamatsu) and analyzed with NDP.view2. RNA isolation from colonized tongue tissue Isolation of total RNA (including fungal RNA) from murine tongue was performed using TRI reagent (Sigma-Aldrich) according to the manufacturer’s protocol. Prior to the addition of chloroform, the tongue tissue was homogenized in presence of a steel ball for 3 minutes at 25Hz followed by homogenization with 0.5 mm glass beads (Sigma) 2 times for 2 minutes at 30 Hz with a 30 second cooling period in between. Both homogenizations were performed using a Tissue Lyzer (Qiagen). RT-qPCR cDNA was generated by RevertAid reverse transcriptase (ThermoFisher Scientific, Cat.no. EP0452). Quantitative PCR was performed using SYBR green (Roche, Cat.no. 4913914001) and a QuantStudio 7 Flex instrument (Life Technologies). The primers used in this study are listed in Table 3 . All qPCR reactions were performed in duplicates, and the relative expression (rel. expr.) of each gene was determined after normalization to EFB1 or ACT1 housekeeping gene transcript levels. View this table: View inline View popup Download powerpoint Table 3. Primers used in this study for detecting C. albicans transcripts 1 . AUTHOR CONTRIBUTIONS R.F.M., D.S. and S.L.-L. designed the study and wrote the manuscript. R.F.M. and S.M. performed the experiments and analyzed the data. D.S. generated C. albicans mutants. V.D.T. did the bioinformatic analyses of strain 101. C.M. and C.d’E did additional bioinformatic analyses. S.L.-L., D.S. and C.d’E. oversaw the study design and data analysis, acquired funding. All authors discussed the results and commented on the manuscript. ACKNOWLEDGMENTS The authors would like to thank the staff of the Laboratory Animal Service Center of University of Zürich for animal husbandry; staff of the Laboratory for Animal Model Pathology of University of Zürich for histology; the Zentrum für klinische Studien of the Vetsuisse Faculty, University of Zurich for access to equipment; Kontxi Martinez de San Vicente for foundational experiments that led to the initiation of this project; members of the LeibundGut-lab for helpful advice and discussions. This work was supported by the Swiss National Science Foundation (grant # CRSII5_173863 to S.L.L., D.S. and CdE). Work in the laboratory of CdE is supported by the Agence Nationale de Recherche (ANR-10-LABX-62-IBEID). REFERENCES 1. ↵ d’Enfert C , Kaune AK , Alaban LR , Chakraborty S , Cole N , Delavy M , Kosmala D , Marsaux B , Frois-Martins R , Morelli M , Rosati D , Valentine M , Xie Z , Emritloll Y , Warn PA , Bequet F , Bougnoux ME , Bornes S , Gresnigt MS , Hube B , Jacobsen ID , Legrand M , Leibundgut-Landmann S , Manichanh C , Munro CA , Netea MG , Queiroz K , Roget K , Thomas V , Thoral C , Van den Abbeele P , Walker AW , Brown AJP . 2021 . The impact of the Fungus-Host-Microbiota interplay upon Candida albicans infections: current knowledge and new perspectives . FEMS Microbiol Rev 45 . 2. ↵ Lu SY . 2021 . Oral Candidosis: Pathophysiology and Best Practice for Diagnosis , Classification, and Successful Management. J Fungi (Basel ) 7 . 3. ↵ Denning DW , Kneale M , Sobel JD , Rautemaa-Richardson R . 2018 . Global burden of recurrent vulvovaginal candidiasis: a systematic review . Lancet Infect Dis 18 : e339 – e347 . OpenUrl CrossRef PubMed 4. ↵ Bacher P , Hohnstein T , Beerbaum E , Rocker M , Blango MG , Kaufmann S , Rohmel J , Eschenhagen P , Grehn C , Seidel K , Rickerts V , Lozza L , Stervbo U , Nienen M , Babel N , Milleck J , Assenmacher M , Cornely OA , Ziegler M , Wisplinghoff H , Heine G , Worm M , Siegmund B , Maul J , Creutz P , Tabeling C , Ruwwe-Glosenkamp C , Sander LE , Knosalla C , Brunke S , Hube B , Kniemeyer O , Brakhage AA , Schwarz C , Scheffold A . 2019 . Human Anti-fungal Th17 Immunity and Pathology Rely on Cross-Reactivity against Candida albicans . Cell 176 : 1340 – 1355 e15. OpenUrl CrossRef PubMed 5. ↵ Shao TY , Ang WXG , Jiang TT , Huang FS , Andersen H , Kinder JM , Pham G , Burg AR , Ruff B , Gonzalez T , Khurana Hershey GK , Haslam DB , Way SS . 2019 . Commensal Candida albicans Positively Calibrates Systemic Th17 Immunological Responses . Cell Host Microbe 25 : 404 – 417 e6. OpenUrl CrossRef PubMed 6. Carlson SL , Mathew L , Savage M , Kok K , Lindsay JO , Munro CA , McCarthy NE . 2023 . Mucosal Immunity to Gut Fungi in Health and Inflammatory Bowel Disease . J Fungi (Basel) 9 . 7. Li XV , Leonardi I , Putzel GG , Semon A , Fiers WD , Kusakabe T , Lin WY , Gao IH , Doron I , Gutierrez-Guerrero A , DeCelie MB , Carriche GM , Mesko M , Yang C , Naglik JR , Hube B , Scherl EJ , Iliev ID . 2022 . Immune regulation by fungal strain diversity in inflammatory bowel disease . Nature 603 : 672 – 678 . OpenUrl CrossRef PubMed 8. ↵ Zeng S , Rosati E , Saggau C , Messner B , Chu H , Duan Y , Hartmann P , Wang Y , Ma S , Huang WJM , Lee J , Lee SM , Carvalho-Gontijo R , Zhang V , Hoffmann JP , Kolls JK , Raz E , Brenner DA , Kisseleva T , LeibundGut-Landmann S , Bacher P , Starkel P , Schnabl B . 2023 . Candida albicans-specific Th17 cell-mediated response contributes to alcohol-associated liver disease . Cell Host Microbe 31 : 389 – 404 e7. OpenUrl PubMed 9. ↵ Wall G , Lopez-Ribot JL . 2020 . Current Antimycotics, New Prospects, and Future Approaches to Antifungal Therapy . Antibiotics (Basel ) 9 . 10. ↵ Liang SH , Sircaik S , Dainis J , Kakade P , Penumutchu S , McDonough LD , Chen YH , Frazer C , Schille TB , Allert S , Elshafee O , Hanel M , Mogavero S , Vaishnava S , Cadwell K , Belenky P , Perez JC , Hube B , Ene IV , Bennett RJ . 2024 . The hyphal-specific toxin candidalysin promotes fungal gut commensalism . Nature 627 : 620 – 627 . OpenUrl CrossRef PubMed 11. ↵ Cleary IA , Lazzell AL , Monteagudo C , Thomas DP , Saville SP . 2012 . BRG1 and NRG1 form a novel feedback circuit regulating Candida albicans hypha formation and virulence . Mol Microbiol 85 : 557 – 73 . OpenUrl CrossRef PubMed 12. ↵ Saville SP , Lazzell AL , Monteagudo C , Lopez-Ribot JL . 2003 . Engineered control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of Candida albicans during infection . Eukaryot Cell 2 : 1053 – 60 . OpenUrl Abstract / FREE Full Text 13. ↵ Ricardo Frois-Martins JL , Tim B. Schille , Osama Elshafee , Kontxi Martinez de San Vicente , Sarah Mertens , Michelle Stokmaier , Iman Kilb , Natacha Sertour , Sophie Bachellier-Bassi , Selene Mogavero , Dominique Sanglard , Christophe d’Enfert , Bernhard Hube , and Salomé LeibundGut-Landmann 2025 . Dynamic expression of the fungal toxin candidalysin governs homeostatic oral colonization . Nature Microbiology in press. 14. ↵ Lemberg C , Martinez de San Vicente K , Frois-Martins R , Altmeier S , Tran VDT , Mertens S , Amorim-Vaz S , Rai LS , d’Enfert C , Pagni M , Sanglard D , LeibundGut-Landmann S . 2022 . Candida albicans commensalism in the oral mucosa is favoured by limited virulence and metabolic adaptation . PLoS Pathog 18 : e1010012 . OpenUrl CrossRef PubMed 15. ↵ Noble SM , Gianetti BA , Witchley JN . 2017 . Candida albicans cell-type switching and functional plasticity in the mammalian host . Nat Rev Microbiol 15 : 96 – 108 . OpenUrl CrossRef PubMed 16. ↵ Chow EWL , Pang LM , Wang Y . 2021 . From Jekyll to Hyde: The Yeast-Hyphal Transition of Candida albicans . Pathogens 10 . 17. ↵ Grahl N , Demers EG , Lindsay AK , Harty CE , Willger SD , Piispanen AE , Hogan DA . 2015 . Mitochondrial Activity and Cyr1 Are Key Regulators of Ras1 Activation of C. albicans Virulence Pathways . PLoS Pathog 11 : e1005133 . OpenUrl CrossRef PubMed 18. ↵ Hogan DA , Muhlschlegel FA . 2011 . Candida albicans developmental regulation: adenylyl cyclase as a coincidence detector of parallel signals . Curr Opin Microbiol 14 : 682 – 6 . OpenUrl CrossRef PubMed 19. ↵ Mogavero S , Sauer FM , Brunke S , Allert S , Schulz D , Wisgott S , Jablonowski N , Elshafee O , Kruger T , Kniemeyer O , Brakhage AA , Naglik JR , Dolk E , Hube B . 2021 . Candidalysin delivery to the invasion pocket is critical for host epithelial damage induced by Candida albicans . Cell Microbiol 23 : e13378 . OpenUrl PubMed 20. Moyes DL , Wilson D , Richardson JP , Mogavero S , Tang SX , Wernecke J , Hofs S , Gratacap RL , Robbins J , Runglall M , Murciano C , Blagojevic M , Thavaraj S , Forster TM , Hebecker B , Kasper L , Vizcay G , Iancu SI , Kichik N , Hader A , Kurzai O , Luo T , Kruger T , Kniemeyer O , Cota E , Bader O , Wheeler RT , Gutsmann T , Hube B , Naglik JR . 2016 . Candidalysin is a fungal peptide toxin critical for mucosal infection . Nature 532 : 64 – 8 . OpenUrl CrossRef PubMed 21. ↵ Staab JF , Bradway SD , Fidel PL , Sundstrom P . 1999 . Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1 . Science 283 : 1535 – 8 . OpenUrl Abstract / FREE Full Text 22. ↵ Murad AM , Leng P , Straffon M , Wishart J , Macaskill S , MacCallum D , Schnell N , Talibi D , Marechal D , Tekaia F , d’Enfert C , Gaillardin C , Odds FC , Brown AJ . 2001 . NRG1 represses yeast-hypha morphogenesis and hypha-specific gene expression in Candida albicans . EMBO J 20 : 4742 – 52 . OpenUrl Abstract / FREE Full Text 23. ↵ Braun BR , Kadosh D , Johnson AD . 2001 . NRG1, a repressor of filamentous growth in C.albicans, is down-regulated during filament induction . EMBO J 20 : 4753 – 61 . OpenUrl Abstract / FREE Full Text 24. ↵ Ropars J , Maufrais C , Diogo D , Marcet-Houben M , Perin A , Sertour N , Mosca K , Permal E , Laval G , Bouchier C , Ma L , Schwartz K , Voelz K , May RC , Poulain J , Battail C , Wincker P , Borman AM , Chowdhary A , Fan S , Kim SH , Le Pape P , Romeo O , Shin JH , Gabaldon T , Sherlock G , Bougnoux ME , d’Enfert C . 2018 . Gene flow contributes to diversification of the major fungal pathogen Candida albicans . Nat Commun 9 : 2253 . OpenUrl CrossRef PubMed 25. ↵ Schonherr FA , Sparber F , Kirchner FR , Guiducci E , Trautwein-Weidner K , Gladiator A , Sertour N , Hetzel U , Le GTT , Pavelka N , d’Enfert C , Bougnoux ME , Corti CF , LeibundGut-Landmann S . 2017 . The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity . Mucosal Immunol 10 : 1335 – 1350 . OpenUrl CrossRef PubMed 26. ↵ Anderson FM , Visser ND , Amses KR , Hodgins-Davis A , Weber AM , Metzner KM , McFadden MJ , Mills RE , O’Meara MJ , James TY , O’Meara TR . 2023 . Candida albicans selection for human commensalism results in substantial within-host diversity without decreasing fitness for invasive disease . PLoS Biol 21 : e3001822 . OpenUrl CrossRef PubMed 27. ↵ Conti HR , Shen F , Nayyar N , Stocum E , Sun JN , Lindemann MJ , Ho AW , Hai JH , Yu JJ , Jung JW , Filler SG , Masso-Welch P , Edgerton M , Gaffen SL . 2009 . Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis . J Exp Med 206 : 299 – 311 . OpenUrl Abstract / FREE Full Text 28. ↵ McDonough LD , Mishra AA , Tosini N , Kakade P , Penumutchu S , Liang SH , Maufrais C , Zhai B , Taur Y , Belenky P , Bennett RJ , Hohl TM , Koh AY , Ene IV . 2021 . Candida albicans Isolates 529L and CHN1 Exhibit Stable Colonization of the Murine Gastrointestinal Tract . mBio 12 : e0287821 . OpenUrl CrossRef PubMed 29. ↵ 29. Millet N , Sekar J , Solis NV , Millet A , Aggor FEY , Wildeman A , Lionakis MS , Gaffen SL , Jendzjowsky N , Filler SG , Swidergall M. 2024 . Non-canonical IL-22 receptor signaling remodels the mucosal barrier during fungal immunosurveillance . bioRxiv doi: 10.1101/2024.09.08.611873 . OpenUrl Abstract / FREE Full Text 30. ↵ Braunsdorf C , LeibundGut-Landmann S . 2018 . Modulation of the Fungal-Host Interaction by the Intra-Species Diversity of C. albicans . Pathogens 7 . 31. ↵ Kirchner FR , LeibundGut-Landmann S . 2021 . Tissue-resident memory Th17 cells maintain stable fungal commensalism in the oral mucosa . Mucosal Immunol 14 : 455 – 467 . OpenUrl PubMed 32. ↵ Kirchner FR , Littringer K , Altmeier S , Tran VDT , Schonherr F , Lemberg C , Pagni M , Sanglard D , Joller N , LeibundGut-Landmann S . 2019 . Persistence of Candida albicans in the Oral Mucosa Induces a Curbed Inflammatory Host Response That Is Independent of Immunosuppression . Front Immunol 10 : 330 . OpenUrl PubMed 33. ↵ Rodriguez DL , Quail MM , Hernday AD , Nobile CJ . 2020 . Transcriptional Circuits Regulating Developmental Processes in Candida albicans . Front Cell Infect Microbiol 10 : 605711 . OpenUrl PubMed 34. ↵ Martin R , Albrecht-Eckardt D , Brunke S , Hube B , Hunniger K , Kurzai O . 2013 . A core filamentation response network in Candida albicans is restricted to eight genes . PLoS One 8 : e58613 . OpenUrl CrossRef PubMed 35. ↵ Gladiator A , Wangler N , Trautwein-Weidner K , LeibundGut-Landmann S . 2013 . Cutting edge: IL-17-secreting innate lymphoid cells are essential for host defense against fungal infection . J Immunol 190 : 521 – 5 . OpenUrl Abstract / FREE Full Text 36. ↵ Trautwein-Weidner K , Gladiator A , Nur S , Diethelm P , LeibundGut-Landmann S . 2015 . IL-17-mediated antifungal defense in the oral mucosa is independent of neutrophils . Mucosal Immunol 8 : 221 – 31 . OpenUrl CrossRef PubMed 37. ↵ Bai C , Xu XL , Wang HS , Wang YM , Chan FY , Wang Y . 2011 . Characterization of a hyperactive Cyr1 mutant reveals new regulatory mechanisms for cellular cAMP levels in Candida albicans . Mol Microbiol 82 : 879 – 93 . OpenUrl CrossRef PubMed 38. ↵ Bougnoux ME , Kac G , Aegerter P , d’Enfert C , Fagon JY , CandiRea Study G . 2008 . Candidemia and candiduria in critically ill patients admitted to intensive care units in France: incidence, molecular diversity, management and outcome . Intensive Care Med 34 : 292 – 9 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Fang HM , Wang Y . 2006 . RA domain-mediated interaction of Cdc35 with Ras1 is essential for increasing cellular cAMP level for Candida albicans hyphal development . Mol Microbiol 61 : 484 – 96 . OpenUrl CrossRef PubMed 40. ↵ Won DD , Lee JI , Lee IK , Oh ST , Jung ES , Lee SH . 2017 . The prognostic significance of KRAS and BRAF mutation status in Korean colorectal cancer patients . BMC Cancer 17 : 403 . OpenUrl PubMed 41. Palmirotta R , Ludovici G , De Marchis ML , Leone B , Formica V , Ettorre GM , Cavaliere F , Della-Morte D , Ferroni P , Roselli M , Guadagni F . 2012 . A comprehensive procedural approach to genotyping KRAS and BRAF from paraffin embedded tissues for diagnostic purposes . In Vivo 26 : 537 – 47 . OpenUrl Abstract / FREE Full Text 42. ↵ Feng Q , Summers E , Guo B , Fink G . 1999 . Ras signaling is required for serum-induced hyphal differentiation in Candida albicans . J Bacteriol 181 : 6339 – 46 . OpenUrl Abstract / FREE Full Text 43. ↵ Lu Y , Su C , Liu H . 2012 . A GATA transcription factor recruits Hda1 in response to reduced Tor1 signaling to establish a hyphal chromatin state in Candida albicans . PLoS Pathog 8 : e1002663 . OpenUrl CrossRef PubMed 44. ↵ Glazier VE , Kramara J , Ollinger T , Solis NV , Zarnowski R , Wakade RS , Kim MJ , Weigel GJ , Liang SH , Bennett RJ , Wellington M , Andes DR , Stamnes MA , Filler SG , Krysan DJ . 2023 . The Candida albicans reference strain SC5314 contains a rare, dominant allele of the transcription factor Rob1 that modulates filamentation, biofilm formation, and oral commensalism . mBio 14 : e0152123 . OpenUrl CrossRef PubMed 45. ↵ Gnaien M , Maufrais C , Rebai Y , Kallel A , Ma L , Hamouda S , Khalsi F , Meftah K , Smaoui H , Khemiri M , Hadj Fredj S , Bachellier-Bassi S , Najjar I , Messaoud T , Boussetta K , Kallel K , Mardassi H , d’Enfert C , Bougnoux ME , Znaidi S . 2024 . A gain-of-function mutation in zinc cluster transcription factor Rob1 drives Candida albicans adaptive growth in the cystic fibrosis lung environment . PLoS Pathog 20 : e1012154 . OpenUrl PubMed 46. ↵ Wakade RS , Ristow LC , Wellington M , Krysan DJ . 2023 . Intravital imaging-based genetic screen reveals the transcriptional network governing Candida albicans filamentation during mammalian infection . Elife 12 . 47. ↵ Su C , Lu Y , Liu H . 2013 . Reduced TOR signaling sustains hyphal development in Candida albicans by lowering Hog1 basal activity . Mol Biol Cell 24 : 385 – 97 . OpenUrl Abstract / FREE Full Text 48. ↵ Wakade RS , Kramara J , Wellington M , Krysan DJ . 2022 . Candida albicans Filamentation Does Not Require the cAMP-PKA Pathway In Vivo . mBio 13 : e0085122 . OpenUrl PubMed 49. ↵ Fróis-Martins R , Lagler J , LeibundGut-Landmann S . 2024 . Candida albicans Virulence Traits in Commensalism and Disease . Current Clinical Microbiology Reports doi: 10.1007/s40588-024-00235-8 . OpenUrl CrossRef 50. ↵ Xu XL , Lee RT , Fang HM , Wang YM , Li R , Zou H , Zhu Y , Wang Y . 2008 . Bacterial peptidoglycan triggers Candida albicans hyphal growth by directly activating the adenylyl cyclase Cyr1p . Cell Host Microbe 4 : 28 – 39 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Polke M , Sprenger M , Scherlach K , Alban-Proano MC , Martin R , Hertweck C , Hube B , Jacobsen ID . 2017 . A functional link between hyphal maintenance and quorum sensing in Candida albicans . Mol Microbiol 103 : 595 – 617 . OpenUrl CrossRef PubMed 52. ↵ Salafsky J , S. ; Mccguinness, Ryan , P . 2013 . Methods for Identifying Modulators of RAS Using Nonlinear TechniquesWO 2013/115867 A1 . 53. ↵ Roman E , Arana DM , Nombela C , Alonso-Monge R , Pla J . 2007 . MAP kinase pathways as regulators of fungal virulence . Trends Microbiol 15 : 181 – 90 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Wartenberg A , Linde J , Martin R , Schreiner M , Horn F , Jacobsen ID , Jenull S , Wolf T , Kuchler K , Guthke R , Kurzai O , Forche A , d’Enfert C , Brunke S , Hube B . 2014 . Microevolution of Candida albicans in macrophages restores filamentation in a nonfilamentous mutant . PLoS Genet 10 : e1004824 . OpenUrl CrossRef PubMed 55. Case NT , Westman J , Hallett MT , Plumb J , Farheen A , Maxson ME , MacAlpine J , Liston SD , Hube B , Robbins N , Whitesell L , Grinstein S , Cowen LE . 2023 . Respiration supports intraphagosomal filamentation and escape of Candida albicans from macrophages . mBio 14 : e0274523 . OpenUrl PubMed 56. ↵ Case NT , Duah K , Larsen B , Wong CJ , Gingras AC , O’Meara TR , Robbins N , Veri AO , Whitesell L , Cowen LE . 2021 . The macrophage-derived protein PTMA induces filamentation of the human fungal pathogen Candida albicans . Cell Rep 36 : 109584 . OpenUrl PubMed 57. Gillum AM , Tsay EY , Kirsch DR . 1984 . Isolation of the Candida albicans gene for orotidine-5’-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations . Mol Gen Genet 198 : 179 – 82 . OpenUrl CrossRef PubMed Web of Science 58. Schönherr FA , Sparber F , Kirchner FR , Guiducci E , Trautwein-Weidner K , Gladiator A , Sertour N , Hetzel U , Le GTT , Pavelka N , d’Enfert C , Bougnoux ME , Corti CF , LeibundGut-Landmann S . 2017 . The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity . Mucosal Immunol 10 : 1335 – 1350 . OpenUrl CrossRef PubMed 59. ↵ Homann OR , Dea J , Noble SM , Johnson AD . 2009 . A phenotypic profile of the Candida albicans regulatory network . PLoS Genet 5 : e1000783 . OpenUrl CrossRef PubMed 60. ↵ 60. Grahl N , Demers EG , Crocker AW , Hogan DA . 2017 . Use of RNA-Protein Complexes for Genome Editing in Non-albicans Candida Species . mSphere 2 . 61. ↵ 61. Min K , Ichikawa Y , Woolford CA , Mitchell AP . 2016 . Candida albicans Gene Deletion with a Transient CRISPR-Cas9 System . mSphere 1 . 62. ↵ Vyas VK , Barrasa MI , Fink GR . 2015 . A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families . Sci Adv 1 : e1500248 . OpenUrl FREE Full Text 63. ↵ Basso LR , Jr ., Bartiss A , Mao Y , Gast CE , Coelho PS , Snyder M , Wong B . 2010 . Transformation of Candida albicans with a synthetic hygromycin B resistance gene . Yeast 27 : 1039 – 48 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Vale-Silva L , Beaudoing E , Tran VDT , Sanglard D . 2017 . Comparative Genomics of Two Sequential Candida glabrata Clinical Isolates . G3 (Bethesda) 7 : 2413 – 2426 . OpenUrl 65. ↵ Cheng H , Concepcion GT , Feng X , Zhang H , Li H . 2021 . Haplotype-resolved de novo assembly using phased assembly graphs with hifiasm . Nat Methods 18 : 170 – 175 . OpenUrl CrossRef PubMed 66. ↵ Kurtz S , Phillippy A , Delcher AL , Smoot M , Shumway M , Antonescu C , Salzberg SL . 2004 . Versatile and open software for comparing large genomes . Genome Biol 5 : R12 . OpenUrl CrossRef PubMed 67. ↵ Gurevich A , Saveliev V , Vyahhi N , Tesler G . 2013 . QUAST: quality assessment tool for genome assemblies . Bioinformatics 29 : 1072 – 5 . OpenUrl CrossRef PubMed Web of Science 68. ↵ Kalvari I , Nawrocki EP , Ontiveros-Palacios N , Argasinska J , Lamkiewicz K , Marz M , Griffiths-Jones S , Toffano-Nioche C , Gautheret D , Weinberg Z , Rivas E , Eddy SR , Finn RD , Bateman A , Petrov AI . 2021 . Rfam 14: expanded coverage of metagenomic, viral and microRNA families . Nucleic Acids Res 49 : D192 – D200 . OpenUrl CrossRef PubMed 69. ↵ Stanke M , Keller O , Gunduz I , Hayes A , Waack S , Morgenstern B . 2006 . AUGUSTUS: ab initio prediction of alternative transcripts . Nucleic Acids Res 34 : W435 – 9 . OpenUrl CrossRef PubMed Web of Science 70. ↵ Altenhoff AM , Warwick Vesztrocy A , Bernard C , Train CM , Nicheperovich A , Prieto Banos S , Julca I , Moi D , Nevers Y , Majidian S , Dessimoz C , Glover NM . 2024 . OMA orthology in 2024: improved prokaryote coverage, ancestral and extant GO enrichment, a revamped synteny viewer and more in the OMA Ecosystem . Nucleic Acids Res 52 : D513 – D521 . OpenUrl CrossRef PubMed 71. ↵ Nawrocki EP , Eddy SR . 2013 . Infernal 1.1: 100-fold faster RNA homology searches . Bioinformatics 29 : 2933 – 5 . OpenUrl CrossRef PubMed Web of Science 72. ↵ Rice P , Longden I , Bleasby A . 2000 . EMBOSS: the European Molecular Biology Open Software Suite . Trends Genet 16 : 276 – 7 . OpenUrl CrossRef PubMed Web of Science 73. ↵ Holt C , Yandell M . 2011 . MAKER2: an annotation pipeline and genome-database management tool for second-generation genome projects . BMC Bioinformatics 12 : 491 . OpenUrl CrossRef PubMed 74. ↵ Calabrese D , Bille J , Sanglard D . 2000 . A novel multidrug efflux transporter gene of the major facilitator superfamily from Candida albicans (FLU1) conferring resistance to fluconazole . Microbiology (Reading ) 146 ( Pt 11 ): 2743 – 2754 . OpenUrl CrossRef PubMed Web of Science 75. ↵ Langmead B , Salzberg SL . 2012 . Fast gapped-read alignment with Bowtie 2 . Nat Methods 9 : 357 – 9 . OpenUrl CrossRef PubMed Web of Science 76. ↵ Zhang J , Wu Y . 2011 . Haplotype inference from short sequence reads using a population genealogical history model . Pac Symp Biocomput doi: 10.1142/9789814335058_0030:288-99 . OpenUrl CrossRef 77. ↵ Danecek P , Bonfield JK , Liddle J , Marshall J , Ohan V , Pollard MO , Whitwham A , Keane T , McCarthy SA , Davies RM , Li H . 2021 . Twelve years of SAMtools and BCFtools . Gigascience 10 . 78. ↵ Danecek P , Auton A , Abecasis G , Albers CA , Banks E , DePristo MA , Handsaker RE , Lunter G , Marth GT , Sherry ST , McVean G , Durbin R , Genomes Project Analysis G . 2011 . The variant call format and VCFtools . Bioinformatics 27 : 2156 – 8 . OpenUrl CrossRef PubMed Web of Science 79. ↵ Cingolani P , Platts A , Wang le L , Coon M , Nguyen T , Wang L , Land SJ , Lu X , Ruden DM . 2012 . A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3 . Fly (Austin) 6 : 80 – 92 . OpenUrl PubMed 80. ↵ Rupniak HT , Rowlatt C , Lane EB , Steele JG , Trejdosiewicz LK , Laskiewicz B , Povey S , Hill BT . 1985 . Characteristics of four new human cell lines derived from squamous cell carcinomas of the head and neck . J Natl Cancer Inst 75 : 621 – 35 . OpenUrl PubMed Web of Science 81. ↵ Jacobsen ID , Wilson D , Wachtler B , Brunke S , Naglik JR , Hube B . 2012 . Candida albicans dimorphism as a therapeutic target . Expert Rev Anti Infect Ther 10 : 85 – 93 . OpenUrl CrossRef PubMed 82. ↵ Solis NV , Filler SG . 2012 . Mouse model of oropharyngeal candidiasis . Nat Protoc 7 : 637 – 42 . OpenUrl CrossRef PubMed 83. ↵ Edgar RC . 2004 . MUSCLE: multiple sequence alignment with high accuracy and high throughput . Nucleic Acids Res 32 : 1792 – 7 . OpenUrl CrossRef PubMed Web of Science 84. ↵ 84. Waterhouse AM , Procter JB , Martin DM , Clamp M , Barton GJ . 2009 . Jalview Version 2--a multiple sequence alignment editor and analysis workbench . Bioinformatics 25 : 1189 – 91 . OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted July 17, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Genome-guided manipulation of regulators of morphogenesis in a C. albicans strain with low virulence is not sufficient to trigger a high-virulence phenotype Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Genome-guided manipulation of regulators of morphogenesis in a C. albicans strain with low virulence is not sufficient to trigger a high-virulence phenotype Ricardo Fróis-Martins , Sarah Mertens , Van Du T. Tran , Corinne Maufrais , Christophe d’Enfert , Dominique Sanglard , Salomé LeibundGut-Landmann bioRxiv 2025.07.16.665085; doi: https://doi.org/10.1101/2025.07.16.665085 Share This Article: Copy Citation Tools Genome-guided manipulation of regulators of morphogenesis in a C. albicans strain with low virulence is not sufficient to trigger a high-virulence phenotype Ricardo Fróis-Martins , Sarah Mertens , Van Du T. Tran , Corinne Maufrais , Christophe d’Enfert , Dominique Sanglard , Salomé LeibundGut-Landmann bioRxiv 2025.07.16.665085; doi: https://doi.org/10.1101/2025.07.16.665085 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Microbiology Subject Areas All Articles Animal Behavior and Cognition (7619) Biochemistry (17639) Bioengineering (13865) Bioinformatics (41854) Biophysics (21405) Cancer Biology (18544) Cell Biology (25432) Clinical Trials (138) Developmental Biology (13356) Ecology (19863) Epidemiology (2067) Evolutionary Biology (24287) Genetics (15587) Genomics (22465) Immunology (17701) Microbiology (40300) Molecular Biology (17142) Neuroscience (88440) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4814) Physiology (7633) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9809) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.