The sonic hedgehog signaling inhibitor cyclopamine improves pulmona ry arterial hypertension via regulating the bone morphogenetic protein receptor 2 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The sonic hedgehog signaling inhibitor cyclopamine improves pulmona ry arterial hypertension via regulating the bone morphogenetic protein receptor 2 pathway Youpeng Jin, Fei Mao, Xuehui Wang, Jie Zhang, Yanting Gao, Youfei Fan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4881852/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Pulmonary arterial hypertension (PAH) is a severe and progressive disease with hallmarks of pulmonary vascular remodeling and bone morphogenetic protein receptor 2 (BMPR2) mutation. Recent studies indicate Sonic hedgehog (SHH) signaling is involved in the proliferation of human pulmonary arterial smooth muscle cells (hPASMCs) but the role of the SHH signaling inhibitor cyclopamine in monocrotaline (MCT)-induced PAH has not been investigated. We hypothesized SHH promotes pulmonary vascular remodeling and that inhibition of SHH signaling by cyclopamine could attenuate pulmonary hypertension via the bone morphogenetic protein (BMP) pathway. SHH and BMPR2 proteins were measured in pulmonary arteries isolated from MCT-induced PAH rats and in hPASMCs. The therapeutic effects of cyclopamine were tested in PAH rats and in BMPR2 knockdown hPASMCs. SHH protein levels were increased in PAH rats and exogenous recombinant SHH protein promoted proliferation of hPASMCs via BMPR2 and osteopontin. Furthermore, cyclopamine attenuated hemodynamics and vascular remodeling via the BMP pathway in PAH rats. Finally, cyclopamine enhanced apoptosis and reduced proliferation in hPASMCs with impaired BMPR2. The findings of this study provide evidence that SHH has a role in pulmonary vascular remodeling via BMP4/BMPR2/ID1, and its inhibition by cyclopamine could be a potential therapeutic target in PAH. Biological sciences/Drug discovery Biological sciences/Molecular biology Health sciences/Diseases Health sciences/Medical research cyclopamine sonic hedgehog pulmonary arterial hypertension bone morphogenetic protein receptor 2 pulmonary arterial remolding Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Pulmonary arterial hypertension (PAH) is a multifactorial and progressive disease, which is characterized by a sustained increase in pulmonary arterial pressure and ultimately leads to right ventricular failure and death. Impaired production of vascular mediators such as nitric oxide, endothelin-1, and inflammatory cytokines, and variations in signaling molecules have been implicated in the pathophysiological progression of PAH 1 . There is strong evidence suggesting that bone morphogenetic protein (BMP) signaling has a protective role in the pulmonary vascular wall by inhibiting proliferation of pulmonary arterial smooth muscle cells (PASMCs) and triggering anti-inflammatory responses 2 . BMP ligands activate transmembrane bone morphogenetic protein type 2 receptor (BMPR2), which forms hetero-tetrameric complexes. The activated BMP receptor complexes trigger phosphorylation of R-SMAD (SMAD1, SMAD5 and SMAD8) and regulate target gene expression together with co-activators or repressors 3 . BMPR2 deficiency has been reported to cause resistance to apoptosis via the BMPR2-ALK1-BclX-mediated pathway both in PASMCs and pulmonary vascular endothelial cells, leading to vascular remodeling in PAH 4 . Therefore, an impaired BMPR2 pathway may increase susceptibility to abnormal vascular homeostasis, and modulation of BMPR2 signaling is considered a promising therapeutic approach for PAH 5 . Sonic hedgehog (SHH), a member of the hedgehog protein family, is a 45-kDa protein that is essential for normal development of multiple tissues and organs 6 . Activation of the SHH signaling cascade is initiated when SHH ligands bind to the membrane receptor Patched1, thus releasing smoothened (SMO) to be activated by phosphorylation. SMO ultimately decreases the interaction between suppressor of fused homolog and glioma-associated oncogenes. Proteins in the SHH cascade have a potential role in the pathogenesis of cardiovascular and pulmonary vascular diseases, which play critical roles in angiogenesis either in development or in ischemic adult tissues 7 – 9 . Furthermore, SHH signaling has been shown to enhance the proliferation of human pulmonary arterial smooth muscle cells (hPASMCs) during hypoxia, and the SHH pathway inhibitor cyclopamine has been shown to relieve hypoxia-induced dysfunction of smooth muscle cells (SMCs) 10 , 11 . Moreover, interference with SHH signaling by deletion of smo from platelet-derived growth factor receptor-β-derived mesenchyme results in spontaneous development of pulmonary hypertension with increased right ventricular systolic pressure (RVSP) 12 . Accordingly, targeted modulation of SHH signaling is believed to be effective in the treatment of human cancer 13 , myocardial ischemia 14 , and stroke 15 . Although SHH signaling and its inhibitor have been studied in the context of regulation of proliferation of hPASMCs in vitro , to our knowledge, little is known about their functions during development of PAH in vivo . Moreover, the underlying mechanisms via which inhibition of the SHH pathway is controlled in the treatment of PAH remain unclear. SHH and BMP4 signaling pathways are activated in a complementary pattern during development of the oral-aboral axis in the embryonic mandibular arch of the mouse and limb development in the chick embryo 16 . Furthermore, treatment with SHH was found to induce expansion of pluripotent human hematopoietic repopulating cells, and Noggin, a specific inhibitor of bone morphogenetic protein 4 (BMP4), to be capable of inhibiting SHH-induced proliferation and disrupting the BMP-SHH-Gli1 network 17 . SHH-BMP signaling participates in early development of the ureters, early patterning of the limb buds, and neural differentiation 3 , 18 , 19 . These findings suggest that SHH and BMP act cooperatively during development and cell differentiation in other tissues; however, the relationship between these molecules is not completely understood in PAH. Therefore, we hypothesized that SHH may have an important role in the pathobiology of PAH by promoting pulmonary vascular remodeling and that inhibition of SHH by cyclopamine could attenuate pulmonary vascular remodeling via the BMP4/BMPR2/ID1 pathway. RESULTS Expression of SHH and BMPR2 proteins in the pulmonary arteries of rats with MCT-induced PAH and in hPASMCs SHH expression in the pulmonary vasculature appeared to be higher in rats with experimental PAH than in the control group (Fig. 1 a, 1 b), as did RVSP and the RV hypertrophy index (Fig. 1 c, 1 d). Exogenous recombinant SHH protein decreased the number of TUNEL-positive cells and increased the number of BrdU-positive cells in hPASMCs, suggesting that it has a crucial role in remodeling of the pulmonary vessels (Fig. 1 e, 1 f). The BMPR2 protein level was significantly lower in rats treated with MCT than in those treated with saline (Fig. 1 g, P < 0.001). The osteopontin protein level in the pulmonary arteries was significantly higher in rats with MCT-induced PAH than in the control rats (Fig. 1 h, P < 0.05). The SHH signaling inhibitor cyclopamine attenuated pulmonary hemodynamics and vascular remodeling in rats with MCT-induced PAH We assessed the potential therapeutic role of inhibition of the SHH pathway in PAH by examining the effect of cyclopamine in rats with MCT-induced PAH. The pulmonary vessel wall, expression of alpha-smooth muscle actin (α-SMA) protein and proliferating cell nuclear antigen (PCNA) in the lung tissues of rats with MCT-induced PAH were examined by immunohistochemical staining (Fig. 2 a, 2 b). Cyclopamine (2.5, 5, and 10 mg/kg [Cy2.5, Cy5, and Cy10, respectively] or vehicle was administered every 24 hours via the intraperitoneal route to the rats (n = 6–8 animals per group) 20 , starting one day after subcutaneous injection of MCT (50 mg/kg via the intrahepatic route). Administration of cyclopamine prevented development of MCT-induced PAH. Treatment with cyclopamine 10 mg/kg significantly reduced PAH when assessed by RVSP, the RV hypertrophy index, and the degree of pulmonary artery muscularization without affecting heart rate (Fig. 2 c– 2 f). Furthermore, treatment with Cy5 or Cy10 decreased remodeling of the pulmonary arteries, as demonstrated by changes in the media wall area and media wall thickness in lung tissues (Fig. 2 g, 2 h). Treatment with Cy2.5 had no significant ability to prevent PAH. Cyclopamine improves the BMP pathway in the pulmonary arteries of rats with MCT-induced PAH The pulmonary arteries from rats with PAH treated with cyclopamine were analyzed by western blotting to determine whether cyclopamine exerted its effects via the BMP pathway. The rats with PAH showed increased expression of BMP4 and SHH protein and decreased expression of BMPR2 and p-SMAD1/5/8 protein (P < 0.05). Treatment with Cy5 or Cy10 prevented the MCT-induced changes in BMP4, BMPR2, and p-SMAD1/5/8 levels (P < 0.05), such that there was no difference in protein expression in the BMP pathway in the Cy2.5 group (Fig. 3 a-c). Furthermore, compared with the rats with MCT-induced PAH, treatment with Cy5 or Cy10 reduced the expression of SHH protein (P < 0.01). Similarly, Cy2.5 did not affect expression of SHH protein in rats with PAH (Fig. 3 d). Effect of cyclopamine on proliferation and expression of α-SMA and osteopontin protein in BMPR2 knockdown hPASMCs We investigated proliferation by Brdu staining and proliferation-related proteins in hPASMCs following knockdown of BMPR2 to determine the role of inhibition of SHH on apoptosis and apoptosis-related proteins in vitro. Western blotting and quantitative PCR analyses of BMPR2 showed that levels of these transcripts and protein expression in hPASMCs transfected with siRNAs were lower than those in controls (Fig. 4 a, 4 b). The number of BrdU-positive cells were increased in BMPR2 knockdown hPASMCs (P < 0.05) and hPASMCs exposed to exogenous SHH-N (P < 0.01, Fig. 4 c, 4 d), whereas the number of BrdU-positive hPASMCs was significantly diminished after treatment with cyclopamine (P < 0.05, Fig. 4 c, 4 d). BMPR2 knockdown also increased the expression of α-SMA and osteopontin proteins (P < 0.05, Fig. 4 e, 4 f); similarly, exogenous SHH-N improved the α-SMA and osteopontin protein levels (P < 0.01, Fig. 4 e, 4 f), suggesting a pro-proliferative effect of SHH-N at different stages. Treatment with cyclopamine 10µM for 48 h normalized the BMPR2 knockdown-induced upregulation of α-SMA and osteopontin in hPASMCs (P < 0.01, Fig. 4 e, 4 f). Effect of cyclopamine on apoptosis and caspase-3, Bax, and BCL-2 protein expression in BMPR2 knockdown hPASMCs The number of TUNEL-positive hPASMCs was reduced, suggesting a prosurvival role of BMPR2-mediated signaling in BMPR2 knockdown hPASMCs (P < 0.05, Fig. 5 A, 5 B). In contrast, the number of TUNEL-positive hPASMCs was significantly increased after treatment with cyclopamine (P < 0.05, Fig. 5 a, 5 b). Although exogenous SHH protein could also decrease the number of TUNEL-positive hPASMCs, there was no significant difference between the SHH group and the control group (P = 0.57, Fig. 5 a, 5 b). There was also a decrease in the procaspase-3 protein level (P < 0.01); accordingly, the caspase-3 activity increased in BMPR2 knockdown hPASMCs (P < 0.01, Fig. 5 c, 5 d). A similar result was obtained for procaspase-3 expression and caspase-3 activity in the exogenous SHH-N group (P < 0.05). Moreover, procaspase-3 protein expression and caspase-3 activity were markedly restored by Cy10 (P < 0.01, Fig. 5 c, 5 d). Next, we found that BMPR2 knockdown increased expression of BCL-2 protein; the BCL-2/Bax ratio was increased by nearly three-fold in BMPR2 knockdown hPASMCs. BCL-2 protein expression was normalized and the BCL-2/BAX ratio was decreased by Cy5 and Cy10 (P < 0.01, Fig. 5 e). Treatment with cyclopamine attenuated the BMP pathway in BMPR2 knockdown hPASMCs We examined the levels of p-SMAD1/5/8 protein, SMAD1 protein, ID1 mRNA, and ID3 mRNA in hPASMCs to determine whether downregulation of BMPR2 could prevent BMP4-induced dysfunction in the BMP pathway. The p-SMAD1/5/8 protein level, which was used to determine the activity of the BMP pathway in hPASMCs, was increased by BMP4 activated by BMP4 compared with control + BMP4 group (P < 0.01, Fig. 6 a); however, downregulation of BMPR2 abolished the change in the p-SMAD1/5/8 protein level (Fig. 6 a). The trends in the ID1 and ID3 mRNA levels were similar to that of p-SMAD1/5/8 protein expression in response to stimulation by BMP4 (P < 0.01, Fig. 6 b, 6 c). We also evaluated the relationship between SHH and the BMP pathway and whether cyclopamine attenuated the BMP pathway in hPASMCs. BMPR2 knockdown increased the SHH protein levels in vitro, whereas cyclopamine treatment dose-dependently normalized SHH expression (P < 0.05, Fig. 6 d). Moreover, we found that treatment with cyclopamine significantly relieved the impaired BMPR2 knockdown-induced p-SMAD1/5/8 protein and ID1 mRNA, which represented damage to the BMP pathway in hPASMCs (P < 0.01 and P < 0.05, respectively, Fig. 6 e, 6 f). DISCUSSION In this study, we found that the SHH signaling inhibitor cyclopamine prevented pulmonary arterial remodeling by regulating the BMP4/BMPR2/ID1 pathway in both rats with MCT-induced PAH and hPASMCs. Consistent with previous work demonstrating that activation of SHH protein levels control proliferation of hPASMCs in response to hypoxia 10 , our present findings indicate that SHH protein is activated in rats with MCT-induced PAH and in hPASMCs with impaired BMPR2. Furthermore, we found that regulation of the SHH protein level by cyclopamine had a protective effect on apoptosis and proliferation of hPASMCs via modulation of the BMP pathway and on expression of osteopontin protein in hPASMCs with impaired BMPR2. Based on loss-of-function and gain-of-function studies, the BMP pathway has been proposed to function downstream of SHH signaling but at the same time inhibit SHH signaling in the limb bud mesenchyme, the oral-aboral axis of the mandibular arch, and the stem cells from the apical papilla, suggesting strong crosstalk between BMP and SHH signaling 3 , 16 , 21 . Disassembly of SHH signaling in mesenchyme results in spontaneous development of pulmonary hypertension with increased RVSP and RV wall thickness in rats 12 . Importantly, consistent with an in vitro study by Wang et al 10 , we observed upregulation of SHH protein in both the lung vessels of rats with MCT-induced PAH and in BMPR2 knockdown hPASMCs. Increased SHH protein controlled apoptosis of hPASMCs and their proliferation in response to hypoxia and injury to the BMP pathway both in our study and in studies by others 10 . The evidence presented above confirms that SHH cascade proteins are activated during the pathogenesis of PAH via the BMP pathway. Therefore, it is necessary in our subsequent research to determine whether inactivation of SHH can improve the aberrant vascular remodeling in PAH. The BMPR2 gene provides instructions for making a protein called bone morphogenetic protein receptor type 2, which spans the cell membrane, so that one end of the protein is on the outer surface of the cell and the other end remains inside the cell 4 , 5 . About 70% of heritable PAH and 15–40% of idiopathic PAH develops in the BMPR2 gene, making BMPR2 mutations the main genetic risk. Consistent with a previous report 22 , we found that BMPR2 protein levels were downregulated in the pulmonary arteries of rats with MCT-induced PAH when compared with controls that had received saline. Targeted adenoviral BMPR2 gene delivery, the transcriptional regulator SIN3a, the protease inhibitor elafin, exogenous BMP9, and specific agents such as FK506 and rapamycin, have recently been recognized to have novel therapeutic mechanisms in PAH 5 . However, continued interest in the interaction between BMPR2 signaling and the process of vascular remodeling should expand our understanding of this presently incurable pulmonary vascular disorder. Use of cyclopamine as an SHH pathway inhibitor has already been established in many disorders, including cancer, blood-brain barrier defects, benign prostatic hyperplasia, and osteoarthritis 13 , 20 , 23 , 24 , and the cyclopamine dosage usually used in rats is 10 mg/kg. We selected rats with MCT-induced PAH and a BMPR2-downregulated hPASMC model to explore the functional activities of cyclopamine that are potentially involved in the progression of PAH. In this study, we found that BMPR2 protein expression was decreased in the lung tissue of MCT-induced PAH rats, and cyclopamine treatment could increase BMPR2 expression. It is possible this occurs because cyclopamine can improve pulmonary vessel remodeling and decrease RVSP in vivo, leading to an improvement in hypoxia that increases BMPR2 protein expression through multiple pathways, including the microRNA, hypoxia-inducible factor and so on. 5 Several groups have treated SMCs, such as hPASMCs, SMC-like cells in atherosclerosis, and vascular SMCs, with cyclopamine in vitro 10 , 25 , 26 . However, there is a lack of information about what happens when cyclopamine is administered in animal models. In this study, we demonstrated for the first time that treatment with cyclopamine 10 mg/kg decreased the RVSP and RV/LV + S ratio in a rat model of MCT-induced PAH without affecting heart rate in comparison with controls that received saline. Cyclopamine also addressed pulmonary vessel wall remodeling involving muscularization of the vessel wall, in that thickening of the small pulmonary arteries in rats with MCT-induced PAH was repaired by cyclopamine. Furthermore, cyclopamine has been found to attenuate intimal thickening and neointima formation in the common carotid arteries in a mouse model, especially in vascular lesions 26 , 27 . Overall, our results suggest that cyclopamine has a beneficial effect on pulmonary vascular dysfunction. The inhibitor of DNA binding family of proteins (ID) 1 and 3, which are critical downstream effectors of BMP signaling in PASMCs 28 , are increased by administration of BMP4. As in previous studies 29 , we found that downregulation of BMPR2 reduced the BMP-stimulated induction of ID1 and ID3 in hPASMCs. ID1 regulates stemness and BMPR-mediated differentiation in various cells and tissues 30 , 31 , and inhibition of ID1 improves SHH-induced neuron survival. However, in our study, exogenous SHH-N could not increase mRNA expression of ID1 and ID3 in vitro. Therefore, we hypothesized that this phenomenon may be explained as follows: the SHH protein may promote translocation of ID1 and ID3 and result in acceleration of these proteins in the nucleus 32 and the SHH protein is located downstream of ID1, as demonstrated in rodent cortical neurons by Hung et al 30 . However, more intensive methods, such as co-immunoprecipitation and western blot analysis of nuclear proteins, are needed to confirm the above-mentioned hypotheses. There is some evidence that SHH signaling inhibitors, such as GANT61 and cyclopamine, diminish proliferation of carcinoma cells via ID1 31,33 ; however, before the present study, nothing was known about the effect of inhibition of SHH signaling on BMP-related proliferation of hPASMCs. Our finding that cyclopamine improved BMPR2 knockdown-induced hPASMC dysfunction probably through ID1 but not ID3 may ultimately lead to a new diagnostic or therapeutic target for remodeling in PAH. Apoptosis, proliferation, and senescence of PASMCs are the main causes of pulmonary vascular remodeling 10 , 34 , 35 . The mechanisms via which cyclopamine regulates PASMCs are far from being understood. By generating BMPR2 knockdown hPASMCs, which simulate patients with mutant BMPR2, we found that an impaired BMP pathway could induce apoptosis and proliferation of dysfunctional PASMCs, which has also been documented in previous studies 5 , 22 , 36 . In our research, we found that cyclopamine improved the function of hPASMCs by enhancing apoptosis, which eventually led to proliferation of these cells and vascular thickening. Moreover, we found that changes in the ratio of BAX to BCL-2 may contribute to activation of caspase-3 and modulation of apoptosis during treatment with cyclopamine. For the first time, we also found that overexpression of SHH protein led to disordered expression of osteopontin and α-SMA protein, which are either a key mediator of the SMC lineage and senescence or a marker of disease severity in PAH 34 . Given that osteopontin participates in cell proliferation in multiple tissues, activation/inhibition of osteopontin is a promising therapeutic target 37 . In this study, we also showed that the BMP4/BMPR2 signaling pathway mediated SHH-induced upregulation of osteopontin in PASMCs and that inhibition of SHH/Gli signaling by cyclopamine ameliorates BMPR2 deficiency-induced upregulation of osteopontin in vitro. This study has several limitations. First, our studies used commercially available hPASMCs that are isolated from main pulmonary artery segments. Confidence in our results could be increased if we performed a larger study and obtained samples of lung tissue from patients with BMPR2 mutation to assess SHH signaling. Second, even though we used different concentrations of cyclopamine based on previous literature, treatment with this agent still cannot fully reduce pulmonary artery pressure to normal levels or reverse the pulmonary arterial remodeling completely. A different type of SHH signaling inhibitor can be used to induce remodeling of PASMCs 9 . Based on numerous chemical compounds and drug delivery methods in tumor therapy with SHH signaling inhibition 38 , our research in the future will focus on multi-drug combination therapy in the treatment of pulmonary remodeling 31 . Third, in cultured renal fibroblasts, recombinant SHH-N activated Gli1 and induced α-SMA expression 39 . Wang et al 10 demonstrated that hPASMCs contain SHH, and they further showed that hypoxia augmented SHH expression and secretion into the culture medium. However, the relationship between SHH and α-SMA in PASMCs is still unknown. In future work, we will try to investigate the interaction between SHH and α-SMA, as well as their role in influencing PAH. In conclusion, our data indicate that expression of SHH protein is increased in rats with MCT-induced PAH, resulting in an increase in the number of viable hPASMCs contributing to remodeling of the pulmonary vessels, and that this effect on SHH signaling is via the BMPR2/p-SMAD pathway. We have shown that the SHH signaling inhibitor cyclopamine attenuates MCT-induced changes in RVSP and RV wall thickness in Sprague–Dawley rats and that it may play a role in preventing BMPR2 mutant-induced apoptosis of hPASMCs by restoration of caspase-3 and the Bax/BCL2 ratio and proliferation of hPASMCs by improvement of osteopontin and α-SMA levels. Furthermore, we provide evidence that targeting the BMPR2-SAMD-ID1 signaling pathway with cyclopamine may provide novel therapies for the prevention of PAH. METHODS Animal models and hemodynamic measurements Experiments were performed using forty-eight adult male Sprague–Dawley rats (body weight, 200–220 g). All procedures were approved by the Institutional Committee for Use and Care of Laboratory Animals of Shandong Provincial Hospital (approval number. 2017 − 111), and complied with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). All methods were performed in accordance with the relevant guidelines. The rats were divided into five groups. The first was a group of control rats that received a single subcutaneous injection of saline (n = 8; saline group) and the second was a group of rats that received a single subcutaneous injection of monocrotaline (MCT; 50 mg/kg; Sigma, St Louis, MO, USA) to induce PAH (n = 40) 40 . Three weeks later, the rats with induced PAH were randomly and equally divided into four groups for oral treatment with various doses of cyclopamine (2.5, 5, and 10 mg/kg day; Cy2.5, Cy5, and Cy10) or vehicle (an equal volume of saline; MCT group) for a further 21 days. Six weeks after receiving a single subcutaneous injection, all surviving rats were anaesthetized with intraperitoneal sodium pentobarbital (40 mg/kg) until the end of operations and tests, hemodynamic parameters were measured using a polygraph system (PowerLab 8/30; ADInstruments, Bella Vista, NSW, Australia). After tracheotomy, a polyethylene-50 catheter was inserted into the right ventricle (RV) via the right external jugular vein for assessment of hemodynamic parameters, including heart rate and RVSP. When rats were unable to move, slow to respond and demonstrating symptoms such as diarrhea or urinary incontinence or reached the end of the experimental timeline. They were anesthetized with isoflurane (induction 4% and maintenance 2.5%) and euthanized by cervical dislocation. The death of rats was confirmed by cardiac and respiratory arrest, muscle relaxation and lack of reflex. Morphometric analysis of pulmonary arteries and right ventricular hypertrophy in rats The lungs were flushed with ice-cold saline via the main pulmonary artery immediately after assessment of hemodynamic parameters. The rats were then euthanized by removal of the heart under deep anaesthesia prior to morphometric analysis. Sections of the tissue from the upper left lung were embedded in paraffin and stained with hematoxylin–eosin. Arteries with a diameter of 15–200 mm were evaluated at ×400 magnification and analyzed using Intel Integrated Performance Primitives version 5.0 software (Santa Clara, CA, USA). The medial wall thickness (%WT) and the medial wall area (%WA) of arterial cross-sections were expressed as previously reported 40 . Thirty randomly selected vessels per rat were measured by investigators who were blinded to the experimental group assignment, and the average values were calculated. The weights of the free wall of the RV and the left ventricle plus septum (LV + S) were measured separately. The RV/(LV + S) ratio was calculated as the RV hypertrophy index. Immunohistochemical analysis in rats Immunohistochemical labelling for a-smooth muscle actin (ProteinTech, Chicago, IL, USA) was used to visualize the medial layer of the vessels. Arteries with an external diameter of 15–50 mmwere evaluated for muscularization of the pulmonary microvessels. Proliferative cells were assessed in the walls of the distal pulmonary vessels using a monoclonal antibody against proliferating cell nuclear antigen (PCNA) staining (Dako, Carpentaria, CA, USA), The percentages of PCNA- and TUNEL-positive cells were calculated in 10 randomly chosen fields of each section at ×400 magnification. Cell cultures Human PASMCs (HUM-iCell-a009, iCell Bioscience Inc, Shanghai, China. The cells were purchased at passage 3.) were grown in smooth muscle growth medium (SmGM, Lonza) and studied at passages 5–8. Varying concentrations of cyclopamine (11321, Cayman Chemical, Ann Arbor, MI, USA; 2.5, 5, or 10 µM), SHH-N (100 − 45, PeproTech, Cranbury, NJ, USA; 10 µM), or vehicle was added to the cells, which were then incubated for 48 h. After completion of exposure, the cells were used for proliferation assays and western blot analysis as described below. RNA isolation and real-time polymerase chain reaction Total RNA was extracted using the RNAiso Plus Reagent (9108, Takara Bio, Otsu, Japan). RNA (500 ng) was reverse-transcribed into first-strand complementary DNA using the Primescript RT reagent kit (RR047A, Takara Bio). The optimized reaction was carried out in 10 µL of kit-supplied SYBR PCR Master mix, 0.4 µL of forward primer (10 µM), 0.4 µL of reverse primer (10 µM), 2 µL of complementary DNA, and 7.2 µL of distilled H 2 O, all mixed together to a final volume of 20 µL. Thermal cycling was performed using the Roche LightCycler 480 system (Roche, Basel, Switzerland). Target gene mRNA expression levels were determined using a calibration curve of standards and expressed relative to β-actin expression levels. The primers of the target genes were designed and synthesized by TianGen Biotech (Beijing, China). The sequences of the primers were as follows: human ID1 , forward 5′–3′ (AATCATGAAAGTCGCCAGTG), reverse 3′–5′ (ATGTCGTAGAGCAGCACGTTT); human ID3 , forward 5′–3′ (TCATCTCCAACGACAAAAGG), reverse 3′–5′ (ACCAGGTTTAGTCTCCAGGAA); human β-actin , forward 5′–3′ (GCACCACACCTTCTACAATGA), reverse 3′-5′ (GTCATCTTCTCGCGGTTGGC). Western blotting Equal amounts of protein from the cell lysates were loaded into each well and subjected to 12% electrophoresis on sodium dodecyl sulfate polyacrylamide gels and were then transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% skim milk or 1% bovine serum albumin and probed with one of the following monoclonal antibodies: monoclonal rabbit anti-Bax antibody (1:1000, 2774, Cell Signaling, Danvers, MA, USA), monoclonal rabbit anti-Bcl2 antibody (1:1000; 2872, Cell Signaling), anti-BMPR2 (1:1000, 6979, Cell Signaling), monoclonal rabbit anti-SMAD1/5/8 antibody (1:500, ab66737, Abcam, Cambridge, UK), monoclonal rabbit anti-p-SMAD1/5/8 antibody (1:400, 9511, Cell Signaling), polyclonal rabbit anti-SHH antibody (1:1500, 20697-1-AP, Proteintech, Chicago, IL, USA), polyclonal rabbit anti-osteopontin antibody (1:2000, 22952-1-AP, Proteintech), or anti-GAPDH (1:2500, ab9485, Abcam, Cambridge, MA, USA), followed by the matched secondary antibodies (Proteintech). The cells were lysed in a modified radioimmunoprecipitation assay lysis buffer with a protease and phosphatase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA). Protein quantification and western blot analysis were performed according to standard procedures. The quantification of band intensity upon western blot analysis was conducted using NIH Image software (ProteinSimple, Santa Clara, CA, USA). Lentivirus transfection hPASMCs were infected with Lentivirus/GV248-siBMPR2 (hU6‐MCS‐ubiquitin‐EGFP‐IRES‐puromycin) and their corresponding control lentivirus, lentivirus/GV24 (Genechem, Shanghai, China). The virus titer was determined by quantitative real-time polymerase chain reaction (qRT-PCR). Approximately 3.5–4.5 × 10 4 hPASMCs per well were seeded in a six‐well plate. After culture for 24 h, the medium was replaced by 1 ml of the infection solution (LV‐GV248, LV‐siBMPR2) per well. Twenty-four hours later, the infection solution was replaced with complete SmGM with puromycin. After 48-h puromycin selection, the hPASMCs were harvested 84 h after infection for observation of cell morphology, protein expression, proliferation, and apoptosis. mRNA and protein expression of BMPR2 were detected by qRT-PCR and western blot. The knockdown efficiencies of BMPR2 protein and mRNA were 52% and 40% respectively in hPASMCs dealing with BMPR2 siRNA. The sequences of the siRNAs used for BMPR2 knockdown are as follows: Sense, 5ʹ-GCAGCAAGCACAAAUCAAATT-3ʹ; Antisense, 5ʹ-UUUGAUUUGUGCUUGCUGCTT-3ʹ. The scramble siRNA (Lv-NC) were used as negative control, and the sequences were as follow: Sense, 5’-UUC UCC GAA CGU GUC ACG UTT-3’; Antisense, 5’-ACG UGA CAC GUU CGG AGA ATT-3’. We have added the sequences in the manuscript. TUNEL assay Late apoptotic cells were assessed using the TdT-mediated dUTP nick end labeling (TUNEL) method (11684795910, Roche Applied Science, Penzberg, Germany). hPASMCs were cultured on cover slips overnight. After exposure to the various treatments, the cells were fixed with 4% paraformaldehyde at 37°C for 30 min. hPASMCs were incubated with 0.3% H 2 O 2 methanol solution for 10 min at 37°C. The cells were then treated with 0.1% Triton X-100 at 4°C for 1 min. Next, the cells were incubated in the TUNEL solution at 37°C for 60 min and visualized by fluorescence microscopy (BX51, Olympus, Tokyo, Japan). The number of TUNEL-positive cells among at least 100 cells was calculated from five randomly selected fields at ×400 magnification by observers who were blinded to the treatments. The counts were expressed as a percentage of the total number of cells. Cell proliferation assays The hPASMCs were seeded into 24-well plates at a density of 1.4 × 10 4 cells/well and attached for 4 h in complete medium. The medium was replaced with 0.4% serum-containing medium for 24 h before BMP4 stimulation. Recombinant human BMP4 (120-05, PeproTech; 10 ng/ml) was added to the medium for 48 h in the presence or absence of cyclopamine. The hPASMCs were incubated with 50 µM BrdU (B5002, Sigma-Aldrich) for 1 h. The hPASMCs were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, denatured with 2 M HCl, neutralized with 0.1 M sodium borate (pH 8.5), and blocked with 5% normal goat serum. The cells were then incubated with an anti-BrdU antibody (1:1000, B2531, Sigma-Aldrich) overnight at 4°C followed by incubation with rhodamine-conjugated secondary antibodies (1:50, ZF0313, ZSGB-BIO, Beijing, China) for 1 h at 37°C. The coverslips were rinsed in water, mounted on a glass slide with antifading mounting medium, and visualized using a fluorescence microscope (BX51, Olympus). The number of BrdU-positive cells among at least 100 cells was calculated from five randomly selected fields at ×400 magnification. The counts were expressed as a percentage of the total number of cells. Measurement of caspase-3 activity Caspase-3 activity was measured using a Caspase 3 Activity Assay Kit (C1115, Beyotime Institute of Biotechnology, Nanjing, China). In brief, the protein samples were prepared as indicated for western blot analysis. Next, approximately 50 µg of total cell protein was added to the reaction buffer containing Ac-DEVD-pNA (2 mM) and incubated for 2 h at 37°C. The absorbance of yellow pNA cleaved from its corresponding precursors was measured using a spectrometer at 405 nm. The specific caspase-3 activity, normalized for total protein in the cell lysates, was then expressed as the fold change from the baseline caspase activity in the control cells. Statistical analysis The data are presented as the mean ± standard deviation. Comparisons among groups were made using the Student's t -test or analysis of variance. One-way ANOVA was used, followed by LSD(least-significant difference) post-hoc test for pairwise comparison. The statistical analysis was performed using SPSS version 23.0 (IBM Corp., Armonk, NY, USA). A P-value < 0.05 was considered statistically significant. Abbreviations α-SMA, alpha-smooth muscle actin BMP, bone morphogenetic protein BMPR2, bone morphogenetic protein receptor 2 Cy, cyclopamine hPASMCs, human pulmonary arterial smooth muscle cells MCT, monocrotaline PAH, pulmonary arterial hypertension PCR, polymerase chain reaction PASMCs, pulmonary arterial smooth muscle cells RV, right ventricle RVSP, right ventricular systolic pressure SHH, sonic hedgehog SMCs, smooth muscle cells Declarations Acknowledgments We thank Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the English text of a draft of this manuscript. Authors' contributions Youpeng Jin and Youfei Fan wrote the manuscript, analyzed the data, and conducted most experiments. Fei Mao designed the study and contributed to the writing. Xuehui Wang, Jie Zhang and Yanting Gao performed the animal experiments. Youpeng Jin critically revised the manuscript. All authors read and approved the final manuscript. Data availability statements The data generated in the present study may be requested from the corresponding author. Fundings This work was supported by the National Natural Science Foundation of China (No. 81700053), the Natural Science Foundation of Shandong Province (No. ZR2021MH396, ZR2023MH298 and ZR2023MH113), Science Foundation for Young Scholars of Shandong First Medical University (No. 202201-084) and Special Funds for Taishan Scholars Project. Competing interests The author(s) declare no competing interests. References Humbert, M. et al. Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives. Eur Respir J 53 , doi:10.1183/13993003.01887-2018 (2019). Soon, E. et al. Bone morphogenetic protein receptor type II deficiency and increased inflammatory cytokine production. A gateway to pulmonary arterial hypertension. Am J Respir Crit Care Med 192 , 859-872, doi:10.1164/rccm.201408-1509OC (2015). Gamart, J. et al. SMAD4 target genes are part of a transcriptional network that integrates the response to BMP and SHH signaling during early limb bud patterning. Development 148 , doi:10.1242/dev.200182 (2021). Chowdhury, H. M. et al. BMPRII deficiency impairs apoptosis via the BMPRII-ALK1-BclX-mediated pathway in pulmonary arterial hypertension. Hum Mol Genet 28 , 2161-2173, doi:10.1093/hmg/ddz047 (2019). Orriols, M., Gomez-Puerto, M. C. & Ten Dijke, P. BMP type II receptor as a therapeutic target in pulmonary arterial hypertension. Cell Mol Life Sci 74 , 2979-2995, doi:10.1007/s00018-017-2510-4 (2017). Ingham, P. W. & McMahon, A. P. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15 , 3059-3087, doi:10.1101/gad.938601 (2001). Salybekov, A. A., Salybekova, A. K., Pola, R. & Asahara, T. Sonic Hedgehog Signaling Pathway in Endothelial Progenitor Cell Biology for Vascular Medicine. Int J Mol Sci 19 , doi:10.3390/ijms19103040 (2018). Xiang, X. et al. Metformin regulates macrophage polarization via the Shh signaling pathway to improve pulmonary vascular development in bronchopulmonary dysplasia. IUBMB Life 74 , 259-271, doi:10.1002/iub.2588 (2022). Henno, P. et al. In smokers, Sonic hedgehog modulates pulmonary endothelial function through vascular endothelial growth factor. Respir Res 18 , 102, doi:10.1186/s12931-017-0590-1 (2017). Wang, G. et al. Activation of the sonic hedgehog signaling controls human pulmonary arterial smooth muscle cell proliferation in response to hypoxia. Biochim Biophys Acta 1803 , 1359-1367, doi:10.1016/j.bbamcr.2010.09.002 (2010). He, S. et al. GLI1-mediated pulmonary artery smooth muscle cell pyroptosis contributes to hypoxia-induced pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 318 , L472-L482, doi:10.1152/ajplung.00405.2019 (2020). Peng, T. et al. Hedgehog actively maintains adult lung quiescence and regulates repair and regeneration. Nature 526 , 578-582, doi:10.1038/nature14984 (2015). Bariwal, J., Kumar, V., Dong, Y. & Mahato, R. I. Design of Hedgehog pathway inhibitors for cancer treatment. Med Res Rev 39 , 1137-1204, doi:10.1002/med.21555 (2019). Dutzmann, J. et al. Sonic hedgehog-dependent activation of adventitial fibroblasts promotes neointima formation. Cardiovasc Res 113 , 1653-1663, doi:10.1093/cvr/cvx158 (2017). Chen, S. C. et al. Administration of sonic hedgehog protein induces angiogenesis and has therapeutic effects after stroke in rats. Neuroscience 352 , 285-295, doi:10.1016/j.neuroscience.2017.03.054 (2017). Xu, J. et al. Hedgehog signaling patterns the oral-aboral axis of the mandibular arch. Elife 8 , doi:10.7554/eLife.40315 (2019). Deng, J. et al. Noggin Overexpression Impairs the Development of Muscles, Tendons, and Aponeurosis in Soft Palates by Disrupting BMP-Smad and Shh-Gli1 Signaling. Front Cell Dev Biol 9 , 711334, doi:10.3389/fcell.2021.711334 (2021). Manzari-Tavakoli, A. et al. The Cross-Talks Among Bone Morphogenetic Protein (BMP) Signaling and Other Prominent Pathways Involved in Neural Differentiation. Front Mol Neurosci 15 , 827275, doi:10.3389/fnmol.2022.827275 (2022). Meuser, M. et al. FGFR2 signaling enhances the SHH-BMP4 signaling axis in early ureter development. Development 149 , doi:10.1242/dev.200021 (2022). Pratap, A. et al. Cyclopamine attenuates acute warm ischemia reperfusion injury in cholestatic rat liver: hope for marginal livers. Mol Pharm 8 , 958-968, doi:10.1021/mp200115v (2011). Bastida, M. F., Sheth, R. & Ros, M. A. A BMP-Shh negative-feedback loop restricts Shh expression during limb development. Development 136 , 3779-3789, doi:10.1242/dev.036418 (2009). Hautefort, A. et al. Bmpr2 Mutant Rats Develop Pulmonary and Cardiac Characteristics of Pulmonary Arterial Hypertension. Circulation 139 , 932-948, doi:10.1161/CIRCULATIONAHA.118.033744 (2019). Apostu, D. et al. Systemic drugs with impact on osteoarthritis. Drug Metab Rev 51 , 498-523, doi:10.1080/03602532.2019.1687511 (2019). Wang, H. et al. Inactivation of Hedgehog signal transduction in adult astrocytes results in region-specific blood-brain barrier defects. Proc Natl Acad Sci U S A 118 , doi:10.1073/pnas.2017779118 (2021). Xu, J. et al. Paired box 9 regulates VSMC phenotypic transformation, proliferation, and migration via sonic hedgehog. Life Sci 257 , 118053, doi:10.1016/j.lfs.2020.118053 (2020). Di Luca, M. et al. The calcium binding protein S100beta marks hedgehog-responsive resident vascular stem cells within vascular lesions. NPJ Regen Med 6 , 10, doi:10.1038/s41536-021-00120-8 (2021). Li, H. et al. Sonic hedgehog promotes autophagy of vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 303 , H1319-1331, doi:10.1152/ajpheart.00160.2012 (2012). Peddada, S., Yasui, D. H. & LaSalle, J. M. Inhibitors of differentiation (ID1, ID2, ID3 and ID4) genes are neuronal targets of MeCP2 that are elevated in Rett syndrome. Hum Mol Genet 15 , 2003-2014, doi:10.1093/hmg/ddl124 (2006). Yang, J. et al. Id proteins are critical downstream effectors of BMP signaling in human pulmonary arterial smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 305 , L312-321, doi:10.1152/ajplung.00054.2013 (2013). Hung, Y. H. et al. Inhibitor of Differentiation-1 and Hypoxia-Inducible Factor-1 Mediate Sonic Hedgehog Induction by Amyloid Beta-Peptide in Rat Cortical Neurons. Mol Neurobiol 53 , 793-809, doi:10.1007/s12035-014-9046-5 (2016). Jin, X. et al. Inhibition of ID1-BMPR2 Intrinsic Signaling Sensitizes Glioma Stem Cells to Differentiation Therapy. Clin Cancer Res 24 , 383-394, doi:10.1158/1078-0432.CCR-17-1529 (2018). Chu, Y. H., Lin, J. D., Nath, S. & Schachtrup, C. Id proteins: emerging roles in CNS disease and targets for modifying neural stemcell behavior. Cell Tissue Res 387 , 433-449, doi:10.1007/s00441-021-03490-z (2022). Jin, X. et al. The ID1-CULLIN3 Axis Regulates Intracellular SHH and WNT Signaling in Glioblastoma Stem Cells. Cell Rep 16 , 1629-1641, doi:10.1016/j.celrep.2016.06.092 (2016). Mura, M., Cecchini, M. J., Joseph, M. & Granton, J. T. Osteopontin lung gene expression is a marker of disease severity in pulmonary arterial hypertension. Respirology 24 , 1104-1110, doi:10.1111/resp.13557 (2019). Wang, A. P. et al. Pulmonary Artery Smooth Muscle Cell Senescence Promotes the Proliferation of PASMCs by Paracrine IL-6 in Hypoxia-Induced Pulmonary Hypertension. Front Physiol 12 , 656139, doi:10.3389/fphys.2021.656139 (2021). Hansmann, G. et al. An antiproliferative BMP-2/PPARgamma/apoE axis in human and murine SMCs and its role in pulmonary hypertension. J Clin Invest 118 , 1846-1857, doi:10.1172/JCI32503 (2008). Wu, W. et al. A Noncanonical Hedgehog Signaling Exerts a Tumor-Promoting Effect on Pancreatic Cancer Cells Via Induction of Osteopontin Expression. Cancer Biother Radiopharm , doi:10.1089/cbr.2021.0317 (2021). Jeng, K. S., Chang, C. F. & Lin, S. S. Sonic Hedgehog Signaling in Organogenesis, Tumors, and Tumor Microenvironments. Int J Mol Sci 21 , doi:10.3390/ijms21030758 (2020). Ding, H. et al. Sonic Hedgehog Signaling Mediates Epithelial–Mesenchymal Communication and Promotes Renal Fibrosis. Journal of the American Society of Nephrology 23 , 801-813, doi:10.1681/asn.2011060614 (2012). Fan, Y. F. et al. The phosphodiesterase-5 inhibitor vardenafil reduces oxidative stress while reversing pulmonary arterial hypertension. Cardiovasc Res 99 , 395-403, doi:10.1093/cvr/cvt109 (2013). Additional Declarations No competing interests reported. Supplementary Files WBIHF.pdf Cite Share Download PDF Status: Published Journal Publication published 11 Apr, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 19 Feb, 2025 Reviews received at journal 17 Feb, 2025 Reviewers agreed at journal 15 Feb, 2025 Reviews received at journal 14 Dec, 2024 Reviewers agreed at journal 04 Dec, 2024 Reviewers invited by journal 22 Aug, 2024 Editor assigned by journal 22 Aug, 2024 Editor invited by journal 21 Aug, 2024 Submission checks completed at journal 18 Aug, 2024 First submitted to journal 08 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4881852","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":346059327,"identity":"6036e2d6-8049-4d67-9257-568cbedd6a53","order_by":0,"name":"Youpeng Jin","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Youpeng","middleName":"","lastName":"Jin","suffix":""},{"id":346059328,"identity":"d930efcd-d3d7-42b0-92da-ac8853b06ae6","order_by":1,"name":"Fei Mao","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Fei","middleName":"","lastName":"Mao","suffix":""},{"id":346059329,"identity":"4ea397c5-3a22-4546-b590-29e2b912b2f4","order_by":2,"name":"Xuehui Wang","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xuehui","middleName":"","lastName":"Wang","suffix":""},{"id":346059330,"identity":"e7cc72e5-027a-4190-9414-b7da9a78b4da","order_by":3,"name":"Jie Zhang","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Zhang","suffix":""},{"id":346059331,"identity":"7a982d6b-40ea-4185-8463-83506f5ee064","order_by":4,"name":"Yanting Gao","email":"","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yanting","middleName":"","lastName":"Gao","suffix":""},{"id":346059332,"identity":"f9558612-920b-4191-a14a-1cfa399bc347","order_by":5,"name":"Youfei Fan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYBAC9gYwJcfAxsz/8UFChYQcPyEtPAfAlDEDG3uDscGHMxbGkg3EagGyzCRntlUkbiCohf3sMYmPbQZyfBIJCdK88yQYNzAwP3x0A58Wnrw0oOEGxmwSCQeMebdJMJszsBkb5+DRYs+QYybN2/YnsU0isSEZqIXNsoGHTRqfFh7+NyAtBvVtEskMh3nnSPAYHCCkRQJsi0ECG88xxsaZDRISRGh5Y2w545yBYRt7DzPDh2MSBpLNBPzCw59jeONDmYG8fDMP+4+Emrr6fvbmh4/xaQECFglUPjN+5WAlHwirGQWjYBSMghENALfxQvR9xlrAAAAAAElFTkSuQmCC","orcid":"","institution":"Shandong Provincial Hospital Affiliated to Shandong First Medical University","correspondingAuthor":true,"prefix":"","firstName":"Youfei","middleName":"","lastName":"Fan","suffix":""}],"badges":[],"createdAt":"2024-08-08 14:43:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4881852/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4881852/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-97627-7","type":"published","date":"2025-04-11T16:05:54+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":64596259,"identity":"4aa0d181-b805-4d97-846a-6fccd811b1a4","added_by":"auto","created_at":"2024-09-16 10:52:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":168352,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression of SHH and BMPR2 protein in the pulmonary arteries of rats with MCT-induced PAH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSprague–Dawley rats were treated with MCT (50 mg/kg) for21 days and hPASMCs were treated with SHH-N for 48 h. (a) The location of SHH protein was detected using immunohistochemical staining (n=6 for each treatment group). (b) The SHH protein expression level was measured by western blot analysis. (c) Pulmonary hemodynamics were evaluated by RVSP and (d) right ventricular remodeling was measured by RVHI. Apoptosis was detected by TUNEL staining analysis (e) and proliferation was detected by BrdU staining in hPASMCs (f). (g, h) Western blot analysis showing the BMPR2 and osteopontin protein expression levels in the saline group and the MCT-treated group. The protein expression levels were normalized to GAPDH (n=3 for each treatment group). \u003cem\u003e*\u003c/em\u003eP\u0026lt;0.05 vs. the saline group; **P\u0026lt;0.001 vs. the saline group. α-SMA, alpha-smooth muscle actin; BMPR2, bone morphogenetic protein receptor 2; HE, hematoxylin-eosin; MCT, monocrotaline; OPN, osteopontin; PAH, pulmonary arterial hypertension; RVHI, right ventricular hypertrophy index; RVSP, right ventricular systolic pressure; SHH, Sonic hedgehog\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/be89000140e1e02652497c2b.png"},{"id":64596258,"identity":"db69e180-ffa2-4570-a571-f9f4623d62b8","added_by":"auto","created_at":"2024-09-16 10:52:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":594145,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of cyclopamine on pulmonary hemodynamics and vascular remodeling in rats with MCT-induced PAH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSprague–Dawley rats were treated with saline or 50 mg/kg MCT in the presence or absence of cyclopamine (2.5, 5, or 10 mg/kg every 24 hours). The morphometrics of the pulmonary arteries were detected by HE staining. (a). The number of α-SMA-positive arteries were measured in pulmonary vessels (b). The number of PCNA-positive cells were measured in pulmonary vessels (c). The number of TUNELpositive cells were measured in pulmonary vessels (d). \u0026nbsp;Pulmonary hemodynamics were evaluated by (e) RVSP and (f) HR. Vascular remodeling of the pulmonary arteries was evaluated by (g) the ratio of the free wall of the RV weight to LV+S weight, (h) percentage muscularization of the medial smooth muscle layer in pulmonary vessels less than 50 µm in external diameter, (i) medial wall thickness in pulmonary vessels less than 200 µm in external diameter, and (j) the medial wall area in pulmonary vessels less than 200 µm in external diameter (n=6 for each treatment group). α-SMA, alpha-smooth muscle actin; Cy, cyclopamine; HE,\u0026nbsp;hematoxylin-eosin; HR, heart rate; MCT, monocrotaline; PAH, pulmonary arterial hypertension; RVSP, right ventricular systolic pressure. \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. the saline group; *P\u0026lt;0.05 vs. the MCT group.\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/60c2c77933f4a2131a03c9d4.png"},{"id":64596253,"identity":"14586194-bb3f-45f3-af73-06450614cfd0","added_by":"auto","created_at":"2024-09-16 10:52:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":60250,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCyclopamine improves the BMP pathway in the pulmonary arteries of rats with MCT-induced PAH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSprague–Dawley rats were treated with saline or 50 mg/kg MCT in the presence or absence of cyclopamine (2.5, 5, or 10 mg/kg every 24 hours). Western blot analysis shows (a) BMP4 protein expression levels, (b) BMPR2, (c) p-SMAD1/5/8 and SMAD1/5/8 protein expression levels, and (d) SHH protein expression levels in the various groups. The protein expression levels were normalized to GAPDH (n=3 for each treatment group). BMP, bone morphogenetic protein; BMPR, bone morphogenetic protein receptor; Cy, cyclopamine; MCT, monocrotaline; PAH, pulmonary arterial hypertension; SHH, Sonic hedgehog. \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. the saline group; *P\u0026lt;0.05 vs. the MCT group; **P\u0026lt;0.01 vs. the MCT group.\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/e1723c733fc8fa7c27c2fc93.png"},{"id":64596254,"identity":"b90b9a23-117d-49ab-8d4a-40574f0c6baf","added_by":"auto","created_at":"2024-09-16 10:52:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":115141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of cyclopamine on proliferation and expression of α-SMA and osteopontin protein in BMPR2 knockdown hPASMCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hPASMCs were treated with Lv-NC, Lv-siBMPR2, and SHH in the presence or absence of cyclopamine (2.5, 5, or 10 µM) for 48 h. Exogenous BMP4 protein (10 ng/ml) was added in culture medium to promote proliferation. The transfection efficiency was evaluated by (a) BMPR2 protein levels and (b) BMPR2 mRNA levels. (c) Proliferation was detected by BrdU staining analysis. (d) The numbers of BrdU-positive cells were measured. Western blot analysis and quantification showing (e) α-SMA and (f) OPN protein expression levels in the various groups. The protein expression levels were normalized to GAPDH (n=3 for each treatment group). \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. the control group; *P\u0026lt;0.05 vs. the Lv-siBMPR2 group. α-SMA, alpha-smooth muscle actin; BMPR, bone morphogenetic protein receptor; Cy, cyclopamine; hPASMCs, human pulmonary arterial smooth muscle cells; Lv, lentivirus; OPN, osteopontin; SHH, Sonic hedgehog\u003c/p\u003e","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/d6f4fd1487b7b0e3cbd97955.png"},{"id":64596260,"identity":"75b35701-07f0-406f-98e8-92039be86b17","added_by":"auto","created_at":"2024-09-16 10:52:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":158014,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of cyclopamine on apoptosis and expression of caspase-3, Bax, and BCL-2 protein in BMPR2 knockdown hPASMCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hPASMCs were treated with Lv-NC, Lv-siBMPR2, and SHH in the presence or absence of cyclopamine (2.5, 5, or 10 µM) for 24 h. (a) Apoptosis was detected by a TUNEL staining analysis and (b) the numbers of TUNEL-positive cells were measured. Caspase-3 activity was measured by (c) a commercial kit and (d) procaspase-3 protein expression levels by western blot analysis in the various groups. (e) Western blot analysis showing BCL-2 and Bax protein expression levels in the various groups. The protein expression levels were normalized to GAPDH (n=3 for each treatment group). BMPR, bone morphogenetic protein receptor; Cy, cyclopamine; hPASMCs, human pulmonary arterial smooth muscle cells; Lv, lentivirus; SHH, Sonic hedgehog. \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. the control group; *P\u0026lt;0.05 vs. the Lv-siBMPR2 group; **P\u0026lt;0.01 vs. the Lv-siBMPR2 group.\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/f177bca237fb810d2f8eb2c6.png"},{"id":64596256,"identity":"5badebaf-dde6-44b1-9794-3832ee8fa7c3","added_by":"auto","created_at":"2024-09-16 10:52:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":114632,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of treatment with cyclopamine on the BMP pathway in BMPR2 knockdown hPASMCs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hPASMCs were treated with Lv-NC, Lv-siBMPR2, and SHH in the presence or absence of cyclopamine (2.5, 5, or 10 µM) for 48 h. (a) Western blot analysis and quantification showing the protein expression levels of p-SMAD1/5/8 and SMAD1/5/8 in the various groups. The protein expression levels were normalized to GAPDH. The mRNA expression levels of (b) \u003cem\u003eID1\u003c/em\u003e and (c) \u003cem\u003eID3\u003c/em\u003e detected by real-time PCR analysis are shown for the various groups. The mRNA expression levels were normalized to \u003cem\u003eGAPDH\u003c/em\u003e. (d) Western blot analysis of SHH protein expression levels in the various groups. (e) Exogenous BMP4 protein (10 ng/ml) was added to the culture medium to promote proliferation. Western blot analysis and quantification shows the p-SAMD1/5/8 and SMAD1/5/8 protein expression levels in the various groups. The protein expression levels were normalized to GAPDH. (f) Real-time PCR analysis of \u003cem\u003eID1\u003c/em\u003e and \u003cem\u003eID3 \u003c/em\u003emRNA expression levels in the various groups. The mRNA expression levels were normalized to \u003cem\u003eGAPDH\u003c/em\u003e. (n=3 for each treatment group). \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. the control group; *P\u0026lt;0.05 vs. the Lv-siBMPR2 group; **P\u0026lt;0.01 vs. the Lv-siBMPR2 group.\u003cstrong\u003e \u003c/strong\u003eBMPR, bone morphogenetic protein receptor; Cy, cyclopamine; hPASMCs, human pulmonary arterial smooth muscle cells; Lv, lentivirus; SHH, Sonic hedgehog\u003c/p\u003e","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/edfa5dea139706464ac4a114.png"},{"id":64596768,"identity":"3545bef6-9083-4d73-99fc-c9710fbb001f","added_by":"auto","created_at":"2024-09-16 11:00:11","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":65485,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA graphical summary of the present study\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/c3512295b10251d735ab9378.png"},{"id":80558729,"identity":"6bce5fae-381b-4ad0-86ef-f21e2b84882c","added_by":"auto","created_at":"2025-04-14 16:16:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2905512,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/b398e47a-e8a3-43d3-816e-48f5cd2021a9.pdf"},{"id":64596252,"identity":"424af6e2-6d61-4781-bc44-6174c9269c54","added_by":"auto","created_at":"2024-09-16 10:52:10","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":512337,"visible":true,"origin":"","legend":"","description":"","filename":"WBIHF.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4881852/v1/6bb3cabe2280b07c3102924d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The sonic hedgehog signaling inhibitor cyclopamine improves pulmona ry arterial hypertension via regulating the bone morphogenetic protein receptor 2 pathway","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003ePulmonary arterial hypertension (PAH) is a multifactorial and progressive disease, which is characterized by a sustained increase in pulmonary arterial pressure and ultimately leads to right ventricular failure and death. Impaired production of vascular mediators such as nitric oxide, endothelin-1, and inflammatory cytokines, and variations in signaling molecules have been implicated in the pathophysiological progression of PAH \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. There is strong evidence suggesting that bone morphogenetic protein (BMP) signaling has a protective role in the pulmonary vascular wall by inhibiting proliferation of pulmonary arterial smooth muscle cells (PASMCs) and triggering anti-inflammatory responses \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. BMP ligands activate transmembrane bone morphogenetic protein type 2 receptor (BMPR2), which forms hetero-tetrameric complexes. The activated BMP receptor complexes trigger phosphorylation of R-SMAD (SMAD1, SMAD5 and SMAD8) and regulate target gene expression together with co-activators or repressors \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. BMPR2 deficiency has been reported to cause resistance to apoptosis via the BMPR2-ALK1-BclX-mediated pathway both in PASMCs and pulmonary vascular endothelial cells, leading to vascular remodeling in PAH \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Therefore, an impaired BMPR2 pathway may increase susceptibility to abnormal vascular homeostasis, and modulation of BMPR2 signaling is considered a promising therapeutic approach for PAH \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eSonic hedgehog (SHH), a member of the hedgehog protein family, is a 45-kDa protein that is essential for normal development of multiple tissues and organs \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Activation of the SHH signaling cascade is initiated when SHH ligands bind to the membrane receptor Patched1, thus releasing smoothened (SMO) to be activated by phosphorylation. SMO ultimately decreases the interaction between suppressor of fused homolog and glioma-associated oncogenes. Proteins in the SHH cascade have a potential role in the pathogenesis of cardiovascular and pulmonary vascular diseases, which play critical roles in angiogenesis either in development or in ischemic adult tissues \u003csup\u003e\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Furthermore, SHH signaling has been shown to enhance the proliferation of human pulmonary arterial smooth muscle cells (hPASMCs) during hypoxia, and the SHH pathway inhibitor cyclopamine has been shown to relieve hypoxia-induced dysfunction of smooth muscle cells (SMCs) \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Moreover, interference with SHH signaling by deletion of \u003cem\u003esmo\u003c/em\u003e from platelet-derived growth factor receptor-β-derived mesenchyme results in spontaneous development of pulmonary hypertension with increased right ventricular systolic pressure (RVSP) \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Accordingly, targeted modulation of SHH signaling is believed to be effective in the treatment of human cancer \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, myocardial ischemia \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, and stroke \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Although SHH signaling and its inhibitor have been studied in the context of regulation of proliferation of hPASMCs \u003cem\u003ein vitro\u003c/em\u003e, to our knowledge, little is known about their functions during development of PAH \u003cem\u003ein vivo\u003c/em\u003e. Moreover, the underlying mechanisms via which inhibition of the SHH pathway is controlled in the treatment of PAH remain unclear.\u003c/p\u003e \u003cp\u003eSHH and BMP4 signaling pathways are activated in a complementary pattern during development of the oral-aboral axis in the embryonic mandibular arch of the mouse and limb development in the chick embryo \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Furthermore, treatment with SHH was found to induce expansion of pluripotent human hematopoietic repopulating cells, and Noggin, a specific inhibitor of bone morphogenetic protein 4 (BMP4), to be capable of inhibiting SHH-induced proliferation and disrupting the BMP-SHH-Gli1 network \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. SHH-BMP signaling participates in early development of the ureters, early patterning of the limb buds, and neural differentiation \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. These findings suggest that SHH and BMP act cooperatively during development and cell differentiation in other tissues; however, the relationship between these molecules is not completely understood in PAH. Therefore, we hypothesized that SHH may have an important role in the pathobiology of PAH by promoting pulmonary vascular remodeling and that inhibition of SHH by cyclopamine could attenuate pulmonary vascular remodeling via the BMP4/BMPR2/ID1 pathway.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e \u003cb\u003eExpression of SHH and BMPR2 proteins in the pulmonary arteries of rats with MCT-induced PAH and in hPASMCs\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSHH expression in the pulmonary vasculature appeared to be higher in rats with experimental PAH than in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb), as did RVSP and the RV hypertrophy index (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Exogenous recombinant SHH protein decreased the number of TUNEL-positive cells and increased the number of BrdU-positive cells in hPASMCs, suggesting that it has a crucial role in remodeling of the pulmonary vessels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). The BMPR2 protein level was significantly lower in rats treated with MCT than in those treated with saline (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The osteopontin protein level in the pulmonary arteries was significantly higher in rats with MCT-induced PAH than in the control rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eh, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe SHH signaling inhibitor cyclopamine attenuated pulmonary hemodynamics and vascular remodeling in rats with MCT-induced PAH\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe assessed the potential therapeutic role of inhibition of the SHH pathway in PAH by examining the effect of cyclopamine in rats with MCT-induced PAH. The pulmonary vessel wall, expression of alpha-smooth muscle actin (α-SMA) protein and proliferating cell nuclear antigen (PCNA) in the lung tissues of rats with MCT-induced PAH were examined by immunohistochemical staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). Cyclopamine (2.5, 5, and 10 mg/kg [Cy2.5, Cy5, and Cy10, respectively] or vehicle was administered every 24 hours via the intraperitoneal route to the rats (n\u0026thinsp;=\u0026thinsp;6\u0026ndash;8 animals per group) \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, starting one day after subcutaneous injection of MCT (50 mg/kg via the intrahepatic route). Administration of cyclopamine prevented development of MCT-induced PAH. Treatment with cyclopamine 10 mg/kg significantly reduced PAH when assessed by RVSP, the RV hypertrophy index, and the degree of pulmonary artery muscularization without affecting heart rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec\u0026ndash;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef). Furthermore, treatment with Cy5 or Cy10 decreased remodeling of the pulmonary arteries, as demonstrated by changes in the media wall area and media wall thickness in lung tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh). Treatment with Cy2.5 had no significant ability to prevent PAH.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCyclopamine improves the BMP pathway in the pulmonary arteries of rats with MCT-induced PAH\u003c/h2\u003e \u003cp\u003eThe pulmonary arteries from rats with PAH treated with cyclopamine were analyzed by western blotting to determine whether cyclopamine exerted its effects via the BMP pathway. The rats with PAH showed increased expression of BMP4 and SHH protein and decreased expression of BMPR2 and p-SMAD1/5/8 protein (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Treatment with Cy5 or Cy10 prevented the MCT-induced changes in BMP4, BMPR2, and p-SMAD1/5/8 levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), such that there was no difference in protein expression in the BMP pathway in the Cy2.5 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-c). Furthermore, compared with the rats with MCT-induced PAH, treatment with Cy5 or Cy10 reduced the expression of SHH protein (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Similarly, Cy2.5 did not affect expression of SHH protein in rats with PAH (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of cyclopamine on proliferation and expression of α-SMA and osteopontin protein in BMPR2 knockdown hPASMCs\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe investigated proliferation by Brdu staining and proliferation-related proteins in hPASMCs following knockdown of BMPR2 to determine the role of inhibition of SHH on apoptosis and apoptosis-related proteins in vitro. Western blotting and quantitative PCR analyses of BMPR2 showed that levels of these transcripts and protein expression in hPASMCs transfected with siRNAs were lower than those in controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe number of BrdU-positive cells were increased in BMPR2 knockdown hPASMCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and hPASMCs exposed to exogenous SHH-N (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed), whereas the number of BrdU-positive hPASMCs was significantly diminished after treatment with cyclopamine (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003eBMPR2 knockdown also increased the expression of α-SMA and osteopontin proteins (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef); similarly, exogenous SHH-N improved the α-SMA and osteopontin protein levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef), suggesting a pro-proliferative effect of SHH-N at different stages. Treatment with cyclopamine 10\u0026micro;M for 48 h normalized the BMPR2 knockdown-induced upregulation of α-SMA and osteopontin in hPASMCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of cyclopamine on apoptosis and caspase-3, Bax, and BCL-2 protein expression in BMPR2 knockdown hPASMCs\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe number of TUNEL-positive hPASMCs was reduced, suggesting a prosurvival role of BMPR2-mediated signaling in BMPR2 knockdown hPASMCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In contrast, the number of TUNEL-positive hPASMCs was significantly increased after treatment with cyclopamine (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Although exogenous SHH protein could also decrease the number of TUNEL-positive hPASMCs, there was no significant difference between the SHH group and the control group (P\u0026thinsp;=\u0026thinsp;0.57, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThere was also a decrease in the procaspase-3 protein level (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01); accordingly, the caspase-3 activity increased in BMPR2 knockdown hPASMCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed). A similar result was obtained for procaspase-3 expression and caspase-3 activity in the exogenous SHH-N group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Moreover, procaspase-3 protein expression and caspase-3 activity were markedly restored by Cy10 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003eNext, we found that BMPR2 knockdown increased expression of BCL-2 protein; the BCL-2/Bax ratio was increased by nearly three-fold in BMPR2 knockdown hPASMCs. BCL-2 protein expression was normalized and the BCL-2/BAX ratio was decreased by Cy5 and Cy10 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTreatment with cyclopamine attenuated the BMP pathway in BMPR2 knockdown hPASMCs\u003c/h2\u003e \u003cp\u003eWe examined the levels of p-SMAD1/5/8 protein, SMAD1 protein, \u003cem\u003eID1\u003c/em\u003e mRNA, and \u003cem\u003eID3\u003c/em\u003e mRNA in hPASMCs to determine whether downregulation of BMPR2 could prevent BMP4-induced dysfunction in the BMP pathway. The p-SMAD1/5/8 protein level, which was used to determine the activity of the BMP pathway in hPASMCs, was increased by BMP4 activated by BMP4 compared with control\u0026thinsp;+\u0026thinsp;BMP4 group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea); however, downregulation of BMPR2 abolished the change in the p-SMAD1/5/8 protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). The trends in the \u003cem\u003eID1\u003c/em\u003e and \u003cem\u003eID3\u003c/em\u003e mRNA levels were similar to that of p-SMAD1/5/8 protein expression in response to stimulation by BMP4 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also evaluated the relationship between SHH and the BMP pathway and whether cyclopamine attenuated the BMP pathway in hPASMCs. BMPR2 knockdown increased the SHH protein levels in vitro, whereas cyclopamine treatment dose-dependently normalized SHH expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed). Moreover, we found that treatment with cyclopamine significantly relieved the impaired BMPR2 knockdown-induced p-SMAD1/5/8 protein and \u003cem\u003eID1\u003c/em\u003e mRNA, which represented damage to the BMP pathway in hPASMCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, respectively, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef).\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, we found that the SHH signaling inhibitor cyclopamine prevented pulmonary arterial remodeling by regulating the BMP4/BMPR2/ID1 pathway in both rats with MCT-induced PAH and hPASMCs. Consistent with previous work demonstrating that activation of SHH protein levels control proliferation of hPASMCs in response to hypoxia \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, our present findings indicate that SHH protein is activated in rats with MCT-induced PAH and in hPASMCs with impaired BMPR2. Furthermore, we found that regulation of the SHH protein level by cyclopamine had a protective effect on apoptosis and proliferation of hPASMCs via modulation of the BMP pathway and on expression of osteopontin protein in hPASMCs with impaired BMPR2.\u003c/p\u003e \u003cp\u003eBased on loss-of-function and gain-of-function studies, the BMP pathway has been proposed to function downstream of SHH signaling but at the same time inhibit SHH signaling in the limb bud mesenchyme, the oral-aboral axis of the mandibular arch, and the stem cells from the apical papilla, suggesting strong crosstalk between BMP and SHH signaling \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Disassembly of SHH signaling in mesenchyme results in spontaneous development of pulmonary hypertension with increased RVSP and RV wall thickness in rats \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Importantly, consistent with an \u003cem\u003ein vitro\u003c/em\u003e study by Wang et al \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e, we observed upregulation of SHH protein in both the lung vessels of rats with MCT-induced PAH and in BMPR2 knockdown hPASMCs. Increased SHH protein controlled apoptosis of hPASMCs and their proliferation in response to hypoxia and injury to the BMP pathway both in our study and in studies by others \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. The evidence presented above confirms that SHH cascade proteins are activated during the pathogenesis of PAH via the BMP pathway. Therefore, it is necessary in our subsequent research to determine whether inactivation of SHH can improve the aberrant vascular remodeling in PAH.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eBMPR2\u003c/em\u003e gene provides instructions for making a protein called bone morphogenetic protein receptor type 2, which spans the cell membrane, so that one end of the protein is on the outer surface of the cell and the other end remains inside the cell \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. About 70% of heritable PAH and 15\u0026ndash;40% of idiopathic PAH develops in the BMPR2 gene, making BMPR2 mutations the main genetic risk. Consistent with a previous report \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, we found that BMPR2 protein levels were downregulated in the pulmonary arteries of rats with MCT-induced PAH when compared with controls that had received saline. Targeted adenoviral BMPR2 gene delivery, the transcriptional regulator SIN3a, the protease inhibitor elafin, exogenous BMP9, and specific agents such as FK506 and rapamycin, have recently been recognized to have novel therapeutic mechanisms in PAH \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. However, continued interest in the interaction between BMPR2 signaling and the process of vascular remodeling should expand our understanding of this presently incurable pulmonary vascular disorder.\u003c/p\u003e \u003cp\u003eUse of cyclopamine as an SHH pathway inhibitor has already been established in many disorders, including cancer, blood-brain barrier defects, benign prostatic hyperplasia, and osteoarthritis \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, and the cyclopamine dosage usually used in rats is 10 mg/kg. We selected rats with MCT-induced PAH and a BMPR2-downregulated hPASMC model to explore the functional activities of cyclopamine that are potentially involved in the progression of PAH. In this study, we found that BMPR2 protein expression was decreased in the lung tissue of MCT-induced PAH rats, and cyclopamine treatment could increase BMPR2 expression. It is possible this occurs because cyclopamine can improve pulmonary vessel remodeling and decrease RVSP in vivo, leading to an improvement in hypoxia that increases BMPR2 protein expression through multiple pathways, including the microRNA, hypoxia-inducible factor and so on.\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e Several groups have treated SMCs, such as hPASMCs, SMC-like cells in atherosclerosis, and vascular SMCs, with cyclopamine in vitro \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. However, there is a lack of information about what happens when cyclopamine is administered in animal models. In this study, we demonstrated for the first time that treatment with cyclopamine 10 mg/kg decreased the RVSP and RV/LV\u0026thinsp;+\u0026thinsp;S ratio in a rat model of MCT-induced PAH without affecting heart rate in comparison with controls that received saline. Cyclopamine also addressed pulmonary vessel wall remodeling involving muscularization of the vessel wall, in that thickening of the small pulmonary arteries in rats with MCT-induced PAH was repaired by cyclopamine. Furthermore, cyclopamine has been found to attenuate intimal thickening and neointima formation in the common carotid arteries in a mouse model, especially in vascular lesions \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Overall, our results suggest that cyclopamine has a beneficial effect on pulmonary vascular dysfunction.\u003c/p\u003e \u003cp\u003eThe inhibitor of DNA binding family of proteins (ID) 1 and 3, which are critical downstream effectors of BMP signaling in PASMCs \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, are increased by administration of BMP4. As in previous studies \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, we found that downregulation of BMPR2 reduced the BMP-stimulated induction of ID1 and ID3 in hPASMCs. ID1 regulates stemness and BMPR-mediated differentiation in various cells and tissues \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, and inhibition of ID1 improves SHH-induced neuron survival. However, in our study, exogenous SHH-N could not increase mRNA expression of ID1 and ID3 in vitro. Therefore, we hypothesized that this phenomenon may be explained as follows: the SHH protein may promote translocation of ID1 and ID3 and result in acceleration of these proteins in the nucleus \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e and the SHH protein is located downstream of ID1, as demonstrated in rodent cortical neurons by Hung et al \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. However, more intensive methods, such as co-immunoprecipitation and western blot analysis of nuclear proteins, are needed to confirm the above-mentioned hypotheses. There is some evidence that SHH signaling inhibitors, such as GANT61 and cyclopamine, diminish proliferation of carcinoma cells via ID1 \u003csup\u003e31,33\u003c/sup\u003e; however, before the present study, nothing was known about the effect of inhibition of SHH signaling on BMP-related proliferation of hPASMCs. Our finding that cyclopamine improved BMPR2 knockdown-induced hPASMC dysfunction probably through ID1 but not ID3 may ultimately lead to a new diagnostic or therapeutic target for remodeling in PAH.\u003c/p\u003e \u003cp\u003eApoptosis, proliferation, and senescence of PASMCs are the main causes of pulmonary vascular remodeling \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. The mechanisms via which cyclopamine regulates PASMCs are far from being understood. By generating BMPR2 knockdown hPASMCs, which simulate patients with mutant BMPR2, we found that an impaired BMP pathway could induce apoptosis and proliferation of dysfunctional PASMCs, which has also been documented in previous studies \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. In our research, we found that cyclopamine improved the function of hPASMCs by enhancing apoptosis, which eventually led to proliferation of these cells and vascular thickening. Moreover, we found that changes in the ratio of BAX to BCL-2 may contribute to activation of caspase-3 and modulation of apoptosis during treatment with cyclopamine.\u003c/p\u003e \u003cp\u003eFor the first time, we also found that overexpression of SHH protein led to disordered expression of osteopontin and α-SMA protein, which are either a key mediator of the SMC lineage and senescence or a marker of disease severity in PAH \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Given that osteopontin participates in cell proliferation in multiple tissues, activation/inhibition of osteopontin is a promising therapeutic target \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. In this study, we also showed that the BMP4/BMPR2 signaling pathway mediated SHH-induced upregulation of osteopontin in PASMCs and that inhibition of SHH/Gli signaling by cyclopamine ameliorates BMPR2 deficiency-induced upregulation of osteopontin in vitro.\u003c/p\u003e \u003cp\u003eThis study has several limitations. First, our studies used commercially available hPASMCs that are isolated from main pulmonary artery segments. Confidence in our results could be increased if we performed a larger study and obtained samples of lung tissue from patients with BMPR2 mutation to assess SHH signaling. Second, even though we used different concentrations of cyclopamine based on previous literature, treatment with this agent still cannot fully reduce pulmonary artery pressure to normal levels or reverse the pulmonary arterial remodeling completely. A different type of SHH signaling inhibitor can be used to induce remodeling of PASMCs \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Based on numerous chemical compounds and drug delivery methods in tumor therapy with SHH signaling inhibition\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, our research in the future will focus on multi-drug combination therapy in the treatment of pulmonary remodeling \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Third, in cultured renal fibroblasts, recombinant SHH-N activated Gli1 and induced α-SMA expression\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Wang et al\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003edemonstrated that hPASMCs contain SHH, and they further showed that hypoxia augmented SHH expression and secretion into the culture medium. However, the relationship between SHH and α-SMA in PASMCs is still unknown. In future work, we will try to investigate the interaction between SHH and α-SMA, as well as their role in influencing PAH.\u003c/p\u003e \u003cp\u003eIn conclusion, our data indicate that expression of SHH protein is increased in rats with MCT-induced PAH, resulting in an increase in the number of viable hPASMCs contributing to remodeling of the pulmonary vessels, and that this effect on SHH signaling is via the BMPR2/p-SMAD pathway. We have shown that the SHH signaling inhibitor cyclopamine attenuates MCT-induced changes in RVSP and RV wall thickness in Sprague\u0026ndash;Dawley rats and that it may play a role in preventing BMPR2 mutant-induced apoptosis of hPASMCs by restoration of caspase-3 and the Bax/BCL2 ratio and proliferation of hPASMCs by improvement of osteopontin and α-SMA levels. Furthermore, we provide evidence that targeting the BMPR2-SAMD-ID1 signaling pathway with cyclopamine may provide novel therapies for the prevention of PAH.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAnimal models and hemodynamic measurements\u003c/h2\u003e \u003cp\u003eExperiments were performed using forty-eight adult male Sprague\u0026ndash;Dawley rats (body weight, 200\u0026ndash;220 g). All procedures were approved by the Institutional Committee for Use and Care of Laboratory Animals of Shandong Provincial Hospital (approval number. 2017\u0026thinsp;\u0026minus;\u0026thinsp;111), and complied with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments). All methods were performed in accordance with the relevant guidelines.\u003c/p\u003e \u003cp\u003eThe rats were divided into five groups. The first was a group of control rats that received a single subcutaneous injection of saline (n\u0026thinsp;=\u0026thinsp;8; saline group) and the second was a group of rats that received a single subcutaneous injection of monocrotaline (MCT; 50 mg/kg; Sigma, St Louis, MO, USA) to induce PAH (n\u0026thinsp;=\u0026thinsp;40)\u003csup\u003e40\u003c/sup\u003e. Three weeks later, the rats with induced PAH were randomly and equally divided into four groups for oral treatment with various doses of cyclopamine (2.5, 5, and 10 mg/kg day; Cy2.5, Cy5, and Cy10) or vehicle (an equal volume of saline; MCT group) for a further 21 days.\u003c/p\u003e \u003cp\u003eSix weeks after receiving a single subcutaneous injection, all surviving rats were anaesthetized with intraperitoneal sodium pentobarbital (40 mg/kg) until the end of operations and tests, hemodynamic parameters were measured using a polygraph system (PowerLab 8/30; ADInstruments, Bella Vista, NSW, Australia). After tracheotomy, a polyethylene-50 catheter was inserted into the right ventricle (RV) via the right external jugular vein for assessment of hemodynamic parameters, including heart rate and RVSP. When rats were unable to move, slow to respond and demonstrating symptoms such as diarrhea or urinary incontinence or reached the end of the experimental timeline. They were anesthetized with isoflurane (induction 4% and maintenance 2.5%) and euthanized by cervical dislocation. The death of rats was confirmed by cardiac and respiratory arrest, muscle relaxation and lack of reflex.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMorphometric analysis of pulmonary arteries and right ventricular hypertrophy in rats\u003c/h2\u003e \u003cp\u003eThe lungs were flushed with ice-cold saline via the main pulmonary artery immediately after assessment of hemodynamic parameters. The rats were then euthanized by removal of the heart under deep anaesthesia prior to morphometric analysis. Sections of the tissue from the upper left lung were embedded in paraffin and stained with hematoxylin\u0026ndash;eosin. Arteries with a diameter of 15\u0026ndash;200 mm were evaluated at \u0026times;400 magnification and analyzed using Intel Integrated Performance Primitives version 5.0 software (Santa Clara, CA, USA). The medial wall thickness (%WT) and the medial wall area (%WA) of arterial cross-sections were expressed as previously reported \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThirty randomly selected vessels per rat were measured by investigators who were blinded to the experimental group assignment, and the average values were calculated. The weights of the free wall of the RV and the left ventricle plus septum (LV\u0026thinsp;+\u0026thinsp;S) were measured separately. The RV/(LV\u0026thinsp;+\u0026thinsp;S) ratio was calculated as the RV hypertrophy index.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemical analysis in rats\u003c/h2\u003e \u003cp\u003eImmunohistochemical labelling for a-smooth muscle actin (ProteinTech, Chicago, IL, USA) was used to visualize the medial layer of the vessels. Arteries with an external diameter of 15\u0026ndash;50 mmwere evaluated for muscularization of the pulmonary microvessels. Proliferative cells were assessed in the walls of the distal pulmonary vessels using a monoclonal antibody against proliferating cell nuclear antigen (PCNA) staining (Dako, Carpentaria, CA, USA), The percentages of PCNA- and TUNEL-positive cells were calculated in 10 randomly chosen fields of each section at \u0026times;400 magnification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell cultures\u003c/h2\u003e \u003cp\u003eHuman PASMCs (HUM-iCell-a009, iCell Bioscience Inc, Shanghai, China. The cells were purchased at passage 3.) were grown in smooth muscle growth medium (SmGM, Lonza) and studied at passages 5\u0026ndash;8. Varying concentrations of cyclopamine (11321, Cayman Chemical, Ann Arbor, MI, USA; 2.5, 5, or 10 \u0026micro;M), SHH-N (100\u0026thinsp;\u0026minus;\u0026thinsp;45, PeproTech, Cranbury, NJ, USA; 10 \u0026micro;M), or vehicle was added to the cells, which were then incubated for 48 h. After completion of exposure, the cells were used for proliferation assays and western blot analysis as described below.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and real-time polymerase chain reaction\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using the RNAiso Plus Reagent (9108, Takara Bio, Otsu, Japan). RNA (500 ng) was reverse-transcribed into first-strand complementary DNA using the Primescript RT reagent kit (RR047A, Takara Bio). The optimized reaction was carried out in 10 \u0026micro;L of kit-supplied SYBR PCR Master mix, 0.4 \u0026micro;L of forward primer (10 \u0026micro;M), 0.4 \u0026micro;L of reverse primer (10 \u0026micro;M), 2 \u0026micro;L of complementary DNA, and 7.2 \u0026micro;L of distilled H\u003csub\u003e2\u003c/sub\u003eO, all mixed together to a final volume of 20 \u0026micro;L. Thermal cycling was performed using the Roche LightCycler 480 system (Roche, Basel, Switzerland). Target gene mRNA expression levels were determined using a calibration curve of standards and expressed relative to \u003cem\u003eβ-actin\u003c/em\u003e expression levels.\u003c/p\u003e \u003cp\u003eThe primers of the target genes were designed and synthesized by TianGen Biotech (Beijing, China). The sequences of the primers were as follows: human \u003cem\u003eID1\u003c/em\u003e, forward 5\u0026prime;\u0026ndash;3\u0026prime; (AATCATGAAAGTCGCCAGTG), reverse 3\u0026prime;\u0026ndash;5\u0026prime; (ATGTCGTAGAGCAGCACGTTT); human \u003cem\u003eID3\u003c/em\u003e, forward 5\u0026prime;\u0026ndash;3\u0026prime; (TCATCTCCAACGACAAAAGG), reverse 3\u0026prime;\u0026ndash;5\u0026prime; (ACCAGGTTTAGTCTCCAGGAA); human \u003cem\u003eβ-actin\u003c/em\u003e, forward 5\u0026prime;\u0026ndash;3\u0026prime; (GCACCACACCTTCTACAATGA), reverse 3\u0026prime;-5\u0026prime; (GTCATCTTCTCGCGGTTGGC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eEqual amounts of protein from the cell lysates were loaded into each well and subjected to 12% electrophoresis on sodium dodecyl sulfate polyacrylamide gels and were then transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% skim milk or 1% bovine serum albumin and probed with one of the following monoclonal antibodies: monoclonal rabbit anti-Bax antibody (1:1000, 2774, Cell Signaling, Danvers, MA, USA), monoclonal rabbit anti-Bcl2 antibody (1:1000; 2872, Cell Signaling), anti-BMPR2 (1:1000, 6979, Cell Signaling), monoclonal rabbit anti-SMAD1/5/8 antibody (1:500, ab66737, Abcam, Cambridge, UK), monoclonal rabbit anti-p-SMAD1/5/8 antibody (1:400, 9511, Cell Signaling), polyclonal rabbit anti-SHH antibody (1:1500, 20697-1-AP, Proteintech, Chicago, IL, USA), polyclonal rabbit anti-osteopontin antibody (1:2000, 22952-1-AP, Proteintech), or anti-GAPDH (1:2500, ab9485, Abcam, Cambridge, MA, USA), followed by the matched secondary antibodies (Proteintech). The cells were lysed in a modified radioimmunoprecipitation assay lysis buffer with a protease and phosphatase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO, USA). Protein quantification and western blot analysis were performed according to standard procedures. The quantification of band intensity upon western blot analysis was conducted using NIH Image software (ProteinSimple, Santa Clara, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eLentivirus transfection\u003c/h2\u003e \u003cp\u003ehPASMCs were infected with Lentivirus/GV248-siBMPR2 (hU6‐MCS‐ubiquitin‐EGFP‐IRES‐puromycin) and their corresponding control lentivirus, lentivirus/GV24 (Genechem, Shanghai, China). The virus titer was determined by quantitative real-time polymerase chain reaction (qRT-PCR). Approximately 3.5\u0026ndash;4.5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e hPASMCs per well were seeded in a six‐well plate. After culture for 24 h, the medium was replaced by 1 ml of the infection solution (LV‐GV248, LV‐siBMPR2) per well. Twenty-four hours later, the infection solution was replaced with complete SmGM with puromycin. After 48-h puromycin selection, the hPASMCs were harvested 84 h after infection for observation of cell morphology, protein expression, proliferation, and apoptosis. mRNA and protein expression of BMPR2 were detected by qRT-PCR and western blot. The knockdown efficiencies of BMPR2 protein and mRNA were 52% and 40% respectively in hPASMCs dealing with BMPR2 siRNA. The sequences of the siRNAs used for BMPR2 knockdown are as follows: Sense, 5ʹ-GCAGCAAGCACAAAUCAAATT-3ʹ; Antisense, 5ʹ-UUUGAUUUGUGCUUGCUGCTT-3ʹ. The scramble siRNA (Lv-NC) were used as negative control, and the sequences were as follow: Sense, 5\u0026rsquo;-UUC UCC GAA CGU GUC ACG UTT-3\u0026rsquo;; Antisense, 5\u0026rsquo;-ACG UGA CAC GUU CGG AGA ATT-3\u0026rsquo;. We have added the sequences in the manuscript.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eTUNEL assay\u003c/h2\u003e \u003cp\u003eLate apoptotic cells were assessed using the TdT-mediated dUTP nick end labeling (TUNEL) method (11684795910, Roche Applied Science, Penzberg, Germany). hPASMCs were cultured on cover slips overnight. After exposure to the various treatments, the cells were fixed with 4% paraformaldehyde at 37\u0026deg;C for 30 min. hPASMCs were incubated with 0.3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e methanol solution for 10 min at 37\u0026deg;C. The cells were then treated with 0.1% Triton X-100 at 4\u0026deg;C for 1 min. Next, the cells were incubated in the TUNEL solution at 37\u0026deg;C for 60 min and visualized by fluorescence microscopy (BX51, Olympus, Tokyo, Japan). The number of TUNEL-positive cells among at least 100 cells was calculated from five randomly selected fields at \u0026times;400 magnification by observers who were blinded to the treatments. The counts were expressed as a percentage of the total number of cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation assays\u003c/h2\u003e \u003cp\u003eThe hPASMCs were seeded into 24-well plates at a density of 1.4 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well and attached for 4 h in complete medium. The medium was replaced with 0.4% serum-containing medium for 24 h before BMP4 stimulation. Recombinant human BMP4 (120-05, PeproTech; 10 ng/ml) was added to the medium for 48 h in the presence or absence of cyclopamine.\u003c/p\u003e \u003cp\u003eThe hPASMCs were incubated with 50 \u0026micro;M BrdU (B5002, Sigma-Aldrich) for 1 h. The hPASMCs were fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X-100, denatured with 2 M HCl, neutralized with 0.1 M sodium borate (pH 8.5), and blocked with 5% normal goat serum. The cells were then incubated with an anti-BrdU antibody (1:1000, B2531, Sigma-Aldrich) overnight at 4\u0026deg;C followed by incubation with rhodamine-conjugated secondary antibodies (1:50, ZF0313, ZSGB-BIO, Beijing, China) for 1 h at 37\u0026deg;C. The coverslips were rinsed in water, mounted on a glass slide with antifading mounting medium, and visualized using a fluorescence microscope (BX51, Olympus). The number of BrdU-positive cells among at least 100 cells was calculated from five randomly selected fields at \u0026times;400 magnification. The counts were expressed as a percentage of the total number of cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of caspase-3 activity\u003c/h2\u003e \u003cp\u003eCaspase-3 activity was measured using a Caspase 3 Activity Assay Kit (C1115, Beyotime Institute of Biotechnology, Nanjing, China). In brief, the protein samples were prepared as indicated for western blot analysis. Next, approximately 50 \u0026micro;g of total cell protein was added to the reaction buffer containing Ac-DEVD-pNA (2 mM) and incubated for 2 h at 37\u0026deg;C. The absorbance of yellow pNA cleaved from its corresponding precursors was measured using a spectrometer at 405 nm. The specific caspase-3 activity, normalized for total protein in the cell lysates, was then expressed as the fold change from the baseline caspase activity in the control cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. Comparisons among groups were made using the Student's \u003cem\u003et\u003c/em\u003e-test or analysis of variance. One-way ANOVA was used, followed by LSD(least-significant difference) post-hoc test for pairwise comparison. The statistical analysis was performed using SPSS version 23.0 (IBM Corp., Armonk, NY, USA). A P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eα-SMA, alpha-smooth muscle actin\u003c/p\u003e\n\u003cp\u003eBMP, bone morphogenetic protein\u003c/p\u003e\n\u003cp\u003eBMPR2, bone morphogenetic protein receptor 2\u003c/p\u003e\n\u003cp\u003eCy, cyclopamine\u003c/p\u003e\n\u003cp\u003ehPASMCs, human pulmonary arterial smooth muscle cells\u003c/p\u003e\n\u003cp\u003eMCT, monocrotaline\u003c/p\u003e\n\u003cp\u003ePAH, pulmonary arterial hypertension\u003c/p\u003e\n\u003cp\u003ePCR, polymerase chain reaction\u003c/p\u003e\n\u003cp\u003ePASMCs, pulmonary arterial smooth muscle cells\u003c/p\u003e\n\u003cp\u003eRV,\u0026nbsp;right ventricle\u003c/p\u003e\n\u003cp\u003eRVSP,\u0026nbsp;right ventricular systolic pressure\u003c/p\u003e\n\u003cp\u003eSHH, sonic hedgehog\u003c/p\u003e\n\u003cp\u003eSMCs,\u0026nbsp;smooth muscle cells\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the English text of a draft of this manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYoupeng Jin and Youfei Fan wrote the manuscript, analyzed the data, and conducted most experiments. Fei Mao designed the study and contributed to the writing. Xuehui Wang, Jie Zhang and Yanting Gao performed the animal experiments. Youpeng Jin critically revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data generated in the present study may be requested from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFundings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 81700053), the Natural Science Foundation of Shandong Province (No. ZR2021MH396, ZR2023MH298 and ZR2023MH113), Science Foundation for Young Scholars of Shandong\u0026nbsp;First Medical University (No. 202201-084) and Special Funds for Taishan Scholars Project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cbr\u003eThe author(s) declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eHumbert, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives. \u003cem\u003eEur Respir J\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, doi:10.1183/13993003.01887-2018 (2019).\u003c/li\u003e\n \u003cli\u003eSoon, E.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Bone morphogenetic protein receptor type II deficiency and increased inflammatory cytokine production. A gateway to pulmonary arterial hypertension. \u003cem\u003eAm J Respir Crit Care Med\u003c/em\u003e \u003cstrong\u003e192\u003c/strong\u003e, 859-872, doi:10.1164/rccm.201408-1509OC (2015).\u003c/li\u003e\n \u003cli\u003eGamart, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e SMAD4 target genes are part of a transcriptional network that integrates the response to BMP and SHH signaling during early limb bud patterning. \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e148\u003c/strong\u003e, doi:10.1242/dev.200182 (2021).\u003c/li\u003e\n \u003cli\u003eChowdhury, H. M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e BMPRII deficiency impairs apoptosis via the BMPRII-ALK1-BclX-mediated pathway in pulmonary arterial hypertension. \u003cem\u003eHum Mol Genet\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 2161-2173, doi:10.1093/hmg/ddz047 (2019).\u003c/li\u003e\n \u003cli\u003eOrriols, M., Gomez-Puerto, M. C. \u0026amp; Ten Dijke, P. BMP type II receptor as a therapeutic target in pulmonary arterial hypertension. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 2979-2995, doi:10.1007/s00018-017-2510-4 (2017).\u003c/li\u003e\n \u003cli\u003eIngham, P. W. \u0026amp; McMahon, A. P. Hedgehog signaling in animal development: paradigms and principles. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 3059-3087, doi:10.1101/gad.938601 (2001).\u003c/li\u003e\n \u003cli\u003eSalybekov, A. A., Salybekova, A. K., Pola, R. \u0026amp; Asahara, T. Sonic Hedgehog Signaling Pathway in Endothelial Progenitor Cell Biology for Vascular Medicine. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, doi:10.3390/ijms19103040 (2018).\u003c/li\u003e\n \u003cli\u003eXiang, X.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Metformin regulates macrophage polarization via the Shh signaling pathway to improve pulmonary vascular development in bronchopulmonary dysplasia. \u003cem\u003eIUBMB Life\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 259-271, doi:10.1002/iub.2588 (2022).\u003c/li\u003e\n \u003cli\u003eHenno, P.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e In smokers, Sonic hedgehog modulates pulmonary endothelial function through vascular endothelial growth factor. \u003cem\u003eRespir Res\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 102, doi:10.1186/s12931-017-0590-1 (2017).\u003c/li\u003e\n \u003cli\u003eWang, G.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Activation of the sonic hedgehog signaling controls human pulmonary arterial smooth muscle cell proliferation in response to hypoxia. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1803\u003c/strong\u003e, 1359-1367, doi:10.1016/j.bbamcr.2010.09.002 (2010).\u003c/li\u003e\n \u003cli\u003eHe, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e GLI1-mediated pulmonary artery smooth muscle cell pyroptosis contributes to hypoxia-induced pulmonary hypertension. \u003cem\u003eAm J Physiol Lung Cell Mol Physiol\u003c/em\u003e \u003cstrong\u003e318\u003c/strong\u003e, L472-L482, doi:10.1152/ajplung.00405.2019 (2020).\u003c/li\u003e\n \u003cli\u003ePeng, T.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Hedgehog actively maintains adult lung quiescence and regulates repair and regeneration. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e526\u003c/strong\u003e, 578-582, doi:10.1038/nature14984 (2015).\u003c/li\u003e\n \u003cli\u003eBariwal, J., Kumar, V., Dong, Y. \u0026amp; Mahato, R. I. Design of Hedgehog pathway inhibitors for cancer treatment. \u003cem\u003eMed Res Rev\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 1137-1204, doi:10.1002/med.21555 (2019).\u003c/li\u003e\n \u003cli\u003eDutzmann, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Sonic hedgehog-dependent activation of adventitial fibroblasts promotes neointima formation. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 1653-1663, doi:10.1093/cvr/cvx158 (2017).\u003c/li\u003e\n \u003cli\u003eChen, S. C.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Administration of sonic hedgehog protein induces angiogenesis and has therapeutic effects after stroke in rats. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cstrong\u003e352\u003c/strong\u003e, 285-295, doi:10.1016/j.neuroscience.2017.03.054 (2017).\u003c/li\u003e\n \u003cli\u003eXu, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Hedgehog signaling patterns the oral-aboral axis of the mandibular arch. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, doi:10.7554/eLife.40315 (2019).\u003c/li\u003e\n \u003cli\u003eDeng, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Noggin Overexpression Impairs the Development of Muscles, Tendons, and Aponeurosis in Soft Palates by Disrupting BMP-Smad and Shh-Gli1 Signaling. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 711334, doi:10.3389/fcell.2021.711334 (2021).\u003c/li\u003e\n \u003cli\u003eManzari-Tavakoli, A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The Cross-Talks Among Bone Morphogenetic Protein (BMP) Signaling and Other Prominent Pathways Involved in Neural Differentiation. \u003cem\u003eFront Mol Neurosci\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 827275, doi:10.3389/fnmol.2022.827275 (2022).\u003c/li\u003e\n \u003cli\u003eMeuser, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e FGFR2 signaling enhances the SHH-BMP4 signaling axis in early ureter development. \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e149\u003c/strong\u003e, doi:10.1242/dev.200021 (2022).\u003c/li\u003e\n \u003cli\u003ePratap, A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Cyclopamine attenuates acute warm ischemia reperfusion injury in cholestatic rat liver: hope for marginal livers. \u003cem\u003eMol Pharm\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 958-968, doi:10.1021/mp200115v (2011).\u003c/li\u003e\n \u003cli\u003eBastida, M. F., Sheth, R. \u0026amp; Ros, M. A. A BMP-Shh negative-feedback loop restricts Shh expression during limb development. \u003cem\u003eDevelopment\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, 3779-3789, doi:10.1242/dev.036418 (2009).\u003c/li\u003e\n \u003cli\u003eHautefort, A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Bmpr2 Mutant Rats Develop Pulmonary and Cardiac Characteristics of Pulmonary Arterial Hypertension. \u003cem\u003eCirculation\u003c/em\u003e \u003cstrong\u003e139\u003c/strong\u003e, 932-948, doi:10.1161/CIRCULATIONAHA.118.033744 (2019).\u003c/li\u003e\n \u003cli\u003eApostu, D.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Systemic drugs with impact on osteoarthritis. \u003cem\u003eDrug Metab Rev\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 498-523, doi:10.1080/03602532.2019.1687511 (2019).\u003c/li\u003e\n \u003cli\u003eWang, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Inactivation of Hedgehog signal transduction in adult astrocytes results in region-specific blood-brain barrier defects. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, doi:10.1073/pnas.2017779118 (2021).\u003c/li\u003e\n \u003cli\u003eXu, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Paired box 9 regulates VSMC phenotypic transformation, proliferation, and migration via sonic hedgehog. \u003cem\u003eLife Sci\u003c/em\u003e \u003cstrong\u003e257\u003c/strong\u003e, 118053, doi:10.1016/j.lfs.2020.118053 (2020).\u003c/li\u003e\n \u003cli\u003eDi Luca, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The calcium binding protein S100beta marks hedgehog-responsive resident vascular stem cells within vascular lesions. \u003cem\u003eNPJ Regen Med\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 10, doi:10.1038/s41536-021-00120-8 (2021).\u003c/li\u003e\n \u003cli\u003eLi, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Sonic hedgehog promotes autophagy of vascular smooth muscle cells. \u003cem\u003eAm J Physiol Heart Circ Physiol\u003c/em\u003e \u003cstrong\u003e303\u003c/strong\u003e, H1319-1331, doi:10.1152/ajpheart.00160.2012 (2012).\u003c/li\u003e\n \u003cli\u003ePeddada, S., Yasui, D. H. \u0026amp; LaSalle, J. M. Inhibitors of differentiation (ID1, ID2, ID3 and ID4) genes are neuronal targets of MeCP2 that are elevated in Rett syndrome. \u003cem\u003eHum Mol Genet\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 2003-2014, doi:10.1093/hmg/ddl124 (2006).\u003c/li\u003e\n \u003cli\u003eYang, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Id proteins are critical downstream effectors of BMP signaling in human pulmonary arterial smooth muscle cells. \u003cem\u003eAm J Physiol Lung Cell Mol Physiol\u003c/em\u003e \u003cstrong\u003e305\u003c/strong\u003e, L312-321, doi:10.1152/ajplung.00054.2013 (2013).\u003c/li\u003e\n \u003cli\u003eHung, Y. H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Inhibitor of Differentiation-1 and Hypoxia-Inducible Factor-1 Mediate Sonic Hedgehog Induction by Amyloid Beta-Peptide in Rat Cortical Neurons. \u003cem\u003eMol Neurobiol\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 793-809, doi:10.1007/s12035-014-9046-5 (2016).\u003c/li\u003e\n \u003cli\u003eJin, X.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Inhibition of ID1-BMPR2 Intrinsic Signaling Sensitizes Glioma Stem Cells to Differentiation Therapy. \u003cem\u003eClin Cancer Res\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 383-394, doi:10.1158/1078-0432.CCR-17-1529 (2018).\u003c/li\u003e\n \u003cli\u003eChu, Y. H., Lin, J. D., Nath, S. \u0026amp; Schachtrup, C. Id proteins: emerging roles in CNS disease and targets for modifying neural stemcell behavior. \u003cem\u003eCell Tissue Res\u003c/em\u003e \u003cstrong\u003e387\u003c/strong\u003e, 433-449, doi:10.1007/s00441-021-03490-z (2022).\u003c/li\u003e\n \u003cli\u003eJin, X.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The ID1-CULLIN3 Axis Regulates Intracellular SHH and WNT Signaling in Glioblastoma Stem Cells. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1629-1641, doi:10.1016/j.celrep.2016.06.092 (2016).\u003c/li\u003e\n \u003cli\u003eMura, M., Cecchini, M. J., Joseph, M. \u0026amp; Granton, J. T. Osteopontin lung gene expression is a marker of disease severity in pulmonary arterial hypertension. \u003cem\u003eRespirology\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 1104-1110, doi:10.1111/resp.13557 (2019).\u003c/li\u003e\n \u003cli\u003eWang, A. P.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Pulmonary Artery Smooth Muscle Cell Senescence Promotes the Proliferation of PASMCs by Paracrine IL-6 in Hypoxia-Induced Pulmonary Hypertension. \u003cem\u003eFront Physiol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 656139, doi:10.3389/fphys.2021.656139 (2021).\u003c/li\u003e\n \u003cli\u003eHansmann, G.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e An antiproliferative BMP-2/PPARgamma/apoE axis in human and murine SMCs and its role in pulmonary hypertension. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 1846-1857, doi:10.1172/JCI32503 (2008).\u003c/li\u003e\n \u003cli\u003eWu, W.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e A Noncanonical Hedgehog Signaling Exerts a Tumor-Promoting Effect on Pancreatic Cancer Cells Via Induction of Osteopontin Expression. \u003cem\u003eCancer Biother Radiopharm\u003c/em\u003e, doi:10.1089/cbr.2021.0317 (2021).\u003c/li\u003e\n \u003cli\u003eJeng, K. S., Chang, C. F. \u0026amp; Lin, S. S. Sonic Hedgehog Signaling in Organogenesis, Tumors, and Tumor Microenvironments. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, doi:10.3390/ijms21030758 (2020).\u003c/li\u003e\n \u003cli\u003eDing, H.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Sonic Hedgehog Signaling Mediates Epithelial\u0026ndash;Mesenchymal Communication and Promotes Renal Fibrosis. \u003cem\u003eJournal of the American Society of Nephrology\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 801-813, doi:10.1681/asn.2011060614 (2012).\u003c/li\u003e\n \u003cli\u003eFan, Y. F.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e The phosphodiesterase-5 inhibitor vardenafil reduces oxidative stress while reversing pulmonary arterial hypertension. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 395-403, doi:10.1093/cvr/cvt109 (2013).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"cyclopamine, sonic hedgehog, pulmonary arterial hypertension, bone morphogenetic protein receptor 2, pulmonary arterial remolding","lastPublishedDoi":"10.21203/rs.3.rs-4881852/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4881852/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePulmonary arterial hypertension (PAH) is a severe and progressive disease with hallmarks of pulmonary vascular remodeling and bone morphogenetic protein receptor 2 (BMPR2) mutation. Recent studies indicate Sonic hedgehog (SHH) signaling is involved in the proliferation of human pulmonary arterial smooth muscle cells (hPASMCs) but the role of the SHH signaling inhibitor cyclopamine in monocrotaline (MCT)-induced PAH has not been investigated. We hypothesized SHH promotes pulmonary vascular remodeling and that inhibition of SHH signaling by cyclopamine could attenuate pulmonary hypertension via the bone morphogenetic protein (BMP) pathway.\u003cstrong\u003e \u003c/strong\u003eSHH and BMPR2 proteins were measured in pulmonary arteries isolated from MCT-induced PAH rats and in hPASMCs. The therapeutic effects of cyclopamine were tested in PAH rats and in BMPR2 knockdown hPASMCs. SHH protein levels were increased in PAH rats and exogenous recombinant SHH protein promoted proliferation of hPASMCs via BMPR2 and osteopontin. Furthermore, cyclopamine attenuated hemodynamics and vascular remodeling via the BMP pathway in PAH rats. Finally, cyclopamine enhanced apoptosis and reduced proliferation in hPASMCs with impaired BMPR2. The findings of this study provide evidence that SHH has a role in pulmonary vascular remodeling via BMP4/BMPR2/ID1, and its inhibition by cyclopamine could be a potential therapeutic target in PAH.\u003c/p\u003e","manuscriptTitle":"The sonic hedgehog signaling inhibitor cyclopamine improves pulmona ry arterial hypertension via regulating the bone morphogenetic protein receptor 2 pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-16 10:52:06","doi":"10.21203/rs.3.rs-4881852/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-02-19T16:58:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-02-17T23:36:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"328476274619273882084904422046684169642","date":"2025-02-15T14:25:59+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-12-14T15:23:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"18332706567222699615119509378913854238","date":"2024-12-04T15:43:20+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-08-22T20:45:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-22T20:38:02+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-22T01:36:39+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-19T03:58:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-08T14:42:09+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"15aac29a-6759-4db8-98f1-a4d974e555e0","owner":[],"postedDate":"September 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":36690827,"name":"Biological sciences/Drug discovery"},{"id":36690828,"name":"Biological sciences/Molecular biology"},{"id":36690829,"name":"Health sciences/Diseases"},{"id":36690830,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2025-04-14T16:11:44+00:00","versionOfRecord":{"articleIdentity":"rs-4881852","link":"https://doi.org/10.1038/s41598-025-97627-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-04-11 16:05:54","publishedOnDateReadable":"April 11th, 2025"},"versionCreatedAt":"2024-09-16 10:52:06","video":"","vorDoi":"10.1038/s41598-025-97627-7","vorDoiUrl":"https://doi.org/10.1038/s41598-025-97627-7","workflowStages":[]},"version":"v1","identity":"rs-4881852","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4881852","identity":"rs-4881852","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.