Placental maternal vascular malperfusion affecting late fetuses development and multi-organ infection caused by SARS-CoV-2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Case Report Placental maternal vascular malperfusion affecting late fetuses development and multi-organ infection caused by SARS-CoV-2 Behling, J.A.K., Zanirati, G., Rodrigues, F.V.F., Grahl, M.V.C., and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-88599/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Pregnant women are susceptible to the novel coronavirus (SARS-CoV-2) and the consequences on the fetus are still uncertain. Here, we present a case of a pregnant woman with subclinical hypothyroidism and PAI-1 4G/5G mutation who was infected with SARS-CoV-2 at the end of the third trimester of pregnancy. Methods : nested PCR were performed to detect the virus, followed by ssDNA sequencing. Results : transplacental transmission of SARS-CoV-2 can cause placental inflammation, ischemia and neonatal viremia, with complications such as preterm labor and damage to the placental barrier in patients with PAI-1 4G/5G mutation. Conclusion : we show the possibility of transplacental transmission of SARS-CoV-2 infection during the last weeks of pregnancy. Molecular Biology SARS-CoV-2 transplacental transmission infected organs pathological investigation Figures Figure 1 Figure 2 Introduction In December 2019, several cases of pneumonia emerged in the city of Wuhan, China. It was found that it was due to a new betacoronavirus SARS-CoV-2. In March 2020, the World Health Organization (WHO) declared the disease as a pandemic 1 , 2 . Infection with the SARS-CoV-2 virus causes Coronavirus Disease 2019 (COVID-19), whose main symptoms are fever, fatigue, and cough and may progress to dyspnea or, in more severe cases severe acute respiratory system 3 . Besides, older age and comorbidities, such as diabetes, respiratory disease, hypertension, severe heart disease, or immunosuppression are considered risk factors for worsening outcomes of coronavirus infection. There is evidence that pregnant women are more susceptible to respiratory pathogens including SARS and Middle East Respiratory Syndrome (MERS) which are responsible for severe complications during pregnancy 4 , 5 , 6 . Recently, few reports suggested that pregnant women are also susceptible to SARS-CoV-2 7 , 8 . Also, a report showed that the transplacental transmission of SARS-CoV-2 is possible 9 . Here we present a case of a pregnant woman with to subclinical hypothyroidism and the presence of a PAI-1 4G/5G mutation condition who was infected with SARS-CoV-2 at the end of the third trimester of pregnancy in southeast Brazil and demonstrated a vertical transmission of SARS-CoV-2. The present study discusses the details of fetal multi-organ tissue virological and pathological investigations. Ethical Aspects This study was approved by the Research Ethics Committee of Pontifical Catholic University of Rio Grande do Sul (PUCRS) with approval number 3.977.510. The participant provided written informed consent before inclusion in this study. Case Report A 36-year-old pregnant woman (first pregnancy), presented for prenatal care in a pregnancy service due to subclinical hypothyroidism and the presence of a PAI-1 4G/5G mutation. During all prenatal care there are no maternal and fetal complications. An ultrasound scan at 37 weeks of gestation to access growth and fetal well being showed good evolution. Estimated fetal weight was 2,920 g (40th centile), amniotic fluid index 14.8 cm, normal maternal and fetal Doppler, mean uterine artery PI = 0.51; Umbilical artery with positive diastolic flow and pulsatility index ( PI) = 1.05; middle cerebral artery (MCA) PI = 1.19; normal cerebroplacental ratio (CPR) = 1.13. The biophysical profile is also normal (8/8). At the 39th week of gestation, she presented spontaneous rupture of membranes before labor, meconium amniotic fluid, starting contractions of the active phase afterward. Normal cardiotocography, category 1, reassuring pattern, and clinical examination without abnormalities, normal uterine tone, satisfactory uterine dynamics, 6 cm dilated cervix, cephalic fetus. After 5 hours of adequate evolution labor with epidural analgesia, she was in the expulsive period and was necessary operative vaginal delivery (Simpson forceps) due to a non-reassuring fetal status. Birth of a newborn male, hypotonic, weighting 2,600 g. Apgar scores were 1, 1, and 4 in the 1st, 5th, and 10th minutes, respectively. Referred immediately to the neonatal intensive care unit. Evolved to death after 4 days. The placenta and the organs were sent for autopsy analysis. Considering the extensive placental lesion that severely compromised fetal perfusion understanding that there is no evidence in the literature that the PAI 1 4G/5G mutation could justify such ischemia, taking into account the context of the current pandemic of SARS-COV-2, serology of the patient was performed 10 days after delivery with positive IgG (10.9) by the immunofluorescence method and the paraffin embedded tissue were sent to molecular investigation. Methods RNA extraction and reverse transcription for first-strand DNA synthesis RNA was extracted from paraffin embedding sample of the placenta, lung, liver, heart, kidney, and brain of the fetus using a ReliaPrep™ FFPE Total RNA Miniprep System kit (PROMEGA) according to the manufacturer recommendations. The RNA control was extracted from nasopharyngeal and oropharyngeal (throat) specimens collected by a healthcare professional following the Centers for Disease Control and Prevention (CDC). Reverse-transcriptase first-strand DNA synthesis was performed by the 3’ primer technique using M-MLV reverse transcriptase (THERMO FISHER SCIENTIFIC) with two distinct reverse primers (hCOVassay1 R: 5’AGCAGCATCACCGCCATTG 3’ and hCOVassay2 R: 5’ CCGCCATTGCCAGCCATTC 3’). After the transcription reaction, the product was quantified in a NanoDrop fluorometer. Molecular analysis using qRT-PCR Real-time PCR was performed using StepOne Plus (THERMO FISHER SCIENTIFIC) equipment. The samples were amplified from the initial amount of over to 200 ng of ssDNA for each sample using the PowerUp SYBR Green Master Mix kit (THERMO FISHER SCIENTIFIC). The primers sequences used were hCOVassay1 – F 5’GCCTCTTCTCGTTCCTCATCAC 3’ / R 5’AGCAGCATCACCGCCATTG 3’ and hCOVassay2 – F 5’AGCCTCTTCTCGTTCCTCATCAC 3’ / R 5’CCGCCATTGCCAGCCATTC 3’. Nested PCR technique After the first reaction of RT-PCR, a new amplification was performed using the same primer set as the first PCR. For this new reaction ( Nested PCR), the PCR product generated in the initial amplification was used as a template. The thermal cycles and the optimized times were the same used for the first PCR amplification. ssDNA Sequencing Sequencing of samples was performed by ACTGene Análises Moleculares Ltd. (Center for Biotechnology, UFRGS, Porto Alegre, RS, Brazil) using an AB 3500 Genetic Analyzer (THERMO FISHER SCIENTIFIC). Sequencing data were collected using Data Collection 3 software (THERMO FISHER SCIENTIFIC) and the resulting Data Collection files were converted into FASTA files with standard parameters. Using Clustal omega software, the FASTA files were aligned along with the complete Sars-CoV-2 genome sequences that follows: China (MT079844.1), Italy (MT890669.1), United States (MT642254.1), Russia (MT890462.1), and Brazil (MT827074.1). Results Autopsy and Organs Findings The placenta and umbilical cord weighed 416.0 g and measured 42.0 x 12.0 x 4.0 cm. The placenta shape was discoid, with a firm reddish-colored maternal face, spongy in appearance, and adherent clots. It was also possible to observe diffuse whitish areas. The fetal face was smooth and opaque and showed a membrane with evident vessels. The left lung showed intense and extensive acute bronchopneumonia, with numerous neutrophils and pyocytes filling the alveoli, along with abundant amniotic fluid, fibrin deposits, and bacterial colonies. The interlobular septa showed intense congestion and marked recent hemorrhage, forming a trabecular aspect on macroscopic examination. The right lung showed intense capillary and vascular congestion, with amniotic fluid and meconium in the alveoli. In addition to hyaline membranes covering the walls of several alveoli and bronchioles. Several megakaryocytes were also observed in the capillary of the alveolar septa. The heart did not demonstrate significant changes. The liver showed lobulated hepatocellular parenchyma with intense extracellular (canalicular) and more discrete intracellular cholestasis, with necrosis of the hepatocytes in the lobular center peri-vein, where recent hemorrhage and congestion were also observed. Right adrenal with 5.0 mm necrosis of the cortex, associated with recent peripheral and medullary hemorrhage. Left adrenal with intense congestion and recent hemorrhage in the cortex. Kidneys presented a mature appearance, showing intense congestion and foci of recent hemorrhage, in addition to hyaline cylinders in the tubules and diffuse acute tubular necrosis. Spleen, pancreas, and gallbladder did not show any noticeable alterations (Figure 1). Virology investigation It was possible to detect the presence of SARS-CoV-2 through nested RT-PCR assay in the placenta, liver, heart, lung, and brain samples. Simple RT-PCR assays did not identify the virus in any of the tissues analyzed. The amplification and melt curves are shown in figure 2. The sequencing of the generated amplicons showed a high sequence identity for different strains of SARS-CoV-2. The placenta showed of sequence identity of 100 % with query cover 46 %, the brain demonstrated an identity of 100 % with query cover 45 % and in the heart was possible observed 100 % identity with query cover 40 % it was not possible to analyze the sequencing of the other organs due to low quantity of the material. Discussion Thrombophilia is a hereditary or acquired condition that can lead an individual to an increased risk of venous thromboembolism 10 . Among this, there is a polymorphism in the promoter region of the PAI-1 gene. Most obstetric societies worldwide recommend avoiding plasminogen activator inhibitor-1 (PAI-1) polymorphism testing 10, 11 . The screening of PAI-1 should not be performed since the available studies show no evidence that there could be an influence on adverse outcomes in pregnancy or patient management, since about 50% of the general population presents this condition. 10 . Thus, including PAI-1 in the screening could generate anxiety and adverse effects of unnecessary conducts 11 . However, the current grand discussion is whether COVID infection can influence hereditary thrombophilias, as well as acquired thrombophilias, or even potentiate mutations that under normal conditions would not present significant changes 13,14 .. Although the patient's mutation, as stated earlier, is not a formal indication of prophylaxis for thromboembolism, the use of anticoagulants may be indicated according to medical criteria 13,17 . The interesting thing in the report presented is that the pregnant woman used 40 mg of enoxaparin per day, until the day before she started labor signals, thus performing prophylaxis for the condition in question. It is emphasized that the analysis, both of the placenta and organs of the newborn, had laboratory confirmation of SARS-CoV-2 infection by reliable methods, and all histopathological tests were performed by the same experienced pathologist, blind to the maternal results of SARS-CoV-2. Because it is a pregnancy that evolved to death, we found evidence of the presence of SARS-CoV-2 in several organs analyzed post mortem , as well as in the placenta, thus evidenced by transplacental transmission 14,15,16, . We also do not know whether fetal viremia and the presence of SARS-CoV-2 in tissues may have influenced in some way the response to treatments performed without success 13,14 . Also, other studies have shown that transplacental transmission is indeed possible in the last weeks of pregnancy 12,15 . Overall, there is limited evidence of vertical transmission or significant mortality for pregnant women with COVID-19. However, several adverse perinatal outcomes have been reported, including increased risk of miscarriage, premature rupture of membranes, premature and stillbirth, and preeclampsia 13,14, 16,21 . In this report we highlight the non-weight gain predicted in a critical period of the 37th to 40th weeks where fetal growth is an extremely important factor for the outcome and good fetal evolution, showing complication of restricted intrauterine growth due to alterations in the cord and placental perfusion leading to hypoxia and unfavorable evolution to fetal death. This fact is corroborated by the 37-week ultrasound that presented good evolution so far with an estimated fetal weight of 2,920 g (40th percentile) the birth weight counterpart of 2,600 g at 39 weeks (near 3th percentile). This fact reinforces the hypothesis that placental injury occurred during the last weeks of pregnancy, leading to a placental flow deficiency that culminated in chronic fetal hypoxia and the expected non-weight gain 21 . As the global epidemic continues to expand, there will be additional information available on the effects of COVID-19 on pregnant women and their newborns 17 . In the unfortunate event of mortality resulting from SARS-CoV-2 infection among pregnant or newborn women, pathological evaluation of tissues together with molecular characterization of the virus would be useful in determining the pathogenesis of the disease, as is the case in many cases of emerging infections 12 , 19 . In conclusion, we show the possibility of transplacental transmission of SARS-CoV-2 infection during the last weeks of pregnancy. In addition, transplacental transmission can cause placental inflammation, ischemia and neonatal viremia, with complications such as preterm labor and damage to the placental barrier in patients with the presence of PAI-1 4G / 5G mutation. Finally, further studies are needed to confirm our findings and help guide pregnancy management in women with COVID-19, especially in the last trimester of pregnancy in patients with risk or potential factors such as thrombophilias. Declarations The authors declare no competing interests. References 1. Qian G, Yang N, Ma AHY, et al. COVID-19 Transmission Within a Family Cluster by Presymptomatic Carriers in China. Clinical Infectious Diseases 2020;71:861- 2. Tong ZD, Tang A, Li KF, et al. Potential Presymptomatic Transmission of SARS-CoV-2, Zhejiang Province, China, 2020. Emerging infectious diseases 2020;26:1052-4. 3. Bai Y, Yao L, Wei T, et al. Presumed Asymptomatic Carrier Transmission of COVID-19. Jama 2020;323:1406-7. 4. Wong SF, Chow KM, Leung TN, et al. Pregnancy and perinatal outcomes of women with severe acute respiratory syndrome. American journal of obstetrics and gynecology 2004;191:292-7. 5. Alfaraj SH, Al-Tawfiq JA, Memish ZA. Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infection during pregnancy: Report of two cases & review of the literature. Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi 2019;52:501-3. 6. Schwartz DA, Graham AL. Potential Maternal and Infant Outcomes from (Wuhan) Coronavirus 2019-nCoV Infecting Pregnant Women: Lessons from SARS, MERS, and Other Human Coronavirus Infections. Viruses 2020;12. 7. Liu Y, Chen H, Tang K, Guo Y. Clinical manifestations and outcome of SARS-CoV-2 infection during pregnancy. The Journal of infection 2020. 8. Liu H, Wang LL, Zhao SJ, Kwak-Kim J, Mor G, Liao AH. Why are pregnant women susceptible to COVID-19? An immunological viewpoint. Journal of reproductive immunology 2020;139:103122. 9. Vivanti AJ, Vauloup-Fellous C, Prevot S, et al. Transplacental transmission of SARS-CoV-2 infection. Nature communications 2020;11:3572. 10. Bates SM, Rajasekhar A, Middeldorp S, McLintock C. American Society of Hematology 2018 guidelines for management of venous thromboembolism: venous thromboembolism in the context of pregnancy. 2018;2:3317-59. 11. ACOG Practice Bulletin No. 197: Inherited Thrombophilias in Pregnancy. Obstetrics and gynecology 2018;132:e18-e34. 12. Schwartz DA. An Analysis of 38 Pregnant Women with COVID-19, Their Newborn Infants, and Maternal-Fetal Transmission of SARS-CoV-2: Maternal Coronavirus Infections and Pregnancy Outcomes. Archives of pathology & laboratory medicine 2020. 13. Spyropoulos AC, Levy JH, Ageno W, Connors JM. Scientific and Standardization Committee communication: Clinical guidance on the diagnosis, prevention, and treatment of venous thromboembolism in hospitalized patients with COVID-19. 2020;18:1859-65. 14. Shanes ED, Mithal LB, Otero S, Azad HA, Miller ES, Goldstein JA. Placental Pathology in COVID-19. American journal of clinical pathology 2020;154:23-32. 15. Richtmann R, Torloni MR, Oyamada Otani AR, et al. Fetal deaths in pregnancies with SARS-CoV-2 infection in Brazil: A case series. Case reports in women's health 2020;27:e00243. 16. Verma S, Carter EB. SARS-CoV2 and pregnancy: An invisible enemy? 2020:e13308. 17. Turan O, Hakim A, Dashraath P, Jeslyn WJL, Wright A, Abdul-Kadir R. Clinical characteristics, prognostic factors, and maternal and neonatal outcomes of SARS-CoV-2 infection among hospitalized pregnant women: A systematic review. International journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics 2020. 19. Delorme-Axford E, Sadovsky Y, Coyne CB. The Placenta as a Barrier to Viral Infections. Annual review of virology 2014;1:133-46. 21. Gavriilaki E, Anyfanti P, Gavriilaki M, Lazaridis A, Douma S, Gkaliagkousi E. Endothelial Dysfunction in COVID-19: Lessons Learned from Coronaviruses. Current hypertension reports 2020;22:63. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-88599","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Case Report","associatedPublications":[],"authors":[{"id":3147423,"identity":"4d33cc4b-4857-4b22-9dba-11dbb9bbefad","order_by":0,"name":"Behling, J.A.K.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"J.A.K.","middleName":"","lastName":"Behling","suffix":""},{"id":3147424,"identity":"2a2ef6d4-e6bc-463b-b6b2-823fda7214c5","order_by":1,"name":"Zanirati, G.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"G.","middleName":"","lastName":"Zanirati","suffix":""},{"id":3147425,"identity":"3e4aeeac-f03e-4e28-bde9-ed5ec523eda5","order_by":2,"name":"Rodrigues, F.V.F.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"F.V.F.","middleName":"","lastName":"Rodrigues","suffix":""},{"id":3147426,"identity":"d0873204-f0eb-442a-a9fa-c952e6d1ae4b","order_by":3,"name":"Grahl, M.V.C.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"M.V.C.","middleName":"","lastName":"Grahl","suffix":""},{"id":3147427,"identity":"a1c9067f-631f-48bd-a87c-aad605fac602","order_by":4,"name":"Krimberg, F.D.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"F.D.","middleName":"","lastName":"Krimberg","suffix":""},{"id":3147428,"identity":"1cd46593-6917-4e51-b829-1fa36c2adb64","order_by":5,"name":"Pinzetta, G.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"G.","middleName":"","lastName":"Pinzetta","suffix":""},{"id":3147429,"identity":"7280fcf3-902e-41fb-a5f2-77c4b67b31ee","order_by":6,"name":"Borém, L.V.B.","email":"","orcid":"","institution":"Graduate Program in Health Woman of Medical School of Federal University of Minas Gerais, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"L.V.B.","middleName":"","lastName":"Borém","suffix":""},{"id":3147430,"identity":"d7a6a493-a582-4e20-94cc-e52650e5ddc2","order_by":7,"name":"Savi, D.","email":"","orcid":"","institution":"Virchow Laboratory, Belo Horizonte, Minas Gerais, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"D.","middleName":"","lastName":"Savi","suffix":""},{"id":3147431,"identity":"6b5a6330-2ea5-4be3-93c0-cfe55e0df432","order_by":8,"name":"Machado, D.C.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"D.C.","middleName":"","lastName":"Machado","suffix":""},{"id":3147432,"identity":"9e07f526-24b8-49b2-b4e5-ddaa0b05dfba","order_by":9,"name":"Da Costa, J.C.","email":"","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"J.C.","middleName":"Da","lastName":"Costa","suffix":""},{"id":3147433,"identity":"c2d09372-b480-4239-beaa-265200c14ed3","order_by":10,"name":"Marinowic, D.R.","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYDCCAyBUAGIxNgAJCQZ+qEQCfi0GSFokG4jQwgDRAgUGBwho4Tt+9uCBDwYM0fyzD7c9+NhmIW98u8fwc8UfhjzzBuxaJM/kJRycYcCQO+NcYrvhzDYJw213zhhLnm1jKJY5gF2LwYEcg8M8QC0NZxjbpHm3SSSY3cgxY2xsYEicgcNhBuffGBz+A9QyH6bFeAZQS8MfPFpuAG0Bej93A0yLgQRICxtuLZI33hgc7DGQyN0I1CI585+E4Yw7x4olG9skiiVwhdj5HOMPPypscuedYX8m8eFMnTz/7OaNHxv+2OTh0gIFEhhsAhpwax8Fo2AUjIJRAAQA8qldWFP3OZYAAAAASUVORK5CYII=","orcid":"","institution":"Brain Institute of Rio Grande do Sul (BraIns), Pontifical Catholic University of Rio Grande do Sul, Porto Alegre, Brazil","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"D.R.","middleName":"","lastName":"Marinowic","suffix":""}],"badges":[],"createdAt":"2020-10-06 13:19:14","currentVersionCode":1,"declarations":{"humanSubjects":true,"vertebrateSubjects":false,"conflictsOfInterestStatement":true,"humanSubjectEthicalGuidelines":true,"humanSubjectConsent":true,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":true,"vertebrateSubjectEthicalGuidelines":false,"coiExplicitlySet":false},"doi":"10.21203/rs.3.rs-88599/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-88599/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":2890322,"identity":"e07a9985-0085-4618-982a-b4f021f54642","added_by":"auto","created_at":"2020-10-09 16:55:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2026932,"visible":true,"origin":"","legend":"Histopathology of different tissues of the newborn using hematoxylin and eosin staining. A) Thrombus in a placental blood vessel, in the region of the insertion of the umbilical cord (40X). B) Thrombosis of the placental intervening space (40X). C) Lung with hyaline membranes (400X). D) Characteristic image of acute bronchopneumonia (100X). E) Hepatocellular necrosis in the hepatic centrilobular region (40X) ","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-88599/v1/8b59720a4d296952e4cb98d1.png"},{"id":2890323,"identity":"0462ed0b-111e-49c5-8983-96463e7d9eaf","added_by":"auto","created_at":"2020-10-09 16:55:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1073748,"visible":true,"origin":"","legend":" Real-time PCR amplification, melt curves, and ssDNA sequencing of SARS-CoV-2 from different tissues of the newborn. A) Amplification curve of SARS-CoV-2 in a sample from the placenta, lung, heart, liver, and brain. B) The melt curves showed a similar pattern for all SARS-CoV-2 positive amplifications detected in all tissues analyzed. C) ssDNA sequencing of generated amplicons. The results obtained by sequencing the amplicons showed high homology with SARS-CoV-2 sequences. The homology analysis was performed using the entire genome sequences of copies SARS-CoV-2 virus from Russia (MT890462.1 RUS), United States (MT642254.1 USA), Italy (MT890669.1 ITA), China (MT079844.1 CHN), and Brazil (MT827074.1 BRA).","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-88599/v1/b045efe291100be60110991f.png"},{"id":13601650,"identity":"0b27de7e-4c2c-4ade-81a3-659728f4caac","added_by":"auto","created_at":"2021-09-17 05:48:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2576236,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-88599/v1/fb71aeff-cf3b-4ca4-a93a-2ad745220eaf.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003ePlacental maternal vascular malperfusion affecting late fetuses development and multi-organ infection caused by SARS-CoV-2\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIn December 2019, several cases of pneumonia emerged in the city of Wuhan, China. It was found that it was due to a new betacoronavirus SARS-CoV-2. In March 2020, the World Health Organization (WHO) declared the disease as a pandemic\u003ca href=\"#_ENREF_1\"\u003e\u003csup\u003e1\u003c/sup\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e\u003ca href=\"#_ENREF_2\"\u003e\u003csup\u003e2\u003c/sup\u003e\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003eInfection with the SARS-CoV-2 virus causes Coronavirus Disease 2019 (COVID-19), whose main symptoms are fever, fatigue, and cough and may progress to dyspnea or, in more severe cases severe acute respiratory system\u003ca href=\"#_ENREF_3\"\u003e\u003csup\u003e3\u003c/sup\u003e\u003c/a\u003e. Besides, older age and comorbidities, such as diabetes, respiratory disease, hypertension, severe heart disease, or immunosuppression are considered risk factors for worsening outcomes of coronavirus infection. There is evidence that pregnant women are more susceptible to respiratory pathogens including SARS and Middle East Respiratory Syndrome (MERS) which are responsible for severe complications during pregnancy\u003ca href=\"#_ENREF_4\"\u003e\u003csup\u003e4\u003c/sup\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e\u003ca href=\"#_ENREF_5\"\u003e\u003csup\u003e5\u003c/sup\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e\u003ca href=\"#_ENREF_6\"\u003e\u003csup\u003e6\u003c/sup\u003e\u003c/a\u003e. Recently, few reports suggested that pregnant women are also susceptible to SARS-CoV-2\u003ca href=\"#_ENREF_7\"\u003e\u003csup\u003e7\u003c/sup\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e\u003ca href=\"#_ENREF_8\"\u003e\u003csup\u003e8\u003c/sup\u003e\u003c/a\u003e. Also, a report showed that the transplacental transmission of SARS-CoV-2 is possible\u003ca href=\"#_ENREF_9\"\u003e\u003csup\u003e9\u003c/sup\u003e\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003eHere we present a case of a pregnant woman with to subclinical hypothyroidism and the presence of a PAI-1 4G/5G mutation condition who was infected with SARS-CoV-2 at the end of the third trimester of pregnancy in southeast Brazil and demonstrated a vertical transmission of SARS-CoV-2. The present study discusses the details of fetal multi-organ tissue virological and pathological investigations.\u003c/p\u003e"},{"header":"Ethical Aspects","content":"\u003cp\u003eThis study was approved by the Research Ethics Committee of Pontifical Catholic University of Rio Grande do Sul (PUCRS) with approval number 3.977.510. The participant provided written informed consent before inclusion in this study.\u003c/p\u003e"},{"header":"Case Report","content":"\u003cp\u003eA 36-year-old pregnant woman (first pregnancy), presented for prenatal care in a pregnancy service due to subclinical hypothyroidism and the presence of a PAI-1 4G/5G mutation. During all prenatal care there are no maternal and fetal complications. An ultrasound scan at 37 weeks of gestation to access growth and fetal well being showed good evolution. Estimated fetal weight was 2,920 g (40th centile), amniotic fluid index 14.8 cm, normal maternal and fetal Doppler, mean uterine artery PI = 0.51; Umbilical artery with positive diastolic flow and pulsatility index ( PI) = 1.05; middle cerebral artery (MCA) PI = 1.19; normal cerebroplacental ratio (CPR) = 1.13. The biophysical profile is also normal (8/8).\u003c/p\u003e\n\u003cp\u003eAt the 39th week of gestation, she presented spontaneous rupture of membranes before labor, meconium amniotic fluid, starting contractions of the active phase afterward. Normal cardiotocography, category 1, reassuring pattern, and clinical examination without abnormalities, normal uterine tone, satisfactory uterine dynamics, 6 cm dilated cervix, cephalic fetus. After 5 hours of adequate evolution labor with epidural analgesia, she was in the expulsive period and was necessary operative vaginal delivery (Simpson forceps) due to a non-reassuring fetal status. Birth of a newborn male, hypotonic, weighting 2,600 g. Apgar scores were 1, 1, and 4 in the 1st, 5th, and 10th minutes, respectively. Referred immediately to the neonatal intensive care unit.\u0026nbsp; Evolved to death after 4 days.\u003c/p\u003e\n\u003cp\u003eThe placenta and the organs were sent for autopsy analysis. Considering the extensive placental lesion that severely compromised fetal perfusion understanding that there is no evidence in the literature that the PAI 1 4G/5G mutation could justify such ischemia, taking into account the context of the current pandemic of SARS-COV-2, serology of the patient was performed 10 days after delivery with positive IgG (10.9) by the immunofluorescence method and the paraffin embedded tissue were sent to molecular investigation. \u0026nbsp;\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cu\u003eRNA extraction and reverse transcription for first-strand DNA synthesis\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eRNA was extracted from paraffin embedding sample of the placenta, lung, liver, heart, kidney, and brain of the fetus using a ReliaPrep\u0026trade; FFPE Total RNA Miniprep System kit (PROMEGA) according to the manufacturer recommendations. The RNA control was extracted from nasopharyngeal and oropharyngeal (throat) specimens collected by a healthcare professional following the Centers for Disease Control and Prevention (CDC).\u003c/p\u003e\n\u003cp\u003eReverse-transcriptase first-strand DNA synthesis was performed by the 3\u0026rsquo; primer technique using M-MLV reverse transcriptase (THERMO FISHER SCIENTIFIC) with two distinct reverse primers (hCOVassay1 R: 5\u0026rsquo;AGCAGCATCACCGCCATTG 3\u0026rsquo; and hCOVassay2 R: 5\u0026rsquo; CCGCCATTGCCAGCCATTC 3\u0026rsquo;). After the transcription reaction, the product was quantified in a NanoDrop fluorometer.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eMolecular analysis using qRT-PCR\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eReal-time PCR was performed using StepOne Plus (THERMO FISHER SCIENTIFIC) equipment. The samples were amplified from the initial amount of over to 200 ng of ssDNA for each sample using the PowerUp SYBR Green Master Mix kit (THERMO FISHER SCIENTIFIC). The primers sequences used were hCOVassay1 \u0026ndash; F 5\u0026rsquo;GCCTCTTCTCGTTCCTCATCAC 3\u0026rsquo; / R 5\u0026rsquo;AGCAGCATCACCGCCATTG 3\u0026rsquo; and hCOVassay2 \u0026ndash; F 5\u0026rsquo;AGCCTCTTCTCGTTCCTCATCAC 3\u0026rsquo; / R\u0026nbsp; 5\u0026rsquo;CCGCCATTGCCAGCCATTC 3\u0026rsquo;.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eNested\u003c/u\u003e\u003c/em\u003e\u003cu\u003e PCR technique\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eAfter the first reaction of RT-PCR, a new amplification was performed using the same primer set as the first PCR. For this new reaction (\u003cem\u003eNested\u003c/em\u003e PCR), the PCR product generated in the initial amplification was used as a template. The thermal cycles and the optimized times were the same used for the first PCR amplification.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003essDNA Sequencing\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eSequencing of samples was performed by ACTGene An\u0026aacute;lises Moleculares Ltd. (Center for Biotechnology, UFRGS, Porto Alegre, RS, Brazil) using an AB 3500 Genetic Analyzer (THERMO FISHER SCIENTIFIC). Sequencing data were collected using Data Collection 3 software (THERMO FISHER SCIENTIFIC) and the resulting Data Collection files were converted into FASTA files with standard parameters. Using Clustal omega software, the FASTA files were aligned along with the complete Sars-CoV-2 genome sequences that follows: China (MT079844.1), Italy (MT890669.1), United States (MT642254.1), Russia (MT890462.1), and Brazil (MT827074.1).\u003c/p\u003e\n"},{"header":"Results","content":"\n\u003cp\u003e\u003cu\u003eAutopsy and Organs Findings\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eThe placenta and umbilical cord weighed 416.0 g and measured 42.0 x 12.0 x 4.0 cm. The placenta shape was discoid, with a firm reddish-colored maternal face, spongy in appearance, and adherent clots. It was also possible to observe diffuse whitish areas. The fetal face was smooth and opaque and showed a membrane with evident vessels.\u003c/p\u003e\n\u003cp\u003eThe left lung showed intense and extensive acute bronchopneumonia, with numerous neutrophils and pyocytes filling the alveoli, along with abundant amniotic fluid, fibrin deposits, and bacterial colonies. The interlobular septa showed intense congestion and marked recent hemorrhage, forming a trabecular aspect on macroscopic examination. The right lung showed intense capillary and vascular congestion, with amniotic fluid and meconium in the alveoli.\u0026nbsp; In addition to hyaline membranes covering the walls of several alveoli and bronchioles. Several megakaryocytes were also observed in the capillary of the alveolar septa.\u003c/p\u003e\n\u003cp\u003eThe heart did not demonstrate significant changes. The liver showed lobulated hepatocellular parenchyma with intense extracellular (canalicular) and more discrete intracellular cholestasis, with necrosis of the hepatocytes in the lobular center peri-vein, where recent hemorrhage and congestion were also observed. Right adrenal with 5.0 mm necrosis of the cortex, associated with recent peripheral and medullary hemorrhage. Left adrenal with intense congestion and recent hemorrhage in the cortex. Kidneys presented a mature appearance, showing intense congestion and foci of recent hemorrhage, in addition to hyaline cylinders in the tubules and diffuse acute tubular necrosis. Spleen, pancreas, and gallbladder did not show any noticeable alterations (Figure 1).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eVirology investigation\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eIt was possible to detect the presence of SARS-CoV-2 through \u003cem\u003enested \u003c/em\u003eRT-PCR assay in the placenta, liver, heart, lung, and brain samples. Simple RT-PCR assays did not identify the virus in any of the tissues analyzed. The amplification and melt curves are shown in figure 2. The sequencing of the generated amplicons showed a high sequence identity for different strains of SARS-CoV-2. The placenta showed of sequence identity of 100 % with query cover 46 %, the brain demonstrated an identity of 100 % with query cover 45 % and in the heart was possible observed 100 % identity with query cover 40 % it was not possible to analyze the sequencing of the other organs due to low quantity of the material.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThrombophilia is a hereditary or acquired condition that can lead an individual to an increased risk of venous thromboembolism\u003ca href=\"#_ENREF_10\"\u003e\u003csup\u003e10\u003c/sup\u003e\u003c/a\u003e. Among this, there is a polymorphism in the promoter region of the PAI-1 gene. Most obstetric societies worldwide recommend avoiding plasminogen activator inhibitor-1 (PAI-1) polymorphism testing\u003ca href=\"#_ENREF_10\"\u003e\u003csup\u003e10,\u003c/sup\u003e\u003c/a\u003e\u003ca href=\"#_ENREF_11\"\u003e\u003csup\u003e11\u003c/sup\u003e\u003c/a\u003e. The screening of PAI-1 should not be performed since the available studies show no evidence that there could be an influence on adverse outcomes in pregnancy or patient management, since about 50% of the general population presents this condition.\u003ca href=\"#_ENREF_10\"\u003e\u003csup\u003e10\u003c/sup\u003e\u003c/a\u003e. Thus, including PAI-1 in the screening could generate anxiety and adverse effects of unnecessary conducts \u003ca href=\"#_ENREF_11\"\u003e\u003csup\u003e11\u003c/sup\u003e\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003eHowever, the current grand discussion is whether COVID infection can influence hereditary thrombophilias, as well as acquired thrombophilias, or even potentiate mutations that under normal conditions would not present significant changes\u003csup\u003e13,14\u003c/sup\u003e.. Although the patient's mutation, as stated earlier, is not a formal indication of prophylaxis for thromboembolism, the use of anticoagulants may be indicated according to medical criteria\u003ca href=\"#_ENREF_13\"\u003e\u003csup\u003e13,17\u003c/sup\u003e\u003c/a\u003e. The interesting thing in the report presented is that the pregnant woman used 40 mg of enoxaparin per day, until the day before she started labor signals, thus performing prophylaxis for the condition in question. It is emphasized that the analysis, both of the placenta and organs of the newborn, had laboratory confirmation of SARS-CoV-2 infection by reliable methods, and all histopathological tests were performed by the same experienced pathologist, blind to the maternal results of SARS-CoV-2. Because it is a pregnancy that evolved to death, we found evidence of the presence of SARS-CoV-2 in several organs analyzed \u003cem\u003epost mortem\u003c/em\u003e, as well as in the placenta, thus evidenced by transplacental transmission\u003csup\u003e14,15,16,\u003c/sup\u003e. We also do not know whether fetal viremia and the presence of SARS-CoV-2 in tissues may have influenced in some way the response to treatments performed without success\u003csup\u003e13,14\u003c/sup\u003e. Also, other studies have shown that transplacental transmission is indeed possible in the last weeks of pregnancy\u003csup\u003e12,15\u003c/sup\u003e. Overall, there is limited evidence of vertical transmission or significant mortality for pregnant women with COVID-19. However, several adverse perinatal outcomes have been reported, including increased risk of miscarriage, premature rupture of membranes, premature and stillbirth, and preeclampsia\u003csup\u003e13,14,\u003c/sup\u003e\u003ca href=\"#_ENREF_16\"\u003e\u003csup\u003e16,21\u003c/sup\u003e\u003c/a\u003e. In this report we highlight the non-weight gain predicted in a critical period of the 37th to 40th weeks where fetal growth is an extremely important factor for the outcome and good fetal evolution, showing complication of restricted intrauterine growth due to alterations in the cord and placental perfusion leading to hypoxia and unfavorable evolution to fetal death. This fact is corroborated by the 37-week ultrasound that presented good evolution so far with an estimated fetal weight of 2,920 g (40th percentile) the birth weight counterpart of 2,600 g at 39 weeks (near 3th percentile). This fact reinforces the hypothesis that placental injury occurred during the last weeks of pregnancy, leading to a placental flow deficiency that culminated in chronic fetal hypoxia and the expected non-weight gain\u003ca href=\"#_ENREF_12\"\u003e\u003csup\u003e21\u003c/sup\u003e\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003eAs the global epidemic continues to expand, there will be additional information available on the effects of COVID-19 on pregnant women and their newborns\u003ca href=\"#_ENREF_17\"\u003e\u003csup\u003e17\u003c/sup\u003e\u003c/a\u003e. In the unfortunate event of mortality resulting from SARS-CoV-2 infection among pregnant or newborn women, pathological evaluation of tissues together with molecular characterization of the virus would be useful in determining the pathogenesis of the disease, as is the case in many cases of emerging infections\u003ca href=\"#_ENREF_12\"\u003e\u003csup\u003e12\u003c/sup\u003e\u003c/a\u003e\u003csup\u003e,\u003c/sup\u003e\u003ca href=\"#_ENREF_19\"\u003e\u003csup\u003e19\u003c/sup\u003e\u003c/a\u003e.\u003c/p\u003e\n\u003cp\u003eIn conclusion, we show the possibility of transplacental transmission of SARS-CoV-2 infection during the last weeks of pregnancy. In addition, transplacental transmission can cause placental inflammation, ischemia and neonatal viremia, with complications such as preterm labor and damage to the placental barrier in patients with the presence of PAI-1 4G / 5G mutation. Finally, further studies are needed to confirm our findings and help guide pregnancy management in women with COVID-19, especially in the last trimester of pregnancy in patients with risk or potential factors such as thrombophilias.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e1. Qian G, Yang N, Ma AHY, et al. COVID-19 Transmission Within a Family Cluster by Presymptomatic Carriers in China. Clinical Infectious Diseases 2020;71:861-\u003cbr /\u003e2. Tong ZD, Tang A, Li KF, et al. Potential Presymptomatic Transmission of SARS-CoV-2, Zhejiang Province, China, 2020. Emerging infectious diseases 2020;26:1052-4.\u003cbr /\u003e3. Bai Y, Yao L, Wei T, et al. Presumed Asymptomatic Carrier Transmission of COVID-19. Jama 2020;323:1406-7.\u003cbr /\u003e4. Wong SF, Chow KM, Leung TN, et al. Pregnancy and perinatal outcomes of women with severe acute respiratory syndrome. American journal of obstetrics and gynecology 2004;191:292-7.\u003cbr /\u003e5. Alfaraj SH, Al-Tawfiq JA, Memish ZA. Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infection during pregnancy: Report of two cases \u0026amp; review of the literature. Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi 2019;52:501-3.\u003cbr /\u003e6. Schwartz DA, Graham AL. Potential Maternal and Infant Outcomes from (Wuhan) Coronavirus 2019-nCoV Infecting Pregnant Women: Lessons from SARS, MERS, and Other Human Coronavirus Infections. Viruses 2020;12.\u003cbr /\u003e7. Liu Y, Chen H, Tang K, Guo Y. Clinical manifestations and outcome of SARS-CoV-2 infection during pregnancy. The Journal of infection 2020.\u003cbr /\u003e8. Liu H, Wang LL, Zhao SJ, Kwak-Kim J, Mor G, Liao AH. Why are pregnant women susceptible to COVID-19? An immunological viewpoint. Journal of reproductive immunology 2020;139:103122.\u003cbr /\u003e9. Vivanti AJ, Vauloup-Fellous C, Prevot S, et al. Transplacental transmission of SARS-CoV-2 infection. Nature communications 2020;11:3572.\u003cbr /\u003e10. Bates SM, Rajasekhar A, Middeldorp S, McLintock C. American Society of Hematology 2018 guidelines for management of venous thromboembolism: venous thromboembolism in the context of pregnancy. 2018;2:3317-59.\u003cbr /\u003e11. ACOG Practice Bulletin No. 197: Inherited Thrombophilias in Pregnancy. Obstetrics and gynecology 2018;132:e18-e34.\u003cbr /\u003e12. Schwartz DA. An Analysis of 38 Pregnant Women with COVID-19, Their Newborn Infants, and Maternal-Fetal Transmission of SARS-CoV-2: Maternal Coronavirus Infections and Pregnancy Outcomes. Archives of pathology \u0026amp; laboratory medicine 2020.\u003cbr /\u003e13. Spyropoulos AC, Levy JH, Ageno W, Connors JM. Scientific and Standardization Committee communication: Clinical guidance on the diagnosis, prevention, and treatment of venous thromboembolism in hospitalized patients with COVID-19. 2020;18:1859-65.\u003cbr /\u003e14. Shanes ED, Mithal LB, Otero S, Azad HA, Miller ES, Goldstein JA. Placental Pathology in COVID-19. American journal of clinical pathology 2020;154:23-32.\u003cbr /\u003e15. Richtmann R, Torloni MR, Oyamada Otani AR, et al. Fetal deaths in pregnancies with SARS-CoV-2 infection in Brazil: A case series. Case reports in women's health 2020;27:e00243.\u003cbr /\u003e16. Verma S, Carter EB. SARS-CoV2 and pregnancy: An invisible enemy? 2020:e13308.\u003cbr /\u003e17. Turan O, Hakim A, Dashraath P, Jeslyn WJL, Wright A, Abdul-Kadir R. Clinical characteristics, prognostic factors, and maternal and neonatal outcomes of SARS-CoV-2 infection among hospitalized pregnant women: A systematic review. International journal of gynaecology and obstetrics: the official organ of the International Federation of Gynaecology and Obstetrics 2020.\u003cbr /\u003e19. Delorme-Axford E, Sadovsky Y, Coyne CB. The Placenta as a Barrier to Viral Infections. Annual review of virology 2014;1:133-46.\u003cbr /\u003e21. Gavriilaki E, Anyfanti P, Gavriilaki M, Lazaridis A, Douma S, Gkaliagkousi E. Endothelial Dysfunction in COVID-19: Lessons Learned from Coronaviruses. Current hypertension reports 2020;22:63.\u003c/p\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SARS-CoV-2, transplacental transmission, infected organs, pathological investigation","lastPublishedDoi":"10.21203/rs.3.rs-88599/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-88599/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Pregnant women are susceptible to the novel coronavirus (SARS-CoV-2) and the consequences on the fetus are still uncertain. Here, we present a case of a pregnant woman with subclinical hypothyroidism and PAI-1 4G/5G mutation who was infected with SARS-CoV-2 at the end of the third trimester of pregnancy. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: nested PCR were performed to detect the virus, followed by ssDNA sequencing. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: transplacental transmission of SARS-CoV-2 can cause placental inflammation, ischemia and neonatal viremia, with complications such as preterm labor and damage to the placental barrier in patients with PAI-1 4G/5G mutation. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: we show the possibility of transplacental transmission of SARS-CoV-2 infection during the last weeks of pregnancy.\u003c/p\u003e","manuscriptTitle":"Placental maternal vascular malperfusion affecting late fetuses development and multi-organ infection caused by SARS-CoV-2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-10-09 16:55:20","doi":"10.21203/rs.3.rs-88599/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"702921ac-5d1f-41a7-af33-fc009ec1145e","owner":[],"postedDate":"October 9th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":704327,"name":"Molecular Biology"}],"tags":[],"updatedAt":"2020-10-09T16:55:20+00:00","versionOfRecord":[],"versionCreatedAt":"2020-10-09 16:55:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-88599","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-88599","identity":"rs-88599","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.