HIF-1α/Bnip3/VEGF axis regulates autophagy to mitigate intervertebral disc degeneration induced by inflammatory factor TNF-α | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article HIF-1α/Bnip3/VEGF axis regulates autophagy to mitigate intervertebral disc degeneration induced by inflammatory factor TNF-α Xiaoxian Sun, Xue bai, Zitong Zhao, Lining Wang, Mengmin Liu, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4356277/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Intervertebral disc degeneration (IDD) is one of the main factors leading to low back pain. However, its potential pathogenesis targets are poorly understood. Therefore, the potential pathogenesis of IDD must be further explored to identify more appropriate treatment angles. Objective To investigate the effects of the hypoxia-inducing factor-1α (HIF-1α)/BCL-2 interacting protein 3 (Bnip3)/vascular endothelial growth factor (VEGF) signaling axis on IDD induced by the inflammatory factor tumor necrosis factor-alpha (TNF-α) and determine whether IDD progression can be delayed by regulating nucleus pulposus cell (NPC) autophagy. Experimental methods: Differences in TNF-α, VEGF, and HIF-1α expression between IDD model rats and normal rats were observed, and the effects of the HIF-1α inhibitor YC-1 on TNF-α and VEGF expression, HIF-1α/Bnip3 axis autophagy-related molecule levels, and IDD progression were verified in vivo. Finally, the effects of HIF-1α knockdown on HIF-1α and VEGF expression in TNF-α-induced NPCs, HIF-1α/Bnip3/VEGF signaling axis autophagy-related molecule levels, and IDD progression were explored in vitro. Results In vivo experimental results revealed obvious degeneration and significantly higher TNF-α, HIF-1α, and VEGF expression in the model group compared with the normal group. The YC-1 intervention downregulated TNF-α and VEGF in IDD, as verified by qPCR, WB, and immunofluorescence assays. In addition, YC-1 intrusion decreased autophagy flux in intervertebral discs (IVDs), as indicated by the decreased number of autophagosomes and lysosomes under transmission electron microscopy and decreased levels of HIF-1α/Bnip3 axis autophagy-associated molecules in immunohistochemical, WB, qPCR, and immunofluorescence assays. In addition, the YC-1 intervention led to a further decrease in the signal intensity of the intervertebral disc under T2-weighted magnetic resonance imaging (MRI) and an increase in the Pfirrmann score compared with the model group. Hematoxylin and eosin (HE), Masson’s, and safranin O-fast green staining also showed that in the YC-1 group, coagulation and shrinkage of the nucleus pulposus were more obvious, annulus fibrosus was more serious, loss of proteoglycan and collagen was increased, and IDD was further intensified compared with that in the model and dimethyl sulfoxide (DMSO) groups. In vitro experiments showed that the LV-HIF-1α intervention decreased HIF-1α and VEGF expression and autophagy-related molecule levels in the HIF-1α/Bnip3 axis of TNF-α-induced NPCs, as reflected in a decrease in the number of autophagosomes and lysosomes in the Lv-HIF-1α transfection group compared with the Lv-NC-H group. HIF-1α/Bnip3 axis-related mRNA and protein expression was downregulated, type II collagen and proteoglycan were significantly downregulated, and matrix catabolic markers matrix metalloproteinase 13 (MMP13) and A disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS-5) were significantly downregulated, indicating that IDD progression in NPCs was accelerated after HIF-1α knockdown. Conclusion In IDD, inflammatory factor TNF-α may activate autophagy by regulating the HIF-1α/Bnip3/VEGF signaling axis, which promotes NPC death, thereby protecting IVDs and delaying further IDD. However, intervention with HIF-1α blockers reduced autophagy and VEGF expression, which further aggravated IDD progression, thus supporting our hypothesis. These findings provide insights for developing targeted IDD therapies. Intervertebral disc degeneration Nucleus pulposus cells HIF-1α/Bnip3/VEGF axis autophagy TNF-α Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Intervertebral disc degeneration (IDD) is one of the main factors that leading to low back pain, with 11–12% of patients in disc degenerative disease experiencing low back pain disability, which is the main cause of productivity loss in the world and causes a serious economic burden to patients, families, and society ( 1 ).The pathogenesis of IDD mainly involves aging, mechanical damage, inflammatory mediators, and genetic factors ( 2 – 5 ). However, a large gap remains in the study of these pathogenesis targets. Therefore, an increasing number of researchers have begun to further explore the potential pathogenesis of IDD to identify new treatment angles for IDD ( 6 – 9 ). One of the characteristics of IDD is the upregulation of inflammatory mediators (such as IL-6, IL-8, IL-1β, and TNF-α). These mediators play a role in the progression and initiation of IDD by regulating inflammatory response, nucleus pulposus metabolism, autophagy, and cell matrix destruction( 10 – 13 ).Previous studies from our research group have confirmed that inflammatory mediators in IDD are significantly upregulated in IDD compared to the normal group, as previously reported. We also observed that hypoxia-inducing factor (HIF-1α) and vascular endothelial factor (VEGF) were significantly upregulated( 14 ). Ha ( 15 ) found that HIF-1α was highly expressed in IDD group. However, the mechanism underlying the increase in HIF-1α expression was not clarified. Studies have shown that TNF-α can promote the DNA activity of HIF-1α under normal oxygen conditions leading to enhanced translation, transcription, and expression( 16 ). HIF-1α is a major transcription factor in the hypoxic response and can activate the transcription of the gene encoding BCL-2 interacting protein 3 (Bnip3), thereby inducing mitochondrial selective autophagy( 17 , 18 ).In the context of inflammatory stimulation, oxidative stress, and hypoxia, the activation of autophagy during early IDD has a certain protective effect and becomes an adaptive pathway that promotes cell health and survival ( 19 ).In addition, high VEGF expression during IDD promotes the generation of new biochemical blood vessels in the intervertebral disc (IVD), and studies have demonstrated that angiogenesis plays a bidirectional regulatory role in the progression of IDD to maintain the biological functions of the surrounding environment and cells( 20 , 21 ). However, the roles of the HIF-1α/Bnip3 axis in promoting autophagy and VEGF in promoting neovascularization in the progression of IDD remain unclear. In this study, the differences in TNF-α, HIF-1α, and VEGF expression between IDD rats and normal rats were observed in vivo, and the effects of inhibiting HIF-1α expression on TNF-α and VEGF expression in IDD rats were further verified. Then, the effects of inhibiting HIF-1α expression on HIF-1α/Bnip3/VEGF signal axis autophagy levels and IDD progression in IDD rats were investigated. Finally, the effects of HIF-1α knockdown on VEGF expression in TNF-α-induced nucleus pulposus cells (NPCs), HIF-1α/Bnip3/VEGF signaling axis autophagy levels, and IDD progression were verified in vitro to explore whether this signaling axis is involved in IDD progression via autophagy regulation. Experimental materials and methods Experimental materials Establishment of IDD animal models All animal experiments were performed in accordance with the Guiding Principles of the Care and Use of Animals and approved by the Animal Experimental Ethics Committee of Nanjing University of Chinese Medicine. Male SD rats (250 ± 20 g, n = 60) were purchased from Beijing Weitonglihua Experimental Animal Technology Co., The rats were randomly divided into the sham operation (Sham), model (M), HIF-1α inhibitor (YC-1), and solvent groups (DMSO), with 15 participants each in the Sham and M groups and 10 participants each in the YC-1 and DMSO groups. After 1 week of adaptive feeding, the modeling intervention began, with fibro annular puncture used to prepare the disc degeneration model( 22 ). On the day after the modeling, two rats from each group were randomly selected for magnetic resonance imaging (MRI)examination, and the signal intensity of the annulus fibrosus and nucleus pulposus was observed under T2-weighted MRI. The success of annulus fibrosus puncture was determined by the blurred boundary of annulus fibrosus and the decreased signal intensity of nucleus pulposus. The intervention began 3 days after the modeling was finished. The Sham and M groups were intraperitoneally injected with normal saline (0.1ml/100g), the YC-1 group was intraperitoneally injected with 5%DMSO + 40%PEG300 + 5%Tween80 + 50%saline (YC-1,1mg/kg;0.1ml/100g), and the solvent DMSO group was injected with 5%DMSO + 40%PEG300 + 5%Tween80 + 50%saline; (0.1ml/100g) three times a week for a total of 8 weeks. Extraction and intervention of NPCs Extraction and culture of NPCs Male SD rats (220 ± 20g, n = 10) were sacrificed for cervical dislocation, and disinfected in 75% ethanol for 10 min. The whole spine was separated from the back under aseptic conditions, and the nucleus pulposum tissue from L 1 -L 5 was separated under a microscope and cut into fragments of approximately 1mm 3 . The tissue was digested with 0.2% type II collagenase (Gibco, USA) at 37°C for 8 h, screened with 200 mesh and centrifuged for cell precipitation. The cells were then cultured in DMEM/F12 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin and streptomycin dual antibody (NCM, China) under the standard incubation conditions (37°C, 5% CO 2 ) ( 23 ). Passage was performed when the cells reached 80–90% confluence, and cells from within three generations were used for all in vitro experiments. NPCs in vitro intervention and grouping For the in vitro experiments, NPCs were divided into the Lv-NC-H group (NC-H group) and Lv-HIF-1α transfection group (H group). After transfection with the corresponding lentivirus, TNF-α (300-01A, Peprotech, USA) (10ng/ml) ( 24 )was then induced under standard incubation conditions (37°C, 5%CO2) for 24h. Lentivirus transfection Corues Biotechnology (Nanjing, Nanjing, China) designed and constructed a lentiviral vector expressing GFP labeled HIF-1α (NM_024359) in the PLv3LLTr-ECMV-ZSGRECn-PGK-Puro-U6 plasmid according to the standard protocol. For viral transduction, NPCs were inoculated and lentivirus infection was achieved after reaching 40–60% confluence with a multiplicity of infection (MOI) of 50. After transfection for 24 h, the culture medium was changed every other day. When the transfected NPCs reached 80–90% confluence, they were used in further experiments to detect the knockdown efficiency and expression level of the HIF-1α gene by immunofluorescence and qPCR. Experimental method MRI On the day after modeling, two rats in each group were randomly selected for MRI examination. At 8 weeks after the intervention, Four rats from each group were randomly selected for MRI examination. The changes and degeneration of IVD signal intensity were observed using T2-weighted MRI, and Pfirrmann grading was performed under the guidance of professional physicians. Pathological staining HE staining Three rats were randomly selected from each group, After administering anesthesia, L 5 -L 6 IVD tissues were taken from marked locations, f fixed in 4% paraformaldehyde, decalcified, and embedded in paraffin. Subsequently, 4µm paraffin sections were produced from the embedded tissues, These sections were dewaxed, dehydrated with hematoxylin-eosin staining solution, and sealed, and the disc histopathological changes were observed under an optical microscope at 50× and 400× magnification. Masson’s staining Paraffin sections were dewaxed in water, immersed in Masson’s stain, differentiated with 1% hydrochloric acid alcohol, rinsed and differentiated with 1% acetic acid, dehydrated with anhydrous ethanol, and examined under a microscope (50×, 400×) after transparent sealing. Images were then collected and analyzed. Safranin O-fast green staining Paraffin sections were dewaxed into water, immersed in solid green dye for approximately 10 min, differentiated and rinsed until colorless, and then placed in safranine O dye for 30 seconds for staining. Finally, the sections underwent conventional dehydration and were made transparent before being sealed with neutral gum. Photographs were taken with an optical microscope (50×, 400×) and used for analysis. Immunohistochemistry IVD tissue from rats in each group were collected, and paraffin-embedded sections were prepared, and dehydrated, Endogenous catalase was blocked using 3% hydrogen peroxide, and the sections were then closed with 3% BSA at room temperature for 1 hour, Rabbit antirat primary antibodies (HIF-1α, 1:200, GB114936, Servicebio; Bnip3, 1:1000, GB111204, Servicebio; Beclin-1, 1:200, GB11228, Servicebio) were incubated overnight at 4℃. After washing with PBS, HRP was added to label goat anti-rabbit secondary antibody (Servicebio, 1:200, GB23303), and DAB was used for color development. Restaining was then performed with hematoxylin, Hydrochloric acid ethanol differentiation was performed, and the sections were then dehydrated and sealed. The expression of HIF-1α, Bnip3 and Beclin-1 positive cells in the IVD tissue sections was observed under the microscope. The hematoxylin-stained nuclei were blue, and the positive expression of DAB was brown-yellow. Three fields (400×) were randomly selected in each section under the microscope and the percentage of positive cells was counted using ImageJ. ELISA The rats were anesthetized with isoflurane, blood was collected through the abdominal aorta, and serum was then separated by centrifugation at 4℃ and 3500r·min − 1 for 15min. The expression levels of serum TNF-α and VEGF in rats were detected using the ELISA kit (AF-01587R1; AF-10645R1, Aifang Biotechnology Co., Hunan, China) was used to detect the expression levels of serum TNF-α and VEGF in rats. NPCs cells were cultured in 6-well plates and transfected with Lv-shHIF1α. They were then induced with TNF-α (10ng/ml) and divided into the NC-H group and H group. After 24 hours, the supernatant of the cell culture was extracted to detect the expression level of VEGF in NPCs. 2.5 Transmission electron microscopy The L 4 -L 5 IVDs were removed from three rats, and the nucleus pulposus was removed, cut into approximately 1mm 3 pieces and placed in glutaraldehyde at a temperature of 4℃ and fixed for a duration of 2 h. Then, the pieces were washed with phosphate buffer, fixed again using a solution containing 3% glutaraldehyde and 1% osmic acid for a period of 5 h, and embedded in epoxy resin. The embedded tissue was sliced into ultra-thin sections measuring 50nm and then stained with 2% uranium acetate and 0.2% lead citrate. Finally, transmission electron microscopy at a magnification of 10000× was employed to analyze the resulting images. NPCs cells were cultured in 6-well plates for the cell samples, transfected with Lv-shHIF-1α and induced with TNF-α (10ng/ml). The cells were divided into the NC-H group and H group. After 24 h, the cells were extracted and precipitated using the same procedure as before. 2.6 Western blot The total protein of NPCs and tissues was extracted with RIPA lysate and quantified according to the instructions of the BCA kit (NCM, Nanjing, China). SDS-PAGE sample loading buffer was added and heated for 10 min. Protein samples were subjected to SDS-P AGE electrophoresis, transferred to a PVDF membrane, and blocked with 5% milk powder at room temperature for 2 h. The PVDF membrane was then incubated with the following primary antibodies(VEGF,1:1000,Abcam; HIF1α,1:1000,Abcam; P62,1:1000,Abcam; LC3-II,1:2000,Abcam; Bnip3,1:1000,CST; Beclin-1,1:1000,CST; beta-actin,1:5000, Proteintech); Then the membrane was incubated with an enzyme-labeled goat anti-rabbit secondary antibody( goat anti-rabbit, 1:10000, Abcam, ab205718) at room temperature for 2 h. Finally, the PVDF membranes were incubated with an ECL chemiluminescence solution (Yeasen, Shanghai, China), and the protein bands were detected using a gel imaging system (Tanon, Shanghai, China). Grayscale values were measured using ImageJ software. RT-qPCR Total RNA was isolated from NPCs and IVD tissues using a Fast Pure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China).The isolated RNA was then reverse-transcribed into cDNA using a HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China).RT-qPCR was performed using Ace Q Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China).A PCR automatic serialization analyzer (ABI Quant Studio 3, USA) was set to pre-denaturation at 95℃ for 10 min, pre-denaturation at 95℃ for 15 s, annealing at 60℃ for 60 s, and extension for 40 cycles. Ct values of each target gene were obtained with GAPDH as the internal reference gene, a Semi-quantitative calculation and analysis were carried out using the 2^ −△△Ct method. The primers are shown in Table 1 . Immunofluorescence After dewaxing the paraffin sections paraffin sections in water and repairing the antigen, the fixed solution was left at room temperature for 10 min, The sections were washed in washing solution was used to wash three times, followed by sealing the solution at room temperature for 1 h, and VEGF, HIF-1α and P62/LC3-II rabbit monoclonal antibodies were then added (1:500; 1:500; 1µg/ml; 1µg/ml, Abcam) and incubated overnight at 4℃. Subsequently, fluorescently labeled goat anti-rabbit IgG was added at room temperature for 1 h, anti-fluorescence quencher was added, and the sample was observed and photographed under a fluorescence microscope 2.9 Statistical methods Experimental data are expressed as the mean ± SD. SPSS 20.0 software was used to compare the differences among the groups. GraphPad 8.0 was used to draw relevant data graphs. Independent-samples t-test was used for, two groups of samples, and significant differences between two or more groups were analyzed using one-way analysis of variance or Tukey’s test. Additionally, P < 0.05 was considered statistically significant. Experimental result After modeling intervention, IDD was obvious, and TNF-α expression and HIF-1α/Bnip3/VEGF axis autophagy levels increased The rat IDD model was established by fibro annular puncture, and IDD and related molecular level expression were evaluated 8 weeks later, as shown in Fig. 1 . Eight weeks after modeling, four rats in each group were examined by MRI before sampling. The results indicated that significant degeneration of IVD tissue occurred, as shown by the lower L 4 -L 6 signal intensity and higher Pfirrmann score under T2-weighted MRI in the M group compared with that in the Sham operation group (Fig. 1 b-c). Pathological results showed that in the M group, the nucleus pulposus coagulated and crumped, the annulus fibrosus was disorganized, and proteoglycan and collagen were lost, as shown in Fig. 1 d-f. qPCR results showed that the mRNA expressions of type II collagen and proteoglycan in the annulus was decreased, and that of matrix catabolic markers matrix metalloproteinase 13 (MMP13) and A disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS-5) were increased. This confirmed the evident degeneration of the IVD 8 weeks after the model was made, as depicted in Fig. 1 g-j. In addition, the ELISA results showed that the expression of inflammatory factor TNF-α and growth factor VEGF significantly increased in the serum of rats in the M group, as shown in the Fig. 1 k-l. The qPCR results also showed that mRNA expression levels of HIF-1α, Bnip3, and VEGF were significantly increased in the M group, as shown in the Fig. 1 m-o figure. Transmission electron microscopy results showed that compared with the Sham operation group, the number of autophagosomes and lysosomes in the M group was significantly increased, reflecting the increased autophagy flux in the M group, as shown in Fig. 1 p. In addition, immunofluorescence results showed that the co-expression of LC3-II/LC-I and P62 manifested a distinct pattern in the progression of IDD, and the fluorescence intensity of LC3 was enhanced in the M group than in the Sham group, while the fluorescence intensity of P62 was weakened, indicating that autophagy was activated, as shown in Fig. 1 q. HIF-1α inhibitor YC-1 decreased the expression of TNF-α, HIF-1α, and VEGF expression during IDD After 8 weeks, ELISA was used to detect TNF-α and VEGF expression in the serum of rats in each group after the modeling intervention. qPCR and WB were used to detect the expression of HIF-1α and VEGF mRNA and protein in the rats in each group. Immunofluorescence method were used to observe the protein co-expression of HIF-1α and VEGF in each group, as depicted in Fig. 2 . The ELISA results indicated that TNF-α and VEGF expression in the M group was significantly higher than that in the Sham group. However, this situation was reversed after YC-1 intervention, with lower TNF-α and VEGF expression induced in the YC-1 group than the DMSO group, as shown in Fig. 2 a-b. The qPCR and WB results showed that HIF-1α and VEGF mRNA and protein expression was significantly increased in the M group compared with the Sham group but decreased in the YC-1 group. Moreover, the difference between the YC-1 group and the solvent DMSO group was significant. The use of solvent DMSO did not alter the effects of the inhibitor YC-1, as shown in the Fig. 2 c-g. Moreover, the immunofluorescence results showed the fluorescence intensity of HIF-1α and VEGF protein co-expression in the IVD and nucleus pulposus of rats in the M group It should be noted that, and after YC-1 intervention, the protein fluorescence intensity in the YC-1 group was significantly lower than that in the model group. After the YC-1 intervention, the protein fluorescence intensity in the YC-1 group was significantly lower than that in the M group, as shown in Fig. 2 h. HIF-1α inhibitor YC-1 reduced autophagy levels in the HIF-1α/Bnip3 axis during IDD After 8 weeks, samples were collected, and changes in the number of autophagosomes and lysosomes in the IVDs of rats in each group were observed under transmission electron microscopy. qPCR and WB were used to detect the expression levels of HIF-1α/Bnip3 axis autophagy-related mRNA and proteins, as shown in Fig. 3 . The transmission electron microscopy results showed that the number of autophagosomes and lysosomes significantly increased in the M group compared with the Sham group, thus reflecting an increase in autophagy flux in the M group. However, the YC-1 intervention reversed this situation, and the number of autophagosomes and lysosomes in the YC-1 group was significantly reduced, as shown in Fig. 3 a. The qPCR and WB results demonstrated that the mRNA and protein levels of HIF-1α/Bnip3 axis autophagy-related molecules (Bnip3, Beclin-1, LC3-II) were significantly increased in the M group compared to the Sham group. Furthermore, P62 expression was significantly decreased, indicating a significant increase in autophagy level in the M group. However, after YC-1 intervention, the mRNA and protein expression of pathway-related molecules and autophagy molecules significantly decreased. Additionally, P62 significantly increased, indicating that the YC-1 intervention reduced autophagy levels during IDD, However, the DMSO intervention did not reverse this change, as shown in Fig. 3 b-j. To further verify the changes in protein levels of HIF-1α/Bnip3 axis autophagy-related molecules, immunohistochemistry was performed to observe the proportion of positive cells in each group of rats after the modeling intervention. In addition, immunofluorescence double staining was used to observe the co-expression of autophagy flux LC3-II and P62 in each group after the modeling intervention, as shown in Fig. 5 . Consistent with the qPCR and WB results in the previous study, the YC-1 intervention reduced the level of HIF-1α/Bnip3 axis autophagy-related molecules in the IDD process. This reduction was evident in the significant decrease in the number of cells positive for HIF-1α, Bnip3, and Beclin-1 in the YC-1 group compared to that in the M and DMSO groups, as shown in Fig. 4 a-d. In addition, the immunofluorescence results showed that the co-expression of LC3-II/LC-I and P62 exhibited contrasting patterns during the progression of IDD. This finding aligns with the previousiy reported results, where the fluorescence intensity of LC3-II/LC-I was shown to increase in the M group compared to the Sham group, while the fluorescence intensity of P62 was shown to decrease. However, the intervention of YC-1 altered this trend, as depicted in Fig. 4 e. The HIF-1α inhibitor YC-1 exacerbated the changes in IDD After 8 weeks, four rats in each group were selected for MRI examination before sampling. Then IVD samples were collected for histopathological analysis and qPCR to detect IDD-related mRNA expression, as shown in Fig. 5 . The MRI results showed that compared with the Sham group, L 4 -L 6 signal intensity was decreased in group M under T2-weighted MRI. Additionally, the Pfirrmann score and IDD degree were increased in group M. In contrast, the YC-1 group showed a significantly decreased T2-weighted MRI signal and an increased Pfirrmann score compared to the M and DMSO groups. These differences were statistically significant. Thus, the YC-1 group showed intensified the changes in IDD, as shown in Fig. 5 a-b. HE, Masson and safranin O-fast green staining showed that YC-1 aggravated the pathological changes of IVD in the IDD model compared with the M and DMSO groups, that is, nucleus pulposus coagulation and shrinkage were more obvious in the YC-1 group, annulus fibrosus disorder was more serious, degeneration was deeper, and the loss of proteoglycan and collagen was more pronounced, as shown in figures Fig. 5 c-e. In addition, the qPCR results demonstrated that 8 weeks after the modeling intervention, the YC-1 intervention intensified the changes in IDD. Compared with the M and DMSO groups, the mRNA expressions of type II collagen and proteoglycan in the IVD was significantly reduced, and that of MMP13 and ADAMTS5 was significantly increased, as shown in Fig. 5 f-i. These findings suggest that intervention with the HIF-1α inhibitor YC-1 accelerated the progression of IDD. Lv-shHIF-1α resulted in decreased expression of both HIF-1α and VEGF Primary rat nucleus pulposus cells (NPCs) were extracted and transfected with Lv-shHIF-1α. The transfection efficiency was verified by immunofluorescence, and the knockdown efficiency was detected by qPCR, as shown in Fig. 6 . The results indicated that at a MOI of 50, the highest fluorescence transfection efficiency and knockdown gene expression efficiency of Lv-shHIF-1α were observed, and the mRNA expression of HIF-1α was significantly reduced after knockdown, as demonstrated in Fig. 6 a-b. Subsequently, NPCs were transfected for 24h with Lv-shHIF-1α were stimulated with TNF-α (10ng/ml), and ELISA was used to detect VEGF expression in the cell supernatant. WB and qPCR were employed to assess the mRNA expression and protein levels of HIF-1α and VEGF in the NPCs. The ELISA results revealed that VEGF expression in TNF-α-induced NPCs was significantly decreased after HIF-1α knockdown, as shown in Fig. 6 c. Furthermore, the qPCR and WB results demonstrated that the expression levels of HIF-1α and VEGF were significantly reduced in the knockdown group compared to the NC-H group, as depicted in Fig. 6 d-h. Lv-shHIF-1α decreased the HIF-1α/Bnip3 axis autophagy levels in TNF-α-induced NPCs and accelerated the IDD progression NPCs were transfected with Lv-shHIF-1α and TNF-α (10ng/ml) induced for 24 h, and then the changes in the number of autophagosomes and lysosomes were observed under transmission electron microscopy. The mRNA expression and protein level of autophagy-related elements were detected via qPCR and WB, as shown in Fig. 7 . The results indicated that the number of autophagosomes and lysosomes in the NC-H group was significantly decreased compared with that in the knockdown group, This finding suggests that the autophagy flux of NPCs is significantly reduced after HIF-1α knockdown, as illustrated in Fig. 7 a. The qPCR and WB results demonstrated a significant decrease in autophagy-related mRNA and protein levels of the HIF-1α/Bnip3 axis in group H compared to the NC-H group, Lv-shHIF-1α effectively reduced the autophagy level of TNF-α induced NPCs. Interestingly, after HIF-1α knockdown, autophagy-related indicator expression decreased to some extent. Contrary to previous observations, in which P62 expression increased while LC3-II/I expression decreased, both P62 and LC3-II/I showed a simultaneous decrease, which may be attributed to the restriction of autophagy flux in NPCs by Lv-shHIF-1α, as indicated by Fig. 7 b-j. Additionally, the qPCR results indicated that IDD degradation was intensified in NPCs after HIF-1α knockdown, as indicated by the significantly lower mRNA expressions of COL2A1 and AGGRECAN in the knockdown group compared with the NC-H group and significant increase in the mRNA expression of MMP13 and Adamts5, as depicted in Fig. 7 k-n. These results indicated that after knocking down NPCs with Lv-shHIF-1α, the autophagy flux of NPCs induced by TNF-α decreased significantly, This decrease was accompanied by the further intensification of IDD. Discussion This study suggests that high expression of inflammatory factors TNF-α, HIF-1α and VEGF may be associated with changes in autophagy flux during the early stage of IDD. Additionally, HIF-1α blocking led to a decrease in autophagy flux and exacerbated the progression of IDD in vivo and in vitro. These findings suggest that the HIF-1α/Bnip3/VEGF axis may promote the death of NPCs by regulating the autophagy level of NPCs, thereby playing a protective role against IVD and delaying the IDD induced by the inflammatory factor TNF-α. Although the pathogenesis of IDD is complex, the involvement of inflammatory mediators is an important cause of its accelerated progression( 25 , 26 ). During the progression of IDD, caused by the increased expression of pro-inflammatory cytokines (such as TNF-α) in NPCs leads to the disturbance of disc mechanical structure and further degradation of the ECM and deterioration of IVD microenvironment, These results are consistent with the observations in our previous animal experiments( 27 – 29 ). In addition, we also found that the high expression of TNF-α is accompanied by the high expression of HIF-1α and VEGF, which is also common in diseases similar to IDD. However, the role of HIF-1α and VEGF in the progression of IDD remains unclear( 30 , 31 ). Oxygen tension in the cell living environment is an important factor in regulating VEGF expression and angiogenesis, and HIF-1α can directly induce VEGF expression under certain conditions and promote the formation of new blood vessels( 32 ). Risbud etal. ( 33 ) proposed the second of the three stages of disc degeneration and suggested that the formation of neovascularization and the growth of nerves into the structurally deficient disc tissue further amplified the inflammatory effect. Moreover, they revealed that HIF-1α was likely involved in regulating the inflammatory response of the IVD microenvironment. Regarding the role of the generation of new biochemical blood vessels in IVD in IDD, some scholars believe that the generation of new blood vessels may be an adaptive response of the body to various influencing factors or a spontaneous repair mechanism, This response not only increases blood circulation, improves IVD nutrition, and regulates inflammatory response but also plays an important role in the progression of IDD( 34 – 37 ).Our in vitro experiment results showed that the Lv-shHIF-1α intervention decreased HIF-1α and VEGF expression in TNF-α-induced NPCs. The ELISA results also showed that the knockdown of HIF-1α reversed the pro-expression effect of TNF-α on VEGF. This point has also been demonstrated via qPCR and WB. In addition, while HIF-1α and VEGF were decreased, the expression of type II collagen and proteoglycan expression was decreased, and MMP13 and ADAMTS5 expression was increased. This suggests that the inactivation of the HIF-1α/VEGF axis has an inhibitory effect on the inflammatory microenvironment and cell biological function of IVD, which further aggravates IDD. Due to the special physiological environment of IVD, HIF-1α accumulates and migrates into the nucleus during hypoxia, and HIF-1α binds to the functional hypoxia response element (HRE) in the Bnip3 promoter to activate the transcription of downstream pro-death target genes( 38 ).Activation of Bnip3 dissociates Beclin-1 from Bcl-XL and Bcl-2, thereby releasing Beclin-l to activate autophagy( 39 , 40 ). The activation of autophagy at the early stage of IDD has a certain protective effect on IVD to a certain extent and serves as an adaptive pathway to promote the health and survival of NPCs( 41 ).In addition, Pereira etal. ( 42 ) found that activation of HIF-1α/Bnip3 promoted VEGF expression in tumor diseases, which inspired us to investigate its role in IDD. Therefore, by establishing a rat IDD model and performing HIF-1α inhibitor intervention, this study further explored the effect of YC-1 on the HIF-1α/Bnip3/VEGF axis autophagy level and the progression of IDD. The results of the in vivo experiment showed that autophagy flux increased compared to the control group. The expressions of autophagy pathway related molecules Bnip3 and Beclin-1 was also significantly increased based on the qPCR and WB results. P62 expression increased, LC3-II/I expression decreased, and autophagy levels decreased. The immunohistochemistry and immunofluorescence results also confirmed this view. However, the intervention with the HIF-1α inhibitor YC-1 reversed this result. Compared with the DMSO group, the number of autophagosomes and lysosomes in the YC-1 inhibitor group was significantly reduced, and the expressions of Bnip3 and Beclin-1 molecules related to the autophagy pathway was also inhibited to a certain extent, suggesting that HIF-1α played a key role in this process, and profoundly affected the subsequent changes in autophagy levels. The decrease of autophagy level was accompanied by the further intensification of IDD, which was manifested by an increase in the Pfirrmann score. The coagulation and contraction of nucleus pulposus and the disordered arrangement of fibrous annulus were observed via pathological staining. Type II collagen and proteoglycan expression decreased, and MMP13 and ADAMTS5 expression increased in the IVD tissue. This indicates that the intervention with the HIF-1α inhibitor YC-1 reduced autophagy levels in NPCs, aggravated changes in IDD, and affected the progression of IDD. The in vitro results also showed that Lv-shHIF-1α decreased the autophagy level of NPCs after the intervention, which was mainly reflected in the reduction of the number of autophagosomes and lysosomes. The qPCR and WB results showed that the expression of autophagy pathway related molecules Bnip3, Beclin-1, P62 and LC3-II/I were downregulated and autophagy flux was decreased. These findings also confirm that the HIF-1α inhibitors YC-1 and LvshHIF-1α accelerate the progression of IDD by reducing the autophagy level of NPCs, which also indicates that HIF-1α may regulate autophagy and neovascularization by activating the HIF-1α/ Bnip3/VEGF axis to delay TNF-α-induced IDD. In summary, during the progression of IDD, the HIF-1α/ Bnip3/VEGF axis may regulate NPCs autophagy and neovascularization in response to TNF-α-induced IDD and promote NPCs death, thereby protecting IVD tissue and delaying IDD progression. However, the intervention with HIF-1α blockers reduced autophagy levels and VEGF expression and further aggravated the progression of IDD, which further supported our hypothesis. Our work provides insights for further exploring targeted IDD therapy. Abbreviations IDD, intervertebral disc degeneration; TNF-α, tumor necrosis factor-alpha; IVD, intervertebral disc; HIF-1α, hypoxia-inducing factor-1α; VEGF, vascular endothelial growth factor; DMSO, dimethyl sulfoxide; MRI, magnetic resonance imaging; HE, hematoxylin and eosin; NPC, nucleus pulposus cell; COL2A1, collagen type II alpha 1; MMP13, matrix metalloproteinase 13; ADAMTS5, A disintegrin and metalloproteinase with thrombospondin motifs 5; Bnip3, BCL-2 interacting protein 3 Declarations Acknowledgments This study was completed in Nanjing University of Chinese Medicine. With the support of the Laboratory for New Techniques of Restoration and Reconstruction of Orthopedics and Traumatology and the Animal Experiment Center. Credit authorship contribution statement Xiaoxian Sun: Data curation, performed cell Culture, analyzed data, wrote the manuscript. Xue Bai and Zitong Zhao: assisted with the data analysis, writing and reviewing. Lining Wang: helped with writing and reviewing. Mengmin Liu and Pengcheng Tu: helped with Correction and modification. Shun Lin and Zheng Yan: provided the experimental assistance. Zhiqiang Wang and Qinfeng Zhou: Methodology. Yongfeng Yuan: helped with the MRI and Disc degeneration rating. Xiaofeng Li: provided technical and theoretical guidance. Jintao Liu and Yong Ma: conceived the concept and supervised the project. Yang Guo: Conceptualization and provided the design of experiments. Xiaoxian Sun, Xue Bai and Zitong Zhao contributed equally to the study. Corresponding author: Jintao Liu, Yong Ma and Yang Guo are all corresponding authors; Yang Guo is the first corresponding author, who is responsible for responding to newsletters during the submission period. Funding Sources Financial support for this study was provided by the Natural Science Foundation of China (Reference Grant No.82074467,82374220,and82374473), NATCM's Project of High-level Construction of Key TCM Disciplines(NATCM's Human Education Letter[2023]No. 85), Training of leading TCM talents in Jiangsu Province([2023]No.17),Jiangsu Province Traditional Chinese medicine science and technology development program([2023]No.19, MS2022080), The Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX23-2202). Competing interests The authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data availability Data will be made available on request. Ethics approval and consent to participate All animal experiments were performed in accordance with Guiding Principles of the Care and Use of Animals and approved by the Animal Experimental Ethics Committee of Nanjing University of Chinese medicine. (No. 202210A009) Author Contribution Xiaoxian Sun: Data curation, performed cell Culture, analyzed data, wrote the manuscript. Xue Bai and Zitong Zhao: assisted with the data analysis, writing and reviewing. Lining Wang: helped with writing and reviewing. Mengmin Liu and Pengcheng Tu: helped with Correction and modification. Shun Lin and Zheng Yan: provided the experimental assistance. Zhiqiang Wang and Qinfeng Zhou: Methodology. Yongfeng Yuan: helped with the MRI and Disc degeneration rating. Xiaofeng Li: provided technical and theoretical guidance. Jintao Liu and Yong Ma: conceived the concept and supervised the project. Yang Guo: Conceptualization and provided the design of experiments. Xiaoxian Sun, Xue Bai and Zitong Zhao contributed equally to the study. References Zhou M, Wang H, Zeng X, Yin P, Zhu J, Chen W, et al. Mortality, morbidity, and risk factors in China and its provinces, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2019;394(10204):1145-58. doi: 10.1016/S0140-6736(19)30427-1. PubMed PMID: 31248666; PubMed Central PMCID: PMCQ1. Kirnaz S, Capadona C, Wong T, Goldberg JL, Medary B, Sommer F, et al. Fundamentals of Intervertebral Disc Degeneration. World Neurosurg. 2022;157:264-73. doi: 10.1016/j.wneu.2021.09.066. PubMed PMID: 34929784; PubMed Central PMCID: PMCQ3. Zhao R, Liu W, Xia T, Yang L. Disordered Mechanical Stress and Tissue Engineering Therapies in Intervertebral Disc Degeneration. Polymers (Basel). 2019;11(7). doi: 10.3390/polym11071151. PubMed PMID: 31284436; PubMed Central PMCID: PMCQ1. Pan H, Li H, Guo S, Wang C, Long L, Wang X, et al. The mechanisms and functions of TNF-α in intervertebral disc degeneration. Exp Gerontol. 2023;174:112119. doi: 10.1016/j.exger.2023.112119. PubMed PMID: 36758650; PubMed Central PMCID: PMCQ2. Ou-Yang DC, Kleck CJ, Ackert-Bicknell CL. Genetics of Intervertebral Disc Degeneration. Curr Osteoporos Rep. 2023;21(1):56-64. doi: 10.1007/s11914-022-00769-0. PubMed PMID: 36680730; PubMed Central PMCID: PMCQ2. Roh EJ, Darai A, Kyung JW, Choi H, Kwon SY, Bhujel B, et al. Genetic Therapy for Intervertebral Disc Degeneration. International journal of molecular sciences. 2021;22(4). doi: 10.3390/ijms22041579. PubMed PMID: 33557287; PubMed Central PMCID: PMCQ1. Yang L, Yu C, Fan X, Zeng T, Yang W, Xia J, et al. Dual-dynamic-bond cross-linked injectable hydrogel of multifunction for intervertebral disc degeneration therapy. J Nanobiotechnology. 2022;20(1):433. doi: 10.1186/s12951-022-01633-0. PubMed PMID: 36182921; PubMed Central PMCID: PMCQ1. Chen J, Yang X, Feng Y, Li Q, Ma J, Wang L, et al. Targeting Ferroptosis Holds Potential for Intervertebral Disc Degeneration Therapy. Cells. 2022;11(21). doi: 10.3390/cells11213508. PubMed PMID: 36359904; PubMed Central PMCID: PMCQ2. Xu J, Shao T, Lou J, Zhang J, Xia C. Aging, cell senescence, the pathogenesis and targeted therapies of intervertebral disc degeneration. Front Pharmacol. 2023;14:1172920. doi: 10.3389/fphar.2023.1172920. PubMed PMID: 37214476; PubMed Central PMCID: PMCQ1. Wang Y, Che M, Xin J, Zheng Z, Li J, Zhang S. The role of IL-1β and TNF-α in intervertebral disc degeneration. Biomed Pharmacother. 2020;131:110660. doi: 10.1016/j.biopha.2020.110660. PubMed PMID: 32853910; PubMed Central PMCID: PMCQ1. Wang S, Liu C, Sun Z, Yan P, Liang H, Huang K, et al. IL-1β increases asporin expression via the NF-κB p65 pathway in nucleus pulposus cells during intervertebral disc degeneration. Sci Rep. 2017;7(1):4112. doi: 10.1038/s41598-017-04384-3. PubMed PMID: 28646230; PubMed Central PMCID: PMCQ2. He R, Wang Z, Cui M, Liu S, Wu W, Chen M, et al. HIF1A Alleviates compression-induced apoptosis of nucleus pulposus derived stem cells via upregulating autophagy. Autophagy. 2021;17(11):3338-60. doi: 10.1080/15548627.2021.1872227. PubMed PMID: 33455530; PubMed Central PMCID: PMCQ1. Zhang L, Li X, Kong X, Jin H, Han Y, Xie Y. Effects of the NF‑κB/p53 signaling pathway on intervertebral disc nucleus pulposus degeneration. Molecular Medicine Reports. 2020;22(3):1821-30. doi: 10.3892/mmr.2020.11288. PubMed PMID: 32705171; PubMed Central PMCID: PMCQ3. Dai F, Yu P, Yu Z, Jiang H, Ma Z, Liu J. Yiqi Huoxue Recipe Delayed Intervertebral Disc Degeneration by Activating Autophagy. Front Pharmacol. 2021;12:705747. doi: 10.3389/fphar.2021.705747. PubMed PMID: 34483910; PubMed Central PMCID: PMCQ1. Ha K-Y, Koh I-J, Kirpalani PA, Kim Y-Y, Cho Y-K, Khang G-S, et al. The expression of hypoxia inducible factor-1alpha and apoptosis in herniated discs. Spine (Phila Pa 1976). 2006;31(12):1309-13. PubMed PMID: 16721291; PubMed Central PMCID: PMCQ2. Kim H, Jeong H, Lee J, Cha H-S, Koh E-M, Ahn JK. Hypoxia Induce Slug Expression via JAK/STAT3 Pathway in Rheumatoid Arthritis Fibroblast-like Synoviocytes. Ann Rheum Dis. 2016;75(Suppl 2):928-. doi: 10.1136/annrheumdis-2016-eular.4687. Wang F, Han J, Wang X, Liu Y, Zhang Z. Roles of HIF-1α/BNIP3 mediated mitophagy in mitochondrial dysfunction of letrozole-induced PCOS rats. J Mol Histol. 2022;53(5):833-42. doi: 10.1007/s10735-022-10096-4. PubMed PMID: 35951252; PubMed Central PMCID: PMCQ3. Filippi I, Saltarella I, Aldinucci C, Carraro F, Ria R, Vacca A, et al. Different Adaptive Responses to Hypoxia in Normal and Multiple Myeloma Endothelial Cells. Cellular Physiology and Biochemistry : International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology. 2018;46(1):203-12. doi: 10.1159/000488423. PubMed PMID: 29587264. Shintani T, Klionsky DJ. Autophagy in health and disease: a double-edged sword. Science. 2004;306(5698):990-5. PubMed PMID: 15528435; PubMed Central PMCID: PMCQ1. Haro H, Kato T, Komori H, Osada M, Shinomiya K. Vascular endothelial growth factor (VEGF)-induced angiogenesis in herniated disc resorption. J Orthop Res. 2002;20(3):409-15. PubMed PMID: 12038611; PubMed Central PMCID: PMCQ2. Mazure NM, Brahimi-Horn MC, Pouysségur J. Protein kinases and the hypoxia-inducible factor-1, two switches in angiogenesis. Curr Pharm Des. 2003;9(7):531-41. PubMed PMID: 12570801; PubMed Central PMCID: PMCQ3. Bonnevie ED, Gullbrand SE, Ashinsky BG, Tsinman TK, Elliott DM, Chao P-HG, et al. Aberrant mechanosensing in injured intervertebral discs as a result of boundary-constraint disruption and residual-strain loss. Nat Biomed Eng. 2019;3(12). doi: 10.1038/s41551-019-0458-4. PubMed PMID: 31611678; PubMed Central PMCID: PMCQ1. Yang W, Jia C, Liu L, Fu Y, Wu Y, Liu Z, et al. Hypoxia-Inducible Factor-1α Protects Against Intervertebral Disc Degeneration Through Antagonizing Mitochondrial Oxidative Stress. Inflammation. 2023;46(1):270-84. doi: 10.1007/s10753-022-01732-y. PubMed PMID: 36064808; PubMed Central PMCID: PMCQ2. Allon AA, Butcher K, Schneider RA, Lotz JC. Structured bilaminar coculture outperforms stem cells and disc cells in a simulated degenerate disc environment. Spine (Phila Pa 1976). 2012;37(10):813-8. doi: 10.1097/BRS.0b013e31823b055f. PubMed PMID: 22024902; PubMed Central PMCID: PMCQ2. Alvarez-Garcia O, Matsuzaki T, Olmer M, Miyata K, Mokuda S, Sakai D, et al. FOXO are required for intervertebral disk homeostasis during aging and their deficiency promotes disk degeneration. Aging Cell. 2018;17(5):e12800. doi: 10.1111/acel.12800. PubMed PMID: 29963746; PubMed Central PMCID: PMCQ1. Liu K, Wei J, Li G, Liu R, Zhao D, Zhang Y, et al. Fexofenadine Protects Against Intervertebral Disc Degeneration Through TNF Signaling. Front Cell Dev Biol. 2021;9:687024. doi: 10.3389/fcell.2021.687024. PubMed PMID: 34504840; PubMed Central PMCID: PMCQ1. Andrade P, Visser-Vandewalle V, Philippens M, Daemen MA, Steinbusch HWM, Buurman WA, et al. Tumor necrosis factor-α levels correlate with postoperative pain severity in lumbar disc hernia patients: opposite clinical effects between tumor necrosis factor receptor 1 and 2. Pain. 2011;152(11):2645-52. doi: 10.1016/j.pain.2011.08.012. PubMed PMID: 21920667; PubMed Central PMCID: PMCQ1. Ohtori S, Inoue G, Eguchi Y, Orita S, Takaso M, Ochiai N, et al. Tumor necrosis factor-α-immunoreactive cells in nucleus pulposus in adolescent patients with lumbar disc herniation. Spine (Phila Pa 1976). 2013;38(6):459-62. doi: 10.1097/BRS.0b013e3182739cb4. PubMed PMID: 22990365; PubMed Central PMCID: PMCQ2. Liang H, Yang X, Liu C, Sun Z, Wang X. Effect of NF-kB signaling pathway on the expression of MIF, TNF-α, IL-6 in the regulation of intervertebral disc degeneration. J Musculoskelet Neuronal Interact. 2018;18(4):551-6. PubMed PMID: 30511959; PubMed Central PMCID: PMCQ4. Doğanlar ZB, Doğanlar O, Kurtdere K, Güçlü H, Chasan T, Turgut E. Melatonin prevents blood-retinal barrier breakdown and mitochondrial dysfunction in high glucose and hypoxia-induced in vitro diabetic macular edema model. Toxicol In Vitro. 2021;75:105191. doi: 10.1016/j.tiv.2021.105191. PubMed PMID: 33962019; PubMed Central PMCID: PMCQ2. Jin F, Zheng X, Yang Y, Yao G, Ye L, Doeppner TR, et al. Impairment of hypoxia-induced angiogenesis by LDL involves a HIF-centered signaling network linking inflammatory TNFα and angiogenic VEGF. Aging (Albany NY). 2019;11(2):328-49. doi: 10.18632/aging.101726. PubMed PMID: 30659163; PubMed Central PMCID: PMCQ2. Kwon W-K, Moon HJ, Kwon T-H, Park Y-K, Kim JH. The Role of Hypoxia in Angiogenesis and Extracellular Matrix Regulation of Intervertebral Disc Cells During Inflammatory Reactions. Neurosurgery. 2017;81(5):867-75. doi: 10.1093/neuros/nyx149. PubMed PMID: 28475716; PubMed Central PMCID: PMCQ1. Risbud MV, Shapiro IM. Role of cytokines in intervertebral disc degeneration: pain and disc content. Nat Rev Rheumatol. 2014;10(1):44-56. doi: 10.1038/nrrheum.2013.160. PubMed PMID: 24166242; PubMed Central PMCID: PMCQ1. Binch ALA, Cole AA, Breakwell LM, Michael ALR, Chiverton N, Cross AK, et al. Expression and regulation of neurotrophic and angiogenic factors during human intervertebral disc degeneration. Arthritis Research & Therapy. 2014;16(5):416. doi: 10.1186/s13075-014-0416-1. PubMed PMID: 25209447; PubMed Central PMCID: PMCQ2. Doita M, Kanatani T, Ozaki T, Matsui N, Kurosaka M, Yoshiya S. Influence of macrophage infiltration of herniated disc tissue on the production of matrix metalloproteinases leading to disc resorption. Spine (Phila Pa 1976). 2001;26(14):1522-7. PubMed PMID: 11462080; PubMed Central PMCID: PMCQ2. Pan Z, Sun H, Xie B, Xia D, Zhang X, Yu D, et al. Therapeutic effects of gefitinib-encapsulated thermosensitive injectable hydrogel in intervertebral disc degeneration. Biomaterials. 2018;160:56-68. doi: 10.1016/j.biomaterials.2018.01.016. PubMed PMID: 29396379; PubMed Central PMCID: PMCQ1. Kwon WK, Moon HJ, Kwon TH, Park YK, Kim JH. Influence of rabbit notochordal cells on symptomatic intervertebral disc degeneration: anti-angiogenic capacity on human endothelial cell proliferation under hypoxia. Osteoarthritis Cartilage. 2017;25(10):1738-46. doi: 10.1016/j.joca.2017.06.003. PubMed PMID: 28647468; PubMed Central PMCID: PMCQ1. Madhu V, Boneski PK, Silagi E, Qiu Y, Kurland I, Guntur AR, et al. Hypoxic Regulation of Mitochondrial Metabolism and Mitophagy in Nucleus Pulposus Cells Is Dependent on HIF-1α-BNIP3 Axis. J Bone Miner Res. 2020;35(8):1504-24. doi: 10.1002/jbmr.4019. PubMed PMID: 32251541; PubMed Central PMCID: PMCQ1. Liu X-W, Lu M-K, Zhong H-T, Wang L-H, Fu Y-P. Panax Notoginseng Saponins Attenuate Myocardial Ischemia-Reperfusion Injury Through the HIF-1α/BNIP3 Pathway of Autophagy. J Cardiovasc Pharmacol. 2019;73(2):92-9. doi: 10.1097/FJC.0000000000000640. PubMed PMID: 30531436; PubMed Central PMCID: PMCQ3. Zhou X, Zhao X, Zhou W, Qi H, Zhang H, Han T-L, et al. Impaired placental mitophagy and oxidative stress are associated with dysregulated BNIP3 in preeclampsia. Sci Rep. 2021;11(1):20469. doi: 10.1038/s41598-021-99837-1. PubMed PMID: 34650122; PubMed Central PMCID: PMCQ2. Chen Y, Lin J, Chen J, Huang C, Zhang Z, Wang J, et al. Mfn2 is involved in intervertebral disc degeneration through autophagy modulation. Osteoarthritis Cartilage. 2020;28(3):363-74. doi: 10.1016/j.joca.2019.12.009. PubMed PMID: 31926268; PubMed Central PMCID: PMCQ1. Pereira ER, Frudd K, Awad W, Hendershot LM. Endoplasmic reticulum (ER) stress and hypoxia response pathways interact to potentiate hypoxia-inducible factor 1 (HIF-1) transcriptional activity on targets like vascular endothelial growth factor (VEGF). J Biol Chem. 2014;289(6):3352-64. doi: 10.1074/jbc.M113.507194. PubMed PMID: 24347168; PubMed Central PMCID: PMCQ2. Table Table 1 Target genes Primer sequences used in qRT-PCR Hif-1α Forward: 5' AAGTCTAGGGATGCAGCACGATC 3' Reverse: 3' TCAAGATGGGAGCTCACGTTGTG 5' vegfa Forward: 5' CTCACTTCCAGAAACACGAC 3' Reverse: 3' TCCACAATAGTGCCATGTCC 5' Bnip3 Forward: 5' CTGTCTCATCTGTTAGCCATTG 3' Reverse: 3' CACAGCTCAGCGTGAATC 5' Beclin-1 Forward: 5' ATGCACAGATACTCTTTTAGACC 3' Reverse: 3' AACAGCGTTTGTAGTTCTGACA 5' P62 Forward: 5' CCTGAACTCATGGCTGAGA 3' Reverse: 3' GTCCAAATAATTCTCCTCGTCATC 5' LC3-II/I Forward: 5' TGTATCCACACCCATCGCTGACA 3' Reverse: 3' CTGACCAGAACTCCCAGCCACC 5' COL2A1 Forward: 5'CTCATCCAGGGCTCCAATGAT3' Reverse: 3'TCTGTGATCGGTACTCGATGA5' Aggrecan Forward: 5'CAGTGCGATGCAGGCTGG3' Reverse: 3'CCTCCGGCACTCGTTGGCTG5' MMP13 Forward: 5'CAAGAATAAAGACTGTGCGAA3' Reverse: 3'TCAGTAAGCACCAAGTGTC5' Adamts5 Forward: 5'TTACTAGATGTACCACGGAAGC3' Reverse: 3'AATGGCGGTAGGCAAACT5' GAPDH Forward: 5' AACGACCCCTTCATTGACC 3' Reverse: 3' ATTCTCAGCCTTGACTGTGC 5' Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4356277","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":301594148,"identity":"3590b1d5-3d80-4ac1-91f6-de691a514dbf","order_by":0,"name":"Xiaoxian Sun","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaoxian","middleName":"","lastName":"Sun","suffix":""},{"id":301594149,"identity":"31c9e959-1876-47b1-9f47-21c72ae28c08","order_by":1,"name":"Xue bai","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xue","middleName":"","lastName":"bai","suffix":""},{"id":301594150,"identity":"ab414b0f-8204-44ca-af38-4336165253a7","order_by":2,"name":"Zitong Zhao","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zitong","middleName":"","lastName":"Zhao","suffix":""},{"id":301594151,"identity":"77b5fca3-151f-46d7-9e0c-cf6809a56d55","order_by":3,"name":"Lining Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lining","middleName":"","lastName":"Wang","suffix":""},{"id":301594152,"identity":"4469404f-3b33-464b-8d65-df0c4f385007","order_by":4,"name":"Mengmin Liu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Mengmin","middleName":"","lastName":"Liu","suffix":""},{"id":301594153,"identity":"3f1ce433-4bf0-47ee-b776-297bc7208d84","order_by":5,"name":"Pengcheng Tu","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Pengcheng","middleName":"","lastName":"Tu","suffix":""},{"id":301594154,"identity":"c5741fa5-ab7f-4df4-9d35-8c055c9bd2ad","order_by":6,"name":"Shun Lin","email":"","orcid":"","institution":"Suzhou Hospital of Traditional Chinese Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shun","middleName":"","lastName":"Lin","suffix":""},{"id":301594155,"identity":"0b5ace3a-2b79-4604-abf2-b5368601a287","order_by":7,"name":"Zheng Yan","email":"","orcid":"","institution":"Suzhou Hospital of Traditional Chinese Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zheng","middleName":"","lastName":"Yan","suffix":""},{"id":301594156,"identity":"a112bd01-d0d5-4efc-9ec1-ae4b32c38f0c","order_by":8,"name":"Zhiqiang Wang","email":"","orcid":"","institution":"Suzhou Hospital of Traditional Chinese Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhiqiang","middleName":"","lastName":"Wang","suffix":""},{"id":301594157,"identity":"40417b65-65b5-47ae-9b49-e7819fe91ec5","order_by":9,"name":"Qinfeng Zhou","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qinfeng","middleName":"","lastName":"Zhou","suffix":""},{"id":301594158,"identity":"8d5dec92-6327-4204-a39a-b1da3f336e54","order_by":10,"name":"Yongfeng Yuan","email":"","orcid":"","institution":"Affiliated Hospital of Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yongfeng","middleName":"","lastName":"Yuan","suffix":""},{"id":301594159,"identity":"914e946e-913e-4b8f-9381-37a77a8bcd05","order_by":11,"name":"Xiaofeng Li","email":"","orcid":"","institution":"Shanghai Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaofeng","middleName":"","lastName":"Li","suffix":""},{"id":301594160,"identity":"8a643f94-aa53-4099-a8e3-204a4a55d598","order_by":12,"name":"Jintao Liu","email":"","orcid":"","institution":"Suzhou Hospital of Traditional Chinese Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jintao","middleName":"","lastName":"Liu","suffix":""},{"id":301594161,"identity":"a33c479c-2b4b-4976-a3eb-beff902af138","order_by":13,"name":"Yong Ma","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Ma","suffix":""},{"id":301594162,"identity":"0b82f55d-4c2e-45e5-b867-086146bcb5aa","order_by":14,"name":"Yang Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA90lEQVRIiWNgGAWjYDCCAzAGewODAYSVQKwWngMka5GAqySghe/28WsSH9vs8uQj3x4o5qnZxsDPnmPA8HMHbi2S53LKJGe2JRcb3s5LMOY5dptBsueNAWPvGdxaDM7wpEnztjEnbpydY2DM23CbweBGjgEzYxtBLfWJG2eegWixJ6yF/RhQy+HE+RI8UFskCGiRPMPDbDnj3PHEDTw5BoZzjt3mkTjzrOBgLx4tfGfYH974UFadOL/9jJnBm5rbcvztyRsf/MSjBRiFBgyMbEAXHmBgA0UlD0jsAD4NwITygIHhDwODfAMD8wP8KkfBKBgFo2CkAgBPblLnYZHC8AAAAABJRU5ErkJggg==","orcid":"","institution":"Nanjing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yang","middleName":"","lastName":"Guo","suffix":""}],"badges":[],"createdAt":"2024-05-02 01:11:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4356277/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4356277/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56543485,"identity":"16351f5a-9266-4984-8a1d-c3dd990b89f0","added_by":"auto","created_at":"2024-05-15 14:37:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1534949,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAfter modeling intervention, intervertebral disc degeneration became apparent in rats, and TNF-α, HIF-1α, Bnip3, and VEGF were upregulated. \u003c/strong\u003e(a) Preparation of the IDD model by puncturing L\u003csub\u003e4\u003c/sub\u003e-L\u003csub\u003e5\u003c/sub\u003e and L\u003csub\u003e5\u003c/sub\u003e-L\u003csub\u003e6\u003c/sub\u003e. (b-c) IDD was observed and Pfirrmann scores of the two groups were evaluated using T2-weighted MRI. (d-f) IDD was observed through HE, Masson’s, and safranin O-fast green staining. (g-h) Expression levels of TNF-α and VEGF detected in the serum of each group of rats after modeling. (i-l) Diagram of the expression of IDD-related molecules detected by qPCR. (m-o) Diagram of HIF-1α, Bnip3, and VEGF mRNA expression in each group after modeling intervention as detected by qPCR. (p) Number of autophagosomes and lysosomes in the IVDs of the Sham group and M group observed by transmission electron microscopy. (q) Protein co-expression of P62 and LC3-II in the Sham group and M group after modeling intervention observed by immunofluorescence. The scale is 500 μm, and the fluorescence microscope magnification is 50X. These values are the average of at least three independent experiments. **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/96931de45af79dae609a4d9c.png"},{"id":56543482,"identity":"ad38efb4-6b76-4e1f-b8bf-385104250cc3","added_by":"auto","created_at":"2024-05-15 14:37:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1508910,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHIF-1α inhibitor YC-1 decreased TNF-α, HIF-1α, and VEGF expression during IDD. \u003c/strong\u003e(a, b) Expression of inflammatory factor TNF-α and neovascularization VEGF in each group of rats after the modeling intervention. (c-g) mRNA and protein levels of HIF-1α and VEGF in each group of rats detected by qPCR and WB. (h) Co-expression of HIF-1α and VEGF in each group of rats after modeling intervention as observed via immunofluorescence. The scale is 200 μm, and the fluorescence microscope was set to 50X magnification. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/c0b8a604712c8be459d06911.png"},{"id":56543487,"identity":"6f4fbb27-2e15-433c-bdf6-2b2431bbfec6","added_by":"auto","created_at":"2024-05-15 14:37:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1605770,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntervention with the HIF-1α inhibitor YC-1 reduced autophagy levels in the HIF-1α/Bnip3 axis during IDD. \u003c/strong\u003e(a) Changes in the number of autophagosomes and lysosomes in IVD after the modeling intervention in each group of rats by transmission electron microscopy. (b-j) HIF-1α/Bnip3 axis autophagy mRNA and protein expression levels in each group after the modeling intervention based on qPCR and WB. The scale in panel a is 1 μm, and the TEM multiple is 10000X. The black arrow indicates the autophagosome, while the red arrow indicates the lysosome. These values are the average of at least three independent experiments.*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/ffb5e7e0cb9b1c422038b6f0.png"},{"id":56544018,"identity":"caf2ddd9-ade4-4641-bc98-085dd775cebc","added_by":"auto","created_at":"2024-05-15 14:45:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2201410,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntervention with the HIF-1α inhibitor YC-1 reduced autophagy levels in the HIF-1α/Bnip3 axis during IDD.\u003c/strong\u003e(a-d) Number of positive cells for HIF-1α/Bnip3 axis-related molecules in each group of rats after modeling intervention as determined by immunohistochemistry. (e) Protein co-expression of P62 and LC3-II in each group of rats after modeling intervention as determined by immunofluorescence. In panel a, the scale is 100 µm, and the microscope magnification is 400X. The brown-yellow cellular particles represent positive cells. In panel e, the scale is 500 μm, and the microscope magnification is 50X. The values are the average of at least three independent experiments. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/1c3a789cbe5242afce42371a.png"},{"id":56543488,"identity":"868266b7-ffaf-4938-80d2-6b42789226bd","added_by":"auto","created_at":"2024-05-15 14:37:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2975984,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntervention with HIF-1α inhibitor YC-1 exacerbated the IDD changes.\u003c/strong\u003e (a, b) MRI evaluation of disc degeneration and Pfirrmann score in each group with T2 weighting (white arrow pointing to disc L4-L6 after intervention). (c) HE staining of pathological changes in each group after modeling. (d) Masson staining of pathological changes of each group after modeling. (e) Safranin O-fast green staining of pathological changes of each group after modeling. In panels c-e, the scale is 500 μm, the observation factor is 50X, and the magnification is 400X. The yellow box points to the fibrous annulus tissue of the corresponding part, and the purple box points to the nucleus pulposus tissue of the corresponding part. (f-i) Expression of IDD degeneration-related mRNA in the intervertebral discs of rats detected after the intervention via qPCR. The values are the average of at least three independent experiments. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/069a5ff0aec9e22fe779ff7a.png"},{"id":56544019,"identity":"f48bef5c-7388-45dd-ba6c-f391f0c445c8","added_by":"auto","created_at":"2024-05-15 14:45:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1285596,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLV-HIF-1α resulted in decreased expression of both HIF-1α and VEGF.\u003c/strong\u003e (a, b) Transfection efficiency of Lv-shHIF-1α with NPCs was measured, and knockdown efficiency of LV-shHIF-1α transfection was assessed via qPCR. (c) ELISA was used to detect the expression of VEGF in NPCs transfected with Lv-shHIF-1α induced by TNF-α. (d-h) mRNA and protein expression levels of HIF-1α and VEGF in transfected NPCs treated with TNF-α were detected using qPCR and WB. In panel a, the scale is 100 μm. These values are the average of at least three independent experiments. **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/b96a8751e19192fa7eb3d8c8.png"},{"id":56544020,"identity":"7fc678e0-3944-4633-9262-80aaf86e054d","added_by":"auto","created_at":"2024-05-15 14:45:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1068185,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLV-HIF-1α decreased the HIF-1α/Bnip3 axis autophagy levels in TNF-α-induced NPCs and accelerated the IDD progression. \u003c/strong\u003e(a) Expression of autophagosomes and lysosomes in NPCs transfected with Lv-HIF-1α treated with TNF-α was observed by transmission electron microscopy. (b-j) mRNA and protein levels of the HIF1α/Bnip3 axis and autophagy-related molecules transfected with NPCs as detected by qPCR and WB. In panel, a, the scale is 1 μm, and the TEM multiple is 10000X. (The black arrow points to the autophagosome, and the red arrow points to the lysosome). (k-n) Expression of IDD degeneration-related mRNA in NPCs after the intervention was detected by qPCR. These values represent the average of at least three independent experiments. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/2ec93f50aa81b1dd58c5731a.png"},{"id":56820328,"identity":"f174d8c3-af1a-4b34-a00d-92660a65a9ff","added_by":"auto","created_at":"2024-05-21 01:01:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":20335846,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4356277/v1/4abbc58a-b574-45f7-b9f6-df1e1b72ce5c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"HIF-1α/Bnip3/VEGF axis regulates autophagy to mitigate intervertebral disc degeneration induced by inflammatory factor TNF-α","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIntervertebral disc degeneration (IDD) is one of the main factors that leading to low back pain, with 11\u0026ndash;12% of patients in disc degenerative disease experiencing low back pain disability, which is the main cause of productivity loss in the world and causes a serious economic burden to patients, families, and society (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e).The pathogenesis of IDD mainly involves aging, mechanical damage, inflammatory mediators, and genetic factors (\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). However, a large gap remains in the study of these pathogenesis targets. Therefore, an increasing number of researchers have begun to further explore the potential pathogenesis of IDD to identify new treatment angles for IDD (\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne of the characteristics of IDD is the upregulation of inflammatory mediators (such as IL-6, IL-8, IL-1β, and TNF-α). These mediators play a role in the progression and initiation of IDD by regulating inflammatory response, nucleus pulposus metabolism, autophagy, and cell matrix destruction(\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).Previous studies from our research group have confirmed that inflammatory mediators in IDD are significantly upregulated in IDD compared to the normal group, as previously reported. We also observed that hypoxia-inducing factor (HIF-1α) and vascular endothelial factor (VEGF) were significantly upregulated(\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Ha (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e) found that HIF-1α was highly expressed in IDD group. However, the mechanism underlying the increase in HIF-1α expression was not clarified. Studies have shown that TNF-α can promote the DNA activity of HIF-1α under normal oxygen conditions leading to enhanced translation, transcription, and expression(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). HIF-1α is a major transcription factor in the hypoxic response and can activate the transcription of the gene encoding BCL-2 interacting protein 3 (Bnip3), thereby inducing mitochondrial selective autophagy(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).In the context of inflammatory stimulation, oxidative stress, and hypoxia, the activation of autophagy during early IDD has a certain protective effect and becomes an adaptive pathway that promotes cell health and survival (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).In addition, high VEGF expression during IDD promotes the generation of new biochemical blood vessels in the intervertebral disc (IVD), and studies have demonstrated that angiogenesis plays a bidirectional regulatory role in the progression of IDD to maintain the biological functions of the surrounding environment and cells(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). However, the roles of the HIF-1α/Bnip3 axis in promoting autophagy and VEGF in promoting neovascularization in the progression of IDD remain unclear.\u003c/p\u003e \u003cp\u003eIn this study, the differences in TNF-α, HIF-1α, and VEGF expression between IDD rats and normal rats were observed in vivo, and the effects of inhibiting HIF-1α expression on TNF-α and VEGF expression in IDD rats were further verified. Then, the effects of inhibiting HIF-1α expression on HIF-1α/Bnip3/VEGF signal axis autophagy levels and IDD progression in IDD rats were investigated. Finally, the effects of HIF-1α knockdown on VEGF expression in TNF-α-induced nucleus pulposus cells (NPCs), HIF-1α/Bnip3/VEGF signaling axis autophagy levels, and IDD progression were verified in vitro to explore whether this signaling axis is involved in IDD progression via autophagy regulation.\u003c/p\u003e"},{"header":"Experimental materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eExperimental materials\u003c/h2\u003e\n \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\n \u003ch2\u003eEstablishment of IDD animal models\u003c/h2\u003e\n \u003cp\u003eAll animal experiments were performed in accordance with the Guiding Principles of the Care and Use of Animals and approved by the Animal Experimental Ethics Committee of Nanjing University of Chinese Medicine. Male SD rats (250\u0026thinsp;\u0026plusmn;\u0026thinsp;20 g, n\u0026thinsp;=\u0026thinsp;60) were purchased from Beijing Weitonglihua Experimental Animal Technology Co., The rats were randomly divided into the sham operation (Sham), model (M), HIF-1\u0026alpha; inhibitor (YC-1), and solvent groups (DMSO), with 15 participants each in the Sham and M groups and 10 participants each in the YC-1 and DMSO groups. After 1 week of adaptive feeding, the modeling intervention began, with fibro annular puncture used to prepare the disc degeneration model(\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e). On the day after the modeling, two rats from each group were randomly selected for magnetic resonance imaging (MRI)examination, and the signal intensity of the annulus fibrosus and nucleus pulposus was observed under T2-weighted MRI. The success of annulus fibrosus puncture was determined by the blurred boundary of annulus fibrosus and the decreased signal intensity of nucleus pulposus. The intervention began 3 days after the modeling was finished. The Sham and M groups were intraperitoneally injected with normal saline (0.1ml/100g), the YC-1 group was intraperitoneally injected with 5%DMSO\u0026thinsp;+\u0026thinsp;40%PEG300\u0026thinsp;+\u0026thinsp;5%Tween80\u0026thinsp;+\u0026thinsp;50%saline (YC-1,1mg/kg;0.1ml/100g), and the solvent DMSO group was injected with 5%DMSO\u0026thinsp;+\u0026thinsp;40%PEG300\u0026thinsp;+\u0026thinsp;5%Tween80\u0026thinsp;+\u0026thinsp;50%saline; (0.1ml/100g) three times a week for a total of 8 weeks.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eExtraction and intervention of NPCs\u003c/h2\u003e\n \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e\n \u003ch2\u003eExtraction and culture of NPCs\u003c/h2\u003e\n \u003cp\u003eMale SD rats (220\u0026thinsp;\u0026plusmn;\u0026thinsp;20g, n\u0026thinsp;=\u0026thinsp;10) were sacrificed for cervical dislocation, and disinfected in 75% ethanol for 10 min. The whole spine was separated from the back under aseptic conditions, and the nucleus pulposum tissue from L\u003csub\u003e1\u003c/sub\u003e-L\u003csub\u003e5\u003c/sub\u003e was separated under a microscope and cut into fragments of approximately 1mm\u003csup\u003e3\u003c/sup\u003e. The tissue was digested with 0.2% type II collagenase (Gibco, USA) at 37\u0026deg;C for 8 h, screened with 200 mesh and centrifuged for cell precipitation. The cells were then cultured in DMEM/F12 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin and streptomycin dual antibody (NCM, China) under the standard incubation conditions (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e) (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). Passage was performed when the cells reached 80\u0026ndash;90% confluence, and cells from within three generations were used for all in vitro experiments.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eNPCs in vitro intervention and grouping\u003c/h2\u003e\n \u003cp\u003eFor the in vitro experiments, NPCs were divided into the Lv-NC-H group (NC-H group) and Lv-HIF-1\u0026alpha; transfection group (H group). After transfection with the corresponding lentivirus, TNF-\u0026alpha; (300-01A, Peprotech, USA) (10ng/ml) (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e)was then induced under standard incubation conditions (37\u0026deg;C, 5%CO2) for 24h.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eLentivirus transfection\u003c/h2\u003e\n \u003cp\u003eCorues Biotechnology (Nanjing, Nanjing, China) designed and constructed a lentiviral vector expressing GFP labeled HIF-1\u0026alpha; (NM_024359) in the PLv3LLTr-ECMV-ZSGRECn-PGK-Puro-U6 plasmid according to the standard protocol. For viral transduction, NPCs were inoculated and lentivirus infection was achieved after reaching 40\u0026ndash;60% confluence with a multiplicity of infection (MOI) of 50. After transfection for 24 h, the culture medium was changed every other day. When the transfected NPCs reached 80\u0026ndash;90% confluence, they were used in further experiments to detect the knockdown efficiency and expression level of the HIF-1\u0026alpha; gene by immunofluorescence and qPCR.\u003c/p\u003e\n \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\n \u003ch2\u003eExperimental method\u003c/h2\u003e\n \u003cdiv id=\"Sec10\" class=\"Section4\"\u003e\n \u003ch2\u003eMRI\u003c/h2\u003e\n \u003cp\u003eOn the day after modeling, two rats in each group were randomly selected for MRI examination. At 8 weeks after the intervention, Four rats from each group were randomly selected for MRI examination. The changes and degeneration of IVD signal intensity were observed using T2-weighted MRI, and Pfirrmann grading was performed under the guidance of professional physicians.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003ePathological staining\u003c/h2\u003e\n \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e\n \u003ch2\u003eHE staining\u003c/h2\u003e\n \u003cp\u003eThree rats were randomly selected from each group, After administering anesthesia, L\u003csub\u003e5\u003c/sub\u003e-L\u003csub\u003e6\u003c/sub\u003e IVD tissues were taken from marked locations, f fixed in 4% paraformaldehyde, decalcified, and embedded in paraffin. Subsequently, 4\u0026micro;m paraffin sections were produced from the embedded tissues, These sections were dewaxed, dehydrated with hematoxylin-eosin staining solution, and sealed, and the disc histopathological changes were observed under an optical microscope at 50\u0026times; and 400\u0026times; magnification.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eMasson\u0026rsquo;s staining\u003c/h2\u003e\n \u003cp\u003eParaffin sections were dewaxed in water, immersed in Masson\u0026rsquo;s stain, differentiated with 1% hydrochloric acid alcohol, rinsed and differentiated with 1% acetic acid, dehydrated with anhydrous ethanol, and examined under a microscope (50\u0026times;, 400\u0026times;) after transparent sealing. Images were then collected and analyzed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eSafranin O-fast green staining\u003c/h2\u003e\n \u003cp\u003eParaffin sections were dewaxed into water, immersed in solid green dye for approximately 10 min, differentiated and rinsed until colorless, and then placed in safranine O dye for 30 seconds for staining. Finally, the sections underwent conventional dehydration and were made transparent before being sealed with neutral gum. Photographs were taken with an optical microscope (50\u0026times;, 400\u0026times;) and used for analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\n \u003cp\u003eIVD tissue from rats in each group were collected, and paraffin-embedded sections were prepared, and dehydrated, Endogenous catalase was blocked using 3% hydrogen peroxide, and the sections were then closed with 3% BSA at room temperature for 1 hour, Rabbit antirat primary antibodies (HIF-1\u0026alpha;, 1:200, GB114936, Servicebio; Bnip3, 1:1000, GB111204, Servicebio; Beclin-1, 1:200, GB11228, Servicebio) were incubated overnight at 4℃. After washing with PBS, HRP was added to label goat anti-rabbit secondary antibody (Servicebio, 1:200, GB23303), and DAB was used for color development. Restaining was then performed with hematoxylin, Hydrochloric acid ethanol differentiation was performed, and the sections were then dehydrated and sealed. The expression of HIF-1\u0026alpha;, Bnip3 and Beclin-1 positive cells in the IVD tissue sections was observed under the microscope. The hematoxylin-stained nuclei were blue, and the positive expression of DAB was brown-yellow. Three fields (400\u0026times;) were randomly selected in each section under the microscope and the percentage of positive cells was counted using ImageJ.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eELISA\u003c/h2\u003e\n \u003cp\u003eThe rats were anesthetized with isoflurane, blood was collected through the abdominal aorta, and serum was then separated by centrifugation at 4℃ and 3500r\u0026middot;min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e for 15min. The expression levels of serum TNF-\u0026alpha; and VEGF in rats were detected using the ELISA kit (AF-01587R1; AF-10645R1, Aifang Biotechnology Co., Hunan, China) was used to detect the expression levels of serum TNF-\u0026alpha; and VEGF in rats. NPCs cells were cultured in 6-well plates and transfected with Lv-shHIF1\u0026alpha;. They were then induced with TNF-\u0026alpha; (10ng/ml) and divided into the NC-H group and H group. After 24 hours, the supernatant of the cell culture was extracted to detect the expression level of VEGF in NPCs.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5 Transmission electron microscopy\u003c/h2\u003e\n \u003cp\u003eThe L\u003csub\u003e4\u003c/sub\u003e-L\u003csub\u003e5\u003c/sub\u003e IVDs were removed from three rats, and the nucleus pulposus was removed, cut into approximately 1mm\u003csup\u003e3\u003c/sup\u003e pieces and placed in glutaraldehyde at a temperature of 4℃ and fixed for a duration of 2 h. Then, the pieces were washed with phosphate buffer, fixed again using a solution containing 3% glutaraldehyde and 1% osmic acid for a period of 5 h, and embedded in epoxy resin. The embedded tissue was sliced into ultra-thin sections measuring 50nm and then stained with 2% uranium acetate and 0.2% lead citrate. Finally, transmission electron microscopy at a magnification of 10000\u0026times; was employed to analyze the resulting images. NPCs cells were cultured in 6-well plates for the cell samples, transfected with Lv-shHIF-1\u0026alpha; and induced with TNF-\u0026alpha; (10ng/ml). The cells were divided into the NC-H group and H group. After 24 h, the cells were extracted and precipitated using the same procedure as before.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6 Western blot\u003c/h2\u003e\n \u003cp\u003eThe total protein of NPCs and tissues was extracted with RIPA lysate and quantified according to the instructions of the BCA kit (NCM, Nanjing, China). SDS-PAGE sample loading buffer was added and heated for 10 min. Protein samples were subjected to SDS-P AGE electrophoresis, transferred to a PVDF membrane, and blocked with 5% milk powder at room temperature for 2 h. The PVDF membrane was then incubated with the following primary antibodies(VEGF,1:1000,Abcam; HIF1\u0026alpha;,1:1000,Abcam; P62,1:1000,Abcam; LC3-II,1:2000,Abcam; Bnip3,1:1000,CST; Beclin-1,1:1000,CST; beta-actin,1:5000, Proteintech); Then the membrane was incubated with an enzyme-labeled goat anti-rabbit secondary antibody( goat anti-rabbit, 1:10000, Abcam, ab205718) at room temperature for 2 h. Finally, the PVDF membranes were incubated with an ECL chemiluminescence solution (Yeasen, Shanghai, China), and the protein bands were detected using a gel imaging system (Tanon, Shanghai, China). Grayscale values were measured using ImageJ software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eRT-qPCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated from NPCs and IVD tissues using a Fast Pure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China).The isolated RNA was then reverse-transcribed into cDNA using a HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China).RT-qPCR was performed using Ace Q Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China).A PCR automatic serialization analyzer (ABI Quant Studio 3, USA) was set to pre-denaturation at 95℃ for 10 min, pre-denaturation at 95℃ for 15 s, annealing at 60℃ for 60 s, and extension for 40 cycles. Ct values of each target gene were obtained with GAPDH as the internal reference gene, a Semi-quantitative calculation and analysis were carried out using the 2^\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method. The primers are shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunofluorescence\u003c/h2\u003e\n \u003cp\u003eAfter dewaxing the paraffin sections paraffin sections in water and repairing the antigen, the fixed solution was left at room temperature for 10 min, The sections were washed in washing solution was used to wash three times, followed by sealing the solution at room temperature for 1 h, and VEGF, HIF-1\u0026alpha; and P62/LC3-II rabbit monoclonal antibodies were then added (1:500; 1:500; 1\u0026micro;g/ml; 1\u0026micro;g/ml, Abcam) and incubated overnight at 4℃. Subsequently, fluorescently labeled goat anti-rabbit IgG was added at room temperature for 1 h, anti-fluorescence quencher was added, and the sample was observed and photographed under a fluorescence microscope\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9 Statistical methods\u003c/h2\u003e\n \u003cp\u003eExperimental data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. SPSS 20.0 software was used to compare the differences among the groups. GraphPad 8.0 was used to draw relevant data graphs. Independent-samples t-test was used for, two groups of samples, and significant differences between two or more groups were analyzed using one-way analysis of variance or Tukey\u0026rsquo;s test. Additionally, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Experimental result","content":"\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n\u003ch2\u003eAfter modeling intervention, IDD was obvious, and TNF-\u0026alpha; expression and HIF-1\u0026alpha;/Bnip3/VEGF axis autophagy levels increased\u003c/h2\u003e\n\u003cp\u003eThe rat IDD model was established by fibro annular puncture, and IDD and related molecular level expression were evaluated 8 weeks later, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. Eight weeks after modeling, four rats in each group were examined by MRI before sampling. The results indicated that significant degeneration of IVD tissue occurred, as shown by the lower L\u003csub\u003e4\u003c/sub\u003e-L\u003csub\u003e6\u003c/sub\u003e signal intensity and higher Pfirrmann score under T2-weighted MRI in the M group compared with that in the Sham operation group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb-c). Pathological results showed that in the M group, the nucleus pulposus coagulated and crumped, the annulus fibrosus was disorganized, and proteoglycan and collagen were lost, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed-f. qPCR results showed that the mRNA expressions of type II collagen and proteoglycan in the annulus was decreased, and that of matrix catabolic markers matrix metalloproteinase 13 (MMP13) and A disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS-5) were increased. This confirmed the evident degeneration of the IVD 8 weeks after the model was made, as depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg-j. In addition, the ELISA results showed that the expression of inflammatory factor TNF-\u0026alpha; and growth factor VEGF significantly increased in the serum of rats in the M group, as shown in the Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ek-l. The qPCR results also showed that mRNA expression levels of HIF-1\u0026alpha;, Bnip3, and VEGF were significantly increased in the M group, as shown in the Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003em-o figure. Transmission electron microscopy results showed that compared with the Sham operation group, the number of autophagosomes and lysosomes in the M group was significantly increased, reflecting the increased autophagy flux in the M group, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ep. In addition, immunofluorescence results showed that the co-expression of LC3-II/LC-I and P62 manifested a distinct pattern in the progression of IDD, and the fluorescence intensity of LC3 was enhanced in the M group than in the Sham group, while the fluorescence intensity of P62 was weakened, indicating that autophagy was activated, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eq.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n\u003ch2\u003eHIF-1\u0026alpha; inhibitor YC-1 decreased the expression of TNF-\u0026alpha;, HIF-1\u0026alpha;, and VEGF expression during IDD\u003c/h2\u003e\n\u003cp\u003eAfter 8 weeks, ELISA was used to detect TNF-\u0026alpha; and VEGF expression in the serum of rats in each group after the modeling intervention. qPCR and WB were used to detect the expression of HIF-1\u0026alpha; and VEGF mRNA and protein in the rats in each group. Immunofluorescence method were used to observe the protein co-expression of HIF-1\u0026alpha; and VEGF in each group, as depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The ELISA results indicated that TNF-\u0026alpha; and VEGF expression in the M group was significantly higher than that in the Sham group. However, this situation was reversed after YC-1 intervention, with lower TNF-\u0026alpha; and VEGF expression induced in the YC-1 group than the DMSO group, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea-b. The qPCR and WB results showed that HIF-1\u0026alpha; and VEGF mRNA and protein expression was significantly increased in the M group compared with the Sham group but decreased in the YC-1 group. Moreover, the difference between the YC-1 group and the solvent DMSO group was significant. The use of solvent DMSO did not alter the effects of the inhibitor YC-1, as shown in the Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec-g. Moreover, the immunofluorescence results showed the fluorescence intensity of HIF-1\u0026alpha; and VEGF protein co-expression in the IVD and nucleus pulposus of rats in the M group It should be noted that, and after YC-1 intervention, the protein fluorescence intensity in the YC-1 group was significantly lower than that in the model group. After the YC-1 intervention, the protein fluorescence intensity in the YC-1 group was significantly lower than that in the M group, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eh.\u003c/p\u003e\n\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\n\u003ch2\u003eHIF-1\u0026alpha; inhibitor YC-1 reduced autophagy levels in the HIF-1\u0026alpha;/Bnip3 axis during IDD\u003c/h2\u003e\n\u003cp\u003eAfter 8 weeks, samples were collected, and changes in the number of autophagosomes and lysosomes in the IVDs of rats in each group were observed under transmission electron microscopy. qPCR and WB were used to detect the expression levels of HIF-1\u0026alpha;/Bnip3 axis autophagy-related mRNA and proteins, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. The transmission electron microscopy results showed that the number of autophagosomes and lysosomes significantly increased in the M group compared with the Sham group, thus reflecting an increase in autophagy flux in the M group. However, the YC-1 intervention reversed this situation, and the number of autophagosomes and lysosomes in the YC-1 group was significantly reduced, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea. The qPCR and WB results demonstrated that the mRNA and protein levels of HIF-1\u0026alpha;/Bnip3 axis autophagy-related molecules (Bnip3, Beclin-1, LC3-II) were significantly increased in the M group compared to the Sham group. Furthermore, P62 expression was significantly decreased, indicating a significant increase in autophagy level in the M group. However, after YC-1 intervention, the mRNA and protein expression of pathway-related molecules and autophagy molecules significantly decreased. Additionally, P62 significantly increased, indicating that the YC-1 intervention reduced autophagy levels during IDD, However, the DMSO intervention did not reverse this change, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb-j. To further verify the changes in protein levels of HIF-1\u0026alpha;/Bnip3 axis autophagy-related molecules, immunohistochemistry was performed to observe the proportion of positive cells in each group of rats after the modeling intervention. In addition, immunofluorescence double staining was used to observe the co-expression of autophagy flux LC3-II and P62 in each group after the modeling intervention, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. Consistent with the qPCR and WB results in the previous study, the YC-1 intervention reduced the level of HIF-1\u0026alpha;/Bnip3 axis autophagy-related molecules in the IDD process. This reduction was evident in the significant decrease in the number of cells positive for HIF-1\u0026alpha;, Bnip3, and Beclin-1 in the YC-1 group compared to that in the M and DMSO groups, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea-d. In addition, the immunofluorescence results showed that the co-expression of LC3-II/LC-I and P62 exhibited contrasting patterns during the progression of IDD. This finding aligns with the previousiy reported results, where the fluorescence intensity of LC3-II/LC-I was shown to increase in the M group compared to the Sham group, while the fluorescence intensity of P62 was shown to decrease. However, the intervention of YC-1 altered this trend, as depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\n\u003ch2\u003e\u003cstrong\u003eThe HIF-1\u0026alpha; inhibitor YC-1 exacerbated the changes in IDD\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eAfter 8 weeks, four rats in each group were selected for MRI examination before sampling. Then IVD samples were collected for histopathological analysis and qPCR to detect IDD-related mRNA expression, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e. The MRI results showed that compared with the Sham group, L\u003csub\u003e4\u003c/sub\u003e-L\u003csub\u003e6\u003c/sub\u003e signal intensity was decreased in group M under T2-weighted MRI. Additionally, the Pfirrmann score and IDD degree were increased in group M. In contrast, the YC-1 group showed a significantly decreased T2-weighted MRI signal and an increased Pfirrmann score compared to the M and DMSO groups. These differences were statistically significant. Thus, the YC-1 group showed intensified the changes in IDD, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea-b. HE, Masson and safranin O-fast green staining showed that YC-1 aggravated the pathological changes of IVD in the IDD model compared with the M and DMSO groups, that is, nucleus pulposus coagulation and shrinkage were more obvious in the YC-1 group, annulus fibrosus disorder was more serious, degeneration was deeper, and the loss of proteoglycan and collagen was more pronounced, as shown in figures Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec-e. In addition, the qPCR results demonstrated that 8 weeks after the modeling intervention, the YC-1 intervention intensified the changes in IDD. Compared with the M and DMSO groups, the mRNA expressions of type II collagen and proteoglycan in the IVD was significantly reduced, and that of MMP13 and ADAMTS5 was significantly increased, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ef-i. These findings suggest that intervention with the HIF-1\u0026alpha; inhibitor YC-1 accelerated the progression of IDD.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\n\u003ch2\u003eLv-shHIF-1\u0026alpha; resulted in decreased expression of both HIF-1\u0026alpha; and VEGF\u003c/h2\u003e\n\u003cp\u003ePrimary rat nucleus pulposus cells (NPCs) were extracted and transfected with Lv-shHIF-1\u0026alpha;. The transfection efficiency was verified by immunofluorescence, and the knockdown efficiency was detected by qPCR, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e. The results indicated that at a MOI of 50, the highest fluorescence transfection efficiency and knockdown gene expression efficiency of Lv-shHIF-1\u0026alpha; were observed, and the mRNA expression of HIF-1\u0026alpha; was significantly reduced after knockdown, as demonstrated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea-b. Subsequently, NPCs were transfected for 24h with Lv-shHIF-1\u0026alpha; were stimulated with TNF-\u0026alpha; (10ng/ml), and ELISA was used to detect VEGF expression in the cell supernatant. WB and qPCR were employed to assess the mRNA expression and protein levels of HIF-1\u0026alpha; and VEGF in the NPCs. The ELISA results revealed that VEGF expression in TNF-\u0026alpha;-induced NPCs was significantly decreased after HIF-1\u0026alpha; knockdown, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ec. Furthermore, the qPCR and WB results demonstrated that the expression levels of HIF-1\u0026alpha; and VEGF were significantly reduced in the knockdown group compared to the NC-H group, as depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ed-h.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\n\u003ch2\u003eLv-shHIF-1\u0026alpha; decreased the HIF-1\u0026alpha;/Bnip3 axis autophagy levels in TNF-\u0026alpha;-induced NPCs and accelerated the IDD progression\u003c/h2\u003e\n\u003cp\u003eNPCs were transfected with Lv-shHIF-1\u0026alpha; and TNF-\u0026alpha; (10ng/ml) induced for 24 h, and then the changes in the number of autophagosomes and lysosomes were observed under transmission electron microscopy. The mRNA expression and protein level of autophagy-related elements were detected via qPCR and WB, as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e. The results indicated that the number of autophagosomes and lysosomes in the NC-H group was significantly decreased compared with that in the knockdown group, This finding suggests that the autophagy flux of NPCs is significantly reduced after HIF-1\u0026alpha; knockdown, as illustrated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ea. The qPCR and WB results demonstrated a significant decrease in autophagy-related mRNA and protein levels of the HIF-1\u0026alpha;/Bnip3 axis in group H compared to the NC-H group, Lv-shHIF-1\u0026alpha; effectively reduced the autophagy level of TNF-\u0026alpha; induced NPCs. Interestingly, after HIF-1\u0026alpha; knockdown, autophagy-related indicator expression decreased to some extent. Contrary to previous observations, in which P62 expression increased while LC3-II/I expression decreased, both P62 and LC3-II/I showed a simultaneous decrease, which may be attributed to the restriction of autophagy flux in NPCs by Lv-shHIF-1\u0026alpha;, as indicated by Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eb-j. Additionally, the qPCR results indicated that IDD degradation was intensified in NPCs after HIF-1\u0026alpha; knockdown, as indicated by the significantly lower mRNA expressions of COL2A1 and AGGRECAN in the knockdown group compared with the NC-H group and significant increase in the mRNA expression of MMP13 and Adamts5, as depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003ek-n. These results indicated that after knocking down NPCs with Lv-shHIF-1\u0026alpha;, the autophagy flux of NPCs induced by TNF-\u0026alpha; decreased significantly, This decrease was accompanied by the further intensification of IDD.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study suggests that high expression of inflammatory factors TNF-\u0026alpha;, HIF-1\u0026alpha; and VEGF may be associated with changes in autophagy flux during the early stage of IDD. Additionally, HIF-1\u0026alpha; blocking led to a decrease in autophagy flux and exacerbated the progression of IDD in vivo and in vitro. These findings suggest that the HIF-1\u0026alpha;/Bnip3/VEGF axis may promote the death of NPCs by regulating the autophagy level of NPCs, thereby playing a protective role against IVD and delaying the IDD induced by the inflammatory factor TNF-\u0026alpha;.\u003c/p\u003e\n\u003cp\u003eAlthough the pathogenesis of IDD is complex, the involvement of inflammatory mediators is an important cause of its accelerated progression(\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e). During the progression of IDD, caused by the increased expression of pro-inflammatory cytokines (such as TNF-\u0026alpha;) in NPCs leads to the disturbance of disc mechanical structure and further degradation of the ECM and deterioration of IVD microenvironment, These results are consistent with the observations in our previous animal experiments(\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e). In addition, we also found that the high expression of TNF-\u0026alpha; is accompanied by the high expression of HIF-1\u0026alpha; and VEGF, which is also common in diseases similar to IDD. However, the role of HIF-1\u0026alpha; and VEGF in the progression of IDD remains unclear(\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e). Oxygen tension in the cell living environment is an important factor in regulating VEGF expression and angiogenesis, and HIF-1\u0026alpha; can directly induce VEGF expression under certain conditions and promote the formation of new blood vessels(\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e). Risbud etal. (\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e) proposed the second of the three stages of disc degeneration and suggested that the formation of neovascularization and the growth of nerves into the structurally deficient disc tissue further amplified the inflammatory effect. Moreover, they revealed that HIF-1\u0026alpha; was likely involved in regulating the inflammatory response of the IVD microenvironment. Regarding the role of the generation of new biochemical blood vessels in IVD in IDD, some scholars believe that the generation of new blood vessels may be an adaptive response of the body to various influencing factors or a spontaneous repair mechanism, This response not only increases blood circulation, improves IVD nutrition, and regulates inflammatory response but also plays an important role in the progression of IDD(\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e).Our in vitro experiment results showed that the Lv-shHIF-1\u0026alpha; intervention decreased HIF-1\u0026alpha; and VEGF expression in TNF-\u0026alpha;-induced NPCs. The ELISA results also showed that the knockdown of HIF-1\u0026alpha; reversed the pro-expression effect of TNF-\u0026alpha; on VEGF. This point has also been demonstrated via qPCR and WB. In addition, while HIF-1\u0026alpha; and VEGF were decreased, the expression of type II collagen and proteoglycan expression was decreased, and MMP13 and ADAMTS5 expression was increased. This suggests that the inactivation of the HIF-1\u0026alpha;/VEGF axis has an inhibitory effect on the inflammatory microenvironment and cell biological function of IVD, which further aggravates IDD.\u003c/p\u003e\n\u003cp\u003eDue to the special physiological environment of IVD, HIF-1\u0026alpha; accumulates and migrates into the nucleus during hypoxia, and HIF-1\u0026alpha; binds to the functional hypoxia response element (HRE) in the Bnip3 promoter to activate the transcription of downstream pro-death target genes(\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e).Activation of Bnip3 dissociates Beclin-1 from Bcl-XL and Bcl-2, thereby releasing Beclin-l to activate autophagy(\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e). The activation of autophagy at the early stage of IDD has a certain protective effect on IVD to a certain extent and serves as an adaptive pathway to promote the health and survival of NPCs(\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e).In addition, Pereira etal. (\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e) found that activation of HIF-1\u0026alpha;/Bnip3 promoted VEGF expression in tumor diseases, which inspired us to investigate its role in IDD. Therefore, by establishing a rat IDD model and performing HIF-1\u0026alpha; inhibitor intervention, this study further explored the effect of YC-1 on the HIF-1\u0026alpha;/Bnip3/VEGF axis autophagy level and the progression of IDD. The results of the in vivo experiment showed that autophagy flux increased compared to the control group. The expressions of autophagy pathway related molecules Bnip3 and Beclin-1 was also significantly increased based on the qPCR and WB results. P62 expression increased, LC3-II/I expression decreased, and autophagy levels decreased. The immunohistochemistry and immunofluorescence results also confirmed this view. However, the intervention with the HIF-1\u0026alpha; inhibitor YC-1 reversed this result. Compared with the DMSO group, the number of autophagosomes and lysosomes in the YC-1 inhibitor group was significantly reduced, and the expressions of Bnip3 and Beclin-1 molecules related to the autophagy pathway was also inhibited to a certain extent, suggesting that HIF-1\u0026alpha; played a key role in this process, and profoundly affected the subsequent changes in autophagy levels. The decrease of autophagy level was accompanied by the further intensification of IDD, which was manifested by an increase in the Pfirrmann score. The coagulation and contraction of nucleus pulposus and the disordered arrangement of fibrous annulus were observed via pathological staining. Type II collagen and proteoglycan expression decreased, and MMP13 and ADAMTS5 expression increased in the IVD tissue. This indicates that the intervention with the HIF-1\u0026alpha; inhibitor YC-1 reduced autophagy levels in NPCs, aggravated changes in IDD, and affected the progression of IDD. The in vitro results also showed that Lv-shHIF-1\u0026alpha; decreased the autophagy level of NPCs after the intervention, which was mainly reflected in the reduction of the number of autophagosomes and lysosomes. The qPCR and WB results showed that the expression of autophagy pathway related molecules Bnip3, Beclin-1, P62 and LC3-II/I were downregulated and autophagy flux was decreased. These findings also confirm that the HIF-1\u0026alpha; inhibitors YC-1 and LvshHIF-1\u0026alpha; accelerate the progression of IDD by reducing the autophagy level of NPCs, which also indicates that HIF-1\u0026alpha; may regulate autophagy and neovascularization by activating the HIF-1\u0026alpha;/ Bnip3/VEGF axis to delay TNF-\u0026alpha;-induced IDD.\u003c/p\u003e\n\u003cp\u003eIn summary, during the progression of IDD, the HIF-1\u0026alpha;/ Bnip3/VEGF axis may regulate NPCs autophagy and neovascularization in response to TNF-\u0026alpha;-induced IDD and promote NPCs death, thereby protecting IVD tissue and delaying IDD progression. However, the intervention with HIF-1\u0026alpha; blockers reduced autophagy levels and VEGF expression and further aggravated the progression of IDD, which further supported our hypothesis. Our work provides insights for further exploring targeted IDD therapy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eIDD, intervertebral disc degeneration; TNF-\u0026alpha;, tumor necrosis factor-alpha; IVD, intervertebral disc; HIF-1\u0026alpha;, hypoxia-inducing factor-1\u0026alpha;; VEGF, vascular endothelial growth factor; DMSO, dimethyl sulfoxide; MRI, magnetic resonance imaging; HE, hematoxylin and eosin; NPC, nucleus pulposus cell; COL2A1, collagen type II alpha 1; MMP13, matrix metalloproteinase 13; ADAMTS5, A disintegrin and metalloproteinase with thrombospondin motifs 5; Bnip3, BCL-2 interacting protein 3\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eThis study was completed in Nanjing University of Chinese Medicine. With the support of the Laboratory for New Techniques of Restoration and Reconstruction of Orthopedics and Traumatology and the Animal Experiment Center.\u003c/p\u003e\n\u003ch2\u003eCredit authorship contribution statement\u003c/h2\u003e\n\u003cp\u003eXiaoxian Sun: Data curation, performed cell Culture, analyzed data, wrote the manuscript. Xue Bai and Zitong Zhao: assisted with the data analysis, writing and reviewing. Lining Wang: helped with writing and reviewing. Mengmin Liu and Pengcheng Tu: helped with Correction and modification. Shun Lin and Zheng Yan: provided the experimental assistance. Zhiqiang Wang and Qinfeng Zhou: Methodology. Yongfeng Yuan: helped with the MRI and Disc degeneration rating. Xiaofeng Li: provided technical and theoretical guidance. Jintao Liu and Yong Ma: conceived the concept and supervised the project. Yang Guo: Conceptualization and provided the design of experiments. Xiaoxian Sun, Xue Bai and Zitong Zhao contributed equally to the study. Corresponding author: Jintao Liu, Yong Ma and Yang Guo are all corresponding authors; Yang Guo is the first corresponding author, who is responsible for responding to newsletters during the submission period.\u003c/p\u003e\n\u003ch2\u003eFunding Sources\u003c/h2\u003e\n\u003cp\u003eFinancial support for this study was provided by the Natural Science Foundation of China (Reference Grant No.82074467,82374220,and82374473), NATCM\u0026apos;s Project of High-level Construction of Key TCM Disciplines(NATCM\u0026apos;s Human Education Letter[2023]No. 85), Training of leading TCM talents in Jiangsu Province([2023]No.17),Jiangsu Province Traditional Chinese medicine science and technology development program([2023]No.19, MS2022080), The Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province (KYCX23-2202).\u003c/p\u003e\n\u003ch2\u003eCompeting interests\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were performed in accordance with Guiding Principles of the Care and Use of Animals and approved by the Animal Experimental Ethics Committee of Nanjing University of Chinese medicine. (No. 202210A009)\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eXiaoxian Sun: Data curation, performed cell Culture, analyzed data, wrote the manuscript. Xue Bai and Zitong Zhao: assisted with the data analysis, writing and reviewing. Lining Wang: helped with writing and reviewing. Mengmin Liu and Pengcheng Tu: helped with Correction and modification. Shun Lin and Zheng Yan: provided the experimental assistance. Zhiqiang Wang and Qinfeng Zhou: Methodology. Yongfeng Yuan: helped with the MRI and Disc degeneration rating. Xiaofeng Li: provided technical and theoretical guidance. Jintao Liu and Yong Ma: conceived the concept and supervised the project. Yang Guo: Conceptualization and provided the design of experiments. Xiaoxian Sun, Xue Bai and Zitong Zhao contributed equally to the study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhou M, Wang H, Zeng X, Yin P, Zhu J, Chen W, et al. Mortality, morbidity, and risk factors in China and its provinces, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2019;394(10204):1145-58. doi: 10.1016/S0140-6736(19)30427-1. PubMed PMID: 31248666; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eKirnaz S, Capadona C, Wong T, Goldberg JL, Medary B, Sommer F, et al. Fundamentals of Intervertebral Disc Degeneration. World Neurosurg. 2022;157:264-73. doi: 10.1016/j.wneu.2021.09.066. PubMed PMID: 34929784; PubMed Central PMCID: PMCQ3.\u003c/li\u003e\n\u003cli\u003eZhao R, Liu W, Xia T, Yang L. Disordered Mechanical Stress and Tissue Engineering Therapies in Intervertebral Disc Degeneration. Polymers (Basel). 2019;11(7). doi: 10.3390/polym11071151. PubMed PMID: 31284436; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003ePan H, Li H, Guo S, Wang C, Long L, Wang X, et al. The mechanisms and functions of TNF-\u0026alpha; in intervertebral disc degeneration. Exp Gerontol. 2023;174:112119. doi: 10.1016/j.exger.2023.112119. PubMed PMID: 36758650; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eOu-Yang DC, Kleck CJ, Ackert-Bicknell CL. Genetics of Intervertebral Disc Degeneration. Curr Osteoporos Rep. 2023;21(1):56-64. doi: 10.1007/s11914-022-00769-0. PubMed PMID: 36680730; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eRoh EJ, Darai A, Kyung JW, Choi H, Kwon SY, Bhujel B, et al. Genetic Therapy for Intervertebral Disc Degeneration. International journal of molecular sciences. 2021;22(4). doi: 10.3390/ijms22041579. PubMed PMID: 33557287; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eYang L, Yu C, Fan X, Zeng T, Yang W, Xia J, et al. Dual-dynamic-bond cross-linked injectable hydrogel of multifunction for intervertebral disc degeneration therapy. J Nanobiotechnology. 2022;20(1):433. doi: 10.1186/s12951-022-01633-0. PubMed PMID: 36182921; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eChen J, Yang X, Feng Y, Li Q, Ma J, Wang L, et al. Targeting Ferroptosis Holds Potential for Intervertebral Disc Degeneration Therapy. Cells. 2022;11(21). doi: 10.3390/cells11213508. PubMed PMID: 36359904; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eXu J, Shao T, Lou J, Zhang J, Xia C. Aging, cell senescence, the pathogenesis and targeted therapies of intervertebral disc degeneration. Front Pharmacol. 2023;14:1172920. doi: 10.3389/fphar.2023.1172920. PubMed PMID: 37214476; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eWang Y, Che M, Xin J, Zheng Z, Li J, Zhang S. The role of IL-1\u0026beta; and TNF-\u0026alpha; in intervertebral disc degeneration. Biomed Pharmacother. 2020;131:110660. doi: 10.1016/j.biopha.2020.110660. PubMed PMID: 32853910; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eWang S, Liu C, Sun Z, Yan P, Liang H, Huang K, et al. IL-1\u0026beta; increases asporin expression via the NF-\u0026kappa;B p65 pathway in nucleus pulposus cells during intervertebral disc degeneration. Sci Rep. 2017;7(1):4112. doi: 10.1038/s41598-017-04384-3. PubMed PMID: 28646230; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eHe R, Wang Z, Cui M, Liu S, Wu W, Chen M, et al. HIF1A Alleviates compression-induced apoptosis of nucleus pulposus derived stem cells via upregulating autophagy. Autophagy. 2021;17(11):3338-60. doi: 10.1080/15548627.2021.1872227. PubMed PMID: 33455530; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eZhang L, Li X, Kong X, Jin H, Han Y, Xie Y. Effects of the NF‑\u0026kappa;B/p53 signaling pathway on intervertebral disc nucleus pulposus degeneration. Molecular Medicine Reports. 2020;22(3):1821-30. doi: 10.3892/mmr.2020.11288. PubMed PMID: 32705171; PubMed Central PMCID: PMCQ3.\u003c/li\u003e\n\u003cli\u003eDai F, Yu P, Yu Z, Jiang H, Ma Z, Liu J. Yiqi Huoxue Recipe Delayed Intervertebral Disc Degeneration by Activating Autophagy. Front Pharmacol. 2021;12:705747. doi: 10.3389/fphar.2021.705747. PubMed PMID: 34483910; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eHa K-Y, Koh I-J, Kirpalani PA, Kim Y-Y, Cho Y-K, Khang G-S, et al. The expression of hypoxia inducible factor-1alpha and apoptosis in herniated discs. Spine (Phila Pa 1976). 2006;31(12):1309-13. PubMed PMID: 16721291; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eKim H, Jeong H, Lee J, Cha H-S, Koh E-M, Ahn JK. Hypoxia Induce Slug Expression via JAK/STAT3 Pathway in Rheumatoid Arthritis Fibroblast-like Synoviocytes. Ann Rheum Dis. 2016;75(Suppl 2):928-. doi: 10.1136/annrheumdis-2016-eular.4687.\u003c/li\u003e\n\u003cli\u003eWang F, Han J, Wang X, Liu Y, Zhang Z. Roles of HIF-1\u0026alpha;/BNIP3 mediated mitophagy in mitochondrial dysfunction of letrozole-induced PCOS rats. J Mol Histol. 2022;53(5):833-42. doi: 10.1007/s10735-022-10096-4. PubMed PMID: 35951252; PubMed Central PMCID: PMCQ3.\u003c/li\u003e\n\u003cli\u003eFilippi I, Saltarella I, Aldinucci C, Carraro F, Ria R, Vacca A, et al. Different Adaptive Responses to Hypoxia in Normal and Multiple Myeloma Endothelial Cells. Cellular Physiology and Biochemistry : International Journal of Experimental Cellular Physiology, Biochemistry, and Pharmacology. 2018;46(1):203-12. doi: 10.1159/000488423. PubMed PMID: 29587264.\u003c/li\u003e\n\u003cli\u003eShintani T, Klionsky DJ. Autophagy in health and disease: a double-edged sword. Science. 2004;306(5698):990-5. PubMed PMID: 15528435; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eHaro H, Kato T, Komori H, Osada M, Shinomiya K. Vascular endothelial growth factor (VEGF)-induced angiogenesis in herniated disc resorption. J Orthop Res. 2002;20(3):409-15. PubMed PMID: 12038611; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eMazure NM, Brahimi-Horn MC, Pouyss\u0026eacute;gur J. Protein kinases and the hypoxia-inducible factor-1, two switches in angiogenesis. Curr Pharm Des. 2003;9(7):531-41. PubMed PMID: 12570801; PubMed Central PMCID: PMCQ3.\u003c/li\u003e\n\u003cli\u003eBonnevie ED, Gullbrand SE, Ashinsky BG, Tsinman TK, Elliott DM, Chao P-HG, et al. Aberrant mechanosensing in injured intervertebral discs as a result of boundary-constraint disruption and residual-strain loss. Nat Biomed Eng. 2019;3(12). doi: 10.1038/s41551-019-0458-4. PubMed PMID: 31611678; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eYang W, Jia C, Liu L, Fu Y, Wu Y, Liu Z, et al. Hypoxia-Inducible Factor-1\u0026alpha; Protects Against Intervertebral Disc Degeneration Through Antagonizing Mitochondrial Oxidative Stress. Inflammation. 2023;46(1):270-84. doi: 10.1007/s10753-022-01732-y. PubMed PMID: 36064808; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eAllon AA, Butcher K, Schneider RA, Lotz JC. Structured bilaminar coculture outperforms stem cells and disc cells in a simulated degenerate disc environment. Spine (Phila Pa 1976). 2012;37(10):813-8. doi: 10.1097/BRS.0b013e31823b055f. PubMed PMID: 22024902; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eAlvarez-Garcia O, Matsuzaki T, Olmer M, Miyata K, Mokuda S, Sakai D, et al. FOXO are required for intervertebral disk homeostasis during aging and their deficiency promotes disk degeneration. Aging Cell. 2018;17(5):e12800. doi: 10.1111/acel.12800. PubMed PMID: 29963746; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eLiu K, Wei J, Li G, Liu R, Zhao D, Zhang Y, et al. Fexofenadine Protects Against Intervertebral Disc Degeneration Through TNF Signaling. Front Cell Dev Biol. 2021;9:687024. doi: 10.3389/fcell.2021.687024. PubMed PMID: 34504840; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eAndrade P, Visser-Vandewalle V, Philippens M, Daemen MA, Steinbusch HWM, Buurman WA, et al. Tumor necrosis factor-\u0026alpha; levels correlate with postoperative pain severity in lumbar disc hernia patients: opposite clinical effects between tumor necrosis factor receptor 1 and 2. Pain. 2011;152(11):2645-52. doi: 10.1016/j.pain.2011.08.012. PubMed PMID: 21920667; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eOhtori S, Inoue G, Eguchi Y, Orita S, Takaso M, Ochiai N, et al. Tumor necrosis factor-\u0026alpha;-immunoreactive cells in nucleus pulposus in adolescent patients with lumbar disc herniation. Spine (Phila Pa 1976). 2013;38(6):459-62. doi: 10.1097/BRS.0b013e3182739cb4. PubMed PMID: 22990365; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eLiang H, Yang X, Liu C, Sun Z, Wang X. Effect of NF-kB signaling pathway on the expression of MIF, TNF-\u0026alpha;, IL-6 in the regulation of intervertebral disc degeneration. J Musculoskelet Neuronal Interact. 2018;18(4):551-6. PubMed PMID: 30511959; PubMed Central PMCID: PMCQ4.\u003c/li\u003e\n\u003cli\u003eDoğanlar ZB, Doğanlar O, Kurtdere K, G\u0026uuml;\u0026ccedil;l\u0026uuml; H, Chasan T, Turgut E. Melatonin prevents blood-retinal barrier breakdown and mitochondrial dysfunction in high glucose and hypoxia-induced in vitro diabetic macular edema model. Toxicol In Vitro. 2021;75:105191. doi: 10.1016/j.tiv.2021.105191. PubMed PMID: 33962019; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eJin F, Zheng X, Yang Y, Yao G, Ye L, Doeppner TR, et al. Impairment of hypoxia-induced angiogenesis by LDL involves a HIF-centered signaling network linking inflammatory TNF\u0026alpha; and angiogenic VEGF. Aging (Albany NY). 2019;11(2):328-49. doi: 10.18632/aging.101726. PubMed PMID: 30659163; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eKwon W-K, Moon HJ, Kwon T-H, Park Y-K, Kim JH. The Role of Hypoxia in Angiogenesis and Extracellular Matrix Regulation of Intervertebral Disc Cells During Inflammatory Reactions. Neurosurgery. 2017;81(5):867-75. doi: 10.1093/neuros/nyx149. PubMed PMID: 28475716; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eRisbud MV, Shapiro IM. Role of cytokines in intervertebral disc degeneration: pain and disc content. Nat Rev Rheumatol. 2014;10(1):44-56. doi: 10.1038/nrrheum.2013.160. PubMed PMID: 24166242; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eBinch ALA, Cole AA, Breakwell LM, Michael ALR, Chiverton N, Cross AK, et al. Expression and regulation of neurotrophic and angiogenic factors during human intervertebral disc degeneration. Arthritis Research \u0026amp; Therapy. 2014;16(5):416. doi: 10.1186/s13075-014-0416-1. PubMed PMID: 25209447; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eDoita M, Kanatani T, Ozaki T, Matsui N, Kurosaka M, Yoshiya S. Influence of macrophage infiltration of herniated disc tissue on the production of matrix metalloproteinases leading to disc resorption. Spine (Phila Pa 1976). 2001;26(14):1522-7. PubMed PMID: 11462080; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003ePan Z, Sun H, Xie B, Xia D, Zhang X, Yu D, et al. Therapeutic effects of gefitinib-encapsulated thermosensitive injectable hydrogel in intervertebral disc degeneration. Biomaterials. 2018;160:56-68. doi: 10.1016/j.biomaterials.2018.01.016. PubMed PMID: 29396379; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eKwon WK, Moon HJ, Kwon TH, Park YK, Kim JH. Influence of rabbit notochordal cells on symptomatic intervertebral disc degeneration: anti-angiogenic capacity on human endothelial cell proliferation under hypoxia. Osteoarthritis Cartilage. 2017;25(10):1738-46. doi: 10.1016/j.joca.2017.06.003. PubMed PMID: 28647468; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eMadhu V, Boneski PK, Silagi E, Qiu Y, Kurland I, Guntur AR, et al. Hypoxic Regulation of Mitochondrial Metabolism and Mitophagy in Nucleus Pulposus Cells Is Dependent on HIF-1\u0026alpha;-BNIP3 Axis. J Bone Miner Res. 2020;35(8):1504-24. doi: 10.1002/jbmr.4019. PubMed PMID: 32251541; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003eLiu X-W, Lu M-K, Zhong H-T, Wang L-H, Fu Y-P. Panax Notoginseng Saponins Attenuate Myocardial Ischemia-Reperfusion Injury Through the HIF-1\u0026alpha;/BNIP3 Pathway of Autophagy. J Cardiovasc Pharmacol. 2019;73(2):92-9. doi: 10.1097/FJC.0000000000000640. PubMed PMID: 30531436; PubMed Central PMCID: PMCQ3.\u003c/li\u003e\n\u003cli\u003eZhou X, Zhao X, Zhou W, Qi H, Zhang H, Han T-L, et al. Impaired placental mitophagy and oxidative stress are associated with dysregulated BNIP3 in preeclampsia. Sci Rep. 2021;11(1):20469. doi: 10.1038/s41598-021-99837-1. PubMed PMID: 34650122; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003cli\u003eChen Y, Lin J, Chen J, Huang C, Zhang Z, Wang J, et al. Mfn2 is involved in intervertebral disc degeneration through autophagy modulation. Osteoarthritis Cartilage. 2020;28(3):363-74. doi: 10.1016/j.joca.2019.12.009. PubMed PMID: 31926268; PubMed Central PMCID: PMCQ1.\u003c/li\u003e\n\u003cli\u003ePereira ER, Frudd K, Awad W, Hendershot LM. Endoplasmic reticulum (ER) stress and hypoxia response pathways interact to potentiate hypoxia-inducible factor 1 (HIF-1) transcriptional activity on targets like vascular endothelial growth factor (VEGF). J Biol Chem. 2014;289(6):3352-64. doi: 10.1074/jbc.M113.507194. PubMed PMID: 24347168; PubMed Central PMCID: PMCQ2.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eTarget genes Primer sequences used in qRT-PCR\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eHif-1\u0026alpha;\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' AAGTCTAGGGATGCAGCACGATC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' TCAAGATGGGAGCTCACGTTGTG 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003evegfa\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' CTCACTTCCAGAAACACGAC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' TCCACAATAGTGCCATGTCC 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eBnip3\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' CTGTCTCATCTGTTAGCCATTG 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' CACAGCTCAGCGTGAATC 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eBeclin-1\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' ATGCACAGATACTCTTTTAGACC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' AACAGCGTTTGTAGTTCTGACA 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eP62\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' CCTGAACTCATGGCTGAGA 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' GTCCAAATAATTCTCCTCGTCATC 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLC3-II/I\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' TGTATCCACACCCATCGCTGACA 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' CTGACCAGAACTCCCAGCCACC 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eCOL2A1\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5'CTCATCCAGGGCTCCAATGAT3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3'TCTGTGATCGGTACTCGATGA5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eAggrecan\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5'CAGTGCGATGCAGGCTGG3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3'CCTCCGGCACTCGTTGGCTG5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eMMP13\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5'CAAGAATAAAGACTGTGCGAA3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3'TCAGTAAGCACCAAGTGTC5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eAdamts5\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5'TTACTAGATGTACCACGGAAGC3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3'AATGGCGGTAGGCAAACT5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eForward:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5' AACGACCCCTTCATTGACC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eReverse:\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3' ATTCTCAGCCTTGACTGTGC 5'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Intervertebral disc degeneration, Nucleus pulposus cells, HIF-1α/Bnip3/VEGF axis, autophagy, TNF-α","lastPublishedDoi":"10.21203/rs.3.rs-4356277/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4356277/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eIntervertebral disc degeneration (IDD) is one of the main factors leading to low back pain. However, its potential pathogenesis targets are poorly understood. Therefore, the potential pathogenesis of IDD must be further explored to identify more appropriate treatment angles.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eTo investigate the effects of the hypoxia-inducing factor-1α (HIF-1α)/BCL-2 interacting protein 3 (Bnip3)/vascular endothelial growth factor (VEGF) signaling axis on IDD induced by the inflammatory factor tumor necrosis factor-alpha (TNF-α) and determine whether IDD progression can be delayed by regulating nucleus pulposus cell (NPC) autophagy.\u003c/p\u003e\u003ch2\u003eExperimental methods:\u003c/h2\u003e \u003cp\u003eDifferences in TNF-α, VEGF, and HIF-1α expression between IDD model rats and normal rats were observed, and the effects of the HIF-1α inhibitor YC-1 on TNF-α and VEGF expression, HIF-1α/Bnip3 axis autophagy-related molecule levels, and IDD progression were verified in vivo. Finally, the effects of HIF-1α knockdown on HIF-1α and VEGF expression in TNF-α-induced NPCs, HIF-1α/Bnip3/VEGF signaling axis autophagy-related molecule levels, and IDD progression were explored in vitro.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn vivo experimental results revealed obvious degeneration and significantly higher TNF-α, HIF-1α, and VEGF expression in the model group compared with the normal group. The YC-1 intervention downregulated TNF-α and VEGF in IDD, as verified by qPCR, WB, and immunofluorescence assays. In addition, YC-1 intrusion decreased autophagy flux in intervertebral discs (IVDs), as indicated by the decreased number of autophagosomes and lysosomes under transmission electron microscopy and decreased levels of HIF-1α/Bnip3 axis autophagy-associated molecules in immunohistochemical, WB, qPCR, and immunofluorescence assays. In addition, the YC-1 intervention led to a further decrease in the signal intensity of the intervertebral disc under T2-weighted magnetic resonance imaging (MRI) and an increase in the Pfirrmann score compared with the model group. Hematoxylin and eosin (HE), Masson\u0026rsquo;s, and safranin O-fast green staining also showed that in the YC-1 group, coagulation and shrinkage of the nucleus pulposus were more obvious, annulus fibrosus was more serious, loss of proteoglycan and collagen was increased, and IDD was further intensified compared with that in the model and dimethyl sulfoxide (DMSO) groups. In vitro experiments showed that the LV-HIF-1α intervention decreased HIF-1α and VEGF expression and autophagy-related molecule levels in the HIF-1α/Bnip3 axis of TNF-α-induced NPCs, as reflected in a decrease in the number of autophagosomes and lysosomes in the Lv-HIF-1α transfection group compared with the Lv-NC-H group. HIF-1α/Bnip3 axis-related mRNA and protein expression was downregulated, type II collagen and proteoglycan were significantly downregulated, and matrix catabolic markers matrix metalloproteinase 13 (MMP13) and A disintegrin and metalloproteinase with thrombospondin motifs 5 (ADAMTS-5) were significantly downregulated, indicating that IDD progression in NPCs was accelerated after HIF-1α knockdown.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eIn IDD, inflammatory factor TNF-α may activate autophagy by regulating the HIF-1α/Bnip3/VEGF signaling axis, which promotes NPC death, thereby protecting IVDs and delaying further IDD. However, intervention with HIF-1α blockers reduced autophagy and VEGF expression, which further aggravated IDD progression, thus supporting our hypothesis. These findings provide insights for developing targeted IDD therapies.\u003c/p\u003e","manuscriptTitle":"HIF-1α/Bnip3/VEGF axis regulates autophagy to mitigate intervertebral disc degeneration induced by inflammatory factor TNF-α","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-15 14:37:32","doi":"10.21203/rs.3.rs-4356277/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"030b3a4d-614a-4414-a8c5-0c8b3dc556d4","owner":[],"postedDate":"May 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-21T00:53:24+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-15 14:37:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4356277","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4356277","identity":"rs-4356277","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.