Pseudomonas syringae lipopolysaccharide synthesis gene wbpL displays heterogeneous expression within in vitro and in planta populations

preprint OA: closed CC-BY-4.0

Abstract

Phenotypic heterogeneity usually refers to phenotypic variation not associated to genetic variation, nor induced by environmental stimuli. The phenotypic heterogeneity processes described for some complex bacterial traits is causing a shift on how bacterial phenotypes are studied, from traditional assessments by averaging populations to single-cell analysis focused on bacterial individual phenotypes and how these distribute within the population. The structure of the lipopolysaccharide (LPS) layer on the outer membrane in gram-negative bacteria is often subjected to phase variation, a form of phenotypic variation critical for virulence in animal pathogens. Here, we apply single-cell expression analyses to wbpL , a conserved Pseudomonas syringae glycosyltransferase-encoding gene essential for the synthesis of the o-antigen component of LPS. We show that expression of wbpL displays phenotypic heterogeneity in P. syringae pv. phaseolicola growing in rich medium, reaching bistable expression in minimal media, where the population splits into WbpL ON and WpbL OFF subpopulations. In planta , wbpL expression is also heterogeneous, displaying intermingled ON/OFF with comparable viability. Finally, we followed expression of wbpL within the spatial context of apoplastic microcolonies. detecting heterogeneity within each microcolony, but also found that microcolonies displayed overall differences in fluorescence intensity that correlated size, with smaller microcolonies displaying higher levels of wbpL expression.
Full text 56,479 characters · extracted from preprint-html · click to expand
Pseudomonas syringae lipopolysaccharide synthesis gene wbpL displays heterogeneous expression within in vitro and in planta populations | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL MicrobiologyOpen This is a preprint and has not been peer reviewed. Data may be preliminary. 2 January 2025 V1 Latest version Share on Pseudomonas syringae lipopolysaccharide synthesis gene wbpL displays heterogeneous expression within in vitro and in planta populations Authors : Laura Mancera-Miranda , José S. Rufián , Nieves López-Pagán , Javier Ruiz-Albert , and Carmen R. Beuzón 0000-0002-6888-3845 [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.173580745.54599741/v1 Published MicrobiologyOpen Version of record Peer review timeline 451 views 202 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Phenotypic heterogeneity usually refers to phenotypic variation not associated to genetic variation, nor induced by environmental stimuli. The phenotypic heterogeneity processes described for some complex bacterial traits is causing a shift on how bacterial phenotypes are studied, from traditional assessments by averaging populations to single-cell analysis focused on bacterial individual phenotypes and how these distribute within the population. The structure of the lipopolysaccharide (LPS) layer on the outer membrane in gram-negative bacteria is often subjected to phase variation, a form of phenotypic variation critical for virulence in animal pathogens. Here, we apply single-cell expression analyses to wbpL , a conserved Pseudomonas syringae glycosyltransferase-encoding gene essential for the synthesis of the o-antigen component of LPS. We show that expression of wbpL displays phenotypic heterogeneity in P. syringae pv. phaseolicola growing in rich medium, reaching bistable expression in minimal media, where the population splits into WbpL ON and WpbL OFF subpopulations. In planta , wbpL expression is also heterogeneous, displaying intermingled ON/OFF with comparable viability. Finally, we followed expression of wbpL within the spatial context of apoplastic microcolonies. detecting heterogeneity within each microcolony, but also found that microcolonies displayed overall differences in fluorescence intensity that correlated size, with smaller microcolonies displaying higher levels of wbpL expression. Pseudomonas syringae lipopolysaccharide synthesis gene wbpL displays heterogeneous expression within in vitro and in planta populations Laura Mancera-Miranda 1 , José S. Rufián 1 , Nieves López-Pagán 1 , Javier Ruiz-Albert 1* , Carmen R. Beuzón 1 * 1 Instituto de Hortofruticultura Subtropical y Mediterránea, Universidad de Málaga-Consejo Superior de Investigaciones Científicas (IHSM-UMA-CSIC), Dpto. Biología Celular, Genética y Fisiología, Campus de Teatinos, Málaga E-29071, Spain *For correspondence: [email protected] / [email protected] Phone: ++ 34-952-132287/++ 34-952-132286 Summary Phenotypic heterogeneity usually refers to phenotypic variation not associated to genetic variation, nor induced by environmental stimuli. The phenotypic heterogeneity processes described for some complex bacterial traits is causing a shift on how bacterial phenotypes are studied, from traditional assessments by averaging populations to single-cell analysis focused on bacterial individual phenotypes and how these distribute within the population. The structure of the lipopolysaccharide (LPS) layer on the outer membrane in gram-negative bacteria is often subjected to phase variation, a form of phenotypic variation critical for virulence in animal pathogens. Here, we apply single-cell expression analyses to wbpL , a conserved Pseudomonas syringae glycosyltransferase-encoding gene essential for the synthesis of the o-antigen component of LPS.We show that expression of wbpL displays phenotypic heterogeneity in P. syringae pv. phaseolicola growing in rich medium, reaching bistable expression in minimal media, where the population splits into WbpL ON and WpbL OFF subpopulations. In planta , wbpL expression is also heterogeneous, displaying intermingled ON/OFF with comparable viability. Finally, we followed expression of wbpL within the spatial context of apoplastic microcolonies. detecting heterogeneity within each microcolony, but also found that microcolonies displayed overall differences in fluorescence intensity that correlated size, with smaller microcolonies displaying higher levels of wbpL expression. Keywords Bacterial gene expression; fluorescent reporter genes; single-cell methods; fluorescence in planta microscopy; non-genetic variation Introduction The outer membrane (OM) is a hallmark of Gram-negative bacteria that is essential for bacterial viability (Silhavy, Kahne and Walker, 2010). The OM is an atypical membrane formed by an asymmetric lipid bilayer, with phospholipids in the inner side and lipopolysaccharides (LPS) in the outer (Funahara and Nikaido, 1980). Lipopolysaccharides (LPSs) are a family of structurally related glycolipids that contain a mix of well-conserved and highly variable structural elements. LPS is formed by three different and covalently linked domains (Whitfield, Williams and Kelly, 2020): ( i ) a conserved lipophilic lipid A moiety, with a major role in permeability, which is recognized by the innate immune system as a pathogen-associated molecular pattern (PAMP) in host-microbe interactions (Whitfield, Williams and Kelly, 2020); ( ii ) a short hydrophilic core oligosaccharide structure (core OS), which contributes to outer membrane stability (Holst and Brade, 1992); and in most cases ( iii ) a long-chain hypervariable repeat-unit polysaccharide (OPS) also known as O-antigen that glycosylates core OS, and may differ in glycose and non-glycose components, linkages, topology and chain lengths (Goldman and Leive, 1980). The OPS is often involved in providing protection against environmental threats (Whitfield, Williams and Kelly, 2020), phage recognition and binding (Mostowy and Holt, 2018), in adhesion to surfaces and biofilm formation (Bogino et al. , 2013), and as the exposed part of LPS, the OPS also contributes to the recognition of LPS by the immune system in both animal and plant hosts (Lerouge and Vanderleyden, 2002; Ranf, 2016).Phase variation of OPS is a critical aspect of virulence in many Gram-negative animal pathogens, e . g . Coxiella burnetii (Long et al. , 2024), Helicobacter pylori (Appelmelk et al. , 2000; Sijmons et al. , 2022), Haemophilus influenzae (Weiser et al. , 1990), Pasteurella multocida (Omaleki et al. , 2022) , Francisella tularensis (Mlynek et al. , 2022) or Salmonella enterica (Cota, Blanc-Potard and Casadesús, 2012). Phase variation refers to an adaptive process by which bacteria undergo frequent and reversible phenotypic changes that result from reversible genetic alterations in specific loci (Hallet, 2001). No such processes have been reported for OPS in plant pathogens. Nonetheless, defects in OPS synthesis have been shown to cause a complete or strong virulence attenuation in plant pathogens such as Erwinia spp., Ralstonia solanacearum, Xanthomonas axonopodis pv. citri or Xylella fastidiosa, (Drigues et al. , 1985; Schoonejans, Expert and Toussaint, 1987; Berry et al. , 2009; Petrocelli et al. , 2012; Li et al. , 2014; Rapicavoli et al. , 2018) . In the model plant pathogen P. syringae species complex, a genetic analysis identified wbpL , a gene encoding a glycosyltransferase, as conserved in all strains examined and essential for OPS synthesis (Kutschera et al. , 2019). Deletion of wbpL in the model strain P. syringae pv. tomato DC3000 reduces the ability of this pathogen to enter the host tissue. This is likely associated to the reduced swarming motility displayed by the ∆ wbpL mutants in this pathogen (Kutschera et al. , 2019). The ∆ wbpL mutant also has a reduced ability to colonize the leaf apoplast of host plant Arabidopsis thaliana (Kutschera et al. , 2019) . Mutations of the wbpL ortholog of another model strain from this species complex, P. syringae pv. phaseolicola 1448A had also been reported previously to reduce leaf colonization and virulence in common bean (Rudolph et al. , 1989).In this work, we have investigated expression of wbpL at the single-cell level within populations of two important P. syringae model strains where this gene has been proven to be involved in virulence: P. syringae pv. tomato DC3000 (hereafter Pto) and P. syringae pv. phaseolicola 1448A (hereafter Pph). We have generated transcriptional fusions to a promoterless GFP3 gene downstream to the wbpL gene of each of these two model strains and used single-cell methods to follow expression of this gene both under laboratory growing conditions and in planta . We show that expression of wbpL displays phenotypic heterogeneity in P. syringae pv. phaseolicola growing in rich medium, reaching bistable expression in minimal media, where the population splits into WbpL ON and WpbL OFF subpopulations. In planta , wbpL expression is also heterogeneous, with the apoplastic population displaying intermingled ON/OFF bacteria with comparable viability. Finally, we followed expression of wbpL within the spatial context of apoplastic microcolonies, detecting heterogeneity within each microcolony. In this context, we also found that microcolonies displayed overall differences in fluorescence intensity that negatively correlated with size, with smaller microcolonies displaying higher levels of wbpL expression. Materials and methods Bacterial strains and growth conditions Bacterial strains used and generated in this work are detailed in Table 1 . E. coli and P. syringae strains were grown with aeration in Lysogeny Broth (LB) medium (Bertani, 1951) at 37ºC ( E. coli ) or 28°C ( P. syringae ). When necessary, antibiotics were used at the following concentration: ampicillin (Amp), 100 μg/ml for E. coli and 500 μg/ml for P. syringae ; kanamycin (Km), 50 μg/ml for E. coli and 15 μg/ml for P. syringae derivative strains; cycloheximide, 2 μg/ml. To mimic conditions within the leaf apoplast, bacteria were initially cultured overnight in LB at 28°C, supplemented with the appropriate antibiotic, then, washed twice in 10 mM MgCl 2 and then grown from an initial OD adjusted to 0,13 in hrp-inducing minimal medium (HIM), containing 10 mM fructose, and pH adjusted to 7 with 10N NaOH, at 28°C with agitation. Generation of strains carrying a wbpL::GFP3 transcriptional fusion Bacterial strains carrying a chromosome-located transcriptional fusion of wbpL to a promoterless GFP3 gene were generated using an adaptation of the method previously described by Rufián et al. (2018). The plasmids used and generated for this purpose are detailed in Table 2 , and the primers used are described in Table 3. To generate the allelic exchange plasmids, we amplified two fragments from either Pph 1448A or Pto DC3000 genomic DNA using Q5 High-Fidelity DNA Polymerase (New England Biolabs, USA); in each case fragment A encompasses the 3’ end of the wbpL ORF, including the STOP codon, and fragment B the sequence immediately downstream to the STOP codon. Reactions were carried out starting at 98ºC for 1 minute for the initial denaturation step, followed by 30 cycles at 98ºC for 30 seconds, annealing at 58ºC (fragment B) or 60ºC (fragment A) for 30 seconds, and extension at 72ºC for 30 seconds, followed by 5 minutes at 72ºC for the final extension step. Reaction mixes included 0,64 mM deoxynucleotide triphosphate (dNTP) mix, 0,4 ng of each primer, 1 ng of genomic DNA, the appropriate enzyme buffer, and commercial ultrapure water (Nalgene, Rochester, NY, USA). Two μl of each gel-purified PCR products was employed as templates for the subsequent fusion PCRs, employing primers A1 and B2, for reactions carried out as described above, with extended elongation times of 1 min. The resulting bands, containing the end of each ORF and its downstream sequence separated by an EcoRI restriction site, were A/T cloned into pGEM-T (Promega, USA) and fully sequenced to disregard mutations. This process rendered the pGT-AB- wbpL plasmids needed for generating the allelic exchange plasmids. A GFP3 -FRT- nptII -FRT fragment was obtained by digesting the plasmid pGT-GFP with EcoRI enzyme. This fragment includes the promoterless GFP3 gene, with its ribosomal binding site (RBS), followed by the kanamycin resistance gene ( nptII ), flanked by FRT (flipase recognition targets) sites, and is flanked by two EcoRI restriction sites. The GFP3 -FRT- nptII -FRT fragment was blunt-ended through a PCR procedure and ligated into EcoRI-digested pGT-AB- wbpL plasmids, generating the pGT- wbpL::GFP3 plasmids. These plasmids were transformed into the corresponding wild type strains, P. syringae pv. phaseolicola 1448A to generate the Pph wbpL::GFP3 strain, and P. syringae pv. tomato DC3000 to generate the Pto wbpL::GFP3 strain. Plant assays Ten-days old Phaseolus vulgaris bean cultivar Canadian Wonder plants cultivated under controlled conditions at 23°C, 95% humidity, with artificial light maintained for periods of 16 hours within the 24 hours were used in all experiments. The first true leaves were inoculated by immersing the entire leaf in the bacterial inoculum, containing 0.01% Silwett L-77 (Crompton Europe Ltd, Evesham, UK), and using a pressure chamber (Rufián et al., 2022). Bacterial inocula were prepared resuspending biomass from bacterial lawns grown on LB plates for 48 h at 28°C, into 2 ml of 10 mM MgCl 2 , adjusting optical density (OD600) to 0,1 (which corresponds to 5 x 10 7 colony forming units per millilitre, CFU/ml, of Pph 1448A), and serially diluting to a final concentration of 5 x 10 4 CFU/ml. Four days post-inoculation (dpi), bacteria were recovered from the plant apoplastic fluid as previously described (Rufián et al., 2022). Briefly, each leaf is pressure infiltrated with 10 ml of a 10 mM MgCl 2 solution inside a 50 ml syringe, by applying 5 cycles of pressure, prior to collecting the flow-through, which is then transferred to a fresh 50 ml tube from which 3 ml are directly analysed by flow-cytometry. Flow Cytometry analysis LB cultures were obtained from an overnight incubation in LB. For HIM cultures, 500 µl of an overnight P. syringae LB culture was washed twice in 10 mM MgCl 2 , added to 4,5 ml of HIM and incubated at 28ºC for 24h (Pph) or 5 h (Pto). Apoplast-extracted bacterial suspensions were obtained as indicated above. Three hundred µl of the cultures in HIM, LB or apoplast-extracts were analysed using a BD FACS Verse cytometer (BD Biosciences, USA). FITC-A filter was used to visualise GFP signal. Graphs were generated using the FlowJo X v. 10.0.7r software. Confocal microscopy analysis Suspensions of 2 µl of apoplast-extracted bacteria or media-grown bacteria were deposited over a 0,17 mm coverslip and an agar-pad square was placed on top of the drop to create a bacterial monolayer, following the method described in Rufián et al. (2022). To visualize all cells, bright field images were included. Images of single-cell bacteria were acquired using the Zeiss LSM880 confocal microscope (Zeiss, Germany), using 63x or 100x objectives. To visualize apoplastic microcolonies, sections of P. vulgaris leaves (approximately 5 mm 2 ) inoculated with Pph wbpL::GFP3, were carefully excised using a razor blade, mounted on slides in double-distilled H 2 O with the lower epidermis facing the objective, and cover with a 0,17 mm coverslip. Images of the leaf mesophyll were taken using the Leica Stellaris 8 confocal microscope (Leica Microsystems GmbH, Germany) with 40x objectives. Filters for wavelength selection were used for the visualization GFP (488 nm/ 500 to 533 nm), and plant autofluorescence (514/ 605 to 670 nm). Images were proccessed using Leica LASX 1.4.6 (Leica Microsystems, Germany) software. Z series imaging was taken at 1 μm using 40x objectives. Live-dead stanning We added one drop of a propidium iodide solution Ready ProbesTM (Thermo Fisher Scientific, USA) to 300 μl of the suspension of apoplast-extracted bacteria. Live-dead bacteria were identified by flow-cytometry. For live-dead staining, bacteria were syringae-infiltrated with a suspension of 5 x 10 4 CFU/ml in bean leaves and apoplast-extracted at 4 days post-inoculation. Live-dead bacteria were identified according to PI staining by confocal microscopy (as described above). Quantification and statistical analysis Quantification and statistical analysis were performed using Prism. Details of the analysis used, and level of significance are indicated in the corresponding figure legends. Software used for data quantification and analysis is detailed in Table 4 . Single-cell expression analysis of wbpL in Pph 1448A in laboratory conditions To investigate single-cell expression of wbpL within populations of Pph (1448A), we generated a transcriptional fusion to a promoterless GFP3 gene downstream to the wbpL gene within its native chromosome location. This was carried out following previously described methodology based on allelic exchange that preserves genome context and the target gene sequence (Rufián et al. , 2018). Cultures grown in rich medium (LB) of the resulting Pph wbpL::GFP3, as well as of the corresponding Pph reference strain, were used for single-cell expression analysis. Flow cytometry shows that wbpL is only expressed (at a very low level) by a small percentage of the population ( Fig. 1A ), with just approximately 10% of WbpL ON bacteria in Pph wbpL::GFP3 populations on average. Histograms consistently show a unimodal distributions for wbpL::GFP3 fluorescence that considerably overlaps with the corresponding non-fluorescent Pph reference strain used as a negative control ( Fig. 1A ). Confocal microscopy analysis of GFP fluorescence within Pph wbpL::GFP3 populations show very low fluorescence intensities with few bacteria displaying low, but higher that most, fluorescence (WbpL ON bacteria) ( Fig. 1B ), in keeping with flow cytometry results ( Fig. 1A ). Control images obtained for the non-GFP3 Pph reference strain taken with these settings show that the very low background expression that can be detected in some Pph wbpL::GFP3 is due to expression of the gene fusion and not to background noise ( Fig. S1 ).We also analysed single-cell expression of wbpL::GFP3 in bacterial populations grown in HIM, a minimal medium that mimics conditions within the plant apoplast (Huynh, Dahlbeck and Staskawicz, 1989). Flow cytometry analysis carried out on HIM-grown populations of Pph wbpL::GFP3 and Pph show results rather different to those previously observed for LB-grown ( Fig. 1C ). First, the percentages of WbpL ON bacteria within the HIM-grown populations were consistently higher than those observed in those LB-grown ( Fig. 1C ), with half of the bacteria, on average, displaying a stronger WbpL ON phenotype. Second, histograms for these samples reproducibly show a marked bimodal (sometimes even trimodal) distribution of fluorescence ( Fig. 1C ). This distribution is compatible with a bistable expression pattern and the formation of WbpL ON and WbpL OFF subpopulations, the latter fully overlapping with the non-fluorescent reference Pph strain ( Fig. 1C ). The term bistability is used to describe bimodal patterns of gene expression. These patterns can be determined by phase variation (van der Woude, 2011), as in the case of opvAB which determines the length of the O-antigen in the LPS of S. enterica (Cota, Blanc-Potard and Casadesús, 2012), but also when loci with heterogeneous (noisy) expression are regulated by positive feedback loops, as in the paradigmatic case of the E. coli lac operon (Aaron Novick and Weiner, 1957), or double negative feedback loops as in another classic example of regulation, the lysis/lysogeny decision in the λ bacteriophage (Herskowitz and Hagen, 1980). Such regulatory loops split heterogeneous populations into ON/OFF subpopulations. Confocal microscopy analysis supports the results obtained by flow cytometry ( Fig. 1D ). Although the fluorescence intensities displayed by WbpL ON bacteria in HIM-grown populations are not high, they are distinctly higher than in LB, to such extend that WbpL ON and WbpL OFF bacteria can be easily identified within these populations ( Fig. 1D ). Our team has previously reported bistable expression for the type III secretion system (T3SS) genes in HIM-grown populations of Pph (Rufián et al. , 2016). In the case of the T3SS genes, bistability is linked to a double ‑negative feedback loop, and enhanced by an additional positive feedback loop (Rufián et al. , 2016). Single-cell expression analysis of wbpL in Pto DC3000 in laboratory conditions To investigated expression of wbpL at the single-cell level within populations of Pto (DC3000), we generated transcriptional fusions to a promoterless GFP3 gene downstream to the wbpL gene of within its native chromosome location, as carried out for Pph ( Fig. 1 ) to preserve genome context and the target gene sequence (Rufián et al. , 2018). Cultures grown in rich medium (LB) of the resulting Pph wbpL::GFP3, as well as of the corresponding Pph reference strain, were used for single-cell expression analysis. Flow cytometry and confocal analysis carried out using LB-grown Pto wbpL::GFP3 cultures ( Fig. 2A-B ) show fluorescence levels were very low and arguably less heterogeneous than observed for Pph wbpL::GFP3 ( Fig. 1A-B ). Histograms show unimodal distributions for Pto wbpL::GFP3 fluorescence extensively overlapping with the corresponding non-fluorescent Pto reference strain ( Fig. 2A ), supporting what can be observed by confocal microscopy ( Fig. 2B ). When flow cytometry analyses were carried out using 5h HIM-grown Pto wbpL::GFP3 cultures, using shorter incubation times to account for the faster growth rate of Pto in this medium, the results obtained were quite different to those observed for Pph wbpL::GFP3 ( Fig. 2C-D versus Fig. 1C-D ). First, although expression is slightly higher in HIM-grown Pto wbpL::GFP3 than in LB-grown cultures, it is lower on average that expression displayed by Pph wbpL::GFP3 WbpL ON bacteria ( Fig. 2C-D versus Fig. 1C-D ). Second, and most importantly, histograms consistently show a unimodal distribution differing from the bimodal distribution displayed by Pph wbpL::GFP3 in HIM-grown cultures ( Fig. 2C versus Fig. 1C ). Confocal microscopy analysis showed little differences in the GFP fluorescence displayed by individual bacteria ( Fig. 2D ). Therefore, although we cannot rule out that the Pto wbpL locus may display heterogeneity or even bistable expression in a different environment, our results do not support this being the case under the conditions used in this study. Thus, from this point onwards, we focused our study on the Pph wbpL locus. Pph heterogeneously expresses wbpL within the plant leaf apoplast Although the wbpL locus is heterogeneously expressed in both LB and HIM in Pph wbpL::GFP3, the formation of ON/OFF subpopulations is only detected in HIM-grown populations. Since HIM mimics conditions within the leaf apoplast, we next evaluated wbpL::GFP3 expression in populations grown in planta , where the function of wbpL has been shown to be involved in virulence. To do this, we inoculated Phaseolus vulgaris (common bean) leaves and bacteria were recovered from the plant apoplastic fluid, as previously described (Rufián et al., 2022), 4 days post-inoculation (dpi). Flow cytometry analysis of apoplast-extracted Pph wbpL::GFP3 bacteria show a heterogeneous expression pattern for this locus following colonization of the bean leaf ( Fig. 3A ). Confocal microscopy analysis supports the heterogeneous activation of the locus as shown by flow cytometry, with WbpL OFF bacteria readily identified among apoplast-extracted bacteria ( Fig. 3B ). The T3SS genes in Pph, which displays bistable expression during growth in HIM, also display heterogeneous expression during growth in the more complex plant environment (Rufián et al. , 2016).The OPS, as the exposed part of LPS, contributes to the recognition of LPS by the plant innate immune system (Ranf, 2016). In addition, the OPS is often involved in providing protection against environmental threats (Whitfield, Williams and Kelly, 2020). Therefore, differences in expression in wbpL within the apoplast could potentially have an impact on how individual bacteria are detected by plant immune receptors and/or their ability of withstand these defenses and/or additional environmental challenges encountered within the apoplast. To evaluate whether if any of such processes have a differential impact on WbpL ON or WbpL OFF bacterial viability, we used propidium iodide (PI) to detect membrane-compromised (not viable) apoplast-extracted bacteria. This approach can help in determining whether any of the phenotypic variants is undergoing higher killing rates during colonization of the apoplast (Lehtinen, Nuutila and Lilius, 2004; Patel et al. , 2021). We found no preferential association of PI staining with WbpL ON or WpbL OFF bacteria within the apoplast-extracted populations ( Fig. 3C ). A similar approach has been applied previously to evaluate killing rates within the apoplast of T3SS ON / T3SS OFF and Flagella ON /Flagella OFF , which also displays heterogeneous expression in this niche, revealing no significant differences between the dead/live ratios of ON versus OFF subpopulations for any of the T3SS/Flagella phenotypic variants (López-Pagán et al. , 2025). Phenotypic heterogeneity between apoplastic microcolonies The analysis of expression of T3SS/Flagella within the context of apoplastic bacterial microcolonies showed a spatial distribution of phenotypic variants that support that Flagella ON /T3SS OFF bacteria are somehow protected from the plant cell responses by Flagella OFF /T3SS ON bacteria trans-complementing their defense suppression defect (López-Pagán et al. , 2025). Thus, a possible explanation for the lack of viability differences between WbpL ON and WbpL OFF bacteria ( Fig. 3C ) might be that these phenotypic variants may cooperate within the context of the microcolony, as shown for the T3SS and Flagellar systems. A key aspect of the cooperative nature of the relationship between the different ON/OFF subpopulations of T3SS and flagellar genes is the spatial context of their respective expression within a growing microcolony (López-Pagán et al. , 2025). Thus, we investigated how wbpL expression is distributed within apoplastic microcolonies, since LPS structure also plays and important role eliciting defences during infection. To this purpose, we analysed by confocal microscopy leaves inoculated with Pph wbpL::GFP3 at 3 dpi ( Fig. 4A ). Apoplastic microcolonies displayed a heterogeneous pattern of single-cell expression very similar to the patterns described previously for flagella and the T3SS genes (López-Pagán et al. , 2025), compatible with stochastic switching of the wbpL locus during microcolony development. However, while flagella and the T3SS genes display a differential spatial distribution within the microcolony, with a preference for Flagella OFF /T3SS ON bacteria in the proximal side of the microcolony, closest to the host cell surface, and an abundance of Flagella ON /T3SS OFF in the more distal parts (López-Pagán et al. , 2025), no consistent zonal pattern was identified for expression of the wbpL locus (Fig. 4A). Zones of strongest fluorescent are sometimes visible in some microcolonies, but no reproducible common pattern for the localization of these areas was identified. Although we cannot rule there might be a zonal pattern that may become apparent in, for example, different defence contexts, the simplest explanation for the available data is that such brighter areas as observed in our conditions may simply reflect denser areas within a given microcolony.While no discernible zonal pattern was evident within each microcolony, one clear pattern did become apparent on these experiments when comparing the different microcolonies to each other, smaller microcolonies were consistently brighter, displaying stronger wbpL::GFP3 fluorescence) (Fig. 4A). Such association between size and overall gene expression intensity is not observed for the flagellar or T3SS genes nor for constitutively expressed fluorescent reporter genes (López-Pagán et al. , 2025). To validate the observed trend, we first classified microcolonies into small or large (not considering intermediate sizes for this purpose) and measured the average GFP fluorescence of each microcolony by manually selecting the area of the microcolony prior to calculating the mean GFP fluorescence. The results validated the observed trend showing that mean GFP fluorescence is significantly higher in small colonies ( Fig. 4B ). We also measured the areas and fluorescence of the microcolonies (all microcolonies, this time including intermediate sizes) and represented the one against the other ( Fig. 4C ). The results obtained supports the notion of a negative correlation between size and wbpL::GFP expression. Discussion The differences in wbpL expression observed when comparing apoplastic microcolonies have two interesting new aspects to consider. First, despite the heterogenous ON/OFF switching there is a common trend for high or low wbpL::GFP expression ( Fig. 4A ), which differs between microcolonies. Such a trend may supports two possible scenarios: ( i ) differences in the microenvironments surrounding small versus large microcolonies may be causing a differential activation of wbpL expression within the entire microcolony, ( ii ) expression of wbpL may be regulated by a phase variation epigenetic mechanism, like it happens with other LPS genes in many pathogens (Weiser et al. , 1990; Appelmelk et al. , 2000; Cota, Blanc-Potard and Casadesús, 2012; Mlynek et al. , 2022; Omaleki et al. , 2022; Sijmons et al. , 2022; Long et al. , 2024), with the mean expression in each microcolony being a reflection of a common inherited status.The second interesting aspect of these results is the negative correlation observed between the size of the microcolony and the intensity of wbpL::GFP fluorescence ( Fig. 4B-C ). A typical Escherichia coli cell possesses ∼2 × 10 6 LPS molecules, covering about three quarters of the cell surface, with 70,000 molecules/min estimated to be exported to the OM, during active growth (reviewed in Whitfield, Williams and Kelly, 2020). These numbers support that production of these macromolecules may require a substantial fraction of bacterial resources. Thus, higher production of WbpL might be associated with slower growth. Additionally, the immunogenic nature of these molecules could determine that stronger expression of wbpL::GFP may lead to a stronger local defense restricting bacterial growth. However, in such a scenario, these defenses would restrict bacterial growth without compromising bacterial viability, since PI staining shows no difference between WbpL ON and WbpL OFF bacteria ( Fig. 3C ).Future work will be necessary to establish the biological implications of the wbpL expression patterns described here, as well as to reveal the underlying mechanisms regulating the heterogeneous and bistable expression of this locus in this plant pathogen. But the results presented here provide evidence of the conservation of an adaptive strategy between plant and animal pathogens: phenotypic heterogeneity of LPS genes. Interestingly, a very recent report has demonstrated through experimental observations and computational simulations, the adaptive value of the bistable expression of the LPS-related Salmonella opvAB locus, regulated by epigenetic variation (Fernández-Fernández et al. , 2024). The report supports the notion of such variation as an evolutionary strategy for mutation avoidance in fluctuating environments, while providing experimental support to game theory models predicting that phenotypic heterogeneity is advantageous in changing and unpredictable environments. The findings from our group that crucial virulence determinants such as the T3SS (Rufián et al. , 2016), flagella (López-Pagán et al. , 2025), and LPS (this report) display phenotypic heterogeneity in P. syringae during growth within the plant host, as these systems do in animal pathogens such as Salmonella (SPI1 T3SS (Bumann, 2002b; Hautefort, Proença and Hinton, 2003; Saini et al., 2010a); Flagella (Freed et al. , 2008) and LPS (Cota et al., 2016)) expands these evolutionary strategies to bacterial pathogens. Acknowledgements This work was supported by Grant PID2021-127245OB-100 to CRB and JRA and LMM was supported by FPU Grant FPU19/03365, both funded by MCIN/AEI/10.13039/501100011033/ and by “ERDF A way of making Europe”. Additional support for LMM was provided by “II Plan Propio de Investigación, Transferencia y Divulgación Científica UMA”. The authors have no conflict of interest to declare. Data availability statement The data that support the findings of this study are available at http://flowrepository.org/id/FR-FCM-Z8X7 and cited in the reference list. E. coli One Shot TM TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Δ lacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG. For clonning Invitrogen 1448A P. syringae pv. phaseolicola wild type strain race 6 (Teverson, 1991) DC3000 P. syringae pv. tomato wild type strain (Cuppels, 1986) LMM1 1448A wbpL::GFP3 Km R This work LMM2 DC3000 wbpL::GFP3 Km R This work Table 1. List of bacterial strains used in this study. Table 2. List of plasmids used and generated in this work. pGEM-T vector E. coli expression vector for cloning. Amp R Promega, USA pGT-GFP + E. coli expression vector carrying the GFP3-Km gene. Amp R Km R (Rufián et al. , 2018) pGT-AB-Pto- wbpL pGEM-T vector carrying the last 600 pb of the wbpL ORF from DC3000 (A) followed by an EcoRI site and the 500 bp immediately downstream the wbpL STOP codon (B). Amp R This work pGT-Pto- wbpL :: GFP3 Allelic exchange vector for the generation of a transcriptional fusion of wbpL to GFP3 in DC3000. Amp R Km R This work pGT-AB-Pph- wbpL pGEM-T vector carrying the last 600 pb of the wbpL ORF from 1448A (A) followed by an EcoRI site and the 600 bp immediately downstream the wbpL STOP codon (B). Amp R This work pGT-Pph- wbpL :: GFP3 Allelic exchange vector for the generation of a transcriptional fusion of wbpL to GFP3 in 1448A. Amp R Km R This work Table 3. List of primers used in this study. A1 PphwbpL CTGGTATGGATGTTGAATCT - This work A2 PphwbpL CCGCTTCGGAATTCTTACCTGATTTCCGCCT EcoRI This work B1 PphwbpL TCAGGTAAGAATTCCGAAGCGGTTTTCTG EcoRI This work B2 PphwbpL TAAATGGCGACCTTCTG - This work A1 PtowbpL CTGGTATGGATGTTGAATCT - This work A2 PtowbpL CCGCTTCGGAATTCTTACCTGCTTTCTGCCT EcoRI This work B1 PtowbpL GCAGGTAAGAATTCCGAAGCGGGTTTCTG EcoRI This work B2 PtowbpL TAGATGGCGACTTTTTGC - This work Table 4. List of software used in this study. Image J 2.9.0/Fiji 2.14.0 https://imagej.net/ij/docs/index.html GraphPad Prism 9.0 Prism https://www.graphpad.com LAS X 1.4.6 Leica microsystem https://www.leica-microsystems.com/es/productos/software-de-microscopia/p/leica-las-x-ls/ ZEN 3.4 Carl Zeiss Microscopy https://www.zeiss.com/microscopy/es/productos/software/zeiss-zen.html BDFACSDiva BD https://www.bdbiosciences.com/ko-kr/products/software/instrument-software/bd-facsdiva-software BDFACSuite 1.0.5 BD https://www.bdbiosciences.com/en-ie/products/software/instrument-software/bd-facsuite-application\#Overview FlowJo X v. 10.0.7r Tree Star https://www.flowjo.com Figure legends Figure 1. Pseudomonas syringae pv. phaseolicola 1448A wbpL displays phenotypic heterogeneity in LB-grown populations and bistability in HIM-grown. ( A and C ) Flow-cytometry analysis of a Pph derivative strain carrying a chromosome-located wbpL : :GFP3 , grown 24h in LB ( A ) or in HIM ( C ) is shown as dot plots representing GFP fluorescence intensity versus cell size. Data are represented as arbitrary units in logarithmic scale. Histograms show GFP fluorescence versus cell count for the same data. Data displayed corresponds to that collected for at least 100,000 events per sample. The non-GFP graphs shows autofluorescence levels displayed by the Pph reference strain not carrying any fluorescent gene marker. Confocal microscopic images LB-grown (B) or HIM-grown (D) of Pph wbpL : :GFP3 . Microscopy images show in the GFP channel the fluorescence of GFP (in white) as reporter of wbpL gene expression. Bright field is used to visualize all bacteria regardless of wbpL expression (merged). Scale bars correspond to the values indicated. Contrast and brightness were adjusted to improve visualization but were kept constant across the different conditions and channels. Microscopy and cytometry panels show typical results of at least three independent replicates. Figure 2. Pseudomonas syringae pv. tomato DC3000 wbpL does not display phenotypic heterogeneity in LB-grown populations nor bistability in HIM-grown. ( A and C ) Flow-cytometry analysis of a Pto derivative strain carrying a chromosome-located wbpL : :GFP3 , grown 24h in LB ( A ) or 5h in HIM ( C ) is shown as dot plots representing GFP fluorescence intensity versus cell size. Data are represented as arbitrary units in logarithmic scale. Histograms show GFP fluorescence versus cell count for the same data. Data displayed corresponds to that collected for at least 100,000 events per sample. The non-GFP graphs shows autofluorescence levels displayed by the Pto reference strain not carrying any fluorescent gene marker. Confocal microscopic images LB-grown (B) or HIM-grown (D) of Pto wbpL : :GFP3 . Microscopy images show in the GFP channel the fluorescence of GFP (in white) as reporter of wbpL gene expression. Bright field is used to visualize all bacteria regardless of wbpL expression (merged). Scale bars correspond to the values indicated. Contrast and brightness were adjusted to improve visualization but were kept constant across the different conditions and channels. Microscopy and cytometry panels show typical results of at least three independent replicates. Figure 3. Expression of Pph wbpL::GFP3 is heterogeneous in apoplast-extracted bacteria. ( A ) Flow-cytometry analysis of Pph wbpL : :GFP3 extracted from the apoplast of 4 dpi bean leaves shown as dot plots representing GFP fluorescence intensity versus cell size. Data are represented as arbitrary units in logarithmic scale. Histograms show GFP fluorescence versus cell count for the same data. Data displayed corresponds to that collected for at least 100,000 events per sample. The non-GFP graphs shows autofluorescence levels displayed by the Pph reference strain not carrying any fluorescent gene marker. ( B ) Selected images of apoplast-extracted Pph wbpL : :GFP3 bacteria. Confocal microscopic images show in the GFP channel the fluorescence of GFP as reporter of wbpL gene expression. Bright field is used to visualize all bacteria regardless of wbpL expression. Scale bars correspond to the values indicated. Contrast and brightness were adjusted to improve visualization but were kept constant across the different conditions and channels. Microscopy and cytometry panels show typical results of at least three independent replicates. ( C ) Selected images of apoplast-extracted Pph wbpL : :GFP3 bacteria stained with propidium iodide (red). Confocal microscopic images show in the GFP channel the fluorescence of GFP as reporter of wbpL gene expression. Bright field is used to visualize all bacteria regardless of wbpL expression. Scale bars correspond to the values indicated. Figure 4. Expression of wbpL::GFP3 within the apoplast display stochastic variation and a negative correlation with the size of the microcolonies. ( A ) Selected images of apoplastic microcolonies of Pph wbpL :: GFP3 taken 4 days post inoculation (dpi) of bean leaves with 5x10 4 CFU/ml bacterial suspensions. Heterogeneity is displayed throughout the microcolony. A Stellaris 8 microscope (Leiva Microsystems) was used to obtain the images. Contrast and brightness were adjusted to improve visualization but were kept constant across the different times and frames of the Z-stack acquisition. Images correspond to Z-stack compilations. Scale bars correspond to the indicated measures. ( B ) Comparison of microcolonies with large (>10 μm) and small (< 5 μm) microcolony shows significant differences in the mean GFP fluorescent intensity (Mann-Whitney U test, P < 10 -4 ). ( C ) Correlation between microcolony area and fluorescence intensity of apoplastic wbpL :: GFP3 microcolonies indicates that higher expression is associated with smaller microcolonies. Figure S1 . Confocal microscopic images of LB-grown ( A ) or HIM-grown ( B ) of non-GFP3 Pph reference strain versus Pph wbpL::GFP3 . Microscopy images show in the GFP channel the fluorescence of GFP (in white) as reporter of wbpL gene expression. Bright field is used to visualize all bacteria regardless of wbpL expression (merged). Scale bars correspond to the values indicated. Contrast and brightness were adjusted to improve visualization but were kept constant across the different conditions and channels. References Aaron Novick, B. and Weiner, M. (1957) ‘Enzyme Induction as an All-or-none Phenomenon’, Proceedings of the National Academy of Sciences , 43, pp. 553–566. Available at: https://www.pnas.org. Appelmelk, B.J. et al. (2000) ‘Phase Variation in H Type I and Lewis a Epitopes of Helicobacter pylori Lipopolysaccharide’, Infection and Immunity , 68(10), pp. 5928–5932. Berry, M.C. et al. (2009) ‘Effect of a waaL mutation on lipopolysaccharide composition, oxidative stress survival, and virulence in Erwinia amylovora’ , FEMS Microbiology Letters , 291(1), pp. 80–87. Available at: https://doi.org/10.1111/j.1574-6968.2008.01438.x. Bertani, G. (1951) ‘Studies on Lysogenesis’, Journal of Bacteriology , 62(3), pp. 293–300. Available at: https://doi.org/10.1128/jb.62.3.293-300.1951. Bogino, P.C. et al. (2013) ‘The role of bacterial biofilms and surface components in plant-bacterial associations’, International Journal of Molecular Sciences , 14(8), pp. 15838–15859. Available at: https://doi.org/10.3390/ijms140815838. Bumann, D. (2002) ‘Examination of Salmonella gene expression in an infected mammalian host using the green fluorescent protein and two-colour flow cytometry’, Molecular Microbiology , 43(5), pp. 1269–1283. Cota, I. et al. (2016) ‘OxyR-dependent formation of DNA methylation patterns in OpvAB OFF and OpvAB ON cell lineages of Salmonella enterica’ , Nucleic Acids Research , 44(8), pp. 3595–3609. Cota, I., Blanc-Potard, A.B. and Casadesús, J. (2012) ‘STM2209-STM2208 (opvAB): A phase variation locus of Salmonella enterica involved in control of O-antigen chain length’, PLoS ONE , 7(5), pp. 1–13. Available at: https://doi.org/10.1371/journal.pone.0036863. Cuppels, D.A. (1986) “Generation and Characterization of Tn5 Insertion Mutations in Pseudomonas syringae pv. tomato,” Applied and Environmental Microbiology, 51(2), pp. 323–327. Drigues, P. et al. (1985) ‘Comparative Studies of Lipopolysaccharide and Exopolysaccharide from a Virulent Strain of Pseudomonas solanacearum and from Three Avirulent Mutants’, Journal of Bacteriology , 162(2), pp. 504–509. Available at: https://journals.asm.org/journal/jb. Fernández-Fernández, R. et al. (2024) ‘Evolution of a bistable genetic system in fluctuating and nonfluctuating environments’, Proceedings of the National Academy of Sciences of the United States of America , 121(36). Available at: https://doi.org/10.1073/pnas.2322371121. Freed, N.E. et al. (2008) ‘A simple screen to identify promoters conferring high levels of phenotypic noise’, PLoS Genetics , 4(12), pp. 1–7. Available at: https://doi.org/10.1371/journal.pgen.1000307. Funahara, Y. and Nikaido, H. (1980) ‘Asymmetric Localization of Lipopolysaccharides on the Outer Membrane of Salmonella typhimurium’ , Journal of Bacteriology , 141(3), pp. 1463–1465. Goldman, R.C. and Leive, L. (1980) ‘Heterogeneity of Antigenic‐Side‐Chain Length in Lipopolysaccharide from Escherichia coli 0111 and Salmonella typhimurium LT2’, European Journal of Biochemistry , 107(1), pp. 145–153. Available at: https://doi.org/10.1111/j.1432-1033.1980.tb04635.x. Hallet, B. (2001) ‘Playing Dr Jekyll and Mr Hyde: combined mechanisms of phase variation in bacteria Hallet’, Current Opinion in Microbiology , 4, pp. 570–581. Hautefort, I., Proença, M.J. and Hinton, J.C.D. (2003) ‘Single-Copy Green Fluorescent Protein Gene Fusions Allow Accurate Measurement of Salmonella Gene Expression In Vitro and during Infection of Mammalian Cells’, Applied and Environmental Microbiology , 69(12), pp. 7480–7491. Available at: https://doi.org/10.1128/AEM.69.12.7480-7491.2003. Herskowitz, I. and Hagen, D. (1980) ‘The Lysis-Lysogeny Decision of a Phage λ Explicit Programming and Responsiveness’, Annual Review of Genetics , 14, pp. 399–445. Available at: www.annualreviews.org. Holst, O. and Brade, H. (1992) ‘Chemical structure of the core region of lipopolysaccharides.’, in D.C. Morrison and J.L. Ryan (eds) Bacterial Endotoxic Lipopolysaccharides . CRC Press, Boca Raton, FL, pp. 171–205. Huynh, T. V., Dahlbeck, D. and Staskawicz, B.J. (1989) ‘Bacterial Blight of Soybean: Regulation of a Pathogen Gene Determining Host Cultivar Specificity’, Science , 245(4924), pp. 1374–1377. Available at: https://doi.org/10.1126/science.2781284. Kutschera, A. et al. (2019) ‘Loss of wbpL disrupts O-polysaccharide synthesis and impairs virulence of plant-associated Pseudomonas strains’, Molecular Plant Pathology , 20(11), pp. 1535–1549. Available at: https://doi.org/10.1111/mpp.12864. Lehtinen, J., Nuutila, J. and Lilius, E.M. (2004) ‘Green fluorescent protein-propidium iodide (GFP-PI) based assay for flow cytometric measurement of bacterial viability’, Cytometry Part A , 60(2), pp. 165–172. Available at: https://doi.org/10.1002/cyto.a.20026. Lerouge, I. and Vanderleyden, J. (2002) ‘O-antigen structural variation: mechanisms and possible roles in animal/plant–microbe interactions’, FEMS Microbiology Reviews , 26(1), pp. 17–47. Available at: https://doi.org/10.1111/j.1574-6976.2002.tb00597.x. Li, C.H. et al. (2014) ‘Roles of different forms of lipopolysaccharides in Ralstonia solanacearum pathogenesis’, Molecular Plant-Microbe Interactions , 27(5), pp. 471–478. Available at: https://doi.org/10.1094/MPMI-08-13-0248-R. Long, C.M. et al. (2024) ‘Natural reversion promotes LPS elongation in an attenuated Coxiella burnetii strain’, Nature Communications , 15(1), pp. 1–8. Available at: https://doi.org/10.1038/s41467-023-43972-y. López-Pagán, N. et al. (2025) ‘Cooperative colonization of the host and pathogen dissemination involves stochastic and spatially structured expression of virulence traits’, In press in Nature Microbiology , pp. 1–40. Available at: https://doi.org/10.21203/rs.3.rs-4131469/v1. Mlynek, K.D. et al. (2022) ‘Phase Variation of LPS and Capsule Is Responsible for Stochastic Biofilm Formation in Francisella tularensis’ , Frontiers in Cellular and Infection Microbiology , 11. Available at: https://doi.org/10.3389/fcimb.2021.808550. Mostowy, R.J. and Holt, K.E. (2018) ‘Diversity-Generating Machines: Genetics of Bacterial Sugar-Coating’, Trends in Microbiology . Elsevier Ltd, pp. 1008–1021. Available at: https://doi.org/10.1016/j.tim.2018.06.006. Omaleki, L. et al. (2022) ‘Phase variation in the glycosyltransferase genes of Pasteurella multocida associated with outbreaks of fowl cholera on free-range layer farms’, Microbial Genomics , 8(3), pp. 1–15. Available at: https://doi.org/10.1099/mgen.0.000772. Patel, R.R. et al. (2021) ‘ Pseudomonas syringae pv. phaseolicola Uses Distinct Modes of Stationary-Phase Persistence To Survive Bacteriocin and Streptomycin Treatments’, mBio , 12(2), pp. 1–17. Available at: https://doi.org/10.1128/mBio. Petrocelli, S. et al. (2012) ‘Modifications of Xanthomonas axonopodis pv. citri lipopolysaccharide affect the basal response and the virulence process during citrus canker’, PLoS ONE , 7(7), pp. 1–15. Available at: https://doi.org/10.1371/journal.pone.0040051. Ranf, S. (2016) ‘Immune Sensing of Lipopolysaccharide in Plants and Animals: Same but Different’, PLoS Pathogens . Public Library of Science, pp. 1–7. Available at: https://doi.org/10.1371/journal.ppat.1005596. Rapicavoli, J.N. et al. (2018) ‘Lipopolysaccharide O-antigen delays plant innate immune recognition of Xylella fastidiosa’ , Nature Communications , 9(1), pp. 1–12. Available at: https://doi.org/10.1038/s41467-018-02861-5. Rudolph, K.W.W. et al. (1989) ‘Extracellular Polysaccharides as Determinants of Leaf Spot Diseases Caused by Pseudomonads and Xanthomonads’ , in A. Graniti, R.D. Durbin, and A. Ballio (eds) Phytotoxins and Plan Pathogenesis . Berlin: Springer, Berlin, Heidelberg, pp. 177–218. Rufián, J.S. et al. (2016) ‘ Pseudomonas syringae Differentiates into Phenotypically Distinct Subpopulations During Colonization of a Plant Host’, Environmental Microbiology , 18(10), pp. 3593–3605. Available at: https://doi.org/10.1111/1462-2920.13497. Rufián, J.S. et al. (2018) ‘Generating Chromosome-Located Transcriptional Fusions to Fluorescent Proteins for Single-Cell Gene Expression Analysis in Pseudomonas syringae’ , in C. Medina and F.J. López-Baena (eds) Host-Pathogen Interactions: Methods and Protocols . New York, NY: Springer New York, pp. 183–199. Available at: https://doi.org/10.1007/978-1-4939-7604-1_15. Rufián, J.S. et al. (2022) ‘Single-Cell Analysis of the Expression of Pseudomonas syringae Genes within the Plant Tissue’, Journal of Visualized Experiments , (188). Available at: https://doi.org/10.3791/64614. Saini, S. et al. (2010) ‘The role of coupled positive feedback in the expression of the SPI1 type three secretion system in Salmonella’ , PLoS Pathogens , 6(7), pp. 1–16. Available at: https://doi.org/10.1371/journal.ppat.1001025. Schoonejans, E., Expert, D. and Toussaint, A. (1987) ‘Characterization and Virulence Properties of Erwinia chrysanthemi Lipopolysaccharide-Defective, pEC2-Resistant Mutants’, Journal of Bacteriology , 169(9), pp. 4011–4017. Available at: https://journals.asm.org/journal/jb. Sijmons, D. et al. (2022) ‘ Helicobacter pylori and the Role of Lipopolysaccharide Variation in Innate Immune Evasion’, Frontiers in Immunology , 13, pp. 1–13. Available at: https://doi.org/10.3389/fimmu.2022.868225. Silhavy, T.J., Kahne, D. and Walker, S. (2010) ‘The bacterial cell envelope’, Cold Spring Harbor perspectives in biology , 2(5), pp. 1–16. Available at: https://doi.org/10.1101/cshperspect.a000414. Teverson, D.M. (1991) ‘ Genetics of pathogenicity and resistance in the halo-blight disease of beans in Africa’ , PhD thesis . University of Birmingham. Weiser, J.N. et al. (1990) ‘Characterization of Repetitive Sequences Controlling Phase Variation of Haemophilus influenzae Lipopolysaccharide’, Journal of Bacteriology , 177(6), pp. 3304–3309. Available at: https://journals.asm.org/journal/jb. Whitfield, C., Williams, D.M. and Kelly, S.D. (2020) ‘Lipopolysaccharide O-antigens-bacterial glycans made to measure’, Journal of Biological Chemistry , 295(31), pp. 10593–10609. Available at: https://doi.org/10.1074/jbc.REV120.009402. van der Woude, M.W. (2011) ‘Phase variation: How to create and coordinate population diversity’, Current Opinion in Microbiology , 14(2), pp. 205–211. Available at: https://doi.org/10.1016/j.mib.2011.01.002. Information & Authors Information Version history V1 Version 1 02 January 2025 Peer review timeline Published MicrobiologyOpen Version of Record 22 Jul 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Collection MicrobiologyOpen Keywords microbial interactions and pathogenesis pathogenesis pseudomonas virulence factors Authors Affiliations Laura Mancera-Miranda Instituto de Hortofruticultura Subtropical y Mediterranea View all articles by this author José S. Rufián Instituto de Hortofruticultura Subtropical y Mediterranea View all articles by this author Nieves López-Pagán Instituto de Hortofruticultura Subtropical y Mediterranea View all articles by this author Javier Ruiz-Albert Instituto de Hortofruticultura Subtropical y Mediterranea View all articles by this author Carmen R. Beuzón 0000-0002-6888-3845 [email protected] Instituto de Hortofruticultura Subtropical y Mediterranea View all articles by this author Metrics & Citations Metrics Article Usage 451 views 202 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Laura Mancera-Miranda, José S. Rufián, Nieves López-Pagán, et al. Pseudomonas syringae lipopolysaccharide synthesis gene wbpL displays heterogeneous expression within in vitro and in planta populations. Authorea . 02 January 2025. DOI: https://doi.org/10.22541/au.173580745.54599741/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.173580745.54599741/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fea75f5c86d58d3',t:'MTc3OTI3MDg3NA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0