Preclinical development of a dual targeting bicistronic gene therapy approach for the treatment of wet age-related macular degeneration

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Age-related macular degeneration (AMD) continues to be a leading cause of severe vision impairment affecting millions worldwide. The late stages of AMD are characterized by outer retinal atrophy (geographic atrophy, GA), or neovascularization associated with subretinal and/or intraretinal exudation (exudative neovascular or ‘wet’ AMD). Intravitreal (IVT) administration of anti-vascular endothelial growth factor (VEGF) therapies has dramatically improved vision preservation for wet AMD (wAMD) patients. However, current Standard of Care (SoC) has significant shortcomings and the benefits of anti-VEGF therapy in the real-world setting fall short of the vision gains observed in randomized clinical trials. This is thought to be attributable to drug burden to patients, lack of therapeutic durability due to progression of underlying macular atrophy and refractility to treatment. Vectorized anti-VEGF therapy has been shown to be effective in reducing drug burden clinically but is unlikely to address the progression of the underlying GA driven by complement-mediated inflammation. Here, we aim to address this unmet need by developing a bicistronic gene therapy vector co-expressing aflibercept and Factor H-like protein 1 (FHL-1) to target the pro-angiogenic and pro-inflammatory environment of wAMD. In vitro assays confirmed the anti-angiogenic and complement inhibitory properties of the bicistronic vector. Recombinant AAV8 (rAAV8)-mediated co-expression was detected for up to 4 weeks following subretinal delivery in wild type (WT) mice. In a mouse laser-induced choroidal neovascularization (CNV) model, subretinal delivery of bicistronic vectors significantly reduced both CNV leakage and lesion. These results demonstrate that a single subretinal administration of bicistronic vector may provide an effective treatment option for wAMD and may also prolong patient’s visual outcomes by preventing the underlying progression of GA.
Full text 223,819 characters · extracted from preprint-html · click to expand
Preclinical development of a dual targeting bicistronic gene therapy approach for the treatment of wet age-related macular degeneration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Preclinical development of a dual targeting bicistronic gene therapy approach for the treatment of wet age-related macular degeneration Lawrence CS Tam, Josephine Joel, Dimitris Stampoulis, Abigail Little, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4636180/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Age-related macular degeneration (AMD) continues to be a leading cause of severe vision impairment affecting millions worldwide. The late stages of AMD are characterized by outer retinal atrophy (geographic atrophy, GA), or neovascularization associated with subretinal and/or intraretinal exudation (exudative neovascular or ‘wet’ AMD). Intravitreal (IVT) administration of anti-vascular endothelial growth factor (VEGF) therapies has dramatically improved vision preservation for wet AMD (wAMD) patients. However, current Standard of Care (SoC) has significant shortcomings and the benefits of anti-VEGF therapy in the real-world setting fall short of the vision gains observed in randomized clinical trials. This is thought to be attributable to drug burden to patients, lack of therapeutic durability due to progression of underlying macular atrophy and refractility to treatment. Vectorized anti-VEGF therapy has been shown to be effective in reducing drug burden clinically but is unlikely to address the progression of the underlying GA driven by complement-mediated inflammation. Here, we aim to address this unmet need by developing a bicistronic gene therapy vector co-expressing aflibercept and Factor H-like protein 1 (FHL-1) to target the pro-angiogenic and pro-inflammatory environment of wAMD. In vitro assays confirmed the anti-angiogenic and complement inhibitory properties of the bicistronic vector. Recombinant AAV8 (rAAV8)-mediated co-expression was detected for up to 4 weeks following subretinal delivery in wild type (WT) mice. In a mouse laser-induced choroidal neovascularization (CNV) model, subretinal delivery of bicistronic vectors significantly reduced both CNV leakage and lesion. These results demonstrate that a single subretinal administration of bicistronic vector may provide an effective treatment option for wAMD and may also prolong patient’s visual outcomes by preventing the underlying progression of GA. Gene therapy age-related macular degeneration (AMD) adeno-associated virus (AAV) anti-vascular endothelial growth factor (anti-VEGF) Factor H-like protein 1 (FHL-1) bicistronic vector Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction wAMD continues to be one of largest single causes of irreversible vision loss in developed countries costing > $ 27.5 billion each year in the US alone[1]. VEGF is the main driver of CNV development, a hallmark of wAMD characterized by new vessels sprouting from the choriocapillaris (CC) penetrating through the Bruch’s membrane (BrM) and proliferating into the subretinal space[2–5]. These leaky immature neovascular vessels can cause fluid extravasation with the formation of intraretinal or subretinal oedema and retinal pigment epithelium (RPE) detachment that are often associated with vision loss[6]. wAMD can be further divided into subtypes depending on the origin and location of neovascular vessels, with type I CNV associated with vessels from the CC growing into the sub- RPE space, type II CNV with vessels expanding into the subretinal space between the neurosensory retina and RPE, and type III comprises of proliferative vessels extending from the deep capillary plexus towards the outer retina[7,8]. Retinal inflammation is believed to play a central role in the pathogenesis of both dry and wet AMD, and the literature has provided strong evidence to suggest that abnormal complement activation is significantly involved in the pathogenesis of the disease[9–14]. Most notably polymorphisms of complement factor H (CFH), which normally acts to inhibit the alternative complement pathway (AP), are among the best-known mutations in AMD, indicating the important role of complement activation in its development[10,15]. Jansen and colleagues have described the pathogenesis of CNV formation in wAMD as a dynamic process involving inflammation, angiogenesis and proteolysis with remodeling of the extracellular matrix (ECM)[16]. Furthermore, CNV development can be divided into 3 stages including initiation, maturation and involution. First, pathological changes in the BrM combined with pro-angiogenic and pro-inflammatory factors enable the invasion of immune cells into the sub-RPE/subretinal space[17]. During the active inflammatory phase, RPE/glial/Muller/endothelial cells and invading macrophages contribute to the production of pro-angiogenic factors (VEGF and angiostatic proteins such as pigment epithelium-derived factor (PEDF), angiostatin & endostatin)[18,19]. Macrophage infiltration is a known key feature of AMD histopathology[20], and these immune cells act as an additional source for increasing levels of VEGF, cytokines (TNF-α) and complement C3 production[21,22], stimulating the continuous growth and maturation of the neovascular membrane. Towards the late stage of the disease, spontaneous regression of neovascular vessels and the cessation of inflammation occur, and this involution stage is characterized by scarring and subretinal fibrosis[18,23–25]. The components of the complement system can be differentially involved in the respective stages of CNV development with important roles played by the AP, anaphylatoxins (C3a and C5a) and membrane attack complex (MAC)[26,27]. Further clinical evidence has shown that C3a, C3, FB, and FH are found with increased levels in aqueous humor (AH) of wAMD patients[28,29]. The current SoC for wAMD is repeated IVT injections of anti-VEGF and this has deeply transformed the management of the disease, improving vision preservation and quality of life for millions of patients. However, there remains significant shortcomings with the current SoC with the magnitude of the vision gain observed in randomized clinical trials (RCT) not being realized or sustained in real world clinical settings (RWS). The potential reasons for the disparity between clinical studies and clinical practice are likely multifactorial. Firstly, patient treatment burden is associated with undertreatment with regimens that deviate from frequent injection schedules and/or non-compliance[30]. In RWS, patients with newly diagnosed nAMD receive fewer injections and less frequent monitoring[31,32]. Moreover, studies have shown that > 20% of patients receiving anti-VEGF therapy discontinued treatment and failed to attend follow-up visits after 12 months[33] and this increased to 50% after 5 years[34]. These elderly patients may be unable to comply with monthly visits due to time or resource constraints[35], or there may be a lag-time between the publication and adoption of RCT evidence into clinical practices, as reflected by the slow but increasing number of injections during the study period[36]. In some cases, physicians and patients may use extended-duration treatment paradigms such as ‘as-needed dosing’ or ‘treat-and extend’ to reduce the treatment burden[31]. Secondly, longitudinal studies have shown shortcomings in durability of efficacy whereby visual gain seen in the first 2 years of RCT was not sustained in the long term (mean 8–11 letter loss between year 2 and 5)[32], and this was attributed partly to the aforementioned underdosing in RWS, but also due to the progression of the underlying macular atrophy. Since anti-VEGF therapy only treats one aspect of the wAMD pathology (angiogenesis), subsequent pathologies including atrophy and fibrosis are not addressed, leading to long term vision loss over time. This is supported by reports showing that 17% of wAMD patients develop or are diagnosed with GA within 2 years after diagnosis[37,38], and this rises to 98% by 7 years[39]. Furthermore, long term clinical studies have shown an association between higher anti-VEGF treatment frequency and higher GA incidence[40–43]. The hypothesis that anti-VEGF agents are associated with GA development has been supported by both animal models and studies of post-mortem human eyes[44]. Foss and colleagues have suggested that the association of a cause effect relationship between GA and anti-VEGF would require implication of multiple clinical parameters such as CNV lesion types and number of injections, which are factors that may increase the risk of developing macular atrophy during long term treatment[41]. Furthermore, overactive complement is a known driver of GA progression and genome-wide association studies (GWAS) have shown that certain polymorphisms in the complement AP genes are a risk factor for the progression to both GA and to wAMD[45]. Different studies have demonstrated that IVT injection of anti-VEGF in neovascular AMD patients resulted in elevated levels of C3a, C4a and C5a in the aqueous humor[46,47]. These observations support that complement-mediated development of macular atrophy may be exacerbated by long-term anti-VEGF treatment. Lastly, a subpopulation of wAMD patients have been shown to be unresponsive to SoC, either at the initial phase to the loading dose or have developed tachyphylaxis during the treatment course. Evidence from longitudinal studies has shown that 28% of eyes discontinued ranibizumab treatment due to lack of apparent treatment response[48]. However, the underlying mechanism of refractility to treatment is not fully understood and management of these patients is often limited to switching of different anti-VEGFs[49]. Interestingly, several association studies have indicated a role of complement polymorphism in anti-VEGF treatment response (CFH CC genotype), although results are not confirmative and long-term follow up is limited[50,51]. To address these unmet medical needs, novel anti-VEGF therapies such as bi-specific antibodies (Vabysmo® Faricimab-svoa, Genentech) enabling longer injection intervals, port delivery system with ranibizumab (Susvimo, Genentech) and topical (PAN-90806, PanOptica) or oral (AKST4290, Alkahest) formulations have been devised to reduce patient burden and compliance issues. Similarly, one-shot anti-VEGF gene therapies have successfully tackled patient burden by reducing annual injection rate by > 80% in clinical trials[52]. However, anti-VEGF monotherapy will not be able to fully address the unmet need of treatment durability which is hampered by the progressive vision loss driven by the underlying macular atrophy, as well as those who are non-responsive to anti-VEGF treatment. Based on the evidence provided above, complement overactivation is involved in the dry and wet forms of AMD, and is a genetic risk factor for both forms. Complement overactivation contributes to the pro-inflammatory and pro-angiogenic environment in AMD, and current anti-VEGF monotherapy can only target the angiogenic aspect of the disease. In this study, we investigated whether simultaneously blocking the two key drivers of AMD pathology, angiogenesis and inflammation, using a bicistronic vector, would lead to an efficacious therapy for wAMD (Fig. 1 ). Based on the data provided herein, the vectorized bicistronic therapy should address patient burden compared to vectorized anti-VEGF gene therapy, and advantageously maintain the durability of visual acuity (VA) gains by targeting complement activation, a key driver of macular atrophy which is not addressed by anti-VEGF treatment alone. We developed a rAAV8 bicistronic vector co-expressing aflibercept and the AP regulator, FHL-1, through a 2A peptide linker under the control of a strong ubiquitous promoter. Protein expression was enhanced through codon optimization (CO) and the biological activities of vector-derived proteins were validated by in vitro VEGF and complement binding assays. Subretinal delivery of rAAV8-bicistronic vectors in C57BL/6JRj mice showed sustained expression of both aflibercept and FHL-1 in ocular fluids at 4 weeks post-injection. The mouse laser-induced CNV model was then used to evaluate the therapeutic efficacy of the bicistronic vector via subretinal delivery and significant CNV reduction was observed. The results presented here provide proof-of-concept supporting further development of a dual targeting bicistronic gene therapy approach as an effective, superior long-term treatment option for wAMD. Results Codon optimization of therapeutic transgenes Codon usage controls translation elongation rate and co-translational protein folding processes, and therefore plays an important role in determining protein expression levels[53–55]. Genes that encode highly expressed proteins are strongly enriched for preferred codons, and CO has been shown to increase endogenous and heterologous gene expression in diverse eukaryotes[55–57]. Many commercially available CO algorithms are based on empirical indices including codon adaptation index (CAI), frequency of relative synonymous codon usage, codon bias index, optimal codon usage and effective codon number[58]. The CAI is the primary index used to predict gene expression level because it indicates the extent to which the codon sequence represents the usage of codons in a particular organism. In this study, we employed 5 different CO tools to avoid bias of any one algorithm and applied manual optimization to the algorithmically optimized CO sequences to further refine the coding sequence, including elimination of cleavage sites, cryptic splice donor/acceptor sites, transcriptional factor binding sites, restriction endonuclease sites, repeats and high GC contents. 10 CO sequences of human FHL-1 coding DNA (cDNA) were first compared to the WT sequence (RC001) for FHL-1 protein expression in human retinal pigment epithelial (ARPE19) cells. pAAV-COFHL-1 constructs carrying the FHL-1 cDNA with a N-terminal CFH signal peptide were placed under the transcriptional control of a CAG promoter in conjunction with the woodchuck post-transcriptional element (WPRE), both elements have previously been included in clinical gene therapy vectors without any safety concerns[59,60] (Fig. 2 A). The 10 pAAV-COFHL-1 constructs (RC138-147) were transiently transfected into ARPE19 cells at equal concentrations and the amount of FHL-1 protein in the cell supernatant was detected by Western blot (Fig. 2 B). Densitometric analyses showed that RC141, RC144, RC145 and RC146 were amongst the highest expressing constructs compared to the WT FHL-1 sequence of RC001. The top performing pAAV-COFHL-1 expression cassettes were then packaged into rAAV2 vectors, and the level of FHL-1 protein in cell supernatant was determined by both ELISA and Western blot 72 hr post transduction of ARPE19 cells. Only a proportion of CO sequences elicited higher FHL-1 protein expression than the WT sequence (RC001), however both data sets showed that the CO sequence of RC146 induced the highest increase in protein expression and secretion compared to WT FHL-1 sequence (RC001) (Fig. 2 C and 2 D). Similarly, 10 CO aflibercept coding sequences (RC290-299) were subcloned into the same expression cassette as that of RC146 (Fig. 2 A) and packaged into rAAV8 vectors. Aflibercept expression in the cell supernatant was determined by both ELISA and Western blot 72 hr post transduction of human embryonic kidney (HEK293) cells. Aflibercept ELISA showed that protein levels in the cell supernatant was highest for RC298 compared to the non-CO sequence RC288 (Fig. 2 E). Western blot analysis showed a dominant protein band at approximately 150 kDa, which corresponds with the aflibercept homodimer molecular weight under non-reducing conditions. However, aberrant protein species were detected in RC299, possibly indicating that the substitution of synonymous codons had negatively impacted protein processing within this particular sequence. Densitometric analysis corroborated with the ELISA data showing that RC298 was the highest expressing CO sequence (Fig. 2 F). Based on these expression data, the CO sequences of RC146 (FHL-1) and RC298 (aflibercept) were used in further experiments to evaluate the bicistronic vector. Bicistronic vector design and in vitro characterization of secreted proteins The use of rAAV vectors for efficient expression of two genes has previously been described in multiple preclinical studies and has been used for the clinical delivery of recombinant heavy- and light-chain Fab fragments[61,62]. Conventional bicistronic expression cassettes have employed either two tandem promoters or bidirectional promoters to drive the expression of two genes independently. However, the limited packaging capacity of rAAV vectors often render these options non-viable. Alternatively, a single promoter driving expression of two genes simultaneously linked by translational control elements such as an internal ribosome binding site (IRES) or 2A linkers can provide a partial solution. The IRES sequence permits the production of multiple proteins from a single mRNA transcript but suffers from two main limitations. First, the IRES-dependent downstream second gene can be expressed at significantly lower level within the vector, and secondly, the size of the IRES element is often in excess of 500 base pairs[63]. These issues can be mitigated by using 2A peptide sequences derived from a large group of viral families including the Foot and Mouth Disease Virus (F2A), equine rhinitis A virus (E2A), porcine teschovirus-1 (P2A) and Thosea Asigna virus (T2A)[64]. 2A peptides are 18–25 amino acid viral oligopeptides that have been shown to mediate efficient bicistronic expression of two gene products from a single promoter through ribosomal skipping (often referred to as self-cleavage) during protein translation[65,66]. Theoretically, the two gene products are expressed at 1:1 molar ratio and each gene product is expressed at high levels. The 2A and 2A-like bicistronic systems have been shown to be highly effective in the CNS where high expression levels of both genes have been demonstrated without any cytotoxic effects[67]. Previous reports have compared the cleavage efficiencies of different 2A motifs in a multi-cistron setting and demonstrated mixed results with a dependency on the genes being expressed[68,69]. The F2A peptide has been previously used in a clinical rAAV8-antiVEGFfab vector[62]. In addition, a furin recognition site was placed upstream of the 2A to enable the removal of the remaining 2A residues after self-cleavage. To further guide optimal bicistronic design, the effect of gene position on protein expression was assessed whereby four bicistronic vectors (RC304, RC312, RC318 and RC319) with alternating positions of FHL-1 and aflibercept genes were evaluated (Fig. 2 A). Two combinations of promoter and post-transcriptional elements (CMV-WPRE and CAG-WPRE3) were also tested. rAAV8 bicistronic vectors were transduced into HEK293 cells and protein expression was assessed in the cell supernatant by ELISA and Western blot at 72 hr post-transduction. FHL-1 expression was detected from all bicistronic vectors but at relatively lower levels compared to monocistronic vector (RC146), irrespective of gene position or promoter-WPRE combination, with RC312 showing the highest level of FHL-1 expression (Fig. 3 A). Aflibercept expression from RC304 and RC312 were similar to the monocistronic vector (RC298), while RC318 and RC319 showed reduced expression (Fig. 3 A). Overall, the CMV-WPRE configuration was observed to drive higher expression levels of both transgenes. The position of the transgenes within each promoter/post-transcriptional element combination appeared to have affected expression differently. Interestingly, it was observed across all bicistronic configurations that the overall molar ratio of FHL-1 expression was higher than that of aflibercept, irrespective of promoter and post-transcriptional element types. Western blots showed that secreted FHL-1 and aflibercept proteins were of the correct expected band size with no observation of uncleaved or incorrectly processed protein products (Fig. 3 B). The biological activity of vector-derived proteins in the cell supernatant of RC304 and RC312 transduced cells was then assessed by respective in vitro VEGF- and complement-binding assays. To determine the binding affinity of aflibercept for VEGF, an equilibrium binding assay was performed in which different concentrations of vector-derived aflibercept in the cell supernatant of transduced cells were incubated with VEGF-A 165 and the amount of unbound VEGF-A 165 was measured. Figure 3 C shows that vector-derived aflibercept had a similar VEGF-binding affinity to the recombinant aflibercept control. Furthermore, to assess the ability of vector-derived aflibercept to block VEGF-stimulated human umbilical vein endothelial cell (HUVEC) proliferation, both VEGF and vector-derived aflibercept were added to cultured HUVEC cells. In agreement with the VEGF-binding affinity assay, all vector-derived aflibercept demonstrated an equal inhibitory effect on VEGF-dependent HUVEC proliferation compared to recombinant aflibercept control (Fig. 3 D). The activity of vector-derived FHL-1 was demonstrated through an in vitro C3b binding assay showing the detection of high levels of iC3b (breakdown product of C3b cleavage) from both RC304 and RC312, similar to the recombinant FHL-1 protein control (Fig. 3 E). These data clearly indicate that all bicistronic vectors express and secrete biologically active aflibercept and FHL-1 proteins. In vivo dose escalation expression study A dose escalation expression study was first carried out using monocistronic RC298 in vivo to determine a safe dose range for subsequent efficacy assessment of the bicistronic vectors in the mouse laser-induced CNV model. Monocistronic rAAV8-aflibercept vectors (RC298) were subretinally injected into WT mice in escalating doses ranging from 5e7 to 1e10 vg/eye (Fig. 4 A). At 4-weeks post-injection, vector genome copy numbers were quantified in mouse eyecups and a dose-dependent increase in genome copies was observed up to 5e9 vg/eye (Fig. 4 B). Similarly, a linear dose-dependent increase in aflibercept protein expression was observed, as well as a ceiling effect at the higher doses of 5e9 and 1e10 vg/eye (Fig. 4 C). Based on the observed dose to expression relationship, the dose threshold was established to be between 5e8 and 5e9 vg/eye. To avoid the potential toxic effects that are often associated with higher doses, 5e7 vg/eye was selected as the representative dose for evaluating the therapeutic effect of bicistronic vectors. In vivo bicistronic expression study To assess dual expression of FHL-1 and aflibercept in vivo , both RC304 and RC312 were subretinally injected into mouse eyes at 5e7 and 5e8 vg/eye (Fig. 5 A). At 4 weeks post-injection, vector genome copy numbers and protein expression levels were measured by qPCR and ELISA in mouse eyecups and ocular fluids respectively. For quantitative comparison of vector genome copies and protein expression levels between monocistronic and bicistronic vectors, we extrapolated relative expression data from monocistronic aflibercept vectors in Fig. 4 . qPCR analyses in mouse eyecups showed a clear dose-response effect in genome copies, but it was observed that the concentration of rAAV8 bicistronic vectors were 1.2 to 3.6-fold lower than that of monocistronic aflibercept vectors at both respective doses (Fig. 5 B). Assessment of protein expression in mouse ocular fluids also showed a linear dose-response effect, with RC304 and RC312 showing similar levels of aflibercept expression across both doses (Fig. 5 C). However, it was noted that aflibercept protein expression from both bicistronic vectors was approximately 3–10 fold lower than the monocistronic vector (Fig. 5 C). FHL-1 protein expression was observed to be moderately higher in RC304 across both doses compared to RC312 (Fig. 5 D). In addition, it was observed that the overall molar ratio of aflibercept expression was higher than FHL-1 for both configurations, contrasting the in vitro data observed in Fig. 3 A. The data here showed that the bicistronic vectors were capable of driving the expression of two gene products in rodent retinas in a dose-dependent manner, despite lower expression levels of aflibercept compared to the monocistronic counterpart. In the ocular fluids, both RC304 and RC312 showed similar aflibercept expression levels but RC304 was observed to deliver higher FHL-1 protein levels. Based on this observation, RC304 was investigated for its therapeutic effect in the laser-induced CNV mouse model. Therapeutic efficacy of bicistronic vectors in laser-induced choroidal neovascularization (CNV) mouse model For proof-of-concept that dual targeting of VEGF and complement can elicit a therapeutic effect in the mouse laser-induced CNV model, 2 groups of mice received unilateral (right eye) subretinal injections of either RC304 (rAAV8-COFHL-1-2A-COaflibercept) at 5e7 vg/eye or null vectors in the negative control group at 5e8 vg/eye (Fig. 6 A). Four weeks post-injection, CNV was induced in the injected eyes by laser photocoagulation laser. The successful production of CNV lesions was confirmed by using spectral-domain optical coherence tomography (SD-OCT) and fluorescein angiography (FA). Immediately after CNV induction, an additional positive control group received IVT administration of aflibercept at 80 µg/eye. Injected eyes were imaged at days 4 and 7 post-lasering and all animals were sacrificed. Choroidal flat mounts were prepared and stained using isolectin B 4 for CNV lesion analysis. At day 4 post-CNV induction, both IVT-aflibercept and the RC304 treated group showed significantly lower CNV leakage area than the null vector group (IVT-aflibercept, p = 0.0008; RC304, p = 0.0002). On day 7 post-CNV, only the RC304 treated group continued to show significant reduction of leakage area compared to the null vector group (p = 0.0273), whereas no statistical significance was detected between IVT-aflibercept and the null vector group (Fig. 6 B). Isolectin B 4 staining in the choroidal flat mounts revealed that both RC304 and IVT-aflibercept treated groups had significantly reduced isolectin-positive areas as compared to the null vector group (RC304, p = 0.0001; IVT-aflibercept, p = 0.0061) (Fig. 6 C). Collectively, the data presented here clearly demonstrated that subretinal administration of RC304 at 5e7 vg/eye achieved therapeutic efficacy on CNV read-outs. Discussion There still remains significant unmet medical need for the treatment of wAMD since most of the visual gains observed with SoC during clinical development are simply not achievable and/or durable in RWS owing to 1) patient drug burden driving non-compliance and underdosing; 2) progression of the underlying AMD to the dry form of the disease (not treated with current SoC); 3) unresponsiveness to SoC, either at treatment start or subsequent development of tachyphylaxis during prolonged treatment. Our data suggest that the treatment gap can be addressed by developing a dual targeting bicistronic gene therapy to improve disease conversion and the overall outcomes in late-stage AMD. Vectorizing anti-VEGF will tackle the non-compliance issue inherent to SoC ensuring clinical trial level efficacy is attained in RWS, while simultaneously targeting complement activation to delay/stop the progression of the dry form of AMD ensuring vision gains are more durable than SoC. For the construction of a dual-targeting bicistronic vector for tackling angiogenesis and complement-driven inflammation, both aflibercept and FHL-1 were evaluated based on their biological function and potency in targeting the respective pathways. Aflibercept is a clinically approved recombinant VEGF receptor fusion protein comprising of the 2nd Ig domain of human VEGFR1 and the 3rd Ig domain of human VEGFR2 expressed as an inline fusion with the Fc portion of human IgG, which binds to VEGF-A, VEGF-B, and placental growth factor (PIGF) and inhibits the activation of VEGFR1 and VEGFR2[70]. Clinical studies have shown that the efficacy and safety of aflibercept are non-inferior to ranibizumab[5], and treatment with aflibercept can improve VA and reduce macular edema in wAMD patients who were poorly treated with other anti-VEGF drugs[71]. From the perspective of simplifying the bicistronic vector design, aflibercept benefits from being a fusion protein omitting the need to include an additional 2A peptide, as opposed to the need of vectorizing the Fab fragment of ranibizumab. FHL-1 is composed of the first 7 N-terminal complement control protein (CCP) domains of Factor H (FH) and functions to protect host surfaces from uncontrolled complement attack through dampening the AP by two distinct mechanisms of action: decay acceleration (dissociation of C3 convertase) and complement cofactor activity (combining with CFI to cleave C3b into iC3b)[72]. Preclinical studies have also shown that intraocular administration of human recombinant FH (recFH) reduced CNV in the mouse laser-CNV model as efficiently as anti-VEGF antibody, decreasing deposition of C3 cleavage fragments, MAC and microglia/macrophage recruitment markers in the CNV lesion site[73]. In comparison to CFH, FHL-1 is a relatively smaller protein that can transverse the BrM and into the CC, which may make it more effective at treating AMD since the disease is thought to start in the choroid[74]. In conjunction, the relatively small coding sequence of the FHL-1 gene allows inclusion in a rAAV bicistronic expression cassette. The use of CO DNA coding sequences has become a common practice to enhance recombinant protein expression by tailoring the coding sequence for a particular expression system. While there exist many commercially available CO algorithms, little-to-no consensus exists for defining the empirical rules and guidelines for optimizing DNA coding sequence. A recent study had identified that discrepancies in codon frequency databases exist between different CO algorithms, leading to a high variability in the recombinant yield of output algorithmically optimized coding sequences[75]. To circumvent the issue of bias, we utilized 5 different open sources of publicly available CO algorithms and included additional manual optimization parameters to generate a total of 10 different synthetic coding sequences for each gene. Indeed, in vitro expression analysis revealed high variability in protein expression, corroborating other reports that algorithm-optimized coding sequences will have equivalent chances of either increasing or diminishing recombinant protein yields as compared to the native cDNA[75]. Simultaneous delivery of two distinct genes for co-synthesis of therapeutic proteins in the same cell can either be achieved by co-infection of two separate monocistronic rAAV vectors, or infection with a single bicistronic rAAV vector co-expressing two genes. Although experimental evidence has indicated that the former has a higher percentage of co-expressing cells[76], the economic burden associated with manufacturing two separate rAAV vectors may present a less attractive option for translation into the clinic. The approach taken in this study for the design of the bicistronic vector mirrors that of previous clinical vectors using a single ubiquitous promoter driving the expression of two distinct genes linked by a self-cleavage 2A peptide[62]. Other designs have seen the use of two independent promoters, but this was strictly not feasible in our context owing to the restricted insert capacity of rAAV vectors[77]. Expression from the rAAV bicistronic vector was first assessed in the cell supernatant of transduced cells as both proteins were secreted to exert their biological activity extracellularly. The biological activity of soluble aflibercept and FHL-1 proteins were found to be non-inferior to their recombinant protein counterparts in blocking VEGF activity and complement activation respectively. Although high levels of aflibercept and FHL-1 expression were detected in the cell supernatant, both proteins were expressed at different molar ratios. In vivo expression data in the mouse ocular fluids further corroborated that soluble protein expression from bicistronic vectors were not at equimolar ratios and were lower than monocistronic vectors at both doses. We did not observe uncleaved soluble protein products by Western blot analyses, and more sensitive methods such as LC-MS/MS peptide mapping may help further decipher the impact of 2A peptide mediated processing on protein expression levels. Additional investigation into the intracellular concentration of encoded proteins may provide evidence whether this observation was due to differences in protein stability and/or secretion. In any case, the evidence provided here demonstrates that the 2A-bicistronic vector supported co-expression of two biologically active proteins both in vitro and in vivo . Importantly, we observed that amelioration of CNV in the laser mouse model was achieved following subretinal injection with the rAAV8-COFHL-1-2A-COaflibercept vector. In particular, the observed efficacious dose of 5e7 vg/eye allometrically scaled to a clinically relevant dose of ∼5e10 vg/eye based on ocular volume, further highlighting the translatability of this data. Both CNV leakage and lesion area were significantly reduced, indicating that the level of expression achieved by the bicistronic vector was sufficient to elicit a therapeutic effect. The therapeutic benefits of the bicistronic gene therapy approach should be determined in longer-term-follow-up (LTFU) clinically to fully elucidate treatment efficacy towards reducing conversion and maintaining VA. A major development path to translate the bicistronic gene therapy approach for this highly prevalent disease to the clinic is to transition towards in-office delivery (IVT or suprachoroidal delivery). Although subretinal injection is the preferred route of administration for a majority of inherited retinal disease (IRD) gene therapies (Luxturna®, Novartis), leading to superior retinal gene transfer particularly to the RPE that coincides with the location of AMD disease pathology[78], it is still a complex surgical procedure undertaken in an operating room, hence limiting its scalability to target large patient populations. In contrast, non-surgical in-office delivery offers significant advantages including access to larger patient populations while maintaining commercial competitiveness with other wAMD treatments. IVT injections of gene therapy vectors have recently been subjected to non-clinical and clinical evaluation using engineered AAV2 capsids (AAV2-7m8, AAV2-GL, AAV2-NN) to bypass the inner limiting membrane (ILM) that often limits transduction of the outer retina[79,80]. Repeated IVT administration of anti-VEGF therapies have also been proven to be safe in the clinic without significant adverse effects[81]. It has been noted that IVT delivery often requires higher vector doses than subretinal delivery owing to the need to overcome the dilution effect in the vitreous and the dynamic fluid clearance via the anterior outflow, as well as penetration through the ILM to reach the outer retina/choroid. However, IVT injection has been associated with increased and persistent distribution in the systemic circulation, raising concerns regarding the immune response and off-target transduction[82]. Moreover, exposure of vectors to the systemic environment may lead to greater susceptibility to neutralization from pre-existing anti-AAV antibodies hampering the long-term efficacy of this delivery approach[83]. Delivery to the suprachoroidal space (SCS) in conjunction with a proprietary microinjector is currently under evaluation in clinical trials for nAMD (NCT04514653) and diabetic retinopathy (NCT04567550) with favorable clinical outcomes. In non-clinical studies, SCS delivery of high doses of rAAV8 vectors could provide widespread transgene expression in the RPE[84]. Further innovations into novel AAV capsids with higher transduction efficiency and immune-evasive properties in conjunction with refined injection devices may help lower the dose needed for in-office delivery and improve their safety and efficacy profiles in the clinic. The expansion of new therapeutic options in the clinic with alternative target pathways and novel modalities has clearly highlighted the urgent need for addressing the treatment gap of current SoC for wAMD. Based on the data herein, we provide proof-of-concept that the application of a rAAV bicistronic vector at a clinically relevant dose ameliorated CNV leakage and lesion in the mouse laser-induced CNV model. A one-shot bicistronic gene therapy of this nature could ensure clinical trial level efficacy that is sustained over time by reducing angiogenesis and the onset and/or progression of underlying GA. In addition, the transition to in-office delivery will be key to ensure competitiveness with current SoC and allowing the therapy to reach larger patient populations. Materials and Methods Codon optimization and construct design The sequence of FHL-1 (NM_001014975) was entered into 5 different online codon optimization tools: 1. GeneArt ( https://www.thermofisher.com/uk/en/home/life-science/cloning/gene-synthesis/geneart-gene-synthesis/geneoptimizer.html ) 2. GenScript ( https://www.genscript.com/quick_order/gene_services_gene_synthesis ) 3. IDT ( https://eu.idtdna.com/CodonOpt ) 4. JCat ( http://www.jcat.de/ ) 5. COOL ( http://cool.syncti.org ) The standard human genetic code was used for all tools. For online tools 1–4 above, one sequence was generated from each tool. For tool 5, default settings were used, and the ‘target expression host’ was set to Homo sapiens. In addition, 39 genes that are highly expressed in the RPE were input into the tool[85]. Tool 5 generated 55 optimized sequences for FHL-1 and the top-ranking sequence was used. 5 further sequences were generated by subjecting each of the original 5 sequences to further manual optimization to eliminate cryptic splice sites, microRNA binding sites, to remove tandem duplicate codons and to check GC content as follows: cryptic splice sites were identified using the www.Fruitfly.orgtool . A cut-off value of 0.4 was used for analysis, but only sequences scoring > 0.75 were modified. Splice sites were removed by changing the GT of the donor site or the AG of the acceptor site wherever possible. When not possible (e.g. for sequences encoding valine), the 5’ adjacent base was changed. All modified sequences were then analyzed with www.Fruitfly.org tool to confirm that all splice sites had either been removed or reduced to below the 0.75 threshold. MicroRNA binding sites were identified using www.Genecards.org . The website identified the miRNA binding site hsa-mir-146a-5p for CFH, however as this is present in the 3’UTR sequence, this does not impact the transgene in the vector. All sequences were manually checked for tandem duplicate codons, and where these were found, the second codon was changed to the next most commonly used codon in Homo sapiens (using the SnapGene codon usage table). The overall GC content was checked to ensure that it was as close to 50% as possible (range 49–65%). The amino acid sequence of aflibercept was acquired from www.drugbank.ca and aligned with human DNA sequence of VEGFR1 (NM_001159920), VEGFR2 (NM_002253) and IgG to determine the WT human sequence. The aflibercept sequence was then CO with Tools 1–4 as above, and at the time of this work the COOL algorithm had become unavailable. Therefore, the Genewiz webtool ( https://clims4.genewiz.com ) was used as replacement. Further manual optimization was performed including removal of TATA box and TF binding sites as follow: a. TATA box consensus = TATAWAW (W = A or T) b. E-box consensus = CANNTG c. Sp-1 consensus = KGGGCGGRRY d. Ap-1 consensus = 5’-TGASTCA-3’ e. CAT boxes – GGCCAATCT f. Poly A signals AATAAA Any restriction sites that could be used for cloning were disrupted. Direct repeats over 10 nucleotides were identified with ( http://bioserver1.physics.iisc.ernet.in/cgi-bin/fair4/fair/indx.pl ) and then disrupted. Sequences were subjected to BLAST to identify any sequences with homology to other regions of the genome and these were disrupted if found. Tandem duplicate codons were removed, as for FHL-1 and the GC content was modified to fall within a range of 50–60%. Each of the steps above was repeated until all elements had been resolved. The output of these modifications yielded 10 sequences per transgene (5 basic, and 5 with further manual optimization). To generate monocistronic DNA constructs, WT or CO FHL-1 or aflibercept cDNA sequences with a CFH signal peptide sequence were cloned into a synthesized AAV genome backbone, consisting of 5′ and 3’ AAV2 inverted terminal repeats (ITR), a CAG promoter (comprised of a chicken β-actin promoter, a cytomegalovirus enhancer and a rabbit β-globulin intron, collectively termed CAG promoter) and a bovine growth hormone polyadenylation (bGHpA) site as previously described[86]. Additionally, a modified Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was added downstream of the cDNA sequence to enhance expression through increasing mRNA stability and extranuclear transport[87,88]. For the generation of bicistronic DNA constructs, the selected FHL-1 or Aflibercept CO cDNA sequences containing a CFH signal peptide were subcloned in different positions into the AAV genome backbone separated by a furin cleavage site (RRKR) followed by a GSG-linker and foot and mouth disease virus 2A (F2A) element plus 11aa upstream 1D sequence[89]. Expression was controlled by either a cytomegalovirus (CMV) or CAG promoter and with/without a WPRE or mutant WPRE (WPRE3[90]) downstream of the transgene based on not exceeding the AAV genome packaging capacity of ~ 4.7 kb. In addition, a canonical 13 nucleotide core binding site for the hepatic transcription factor HNF-1alpha located within the WT AAV2 3’UTR adjacent to the 3’ITR sequence was removed from the AAV bicistronic constructs as it has been shown to confer liver-specific enhancer-promoter activity[91]. Cell Culture All cell culture work was performed in a biological safety cabinet and cells were cultured in 37ºC incubators with 5% CO 2 . HEK293 (DSMZ) or ARPE-19 (ATCC, CRL-2302) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) + Glutamax media (Gibco) + 10% Fetal Bovine Serum (FBS) (Gibco) in T75 flasks. Once cells reached 70% confluency, cells were expanded into T175 flasks and cultured for 2 weeks prior to seeding. To expand cells, media was removed and replaced with 3 ml TrypLE express (Gibco) and cells were incubated at 37ºC until detached. Cells were then collected with the addition of 7 ml DMEM (Gibco) + 10% FBS (Gibco) media. The cell suspension was pipetted up and down to break up any cell clumps and 10 µl of this suspension was removed and mixed with 10 µl of Trypan blue (Gibco) in a separate tube. The cell suspension and Trypan blue mix was then added to a cell counting slide and cells were counted using the Countess II FL (Thermo Scientific). HEK293 cells were seeded at either 1e4 or 2e4 cells/cm 2 and ARPE19 cells were seeded at 2e4 cells/cm 2 to maintain culture and split every 3–4 days once ~ 70% confluence was reached. Transient Transfection of APRE-19 cells 0.25 µg plasmid DNA was transfected in duplicate into 70% confluent ARPE-19 cells in a 48-well plate using PEIpro transfection reagent (Polyplus) as per the manufacturer’s instructions in DMEM/Glutamax supplemented with 10% FBS. The day after transfection, media was aspirated and replaced with 125 µl fresh serum-free media. Supernatant was harvested 48 hr after media change, spun at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4ºC then supernatant was transferred to a fresh tube and stored at -80ºC until ready for use. rAAV transduction of HEK293 and ARPE19 cells HEK293 cells were seeded into 24-well plates prior to transduction using the cell splitting protocol described above. Cells were seeded at 1.25e5 cells/well (4.17e5 cells/ml) with 300 µl of DMEM (Gibco) + 10% FBS (Gibco) media used per well. Cells were incubated at 37ºC for 24 hr. Cells were visually inspected to ensure 60–70% confluency was reached before transduction. Media was removed from each well and cells were washed with 300 µl of Opti-MEM serum free media (Gibco) to remove any residual DMEM (Gibco) + 10% FBS (Gibco) media. rAAV vectors were diluted in Opti-MEM to achieve a final multiplicity of infection (MOI) of 1e4. Opti-MEM was removed from cells and 300 µl of vector and Opti-MEM mix was added to each well. Two replicate wells were transduced per rAAV vector. Cells were then incubated at 37ºC. After 24 hr of incubation, the rAAV vector and Opti-MEM mix was removed and 300 µl of fresh Opti-MEM added to each well. Cells were then incubated at 37ºC. After 48 hr, supernatants were collected from each well by centrifugation at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4ºC to remove any cell debris. Supernatants were then transferred to fresh Eppendorf tubes and stored at -20ºC. APRE-19 cells were seeded into 48-well tissue culture-treated plates at 1e5 cells per well in 200 µl DMEM + 10% FBS and incubated at 37ºC with 5% CO 2 . 24 hr later, with cells at 60–80% confluency, each well was transduced with rAAV2 vectors at MOI of 1e3. Media was changed to 125 µl fresh serum-free media after 24 hr. After a further 48 hr, the supernatant was harvested to low protein binding tubes, centrifuged at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4ºC to remove any cell debris, then transferred to fresh low protein-binding tubes. Production of monocistronic rAAV vectors HEK293 cells (DSMZ) were seeded in 2x 10 cm TC-treated dishes per vector at 5e6 cells per dish in 10 ml DMEM + 10% FBS. 24 hr later the media was aspirated and replaced with 10 ml DMEM/Glutamax with 5% FBS. After 4 hr, cells were triple transfected: 5 µg total plasmid per dish (transgene plasmid, pRepCap2 or pRepCap8 and pHelper) was mixed with PEI per dish and incubated at room temperature (RT) for 30 min before adding dropwise to the cells in their dishes. The following day, sodium butyrate was added to each dish. After a further 48 hr, the supernatant from both dishes was harvested, pooled and mixed then centrifuged at 1000 rpm (Eppendorf 5810R) for 10 min to remove cell debris. The supernatant was transferred to a fresh tube and 1:5 volume of AAVanced reagent (System Biosciences) (i.e. 5 ml in 20 ml) was added and gently mixed by inverting the tube. The mixture was incubated at 4°C for 72 hr. For concentration of vector, the tube was inverted several times to mix then centrifuged at 1000 rpm for 30 min at 4°C. The supernatant was discarded, and the pellet was resuspended in 500 µl PBS then transferred to a 1.5 ml microcentrifuge tube and centrifuged for 3 min at 1500 g. The supernatant was discarded, and the remaining pellet was resuspended in 200 µl (1/100 original volume) and stored at -80°C. Production of bicistronic rAAV vectors Four T-75 flasks were seeded with 5e6 adherent HEK293 (DSMZ) cells per flask in 10 ml DMEM with 10% FBS. 24 hr later the media was aspirated and replaced with 10 ml DMEM/Glutamax with 5% FBS. After 4 hr, cells were triple transfected: 5 µg total plasmid per dish (transgene plasmid, pRepCap8 and pHelper) was mixed with PEI per dish and incubated at RT for 30 min before adding dropwise to the cells in their dishes. The following day, sodium butyrate was added to each dish. 72 hr later, 1M MgCl2 stock and Denerase (250 U/µl) were added to each flask and incubated at 37°C for 30–60 min. Following incubation, media release solution was added to each flask and incubated for a further 30–60 min at 37°C. Finally, the supernatant from all 4 flasks was pooled and mixed, then centrifuged at 150 g (Eppendorf 5810R) for 5 min to remove cell debris, then passed through a 0.2 µM syringe filter and stored at -80°C until FPLC purification. All vectors were purified over 0.2 ml AAVX columns (BioservUK) on a BioRad NGC system and eluted under low pH conditions as per manufacturer’s protocol. Fractions were collected and neutralized in 10% v/v titration buffer, then buffer exchanged into formulation buffer, aliquoted and stored at -80°C. AAV genome titration by qPCR analysis rAAV vector samples were analyzed by qPCR to measure AAV genome titres. Samples underwent DNase I digestion by incubation with DNase I enzyme (Invitrogen). 10 µl of sample was added to a mix of 5 µl DNase I enzyme (Invitrogen), 5 µl 10x DNase I buffer (Invitrogen) and 30 µl of nuclease free water (NFW). Samples were incubated at 37°C for 30 min in a thermocycler. A DNase I positive control (1 µl of linearized reference plasmid DNA and 9 µl NFW) and a DNase I negative control (10 µl NFW) were also prepared and incubated at 37°C for 30 min. To deactivate the DNase I, a mix of 20 µl 25 nM EDTA (Invitrogen) and 30 µl NFW was added to each sample and control. Samples and controls were then heated at 75°C for 30 min followed by 5 min at 4 o C in a thermocycler. A proteinase K digestion step was then performed to break down the AAV capsid. 50 µl of DNase I digested sample was then added to 5 µl PK enzyme (Qiagen) and 45 µl PBS and heated in a thermocycler using the following program: 56 o C for 2 hr, 95°C for 30 min, 4°C for 10 min. DNase I and PK digested samples were then diluted to an appropriate dilution factor to achieve a final Ct value within assay standard curve range. Samples were diluted with salmon sperm buffer (1 µl salmon sperm DNA stock (Invitrogen) diluted in 5 ml of NFW) in a serial dilution resulting in final sample dilution factor of 1e2-1e4. A standard curve was prepared by serial dilution of reference linearized plasmid DNA diluted in salmon sperm buffer to achieve final copy number/10 µl standard range of: 1e8, 2e7, 4e6, 8e5, 1.6e5, 3.2e4, 6.4e3, 1.28e3. qPCR mix was prepared by mixing forward and reverse primers (final concentration 0.25 µM), Sybr Green SSOAdvanced PCR supermix 2x (Bio-Rad) and NFW. Forward and reverse primers were designed to target the bGHpA sequence present in all rAAV constructs used (F primer: CCTTCTAGTTGCCAGCCATC, R primer: ATGACACCTACTCAGACAATGC). 15 µl of the qPCR master mix was added to each well of a 96-well plate and 10 µl of diluted sample, standard or control was added. For each sample two dilution factors were analyzed. The plate was sealed and then transferred to a CFX96 thermocycler (Bio-Rad) where the following program was run: 95°C for 3 min, 40X cycles (95°C for 10 sec, 60°C for 30 sec), melting curve (95°C for 10 sec, 60°C for 5 sec, 95°C for 30 sec). The results were analyzed using the CFX96 software (Bio-Rad) and the resultant Ct values were extrapolated from the standard curve to calculate titre values for each sample. Aflibercept ELISA Aflibercept protein levels were measured in supernatant samples using Aflibercept ELISA kit (Immunoguide, ABIN3172721) according to the manufacturer’s instructions. Supernatant samples were diluted from 1:50 − 1:100 in the supplied dilution buffer to obtain values within the range of the assay. Absorbance measurements at 450 nm were measured using the Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve with 4PL curve fit using GraphPad Prism. FHL-1 ELISA An internally developed FHL-1 quantitative ELISA was used to measure FHL-1 expression levels from constructs. 96-well plates were coated with primary antibody diluted in 1X coating buffer (Bio-Rad, BUF030B) overnight at 4°C. Plates were blocked for 2 hr with 1% BSA (Sigma, 05479) in PBS-0.05% Tween 20 (PBST) (Sigma, P1379). Wells were washed with PBST (Sigma, P1379) using ELx405 Microplate washer (BioTek) and tapped on absorbent paper to remove residual liquid. Wash steps were repeated 3 times and performed after each incubation with blocking buffer, sample and antibodies. Samples and standards were diluted in sample buffer (1% BSA/PBST). A Standard curve was generated ranging from 200 ng/ml to 1.56 ng/ml using human recombinant FHL-1 (GTP, custom made). Samples were analyzed using two dilution factors from (1:100-1:5) to achieve absorbance values within the standard curve range. Standards and samples were loaded into the plate and incubated at RT for 1 hr. Primary anti-FHL-1 Fab antibody (AbD33594.1) was diluted to a final concentration of 3 µg/ml. Secondary biotinylated anti-OX24 (final concentration of 0.05 µg/mL, Thermo-Fisher) and tertiary streptavidin-HRP antibodies (1:40,000) were diluted in 1% BSA/PBST, added to wells and incubated for 1 hr at RT. Development was carried out by adding 1 step ultra TMB-ELISA reagent (Thermo Scientific, 34028) to each well and incubating for 15 min. The reaction was stopped with 1M sulphuric acid (Hach, 93153). Absorbance was measured at 450 nm using a Sunrise Microplate reader (Tecan). Bradford Assay Cell supernatant samples were thawed on ice and protein concentration was quantified using Bradford reagent (Sigma). A BSA (Pierce) standard curve was prepared ranging from 2000-0 µg/ml. BSA standard samples were diluted in the same matrix as supernatant samples (Opti-Mem serum free media (Gibco)). 5 µl of each standard or supernatant sample was added to a 96-well plate. 250 µl of Coomassie reagent (Sigma) was added to each well, the plate was covered and manually shaken to mix sample and reagent. The plate was incubated at RT for 10 min and the absorbance at 595 nm was measured using Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve using 4PL curve fit by GraphPad Prism. Western blot Cell supernatant samples were analyzed by Western blot to detect the presence of aflibercept and FHL-1 protein. Cell supernatant samples were prepared for gel electrophoresis by mixing with Laemmli (4x) reducing buffer (Bio-Rad) and NFW (Gibco). A final protein concentration of 500 ng was loaded in each well. Samples were then incubated at 70°C for 10 min to denature proteins prior to gel electrophoresis. Mini-PROTEAN TGX gel chambers (Bio-Rad) were filled with 1x TGX running buffer (Bio-Rad). 15 µl of each sample was loaded onto a 4–20% 15-well Mini-PROTEAN TGX pre-cast gel (Bio-Rad, 456–1096). Gels were run at 100V for 1 hr and then transferred to a PVDF membrane using the Trans-Blot turbo transfer pack (Bio-Rad, 170–4156) and the Trans-blot Turbo transfer system (Bio-Rad) at 1.3A, 25V for 7 min. Membranes were then blocked in 5% milk (Sigma) /TRIS Buffered Saline -Tween (0.05%) (TBST) for 1 hr at RT. Membranes were probed using anti-human CFH primary antibody (1:5000, Quidel) diluted in 5% milk/TBST at 4°C overnight. The next day membranes were washed 3 times for 5 min in TBST and probed with rabbit anti-Goat HRP secondary antibody (1:2000, Dako) for 1 hr at RT. Membranes were then washed 3 times for 5 min in TBST as previously described. Membranes were then developed using the ECL detection reagent (Amersham, RPN2232). Chemiluminescence was then measured using the ChemiDoc Imaging system (Bio-Rad). Image Lab was used to perform densitometry analysis. To detect aflibercept expression, membranes were probed with only the anti-human IgG- HRP antibody (1:20000, Thermo) at 4°C overnight. The next day membranes were washed and immediately developed as described. Densitometric analysis Densitometric analysis was performed using ImageJ software. The bands representing RC001 (WT FHL-1) and RC288 (non-CO aflibercept) were used as the reference bands. The square selection tool was used to select each band and a background square containing no sample was used as the background reference. ImageJ software was then used to subtract the background level from each band. A relative quantity was calculated compared to the reference band. HUVEC proliferation assay HUVECs (ATCC® PCS-100-013™) were seeded in a 96-well tissue culture dish at 5e3 cells/cm 2 in 180 µl HUVEC media (as instructed by ATCC) with either 0 or 15 ng/ml (360 nM) VEGF, avoiding the edge wells. 3–4 hr later, 20 µl of either OptiMEM (GIBCO), aflibercept diluted in OptiMEM, or cell supernatant containing aflibercept expressed from transduced HEK293 cells diluted in OptiMEM was added to each well. 200 µl PBS was added to each edge well. The 96-well plates were incubated at 37°C in 5% CO 2 for 5 days, after which they were harvested. Cell media was gently tipped off and the plate was blotted on tissue paper to remove excess. 100 µl 10% TCA (trichloroacetic acid) solution was applied to each well for 20 min at RT, then tipped off into a reservoir for disposal. The plate was rinsed three times by dunking the plate into a container of distilled water and flicking off. The plate was blotted on tissue paper to dry, then 100 µl SRB (sulphorhodamine B reagent was added per well and incubated for 15 min before tipping off. Plates were blotted again, then washed three times with 100 µl 1% acetic acid. The plate was then left to dry in dark at ambient temperature overnight. Once all plates were harvested and dried, the SRB dye was solubilized by adding 100 µl 10 mM Tris base per well and incubated for 10 min under shaking at RT. The absorbance was read at 544 nm on a Tecan Sunrise microplate reader. VEGF binding assay Cell supernatant containing vector-derived aflibercept from transduction were incubated with 250 pg/ml recombinant human VEGF (R&D systems) to assess the binding affinity of expressed aflibercept to VEGF. Aflibercept containing cell supernatant were diluted in Opti-MEM serum free media to achieve a molar ratio range of aflibercept:VEGF at 20:1 to 1024:1. Aflibercept concentrations in cell supernatant samples were determined by Aflibercept ELISA (as previously described). Eylea® (recombinant aflibercept) was used as a positive control for VEGF binding. Reactions were incubated at 37 ºC for 1 hr at 350 rpm. The levels of unbound VEGF were measured using human VEGF Quantikine ELISA kit (R&D systems, DVE00) according to the manufacturer’s instructions. A standard curve ranging from 100 − 15.6 pg/ml of VEGF was prepared using standard material provided in the kit. The absorbance at 595 nm was measured using Sunrise Microplate reader (Tecan). Concentration values were extrapolated from standard curve using 4PL curve fit by GraphPad Prism. The concentration of unbound VEGF was plotted for each molar ratio of aflibercept:VEGF and an IC 50 value was calculated for each sample using GraphPad Prism. In Vitro C3b Binding assay An in vitro C3b binding assay was performed to determine the biological activity of human FHL-1 expressed from bicistronic constructs. Concentration of FHL-1 in supernatants was determined using FHL-1 ELISA (as previously described). Human recombinant FHL-1 protein (GTP, custom made) was used as a control. Reactions were prepared at a 1:4 molar ratio of CFI:FHL-1. Reactions containing 50 ng human CFI recombinant protein (Comptech, A138), 1 µg of human recombinant C3b (Comptech, A113) and the required volume of FHL-1 supernatant or control were prepared on ice. Reactions were incubated at 37°C for 20 min in a Thermoblock. After incubation reactions were immediately frozen at -80°C to stop the reaction. The incubation of FHL-1 and CFI with C3b leads to the cleavage of the α-chain of C3b to generate the iC3b by-product. The amount of iC3b produced in this reaction was quantified using an iC3b ELISA. iC3b quantitative ELISA An internal iC3b quantitative ELISA was developed to measure the functional activity of FHL-1 for C3b breakdown with CFI. 96-well plates were coated with mouse anti-C3 primary antibody diluted in 1X coating buffer (Bio-Rad, BUF030B) to a final concentration of 3 µg/ml and incubated overnight at 4°C. Plates were blocked for 1 hr with 2% BSA (Sigma, 05479-50)/PBS. Wells were washed with PBST (Sigma, P1379) using the ELx405 Microplate washer (BioTek) and tapped on absorbent paper to remove any residual liquid. Wash steps were repeated 3 times and performed after each incubation with blocking buffer, samples, and antibodies. Samples and standards were diluted in sample buffer (PBST with 10 mM EDTA). A standard curve was generated ranging from 2 mg/ml to 31.25 ng/ml using human purified iC3b protein (CompTech, A115). Samples were analyzed using two dilution factors (1:100 and 1:400). Standards and samples were loaded onto the plate and incubated at RT for 2 hr. Rat anti-C3g secondary antibody (Hycult) diluted in 1% BSA/PBST to a final concentration of 0.25 µg/ml and mouse anti-rat HRP tertiary antibodies (1:5000, Hycult) were incubated in the wells for 1 hr at RT. Plates were developed by adding 1-step ultra TMB-ELISA reagent (Thermo Scientific, 34028) to each well and incubating for 15 min. Reaction was stopped with 2M sulphuric acid (Hach, 93153). Absorbance was measured at 450 nm using a Sunrise Microplate reader (Tecan). Animal care and handling Inbred male C57BL/6JRj mice aged eight weeks at arrival (Janvier Labs, France) were housed in groups of three to five in individually ventilated cages with aspen bedding, nesting material (Populus tremula, Tapveiâ Estonia OÜ, Estonia) and polycarbonate red igloos (Datesand group, USA) as enrichment, at a constant temperature (22 ± 1°C), relative humidity (50 ± 10%) and in a light-controlled environment (lights on from 7 am to 7 pm) with ad libitum access to food (Rat/Mouse maintenance V1534-000, ssniff Spezialdiäten GmbH, Germany) and tap water. Experiments started after a minimum of one-week quarantine and acclimatization in the vivarium. All animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, the EC Directive 2010/63/EU of the European Parliament and of the Council on the Protection of animals used for Scientific Purposes and using protocols approved and monitored by the Animal Experiment Board of Finland (Experimentica Ltd. animal license number ESAVI-10750-2020). The study is reported in accordance with ARRIVE guidelines ( https://arriveguidelines.org ). Anesthesia and reversal For all the procedures the animals were anesthetized with a subcutaneous injection of a mixture containing ketamine (30 mg/Kg) (Ketaminol Vet 50 mg/ml. Intervet, The Netherlands) and medetomidine (0.4 mg/kg) (Cepetor Vet 1 mg/ml. Vetmedic, Finland). Anesthesia was reversed by α2-antagonist for medetomidine (2.5 mg/kg) (Revertor Vet 5 mg/ml; Vetmedic, Finland). During the anesthesia, mice received a subcutaneous injection of sodium lactate solution to prevent dehydration (Ringer-Lactate Animalcare, Ecuphar NV, Belgium). Subretinal Injections of rAAV vectors The anesthetized animals were placed under a stereomicroscope (Leica Microsystems), and a drop of iodine was applied on the cornea and allowed to spread evenly (Minims Povidione Iodine 5%, Bausch & Lomb, Canada). A small incision in the temporal side of the conjunctiva/sclera was performed to expose the choroid. A 30 G needle was used to create a small hole in the temporal side of the choroid and the cornea was also punctured in order to reduce the intraocular pressure. A micro-syringe (Hamilton Bonaduz AG, Bonaduz, Switzerland) was filled with 1 µl solution of vector and the vector was introduced into the subretinal space through the exposed choroid. The solution was injected into the subretinal space for 10 sec and the needle was kept in place for an additional 30 sec. before being removed. The success of the injection was confirmed using in vivo SD-OCT imaging (Bioptigen Envisu R2200; Bioptigen Inc./Leica Microsystems, Morrisville, NC, USA). Chloramphenicol ointment was applied after the injection (Oftan Chlora, Santen Oy, Finland). All vectors were administered unilaterally into the right eye. The contralateral eye was left as healthy control. Intravitreal administration of aflibercept The positive control compound was Eylea® (Bayer Pharma AG, Germany), a ready-to-use solution for IVT injections at a concentration of 40 mg/mL (formulated in 10 mM sodium phosphate, 40 mM sodium chloride, 0.03% polysorbate 20, and 5% sucrose, pH 6.2). Aflibercept was administered intravitreally into the right eye (OD) at a volume of 2 µl (80 µg/eye) immediately after the CNV induction. Laser-induced Choroidal Neovascularization The anaesthetized animals received a drop of 0.5% tropicamide (Oftan Tropicamid, Santen Oy) to dilate the pupils. A drop of Viscotears (Dr. Gerhard Mann Chem. -Pharm., Germany) was applied on the eye and a coverslip was used to applanate the cornea. Three laser lesions were executed unilaterally on the right eye around the optic nerve head using a 532 nm diode laser (spot size: 100 µm; power: 130 mW; time: 120 ms. Oculight TX. Iridex Corp., USA). The success on perforating the BrM was verified by FA and SD-OCT in vivo imaging. In Vivo Imaging The success of the subretinal injections was confirmed using SD-OCT imaging. SD-OCT was performed prior CNV induction, and the CNV lesions were monitored using FA and SD-OCT on day 0 after CNV induction, and at days 4 and 7 for all the study groups. Fluorescein Angiography (FA) Vascular leakage at the choroid level was examined using a Heidelberg Spectralis HRA system (Heidelberg Engineering, Germany). Briefly, a drop of 0.5% tropicamide (Oftan Tropicamid. Santen Oy) was administered on the cornea of the anaesthetized mouse to dilate the pupils, and the mouse was positioned onto the mouse holder. After aligning the optic nerve head at the retina level, with the use of the infrared reflectance camera, a solution of 2.5% sodium fluorescein (Sigma-Aldrich, Finland) was administered as a subcutaneous injection (30 µl/10 g). Consecutive fluorescent images (Sensitivity: 45; ART Mean: 5 frames) were taken every 60 sec from the retinal and choroidal focus levels for a period of 5 min after the fluorescein administration. Spectral Domain Optical Coherence Tomography (SD-OCT) SD-OCT was performed to verify the subretinal administration, prior and after the CNV induction, and at days 4 and 7 after CNV induction. Immediately after the FA imaging the mouse was examined using the SD-OCT system Envisu R2200 (Bioptigen Inc./Leica Microsystems, USA). The scanned area covers a 1.4 x 1.4 mm 2 of the retina centered around the optic nerve. Each scan is composed of 100 B Scans each one composed of 1000 A Scans. Quantitative and qualitative analysis of CNV The lasered spots were qualitatively graded from FA images for evidence of vascular leak. SD-OCT scans were used for additional confirmation. FA scans were analyzed by a proprietary algorithm, which uses a combination of convolutional neural network (CNN) designed for semantic segmentation and traditional computer vision algorithms. The neural network was trained to recognize and quantify CNV lesions using transfer learning approach. The results from the model were reviewed and adjusted, if necessary, by a scientist blinded to the treatments. Animal Sacrifice and Tissue Collection Mice were sacrificed by anesthesia with a subcutaneous injection of a mixture containing ketamine (30 mg/kg) (Ketaminol Vet 50 mg/ml; Intervet) and medetomidine (0.4 mg/kg) (Cepetor Vet 1 mg/ml; CP-Pharma Handelsgesellschaft MbH) and then decapitation on day 7 after CNV induction. All treated/induced eyes (OD) and two contralateral eyes per group (OS) were enucleated and choroidal flat mounts were prepared for neovascularization analysis. Quantification vector genomes in mouse eyecups 50 µl RNAlater (Invitrogen) was added to each frozen eyecup and allowed to thaw on ice. Each eyecup was cut into 10–20 pieces using dissecting scissors then plunged into liquid nitrogen for 30 sec. 50 µl β-mercaptoethanol-supplemented RLT buffer (Qiagen) was added, and the tissue was disrupted using an electric micro-pestle for 2 min. An additional 200 µl β-mercaptoethanol-supplemented RLT was added and mixed by pipetting. The sample was stored at -80°C overnight. Following thawing, the sample was passed through a QIAshredder (Qiagen) to further homogenize the tissues, then RNA was extracted as per RNeasy fibrous tissue kit (Qiagen) and eluted in 50 µl RNase-free water. DNase I digestion was performed on-column as part of the RNeasy fibrous tissue kit protocol. cDNA was reverse transcribed from 200 ng RNA using a SuperScript III Reverse Transcriptase Kit (Invitrogen 11752-050). Standard curves were prepared by serial dilution of linearized plasmid DNA. qPCR mix was prepared by mixing forward and reverse primers (F: CATCGCATTGTCTGAGTAGGT R: AGCATGCCTGCTATTGTCTT) to a final concentration of 0.25 µM with 2x SybrGreen SSOadvanced PCR supermix (Bio-Rad) and NFW. 15 µl of qPCR master mix was added to each well of a 96-well plate and 10 µl of diluted sample, standard or control was added. The plate was sealed and transferred to a CFX96 thermocycler (Bio-Rad) where the following program was run: 95°C for 3 min, 40X cycles (95°C for 10 sec, 60°C for 30 sec), melting curve (95°C for 10 sec, 60°C for 5 sec, 95°C for 30 sec). The results were analyzed using the CFX96 software (Bio-Rad) and the resultant Ct values were extrapolated from the standard curve to calculate concentration values for each sample. Aflibercept ELISA measurement in mouse ocular fluids Aflibercept protein levels were measured in ocular fluid samples using Aflibercept ELISA kit (Immunoguide, ABIN3172721) according to the manufacturer’s instructions. Ocular fluids were diluted 1:15 in the supplied dilution buffer to obtain values within the range of the assay. Absorbance measurements at 450 nm were measured using the Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve with 4PL curve fit using GraphPad Prism. FHL-1 MSD measurement in mouse ocular fluids FHL-1 protein levels were measured in ocular fluid samples by MSD. MSD SECTOR plates were coated with coating protein anti-FHL-1-biotin spycatch (AbD33594rab, BioRad). Ocular fluid and standard samples were incubated for 1 hr at RT (shaking at 750 rpm) and in-house sulfo-tagged antibody (anti-FH Ox-24, MA170057, Invitrogen) was used for detection. The plate was read using MSD read buffer T and the ocular fluid samples were compared to an 8-point standard curve. The plates were read by an MSD plate reader and analyzed using MSD Discovery Workbench software. CNV staining Choroidal flat mounts were stained with fluorescein labeled Griffonia Simplicifolia Lectin I (GSLI) Isolectin B 4 (FL-1201, Vector Laboratories, USA) to evaluate the neovascularization. Briefly, the flat mounts were washed with Tris-buffered saline (TBS) and blocked with 10% normal goat serum (NGS), 0.5% Triton X-100 in TBS pH 7.4 (TBST) for 1 hr in RT. Samples were washed with TBS and incubated with fluorescein labeled Isolectin GS-IB 4 (1:200, Vector Laboratories) overnight at + 4°C in 1% NGS diluted in 0.1% TBST. Thereafter the samples were washed 3 x 10 min with 1% NGS diluted in 0.1% TBST, counterstained with DAPI and mounted with Fluoroshield™ mounting medium (Sigma-Aldrich) on microscopic slides. Choroidal samples were imaged using a DMi8 THUNDER 3D microscope (Leica Microsystems, Germany). The stained areas were outlined, and the stained area was measured using the image processing software FIJI[92]. Statistical analysis Quantitative data were graphed, analyzed and presented as mean ± standard deviation (SD). Statistical analyses were performed using the GraphPad Prism software (v10.1.1 GraphPad Software, USA). Differences were considered statistically significant at the p < 0.05 level. Imaging data distribution was normalized by square root transformation and One-way ANOVA followed by Dunnett’s multiple comparison tests were performed. Outliers were identified and removed using the ROUT method (Q = 0.2%). Declarations Data Availability All data generated and/or analyzed in this study are included in this published article. Materials may be made available subjected to legal obligations. Acknowledgements Figures 1, 2A, 4A, 5A and 6A were generated with BioRender.com. Author Contributions L.C.S.T wrote the manuscript, supervised the project and conception of idea. J.J conducted codon optimization, designed the bicistronic vectors, conducted in vitro experiments and established the qPCR assay for measuring in vivo RNA expression. D.S designed and conducted data analysis for the in vivo experiments. A.L. conducted the in vitro experiments. A.W. assisted with codon optimization. R.A-D supported and collected data for the in vivo experiments. M.D. and J.H. supported vector manufacturing. J.E-R supervised the in vivo experiments, revised the manuscript and conception of idea. S.E. revised the manuscript and conception of idea. All authors have read and approved the final manuscript. Funding This study was supported and funded by Gyroscope Therapeutics (A Novartis Company). Additional Information L.C.S.T, D.S, R.A-D and J.H are employed by Gyroscope Therapeutics (A Novartis Company). J.J, A.L, A.W, M.D, J.E-R and S.E were previously employed by Gyroscope Therapeutics (A Novartis Company) while engaged in the research project. References Economic Burden of Ageing Eye conditions estimated on the scale of up to billions in USA, Germany and Bulgaria. https://retina-international.org/wsd2022-amdimpact/ . Kwak, N., Okamoto, N., Wood, J. M. & Campochiaro, P. A. VEGF is major stimulator in model of choroidal neovascularization. Invest Ophthalmol Vis Sci 41 , 3158–64 (2000). Okamoto, N. et al. Transgenic mice with increased expression of vascular endothelial growth factor in the retina: a new model of intraretinal and subretinal neovascularization. Am J Pathol 151 , 281–91 (1997). Bhutto, I. & Lutty, G. Understanding age-related macular degeneration (AMD): relationships between the photoreceptor/retinal pigment epithelium/Bruch’s membrane/choriocapillaris complex. Mol Aspects Med 33 , 295–317 (2012). Heier, J. S. et al. Intravitreal aflibercept (VEGF trap-eye) in wet age-related macular degeneration. Ophthalmology 119 , 2537–48 (2012). Daruich, A. et al. Mechanisms of macular edema: Beyond the surface. Prog Retin Eye Res 63 , 20–68 (2018). Schmidt-Erfurth, U. et al. Guidelines for the management of neovascular age-related macular degeneration by the European Society of Retina Specialists (EURETINA). Br J Ophthalmol 98 , 1144–67 (2014). Faatz, H. et al. Vascular Analysis of Type 1, 2, and 3 Macular neovascularization in age-related macular degeneration using swept-source optical coherence tomography angiography shows new insights into differences of pathologic vasculature and may lead to a more personalized understanding. Biomedicines 10 , (2022). Armento, A., Ueffing, M. & Clark, S. J. The complement system in age-related macular degeneration. Cell Mol Life Sci 78 , 4487–4505 (2021). Schwartz, S. G., Hampton, B. M., Kovach, J. L. & Brantley, M. A. Genetics and age-related macular degeneration: a practical review for the clinician. Clin Ophthalmol 10 , 1229–35 (2016). Fritsche, L. G. et al. A large genome-wide association study of age-related macular degeneration highlights contributions of rare and common variants. Nat Genet 48 , 134–143 (2016). Tan, P. L., Bowes Rickman, C. & Katsanis, N. AMD and the alternative complement pathway: genetics and functional implications. Hum Genomics 10 , 23 (2016). Kumar-Singh, R. The role of complement membrane attack complex in dry and wet AMD - From hypothesis to clinical trials. Exp Eye Res 184 , 266–277 (2019). Reis, E. S., Mastellos, D. C., Hajishengallis, G. & Lambris, J. D. New insights into the immune functions of complement. Nat Rev Immunol 19 , 503–516 (2019). Kauppinen, A., Paterno, J. J., Blasiak, J., Salminen, A. & Kaarniranta, K. Inflammation and its role in age-related macular degeneration. Cellular and Molecular Life Sciences 73 , 1765–1786 (2016). Jensen, E. G., Jakobsen, T. S., Thiel, S., Askou, A. L. & Corydon, T. J. Associations between the Complement System and Choroidal Neovascularization in Wet Age-Related Macular Degeneration. Int J Mol Sci 21 , 9752 (2020). Ambati, J., Atkinson, J. P. & Gelfand, B. D. Immunology of age-related macular degeneration. Nat Rev Immunol 13 , 438–451 (2013). Grossniklaus, H. E. & Green, W. R. Choroidal neovascularization. Am J Ophthalmol 137 , 496–503 (2004). Campa, C. et al. Inflammatory Mediators and Angiogenic Factors in Choroidal Neovascularization: Pathogenetic Interactions and Therapeutic Implications. Mediators Inflamm 2010 , 1–14 (2010). Cruz-Guilloty, F. et al. Infiltration of Proinflammatory M1 Macrophages into the Outer Retina Precedes Damage in a Mouse Model of Age-Related Macular Degeneration. Int J Inflam 2013 , 1–12 (2013). Natoli, R. et al. Retinal Macrophages Synthesize C3 and Activate Complement in AMD and in Models of Focal Retinal Degeneration. Investigative Opthalmology & Visual Science 58 , 2977 (2017). Krause, T. A., Alex, A. F., Engel, D. R., Kurts, C. & Eter, N. VEGF-Production by CCR2-Dependent Macrophages Contributes to Laser-Induced Choroidal Neovascularization. PLoS One 9 , e94313 (2014). Ishikawa, K., Kannan, R. & Hinton, D. R. Molecular mechanisms of subretinal fibrosis in age-related macular degeneration. Exp Eye Res 142 , 19–25 (2016). Hinton, D. R., He, S. & Lopez, P. F. Apoptosis in Surgically Excised Choroidal Neovascular Membranes in Age-Related Macular Degeneration. Archives of Ophthalmology 116 , (1998). Lambert, V. et al. Laser-induced choroidal neovascularization model to study age-related macular degeneration in mice. Nat Protoc 8 , 2197–2211 (2013). Rohrer, B. et al. The alternative pathway is required, but not alone sufficient, for retinal pathology in mouse laser-induced choroidal neovascularization. Mol Immunol 48 , e1–e8 (2011). Bora, P. S. et al. Role of Complement and Complement Membrane Attack Complex in Laser-Induced Choroidal Neovascularization. The Journal of Immunology 174 , 491–497 (2005). Loyet, K. M. et al. Activation of the Alternative Complement Pathway in Vitreous is Controlled by Genetics in Age-Related Macular Degeneration. Investigative Opthalmology & Visual Science 53 , 6628 (2012). Schick, T. et al. Local complement activation in aqueous humor in patients with age-related macular degeneration. Eye 31 , 810–813 (2017). Wykoff, C. C. et al. Impact of Anti-VEGF Treatment and Patient Characteristics on Vision Outcomes in Neovascular Age-related Macular Degeneration. Ophthalmology Science 4 , 100421 (2024). Holekamp, N. M. et al. Clinical utilization of anti-VEGF agents and disease monitoring in neovascular age-related macular degeneration. Am J Ophthalmol 157 , (2014). Ciulla, T. A., Hussain, R. M., Taraborelli, D., Pollack, J. S. & Williams, D. F. Longer-Term Anti-VEGF Therapy Outcomes in Neovascular Age-Related Macular Degeneration, Diabetic Macular Edema, and Vein Occlusion-Related Macular Edema. Ophthalmol Retina 6 , 796–806 (2022). Obeid, A. et al. Loss to Follow-up Among Patients With Neovascular Age-Related Macular Degeneration Who Received Intravitreal Anti–Vascular Endothelial Growth Factor Injections. JAMA Ophthalmol 136 , 1251 (2018). Jones, R., Stratton, I. M., Scanlon, P. H. & Theodoropoulou, S. Disengagement and loss to follow-up in intravitreal injection clinics for neovascular age-related macular degeneration. Eye 37 , 3186–3190 (2023). Shahzad, H. et al. Non-adherence and non-persistence to intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy: a systematic review and meta-analysis. Syst Rev 12 , 92 (2023). Mehta, H. et al. Trends in Real-World Neovascular AMD Treatment Outcomes in the UK. Clinical Ophthalmology Volume 14 , 3331–3342 (2020). Xu, L. et al. GEOGRAPHIC ATROPHY IN PATIENTS RECEIVING ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR FOR NEOVASCULAR AGE-RELATED MACULAR DEGENERATION. Retina 35 , 176–186 (2015). Grunwald, J. E. et al. Incidence and Growth of Geographic Atrophy during 5 Years of Comparison of Age-Related Macular Degeneration Treatments Trials. Ophthalmology 124 , 97–104 (2017). Rofagha, S., Bhisitkul, R. B., Boyer, D. S., Sadda, S. R. & Zhang, K. Seven-Year Outcomes in Ranibizumab-Treated Patients in ANCHOR, MARINA, and HORIZON. Ophthalmology 120 , 2292–2299 (2013). Grunwald, J. E. et al. Risk of Geographic Atrophy in the Comparison of Age-related Macular Degeneration Treatments Trials. Ophthalmology 121 , 150–161 (2014). Foss, A., Rotsos, T., Empeslidis, T. & Chong, V. Development of Macular Atrophy in Patients with Wet Age-Related Macular Degeneration Receiving Anti-VEGF Treatment. Ophthalmologica 245 , 204–217 (2022). Eshtiaghi, A., Issa, M., Popovic, M. M., Muni, R. H. & Kertes, P. J. GEOGRAPHIC ATROPHY INCIDENCE AND PROGRESSION AFTER INTRAVITREAL INJECTIONS OF ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR AGENTS FOR AGE-RELATED MACULAR DEGENERATION. Retina 41 , 2424–2435 (2021). Tanaka, E., Chaikitmongkol, V., Bressler, S. B. & Bressler, N. M. Vision-Threatening Lesions Developing with Longer-Term Follow-up after Treatment of Neovascular Age-Related Macular Degeneration. Ophthalmology 122 , 153–161 (2015). Gemenetzi, M., Lotery, A. J. & Patel, P. J. Risk of geographic atrophy in age-related macular degeneration patients treated with intravitreal anti-VEGF agents. Eye 31 , 1–9 (2017). Yan, Q. et al. Genome-wide analysis of disease progression in age-related macular degeneration. Hum Mol Genet 27 , 929–940 (2018). Keir, L. S. et al. VEGF regulates local inhibitory complement proteins in the eye and kidney. Journal of Clinical Investigation 127 , 199–214 (2016). Tanaka, K. et al. Changes in complement activation products after anti-VEGF injection for choroidal neovascularization in age-related macular degeneration and pachychoroid disease. Sci Rep 11 , 8464 (2021). Rasmussen, A. et al. A 4-Year Longitudinal Study of 555 Patients Treated with Ranibizumab for Neovascular Age-related Macular Degeneration. Ophthalmology 120 , 2630–2636 (2013). Ehlken, C. et al. Switch of anti-VEGF agents is an option for nonresponders in the treatment of AMD. Eye 28 , 538–545 (2014). Chen, G. et al. Pharmacogenetics of Complement Factor H Y402H Polymorphism and Treatment of Neovascular AMD with Anti-VEGF Agents: A Meta-Analysis. Sci Rep 5 , 14517 (2015). Sengul, E. A. et al. Pharmacogenetic Aspect of Intravitreal Ranibizumab Treatment in Neovascular Age-Related Macular Degeneration: A Five-Year Follow-Up. Ocul Immunol Inflamm 26 , 971–977 (2018). Castro, B. F. M., Steel, J. C. & Layton, C. J. AAV-Based Strategies for Treatment of Retinal and Choroidal Vascular Diseases: Advances in Age-Related Macular Degeneration and Diabetic Retinopathy Therapies. BioDrugs 38 , 73–93 (2024). Chaney, J. L. & Clark, P. L. Roles for Synonymous Codon Usage in Protein Biogenesis. Annu Rev Biophys 44 , 143–166 (2015). Yu, C.-H. et al. Codon Usage Influences the Local Rate of Translation Elongation to Regulate Co-translational Protein Folding. Mol Cell 59 , 744–754 (2015). Hanson, G. & Coller, J. Codon optimality, bias and usage in translation and mRNA decay. Nat Rev Mol Cell Biol 19 , 20–30 (2018). Quax, T. E. F., Claassens, N. J., Söll, D. & van der Oost, J. Codon Bias as a Means to Fine-Tune Gene Expression. Mol Cell 59 , 149–161 (2015). Inouye, S., Sahara-Miura, Y., Sato, J. & Suzuki, T. Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons. Protein Expr Purif 109 , 47–54 (2015). Fu, H. et al. Codon optimization with deep learning to enhance protein expression. Sci Rep 10 , 17617 (2020). LeWitt, P. A. et al. AAV2-GAD gene therapy for advanced Parkinson’s disease: a double-blind, sham-surgery controlled, randomised trial. Lancet Neurol 10 , 309–319 (2011). Xue, K. et al. Beneficial effects on vision in patients undergoing retinal gene therapy for choroideremia. Nat Med 24 , 1507–1512 (2018). Woodley, E. et al. Efficacy of a bicistronic vector for correction of Sandhoff Disease in a mouse model. Mol Ther Methods Clin Dev 12 , 47–57 (2019). Liu, Y. et al. AAV8-antiVEGFfab ocular gene transfer for neovascular age-related macular degeneration. Molecular Therapy 26 , 542–549 (2018). Mizuguchi, H., Xu, Z., Ishii-Watabe, A., Uchida, E. & Hayakawa, T. IRES-Dependent Second Gene Expression Is Significantly Lower Than Cap-Dependent First Gene Expression in a Bicistronic Vector. Molecular Therapy 1 , 376–382 (2000). de Lima, J. G. S. & Lanza, D. C. F. 2A and 2A-like Sequences: Distribution in Different Virus Species and Applications in Biotechnology. Viruses 13 , 2160 (2021). Ahier, A. & Jarriault, S. Simultaneous Expression of Multiple Proteins Under a Single Promoter in Caenorhabditis elegans via a Versatile 2A-Based Toolkit. Genetics 196 , 605–613 (2014). Donnelly, M. L. L. et al. The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. Journal of General Virology 82 , 1027–1041 (2001). Furler, S., Paterna, J.-C., Weibel, M. & Büeler, H. Recombinant AAV vectors containing the foot and mouth disease virus 2A sequence confer efficient bicistronic gene expression in cultured cells and rat substantia nigra neurons. Gene Ther 8 , 864–873 (2001). Chng, J. et al. Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells. MAbs 7 , 403–412 (2015). Liu, Z. et al. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Sci Rep 7 , 2193 (2017). Holash, J. et al. VEGF-Trap: A VEGF blocker with potent antitumor effects. Proceedings of the National Academy of Sciences 99 , 11393–11398 (2002). Singh, R. P. et al. A single-arm, investigator-initiated study of the efficacy, safety and tolerability of intravitreal aflibercept injection in subjects with exudative age-related macular degeneration, previously treated with ranibizumab or bevacizumab: 6-month interim analysis. British Journal of Ophthalmology 98 , i22–i27 (2014). Mannes, M., Dopler, A., Huber-Lang, M. & Schmidt, C. Q. Tuning the Functionality by Splicing: Factor H and Its Alternative Splice Variant FHL-1 Share a Gene but Not All Functions. Front Immunol 11 , (2020). Borras, C. et al. Mechanisms of FH Protection Against Neovascular AMD. Front Immunol 11 , (2020). Clark, S. J. et al. Identification of Factor H–like Protein 1 as the Predominant Complement Regulator in Bruch’s Membrane: Implications for Age-Related Macular Degeneration. The Journal of Immunology 193 , 4962–4970 (2014). Ranaghan, M. J., Li, J. J., Laprise, D. M. & Garvie, C. W. Assessing optimal: inequalities in codon optimization algorithms. BMC Biol 19 , 36 (2021). Moradian, H., Gossen, M. & Lendlein, A. Co-delivery of genes can be confounded by bicistronic vector design. MRS Commun 12 , 145–153 (2022). Askou, A. L. et al. Suppression of Choroidal Neovascularization by AAV-Based Dual-Acting Antiangiogenic Gene Therapy. Mol Ther Nucleic Acids 16 , 38–50 (2019). Tripepi, D. et al. The Role of Subretinal Injection in Ophthalmic Surgery: Therapeutic Agent Delivery and Other Indications. Int J Mol Sci 24 , 10535 (2023). Dalkara, D. et al. In Vivo–Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous. Sci Transl Med 5 , (2013). Pavlou, M. et al. Novel AAV capsids for intravitreal gene therapy of photoreceptor disorders. EMBO Mol Med 13 , (2021). Singer, M. A. et al. HORIZON: An Open-Label Extension Trial of Ranibizumab for Choroidal Neovascularization Secondary to Age-Related Macular Degeneration. Ophthalmology 119 , 1175–1183 (2012). Seitz, I. P. et al. Superior Retinal Gene Transfer and Biodistribution Profile of Subretinal Versus Intravitreal Delivery of AAV8 in Nonhuman Primates. Investigative Opthalmology & Visual Science 58 , 5792 (2017). Kotterman, M. A. et al. Antibody neutralization poses a barrier to intravitreal adeno-associated viral vector gene delivery to non-human primates. Gene Ther 22 , 116–126 (2015). Yiu, G. et al. Suprachoroidal and Subretinal Injections of AAV Using Transscleral Microneedles for Retinal Gene Delivery in Nonhuman Primates. Mol Ther Methods Clin Dev 16 , 179–191 (2020). Booij, J. C. et al. A New Strategy to Identify and Annotate Human RPE-Specific Gene Expression. PLoS One 5 , e9341 (2010). Dreismann, A. K. et al. Functional expression of complement factor I following AAV-mediated gene delivery in the retina of mice and human cells. Gene Ther 28 , 265–276 (2021). Patrício, M. I., Barnard, A. R., Orlans, H. O., McClements, M. E. & MacLaren, R. E. Inclusion of the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances AAV2-Driven Transduction of Mouse and Human Retina. Mol Ther Nucleic Acids 6 , 198–208 (2017). Zufferey, R., Donello, J. E., Trono, D. & Hope, T. J. Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors. J Virol 73 , 2886–2892 (1999). Minskaia, E., Nicholson, J. & Ryan, M. D. Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications. BMC Biotechnol 13 , 67 (2013). Choi, J.-H. et al. Optimization of AAV expression cassettes to improve packaging capacity and transgene expression in neurons. Mol Brain 7 , 17 (2014). Logan, G. J. et al. Identification of liver-specific enhancer–promoter activity in the 3′ untranslated region of the wild-type AAV2 genome. Nat Genet 49 , 1267–1273 (2017). Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9 , 676–682 (2012). Additional Declarations Competing interest reported. L.C.S.T, D.S, R.A-D and J.H are employed by Gyroscope Therapeutics (A Novartis Company). J.J, A.L, A.W, M.D, J.E-R and S.E were previously employed by Gyroscope Therapeutics (A Novartis Company) while engaged in the research project. Supplementary Files TametalSupplementaryInformation28Jun2024.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4636180","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":328752947,"identity":"d56221b5-5c26-4ea7-9c3d-a45354b0e832","order_by":0,"name":"Lawrence CS Tam","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYBACPhiDH4glGAyI0MIGpSUk20jWYnAMpIUYwMZ+xuzDxx12dcb3mx/eYCiwIUILT47xzJlnkiXMjrEZWzAYpBHjsNzNzLxtB4BaeNiAfjlMhBb+t5uZ/wK1GLeBtfwnQosE0BZGoBYDNrCWA8Roef+ZsbctWXLGsTRjiwSDZMJa+PnTkhl+ttnx8zcffnjjwx87wlpQQQKpGkbBKBgFo2AUYAcAexct4Zk72nIAAAAASUVORK5CYII=","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":true,"prefix":"","firstName":"Lawrence","middleName":"CS","lastName":"Tam","suffix":""},{"id":328752949,"identity":"b6b19d54-1864-4d2a-ad4a-5e59c45cd7da","order_by":1,"name":"Josephine Joel","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Josephine","middleName":"","lastName":"Joel","suffix":""},{"id":328752950,"identity":"fc61a5b7-b0c8-4588-9def-22a2ecd5448f","order_by":2,"name":"Dimitris Stampoulis","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Dimitris","middleName":"","lastName":"Stampoulis","suffix":""},{"id":328752951,"identity":"acc756b8-e787-435c-97e5-fb13ad9c9763","order_by":3,"name":"Abigail Little","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Abigail","middleName":"","lastName":"Little","suffix":""},{"id":328752952,"identity":"2e15796c-9bac-41c8-991d-38cfcbb87f55","order_by":4,"name":"Amy Walton","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Amy","middleName":"","lastName":"Walton","suffix":""},{"id":328752953,"identity":"b72bdbb0-cb11-4072-99e9-8a8477b419c9","order_by":5,"name":"Rebecca Atkinson-Dell","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Rebecca","middleName":"","lastName":"Atkinson-Dell","suffix":""},{"id":328752954,"identity":"f1e4a1ee-4c90-4152-895a-7d2f328eface","order_by":6,"name":"Maya Devine","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Maya","middleName":"","lastName":"Devine","suffix":""},{"id":328752955,"identity":"627c74a6-39e0-4316-a29e-79a2c2634c37","order_by":7,"name":"Jake Hill","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Jake","middleName":"","lastName":"Hill","suffix":""},{"id":328752956,"identity":"b4181bc9-bf10-45b7-89b5-3a77c2cfc710","order_by":8,"name":"Julian Esteve-Rudd","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Julian","middleName":"","lastName":"Esteve-Rudd","suffix":""},{"id":328752957,"identity":"306f290c-d41b-4885-b625-443e8397e609","order_by":9,"name":"Scott Ellis","email":"","orcid":"","institution":"Gyroscope Therapeutics (A Novartis Company)","correspondingAuthor":false,"prefix":"","firstName":"Scott","middleName":"","lastName":"Ellis","suffix":""}],"badges":[],"createdAt":"2024-06-25 11:49:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4636180/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4636180/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60852811,"identity":"e09c63b6-0116-454d-aef0-4df0f8ec161a","added_by":"auto","created_at":"2024-07-22 21:13:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":445267,"visible":true,"origin":"","legend":"\u003cp\u003eBicistronic gene therapy approach targets VEGF and complement overactivation, the two key pathways in wAMD.\u003cem\u003e \u003c/em\u003eComplement activation contributes to the pro-angiogenic and pro-inflammatory environment in AMD. Anti-VEGF monotherapy only targets one aspect of the disease. In contrast, the bicistronic approach simultaneously targets VEGF and complement activation rendering it more effective in sustaining vision gain by blocking the progression of complement-mediated macular atrophy.\u003c/p\u003e","description":"","filename":"TametalFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/8a33f9ac2299b8015d2e5308.png"},{"id":60851775,"identity":"914dcb18-9995-4068-837a-130ba2daabf1","added_by":"auto","created_at":"2024-07-22 21:05:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1851136,"visible":true,"origin":"","legend":"\u003cp\u003eDesign of monocistronic and bicistronic expression cassettes and selection of CO aflibercept and FHL-1 sequences. (A) Schematic representations of monocistronic and bicistronic expression cassettes. rAAV vectors contain either the CAG or CMV promoter, a chicken β-actin intron, a kozak sequence, CFH signal peptide linked to either FHL-1 or aflibercept cDNA, full length or truncated WPRE and bGH polyadenylation (pA) sequence flanked by AAV2 ITRs. The null vector (RC268) contains a stuffer sequence that replaces the promoter and transgene while retaining the WPRE and pA sequence. CO = codon optimization. (B) ARPE19 cells were transfected with the respective pAAV-FHL-1 (WT or CO) constructs at equal molarity and FHL-1 protein expression in the cell supernatant was analyzed 48 hr post-transfection. Western blot analysis of cell supernatant loaded at equal protein concentration showed the detection of a 45 kDa FHL-1 protein band across all constructs. Densitometric analysis of band intensities relative to WT FHL-1 (RC001) showed different levels of protein expression. (C) Mean FHL-1 protein expression (nM ± SD) in ARPE19 cell supernatant transduced with rAAV2-FHL-1 vectors (WT or CO) at MOI 1e3 showed that RC146 induced the highest level of FHL-1 expression level (protein level was below the limit of detection for the WT FHL-1 sequence, RC001). (D) Western blot analysis corroborated with ELISA data showing RC146 was amongst the highest expressing CO sequence compared to the WT control. (E) Mean aflibercept protein expression (nM ± SD) in HEK293 cell supernatant transduced with rAAV8-aflibercept vectors (WT or CO) at MOI 1e4 showing RC298 as the highest expressing CO sequence compared to non-CO control (RC288). (F) Western blot under non-reducing condition showed a single protein band at ∼150kDa, except for RC299. Densitometric analysis of band intensities relative to non-CO aflibercept (RC288) corroborated with ELISA data that RC298 was amongst the highest expressing CO\u003cem\u003e \u003c/em\u003esequence. UTC = untransfected/untransduced control.\u003c/p\u003e","description":"","filename":"TametalFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/8c32c5bce00e2abd458555cc.png"},{"id":60851779,"identity":"9fac43c7-e2b4-48f2-a049-770c36dfacf1","added_by":"auto","created_at":"2024-07-22 21:05:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":721496,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of bicistronic vectors. (A) ELISA analysis of FHL-1 and aflibercept protein expression (nM ± SD) in HEK293 cell supernatant following transduction with bicistronic vectors (RC304, RC312, RC318 and RC319) compared to monocistronic counterparts (RC146 and RC298) at MOI 1e4. (B) Western blot analyses of FHL-1 and aflibercept protein expression (under non-reducing conditions) in cell supernatant showing correct band sizing compared to respective recombinant protein controls. (C) VEGF binding analysis of aflibercept proteins derived from bicistronic vectors. Serial dilution of VEGF detected from each sample was normalized to 0 pMol aflibercept control reaction to calculate percentage bound VEGF. Percentage unbound VEGF was calculated as 100% bound VEGF. (D) HUVEC proliferation assay of vector-derived aflibercept. Serial dilutions of aflibercept were added to HUVEC along with 20\u0026nbsp;pMol of VEGF-A\u003csub\u003e165\u003c/sub\u003e. Each point represents duplicate wells at each concentration. (E) Co-factor assay quantitating the levels of C3b breakdown to iC3b by vector-derived FHL-1. LLOD = lower limit of detection. UTC = untransduced control.\u003c/p\u003e","description":"","filename":"TametalFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/5195aca086603230559f4cd2.png"},{"id":60852808,"identity":"e47140e7-e121-4d24-b174-9997de480b4c","added_by":"auto","created_at":"2024-07-22 21:13:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":487829,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vivo\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003edose escalation expression study. (A) Adult C57BL/6JRj mice were subretinally injected with rAAV8-COaflibercept (RC298) at doses ranging from 5e7 to 1e10 vg/eye. 4 weeks post-injection, posterior retinal eyecups and ocular fluids were taken for vector genome copy number and protein analyses respectively. (B) Posterior eyecups showed a dose-dependent increase in vector genome copy numbers (copies/µL ± SD), and (C) ELISA analysis of ocular fluids showed the same dose-dependent increase in aflibercept protein levels (µM ± SD).\u003c/p\u003e","description":"","filename":"TametalFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/f424c6e44a03800b0c6c321d.png"},{"id":60853373,"identity":"bc918a1b-b8ad-40c2-8133-c41891fc75de","added_by":"auto","created_at":"2024-07-22 21:21:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":411761,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterization of bicistronic vector expression \u003cem\u003ein vivo\u003c/em\u003e. (A) Adult C57BL/6JRj mice were subretinally injected with rAAV8 bicistronic vectors (RC304 and RC312) at low and high doses of 5e7 and 5e8 vg/eye. 4 weeks post-injection, posterior retinal eyecups and ocular fluids were taken for vector genome copy number and protein analysis respectively. (B) Posterior eyecups showed a dose-dependent increase in vector genome copy numbers (copies/µL ± SD). Dotted lines represent relative copy numbers of monocistronic vector (RC298) genome at the two respective doses extrapolated from data in Figure 4B. \u0026nbsp;ELISA analysis of ocular fluids showed the same dose-dependent increase in (C) aflibercept and (D) FHL-1 protein levels (uM ± SD), and the level of protein expression was lower than that of respective monocistronic vectors. Dotted lines of (C) represent relative aflibercept protein expression levels of monocistronic RC298 as per Figure 4C.\u003c/p\u003e","description":"","filename":"TametalFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/9e161c2837fe4841bf5b2d59.png"},{"id":60853684,"identity":"6169899d-ac8d-470e-8d8c-cb3e50f28990","added_by":"auto","created_at":"2024-07-22 21:29:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":476708,"visible":true,"origin":"","legend":"\u003cp\u003eCNV inhibition by rAAV8 bicistronic vectors. (A) Schematic of study design and timeline of the experimental setup used to assess the \u003cem\u003ein vivo\u003c/em\u003e efficacy of rAAV8-COFHL-1-2A-COaflibercept (RC304). Adult C57BL/6JRj mice were subretinally injected with RC304 at 5e7 or rAAV8-null vector at 5e8 vg/eye. 4 weeks post-injection, mice were treated with laser photocoagulation and for the positive control group, mice were intravitreally injected with aflibercept at a volume of 2 µL (80 µg/eye) immediately after laser treatment. 12 eyes were used in each group and 3 laser lesions were executed per eye around the optic nerve head. The CNV lesions were monitored using FA and SD-OCT on day 0 after CNV induction, and at days 4 and 7 for all the study groups. At 4- and 7-days post-laser photocoagulation, FA fundus imaging was performed to measure vascular leakage. At termination, choroidal flat mounts were prepared for IB\u003csub\u003e4\u003c/sub\u003e staining and evaluation of CNV area. (B) CNV grading as assessed from FA and OCT serial imaging sessions at baseline (day 0, CNV induction), day 4 and day 7 post-CNV. Data points correspond to mean values. Differences between treatment groups at specific time points were analyzed by mixed effects analysis followed by Dunnett’s multiple comparison test. Day 4, RC304 ***p=0.0002; Aflibercept***p=0.0008; Day 7, RC304 *p=0.0273. (C) Isolectin positive staining area on day 7. Each data point represents one laser burn for each group. Differences among multiple groups were examined by the Dunnett’s multiple comparison test. ***p=0.0001; **p=0.0061; ns = nonsignificant difference.\u003c/p\u003e","description":"","filename":"TametalFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/f43229a79e91cc5057cf658f.png"},{"id":74235077,"identity":"5e9bd9ad-c4a0-4c1b-a76f-ccccfcb27452","added_by":"auto","created_at":"2025-01-20 08:47:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5243050,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/9879cb24-94a0-4cc0-aff4-15338ebeb86a.pdf"},{"id":60851778,"identity":"86267f5a-b3a4-4b96-a681-615802452f17","added_by":"auto","created_at":"2024-07-22 21:05:11","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":161073,"visible":true,"origin":"","legend":"","description":"","filename":"TametalSupplementaryInformation28Jun2024.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4636180/v1/6c07db3fe1efd97f081d815d.pdf"}],"financialInterests":"Competing interest reported. L.C.S.T, D.S, R.A-D and J.H are employed by Gyroscope Therapeutics (A Novartis Company). J.J, A.L, A.W, M.D, J.E-R and S.E were previously employed by Gyroscope Therapeutics (A Novartis Company) while engaged in the research project.","formattedTitle":"Preclinical development of a dual targeting bicistronic gene therapy approach for the treatment of wet age-related macular degeneration","fulltext":[{"header":"Introduction","content":"\u003cp\u003ewAMD continues to be one of largest single causes of irreversible vision loss in developed countries costing \u0026gt;\u003cspan\u003e$\u003c/span\u003e27.5\u0026nbsp;billion each year in the US alone[1]. VEGF is the main driver of CNV development, a hallmark of wAMD characterized by new vessels sprouting from the choriocapillaris (CC) penetrating through the Bruch\u0026rsquo;s membrane (BrM) and proliferating into the subretinal space[2\u0026ndash;5]. These leaky immature neovascular vessels can cause fluid extravasation with the formation of intraretinal or subretinal oedema and retinal pigment epithelium (RPE) detachment that are often associated with vision loss[6]. wAMD can be further divided into subtypes depending on the origin and location of neovascular vessels, with type I CNV associated with vessels from the CC growing into the sub- RPE space, type II CNV with vessels expanding into the subretinal space between the neurosensory retina and RPE, and type III comprises of proliferative vessels extending from the deep capillary plexus towards the outer retina[7,8].\u003c/p\u003e \u003cp\u003eRetinal inflammation is believed to play a central role in the pathogenesis of both dry and wet AMD, and the literature has provided strong evidence to suggest that abnormal complement activation is significantly involved in the pathogenesis of the disease[9\u0026ndash;14]. Most notably polymorphisms of complement factor H (CFH), which normally acts to inhibit the alternative complement pathway (AP), are among the best-known mutations in AMD, indicating the important role of complement activation in its development[10,15]. Jansen and colleagues have described the pathogenesis of CNV formation in wAMD as a dynamic process involving inflammation, angiogenesis and proteolysis with remodeling of the extracellular matrix (ECM)[16]. Furthermore, CNV development can be divided into 3 stages including initiation, maturation and involution. First, pathological changes in the BrM combined with pro-angiogenic and pro-inflammatory factors enable the invasion of immune cells into the sub-RPE/subretinal space[17]. During the active inflammatory phase, RPE/glial/Muller/endothelial cells and invading macrophages contribute to the production of pro-angiogenic factors (VEGF and angiostatic proteins such as pigment epithelium-derived factor (PEDF), angiostatin \u0026amp; endostatin)[18,19]. Macrophage infiltration is a known key feature of AMD histopathology[20], and these immune cells act as an additional source for increasing levels of VEGF, cytokines (TNF-α) and complement C3 production[21,22], stimulating the continuous growth and maturation of the neovascular membrane. Towards the late stage of the disease, spontaneous regression of neovascular vessels and the cessation of inflammation occur, and this involution stage is characterized by scarring and subretinal fibrosis[18,23\u0026ndash;25]. The components of the complement system can be differentially involved in the respective stages of CNV development with important roles played by the AP, anaphylatoxins (C3a and C5a) and membrane attack complex (MAC)[26,27]. Further clinical evidence has shown that C3a, C3, FB, and FH are found with increased levels in aqueous humor (AH) of wAMD patients[28,29].\u003c/p\u003e \u003cp\u003eThe current SoC for wAMD is repeated IVT injections of anti-VEGF and this has deeply transformed the management of the disease, improving vision preservation and quality of life for millions of patients. However, there remains significant shortcomings with the current SoC with the magnitude of the vision gain observed in randomized clinical trials (RCT) not being realized or sustained in real world clinical settings (RWS). The potential reasons for the disparity between clinical studies and clinical practice are likely multifactorial. Firstly, patient treatment burden is associated with undertreatment with regimens that deviate from frequent injection schedules and/or non-compliance[30]. In RWS, patients with newly diagnosed nAMD receive fewer injections and less frequent monitoring[31,32]. Moreover, studies have shown that \u0026gt;\u0026thinsp;20% of patients receiving anti-VEGF therapy discontinued treatment and failed to attend follow-up visits after 12 months[33] and this increased to 50% after 5 years[34]. These elderly patients may be unable to comply with monthly visits due to time or resource constraints[35], or there may be a lag-time between the publication and adoption of RCT evidence into clinical practices, as reflected by the slow but increasing number of injections during the study period[36]. In some cases, physicians and patients may use extended-duration treatment paradigms such as \u0026lsquo;as-needed dosing\u0026rsquo; or \u0026lsquo;treat-and extend\u0026rsquo; to reduce the treatment burden[31].\u003c/p\u003e \u003cp\u003eSecondly, longitudinal studies have shown shortcomings in durability of efficacy whereby visual gain seen in the first 2 years of RCT was not sustained in the long term (mean 8\u0026ndash;11 letter loss between year 2 and 5)[32], and this was attributed partly to the aforementioned underdosing in RWS, but also due to the progression of the underlying macular atrophy. Since anti-VEGF therapy only treats one aspect of the wAMD pathology (angiogenesis), subsequent pathologies including atrophy and fibrosis are not addressed, leading to long term vision loss over time. This is supported by reports showing that 17% of wAMD patients develop or are diagnosed with GA within 2 years after diagnosis[37,38], and this rises to 98% by 7 years[39]. Furthermore, long term clinical studies have shown an association between higher anti-VEGF treatment frequency and higher GA incidence[40\u0026ndash;43]. The hypothesis that anti-VEGF agents are associated with GA development has been supported by both animal models and studies of post-mortem human eyes[44]. Foss and colleagues have suggested that the association of a cause effect relationship between GA and anti-VEGF would require implication of multiple clinical parameters such as CNV lesion types and number of injections, which are factors that may increase the risk of developing macular atrophy during long term treatment[41]. Furthermore, overactive complement is a known driver of GA progression and genome-wide association studies (GWAS) have shown that certain polymorphisms in the complement AP genes are a risk factor for the progression to both GA and to wAMD[45]. Different studies have demonstrated that IVT injection of anti-VEGF in neovascular AMD patients resulted in elevated levels of C3a, C4a and C5a in the aqueous humor[46,47]. These observations support that complement-mediated development of macular atrophy may be exacerbated by long-term anti-VEGF treatment.\u003c/p\u003e \u003cp\u003eLastly, a subpopulation of wAMD patients have been shown to be unresponsive to SoC, either at the initial phase to the loading dose or have developed tachyphylaxis during the treatment course. Evidence from longitudinal studies has shown that 28% of eyes discontinued ranibizumab treatment due to lack of apparent treatment response[48]. However, the underlying mechanism of refractility to treatment is not fully understood and management of these patients is often limited to switching of different anti-VEGFs[49]. Interestingly, several association studies have indicated a role of complement polymorphism in anti-VEGF treatment response (CFH CC genotype), although results are not confirmative and long-term follow up is limited[50,51].\u003c/p\u003e \u003cp\u003eTo address these unmet medical needs, novel anti-VEGF therapies such as bi-specific antibodies (Vabysmo\u0026reg; Faricimab-svoa, Genentech) enabling longer injection intervals, port delivery system with ranibizumab (Susvimo, Genentech) and topical (PAN-90806, PanOptica) or oral (AKST4290, Alkahest) formulations have been devised to reduce patient burden and compliance issues. Similarly, one-shot anti-VEGF gene therapies have successfully tackled patient burden by reducing annual injection rate by \u0026gt;\u0026thinsp;80% in clinical trials[52]. However, anti-VEGF monotherapy will not be able to fully address the unmet need of treatment durability which is hampered by the progressive vision loss driven by the underlying macular atrophy, as well as those who are non-responsive to anti-VEGF treatment.\u003c/p\u003e \u003cp\u003eBased on the evidence provided above, complement overactivation is involved in the dry and wet forms of AMD, and is a genetic risk factor for both forms. Complement overactivation contributes to the pro-inflammatory and pro-angiogenic environment in AMD, and current anti-VEGF monotherapy can only target the angiogenic aspect of the disease. In this study, we investigated whether simultaneously blocking the two key drivers of AMD pathology, angiogenesis and inflammation, using a bicistronic vector, would lead to an efficacious therapy for wAMD (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Based on the data provided herein, the vectorized bicistronic therapy should address patient burden compared to vectorized anti-VEGF gene therapy, and advantageously maintain the durability of visual acuity (VA) gains by targeting complement activation, a key driver of macular atrophy which is not addressed by anti-VEGF treatment alone.\u003c/p\u003e \u003cp\u003eWe developed a rAAV8 bicistronic vector co-expressing aflibercept and the AP regulator, FHL-1, through a 2A peptide linker under the control of a strong ubiquitous promoter. Protein expression was enhanced through codon optimization (CO) and the biological activities of vector-derived proteins were validated by \u003cem\u003ein vitro\u003c/em\u003e VEGF and complement binding assays. Subretinal delivery of rAAV8-bicistronic vectors in C57BL/6JRj mice showed sustained expression of both aflibercept and FHL-1 in ocular fluids at 4 weeks post-injection. The mouse laser-induced CNV model was then used to evaluate the therapeutic efficacy of the bicistronic vector via subretinal delivery and significant CNV reduction was observed. The results presented here provide proof-of-concept supporting further development of a dual targeting bicistronic gene therapy approach as an effective, superior long-term treatment option for wAMD.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCodon optimization of therapeutic transgenes\u003c/h2\u003e \u003cp\u003eCodon usage controls translation elongation rate and co-translational protein folding processes, and therefore plays an important role in determining protein expression levels[53\u0026ndash;55]. Genes that encode highly expressed proteins are strongly enriched for preferred codons, and CO has been shown to increase endogenous and heterologous gene expression in diverse eukaryotes[55\u0026ndash;57]. Many commercially available CO algorithms are based on empirical indices including codon adaptation index (CAI), frequency of relative synonymous codon usage, codon bias index, optimal codon usage and effective codon number[58]. The CAI is the primary index used to predict gene expression level because it indicates the extent to which the codon sequence represents the usage of codons in a particular organism. In this study, we employed 5 different CO tools to avoid bias of any one algorithm and applied manual optimization to the algorithmically optimized CO sequences to further refine the coding sequence, including elimination of cleavage sites, cryptic splice donor/acceptor sites, transcriptional factor binding sites, restriction endonuclease sites, repeats and high GC contents.\u003c/p\u003e \u003cp\u003e10 CO sequences of human \u003cem\u003eFHL-1\u003c/em\u003e coding DNA (cDNA) were first compared to the WT sequence (RC001) for FHL-1 protein expression in human retinal pigment epithelial (ARPE19) cells. pAAV-COFHL-1 constructs carrying the \u003cem\u003eFHL-1\u003c/em\u003e cDNA with a N-terminal CFH signal peptide were placed under the transcriptional control of a CAG promoter in conjunction with the woodchuck post-transcriptional element (WPRE), both elements have previously been included in clinical gene therapy vectors without any safety concerns[59,60] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The 10 pAAV-COFHL-1 constructs (RC138-147) were transiently transfected into ARPE19 cells at equal concentrations and the amount of FHL-1 protein in the cell supernatant was detected by Western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Densitometric analyses showed that RC141, RC144, RC145 and RC146 were amongst the highest expressing constructs compared to the WT FHL-1 sequence of RC001.\u003c/p\u003e \u003cp\u003eThe top performing pAAV-COFHL-1 expression cassettes were then packaged into rAAV2 vectors, and the level of FHL-1 protein in cell supernatant was determined by both ELISA and Western blot 72 hr post transduction of ARPE19 cells. Only a proportion of CO sequences elicited higher FHL-1 protein expression than the WT sequence (RC001), however both data sets showed that the CO sequence of RC146 induced the highest increase in protein expression and secretion compared to WT FHL-1 sequence (RC001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eSimilarly, 10 CO aflibercept coding sequences (RC290-299) were subcloned into the same expression cassette as that of RC146 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and packaged into rAAV8 vectors. Aflibercept expression in the cell supernatant was determined by both ELISA and Western blot 72 hr post transduction of human embryonic kidney (HEK293) cells. Aflibercept ELISA showed that protein levels in the cell supernatant was highest for RC298 compared to the non-CO sequence RC288 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Western blot analysis showed a dominant protein band at approximately 150 kDa, which corresponds with the aflibercept homodimer molecular weight under non-reducing conditions. However, aberrant protein species were detected in RC299, possibly indicating that the substitution of synonymous codons had negatively impacted protein processing within this particular sequence. Densitometric analysis corroborated with the ELISA data showing that RC298 was the highest expressing CO sequence (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Based on these expression data, the CO sequences of RC146 (FHL-1) and RC298 (aflibercept) were used in further experiments to evaluate the bicistronic vector.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBicistronic vector design and\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003echaracterization of secreted proteins\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe use of rAAV vectors for efficient expression of two genes has previously been described in multiple preclinical studies and has been used for the clinical delivery of recombinant heavy- and light-chain Fab fragments[61,62]. Conventional bicistronic expression cassettes have employed either two tandem promoters or bidirectional promoters to drive the expression of two genes independently. However, the limited packaging capacity of rAAV vectors often render these options non-viable. Alternatively, a single promoter driving expression of two genes simultaneously linked by translational control elements such as an internal ribosome binding site (IRES) or 2A linkers can provide a partial solution. The IRES sequence permits the production of multiple proteins from a single mRNA transcript but suffers from two main limitations. First, the IRES-dependent downstream second gene can be expressed at significantly lower level within the vector, and secondly, the size of the IRES element is often in excess of 500 base pairs[63]. These issues can be mitigated by using 2A peptide sequences derived from a large group of viral families including the Foot and Mouth Disease Virus (F2A), equine rhinitis A virus (E2A), porcine teschovirus-1 (P2A) and Thosea Asigna virus (T2A)[64]. 2A peptides are 18\u0026ndash;25 amino acid viral oligopeptides that have been shown to mediate efficient bicistronic expression of two gene products from a single promoter through ribosomal skipping (often referred to as self-cleavage) during protein translation[65,66]. Theoretically, the two gene products are expressed at 1:1 molar ratio and each gene product is expressed at high levels. The 2A and 2A-like bicistronic systems have been shown to be highly effective in the CNS where high expression levels of both genes have been demonstrated without any cytotoxic effects[67].\u003c/p\u003e \u003cp\u003ePrevious reports have compared the cleavage efficiencies of different 2A motifs in a multi-cistron setting and demonstrated mixed results with a dependency on the genes being expressed[68,69]. The F2A peptide has been previously used in a clinical rAAV8-antiVEGFfab vector[62]. In addition, a furin recognition site was placed upstream of the 2A to enable the removal of the remaining 2A residues after self-cleavage. To further guide optimal bicistronic design, the effect of gene position on protein expression was assessed whereby four bicistronic vectors (RC304, RC312, RC318 and RC319) with alternating positions of FHL-1 and aflibercept genes were evaluated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Two combinations of promoter and post-transcriptional elements (CMV-WPRE and CAG-WPRE3) were also tested.\u003c/p\u003e \u003cp\u003erAAV8 bicistronic vectors were transduced into HEK293 cells and protein expression was assessed in the cell supernatant by ELISA and Western blot at 72 hr post-transduction. FHL-1 expression was detected from all bicistronic vectors but at relatively lower levels compared to monocistronic vector (RC146), irrespective of gene position or promoter-WPRE combination, with RC312 showing the highest level of FHL-1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Aflibercept expression from RC304 and RC312 were similar to the monocistronic vector (RC298), while RC318 and RC319 showed reduced expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Overall, the CMV-WPRE configuration was observed to drive higher expression levels of both transgenes. The position of the transgenes within each promoter/post-transcriptional element combination appeared to have affected expression differently. Interestingly, it was observed across all bicistronic configurations that the overall molar ratio of FHL-1 expression was higher than that of aflibercept, irrespective of promoter and post-transcriptional element types. Western blots showed that secreted FHL-1 and aflibercept proteins were of the correct expected band size with no observation of uncleaved or incorrectly processed protein products (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThe biological activity of vector-derived proteins in the cell supernatant of RC304 and RC312 transduced cells was then assessed by respective \u003cem\u003ein vitro\u003c/em\u003e VEGF- and complement-binding assays. To determine the binding affinity of aflibercept for VEGF, an equilibrium binding assay was performed in which different concentrations of vector-derived aflibercept in the cell supernatant of transduced cells were incubated with VEGF-A\u003csub\u003e165\u003c/sub\u003e and the amount of unbound VEGF-A\u003csub\u003e165\u003c/sub\u003e was measured. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC shows that vector-derived aflibercept had a similar VEGF-binding affinity to the recombinant aflibercept control. Furthermore, to assess the ability of vector-derived aflibercept to block VEGF-stimulated human umbilical vein endothelial cell (HUVEC) proliferation, both VEGF and vector-derived aflibercept were added to cultured HUVEC cells. In agreement with the VEGF-binding affinity assay, all vector-derived aflibercept demonstrated an equal inhibitory effect on VEGF-dependent HUVEC proliferation compared to recombinant aflibercept control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The activity of vector-derived FHL-1 was demonstrated through an \u003cem\u003ein vitro\u003c/em\u003e C3b binding assay showing the detection of high levels of iC3b (breakdown product of C3b cleavage) from both RC304 and RC312, similar to the recombinant FHL-1 protein control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). These data clearly indicate that all bicistronic vectors express and secrete biologically active aflibercept and FHL-1 proteins.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003edose escalation expression study\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA dose escalation expression study was first carried out using monocistronic RC298 \u003cem\u003ein vivo\u003c/em\u003e to determine a safe dose range for subsequent efficacy assessment of the bicistronic vectors in the mouse laser-induced CNV model. Monocistronic rAAV8-aflibercept vectors (RC298) were subretinally injected into WT mice in escalating doses ranging from 5e7 to 1e10 vg/eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). At 4-weeks post-injection, vector genome copy numbers were quantified in mouse eyecups and a dose-dependent increase in genome copies was observed up to 5e9 vg/eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Similarly, a linear dose-dependent increase in aflibercept protein expression was observed, as well as a ceiling effect at the higher doses of 5e9 and 1e10 vg/eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Based on the observed dose to expression relationship, the dose threshold was established to be between 5e8 and 5e9 vg/eye. To avoid the potential toxic effects that are often associated with higher doses, 5e7 vg/eye was selected as the representative dose for evaluating the therapeutic effect of bicistronic vectors.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003ebicistronic expression study\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo assess dual expression of FHL-1 and aflibercept \u003cem\u003ein vivo\u003c/em\u003e, both RC304 and RC312 were subretinally injected into mouse eyes at 5e7 and 5e8 vg/eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). At 4 weeks post-injection, vector genome copy numbers and protein expression levels were measured by qPCR and ELISA in mouse eyecups and ocular fluids respectively. For quantitative comparison of vector genome copies and protein expression levels between monocistronic and bicistronic vectors, we extrapolated relative expression data from monocistronic aflibercept vectors in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e. qPCR analyses in mouse eyecups showed a clear dose-response effect in genome copies, but it was observed that the concentration of rAAV8 bicistronic vectors were 1.2 to 3.6-fold lower than that of monocistronic aflibercept vectors at both respective doses (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAssessment of protein expression in mouse ocular fluids also showed a linear dose-response effect, with RC304 and RC312 showing similar levels of aflibercept expression across both doses (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). However, it was noted that aflibercept protein expression from both bicistronic vectors was approximately 3\u0026ndash;10 fold lower than the monocistronic vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). FHL-1 protein expression was observed to be moderately higher in RC304 across both doses compared to RC312 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In addition, it was observed that the overall molar ratio of aflibercept expression was higher than FHL-1 for both configurations, contrasting the \u003cem\u003ein vitro\u003c/em\u003e data observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA.\u003c/p\u003e \u003cp\u003eThe data here showed that the bicistronic vectors were capable of driving the expression of two gene products in rodent retinas in a dose-dependent manner, despite lower expression levels of aflibercept compared to the monocistronic counterpart. In the ocular fluids, both RC304 and RC312 showed similar aflibercept expression levels but RC304 was observed to deliver higher FHL-1 protein levels. Based on this observation, RC304 was investigated for its therapeutic effect in the laser-induced CNV mouse model.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eTherapeutic efficacy of bicistronic vectors in laser-induced choroidal neovascularization (CNV) mouse model\u003c/h2\u003e \u003cp\u003eFor proof-of-concept that dual targeting of VEGF and complement can elicit a therapeutic effect in the mouse laser-induced CNV model, 2 groups of mice received unilateral (right eye) subretinal injections of either RC304 (rAAV8-COFHL-1-2A-COaflibercept) at 5e7 vg/eye or null vectors in the negative control group at 5e8 vg/eye (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Four weeks post-injection, CNV was induced in the injected eyes by laser photocoagulation laser. The successful production of CNV lesions was confirmed by using spectral-domain optical coherence tomography (SD-OCT) and fluorescein angiography (FA). Immediately after CNV induction, an additional positive control group received IVT administration of aflibercept at 80 \u0026micro;g/eye. Injected eyes were imaged at days 4 and 7 post-lasering and all animals were sacrificed. Choroidal flat mounts were prepared and stained using isolectin B\u003csub\u003e4\u003c/sub\u003e for CNV lesion analysis.\u003c/p\u003e \u003cp\u003eAt day 4 post-CNV induction, both IVT-aflibercept and the RC304 treated group showed significantly lower CNV leakage area than the null vector group (IVT-aflibercept, p\u0026thinsp;=\u0026thinsp;0.0008; RC304, p\u0026thinsp;=\u0026thinsp;0.0002). On day 7 post-CNV, only the RC304 treated group continued to show significant reduction of leakage area compared to the null vector group (p\u0026thinsp;=\u0026thinsp;0.0273), whereas no statistical significance was detected between IVT-aflibercept and the null vector group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Isolectin B\u003csub\u003e4\u003c/sub\u003e staining in the choroidal flat mounts revealed that both RC304 and IVT-aflibercept treated groups had significantly reduced isolectin-positive areas as compared to the null vector group (RC304, p\u0026thinsp;=\u0026thinsp;0.0001; IVT-aflibercept, p\u0026thinsp;=\u0026thinsp;0.0061) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Collectively, the data presented here clearly demonstrated that subretinal administration of RC304 at 5e7 vg/eye achieved therapeutic efficacy on CNV read-outs.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThere still remains significant unmet medical need for the treatment of wAMD since most of the visual gains observed with SoC during clinical development are simply not achievable and/or durable in RWS owing to 1) patient drug burden driving non-compliance and underdosing; 2) progression of the underlying AMD to the dry form of the disease (not treated with current SoC); 3) unresponsiveness to SoC, either at treatment start or subsequent development of tachyphylaxis during prolonged treatment. Our data suggest that the treatment gap can be addressed by developing a dual targeting bicistronic gene therapy to improve disease conversion and the overall outcomes in late-stage AMD. Vectorizing anti-VEGF will tackle the non-compliance issue inherent to SoC ensuring clinical trial level efficacy is attained in RWS, while simultaneously targeting complement activation to delay/stop the progression of the dry form of AMD ensuring vision gains are more durable than SoC.\u003c/p\u003e \u003cp\u003eFor the construction of a dual-targeting bicistronic vector for tackling angiogenesis and complement-driven inflammation, both aflibercept and FHL-1 were evaluated based on their biological function and potency in targeting the respective pathways. Aflibercept is a clinically approved recombinant VEGF receptor fusion protein comprising of the 2nd Ig domain of human VEGFR1 and the 3rd Ig domain of human VEGFR2 expressed as an inline fusion with the Fc portion of human IgG, which binds to VEGF-A, VEGF-B, and placental growth factor (PIGF) and inhibits the activation of VEGFR1 and VEGFR2[70]. Clinical studies have shown that the efficacy and safety of aflibercept are non-inferior to ranibizumab[5], and treatment with aflibercept can improve VA and reduce macular edema in wAMD patients who were poorly treated with other anti-VEGF drugs[71]. From the perspective of simplifying the bicistronic vector design, aflibercept benefits from being a fusion protein omitting the need to include an additional 2A peptide, as opposed to the need of vectorizing the Fab fragment of ranibizumab. FHL-1 is composed of the first 7 N-terminal complement control protein (CCP) domains of Factor H (FH) and functions to protect host surfaces from uncontrolled complement attack through dampening the AP by two distinct mechanisms of action: decay acceleration (dissociation of C3 convertase) and complement cofactor activity (combining with CFI to cleave C3b into iC3b)[72]. Preclinical studies have also shown that intraocular administration of human recombinant FH (recFH) reduced CNV in the mouse laser-CNV model as efficiently as anti-VEGF antibody, decreasing deposition of C3 cleavage fragments, MAC and microglia/macrophage recruitment markers in the CNV lesion site[73]. In comparison to CFH, FHL-1 is a relatively smaller protein that can transverse the BrM and into the CC, which may make it more effective at treating AMD since the disease is thought to start in the choroid[74]. In conjunction, the relatively small coding sequence of the FHL-1 gene allows inclusion in a rAAV bicistronic expression cassette.\u003c/p\u003e \u003cp\u003eThe use of CO DNA coding sequences has become a common practice to enhance recombinant protein expression by tailoring the coding sequence for a particular expression system. While there exist many commercially available CO algorithms, little-to-no consensus exists for defining the empirical rules and guidelines for optimizing DNA coding sequence. A recent study had identified that discrepancies in codon frequency databases exist between different CO algorithms, leading to a high variability in the recombinant yield of output algorithmically optimized coding sequences[75]. To circumvent the issue of bias, we utilized 5 different open sources of publicly available CO algorithms and included additional manual optimization parameters to generate a total of 10 different synthetic coding sequences for each gene. Indeed, \u003cem\u003ein vitro\u003c/em\u003e expression analysis revealed high variability in protein expression, corroborating other reports that algorithm-optimized coding sequences will have equivalent chances of either increasing or diminishing recombinant protein yields as compared to the native cDNA[75].\u003c/p\u003e \u003cp\u003eSimultaneous delivery of two distinct genes for co-synthesis of therapeutic proteins in the same cell can either be achieved by co-infection of two separate monocistronic rAAV vectors, or infection with a single bicistronic rAAV vector co-expressing two genes. Although experimental evidence has indicated that the former has a higher percentage of co-expressing cells[76], the economic burden associated with manufacturing two separate rAAV vectors may present a less attractive option for translation into the clinic. The approach taken in this study for the design of the bicistronic vector mirrors that of previous clinical vectors using a single ubiquitous promoter driving the expression of two distinct genes linked by a self-cleavage 2A peptide[62]. Other designs have seen the use of two independent promoters, but this was strictly not feasible in our context owing to the restricted insert capacity of rAAV vectors[77].\u003c/p\u003e \u003cp\u003eExpression from the rAAV bicistronic vector was first assessed in the cell supernatant of transduced cells as both proteins were secreted to exert their biological activity extracellularly. The biological activity of soluble aflibercept and FHL-1 proteins were found to be non-inferior to their recombinant protein counterparts in blocking VEGF activity and complement activation respectively. Although high levels of aflibercept and FHL-1 expression were detected in the cell supernatant, both proteins were expressed at different molar ratios. \u003cem\u003eIn vivo\u003c/em\u003e expression data in the mouse ocular fluids further corroborated that soluble protein expression from bicistronic vectors were not at equimolar ratios and were lower than monocistronic vectors at both doses. We did not observe uncleaved soluble protein products by Western blot analyses, and more sensitive methods such as LC-MS/MS peptide mapping may help further decipher the impact of 2A peptide mediated processing on protein expression levels. Additional investigation into the intracellular concentration of encoded proteins may provide evidence whether this observation was due to differences in protein stability and/or secretion. In any case, the evidence provided here demonstrates that the 2A-bicistronic vector supported co-expression of two biologically active proteins both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eImportantly, we observed that amelioration of CNV in the laser mouse model was achieved following subretinal injection with the rAAV8-COFHL-1-2A-COaflibercept vector. In particular, the observed efficacious dose of 5e7 vg/eye allometrically scaled to a clinically relevant dose of \u0026sim;5e10 vg/eye based on ocular volume, further highlighting the translatability of this data. Both CNV leakage and lesion area were significantly reduced, indicating that the level of expression achieved by the bicistronic vector was sufficient to elicit a therapeutic effect. The therapeutic benefits of the bicistronic gene therapy approach should be determined in longer-term-follow-up (LTFU) clinically to fully elucidate treatment efficacy towards reducing conversion and maintaining VA.\u003c/p\u003e \u003cp\u003eA major development path to translate the bicistronic gene therapy approach for this highly prevalent disease to the clinic is to transition towards in-office delivery (IVT or suprachoroidal delivery). Although subretinal injection is the preferred route of administration for a majority of inherited retinal disease (IRD) gene therapies (Luxturna\u0026reg;, Novartis), leading to superior retinal gene transfer particularly to the RPE that coincides with the location of AMD disease pathology[78], it is still a complex surgical procedure undertaken in an operating room, hence limiting its scalability to target large patient populations. In contrast, non-surgical in-office delivery offers significant advantages including access to larger patient populations while maintaining commercial competitiveness with other wAMD treatments. IVT injections of gene therapy vectors have recently been subjected to non-clinical and clinical evaluation using engineered AAV2 capsids (AAV2-7m8, AAV2-GL, AAV2-NN) to bypass the inner limiting membrane (ILM) that often limits transduction of the outer retina[79,80]. Repeated IVT administration of anti-VEGF therapies have also been proven to be safe in the clinic without significant adverse effects[81]. It has been noted that IVT delivery often requires higher vector doses than subretinal delivery owing to the need to overcome the dilution effect in the vitreous and the dynamic fluid clearance via the anterior outflow, as well as penetration through the ILM to reach the outer retina/choroid. However, IVT injection has been associated with increased and persistent distribution in the systemic circulation, raising concerns regarding the immune response and off-target transduction[82]. Moreover, exposure of vectors to the systemic environment may lead to greater susceptibility to neutralization from pre-existing anti-AAV antibodies hampering the long-term efficacy of this delivery approach[83]. Delivery to the suprachoroidal space (SCS) in conjunction with a proprietary microinjector is currently under evaluation in clinical trials for nAMD (NCT04514653) and diabetic retinopathy (NCT04567550) with favorable clinical outcomes. In non-clinical studies, SCS delivery of high doses of rAAV8 vectors could provide widespread transgene expression in the RPE[84]. Further innovations into novel AAV capsids with higher transduction efficiency and immune-evasive properties in conjunction with refined injection devices may help lower the dose needed for in-office delivery and improve their safety and efficacy profiles in the clinic.\u003c/p\u003e \u003cp\u003eThe expansion of new therapeutic options in the clinic with alternative target pathways and novel modalities has clearly highlighted the urgent need for addressing the treatment gap of current SoC for wAMD. Based on the data herein, we provide proof-of-concept that the application of a rAAV bicistronic vector at a clinically relevant dose ameliorated CNV leakage and lesion in the mouse laser-induced CNV model. A one-shot bicistronic gene therapy of this nature could ensure clinical trial level efficacy that is sustained over time by reducing angiogenesis and the onset and/or progression of underlying GA. In addition, the transition to in-office delivery will be key to ensure competitiveness with current SoC and allowing the therapy to reach larger patient populations.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003eCodon optimization and construct design\u003c/h2\u003e\n \u003cp\u003eThe sequence of FHL-1 (NM_001014975) was entered into 5 different online codon optimization tools:\u003c/p\u003e\n \u003cp\u003e\u003cspan\u003e1. GeneArt (\u003cspan\u003e\u003cspan\u003ehttps://www.thermofisher.com/uk/en/home/life-science/cloning/gene-synthesis/geneart-gene-synthesis/geneoptimizer.html\u003c/span\u003e\u003c/span\u003e)\u003cbr\u003e\u003c/span\u003e\u003cspan\u003e2. GenScript (\u003cspan\u003e\u003cspan\u003ehttps://www.genscript.com/quick_order/gene_services_gene_synthesis\u003c/span\u003e\u003c/span\u003e)\u003cbr\u003e\u003c/span\u003e\u003cspan\u003e3. IDT (\u003cspan\u003e\u003cspan\u003ehttps://eu.idtdna.com/CodonOpt\u003c/span\u003e\u003c/span\u003e)\u003cbr\u003e\u003c/span\u003e\u003cspan\u003e4. JCat (\u003cspan\u003e\u003cspan\u003ehttp://www.jcat.de/\u003c/span\u003e\u003c/span\u003e)\u003cbr\u003e\u003c/span\u003e\u003cspan\u003e5. COOL (\u003cspan\u003e\u003cspan\u003ehttp://cool.syncti.org\u003c/span\u003e\u003c/span\u003e)\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eThe standard human genetic code was used for all tools. For online tools 1\u0026ndash;4 above, one sequence was generated from each tool. For tool 5, default settings were used, and the \u0026lsquo;target expression host\u0026rsquo; was set to Homo sapiens. In addition, 39 genes that are highly expressed in the RPE were input into the tool[85]. Tool 5 generated 55 optimized sequences for FHL-1 and the top-ranking sequence was used. 5 further sequences were generated by subjecting each of the original 5 sequences to further manual optimization to eliminate cryptic splice sites, microRNA binding sites, to remove tandem duplicate codons and to check GC content as follows: cryptic splice sites were identified using the \u003cspan\u003e\u003cspan\u003ewww.Fruitfly.orgtool\u003c/span\u003e\u003c/span\u003e. A cut-off value of 0.4 was used for analysis, but only sequences scoring\u0026thinsp;\u0026gt;\u0026thinsp;0.75 were modified. Splice sites were removed by changing the GT of the donor site or the AG of the acceptor site wherever possible. When not possible (e.g. for sequences encoding valine), the 5\u0026rsquo; adjacent base was changed. All modified sequences were then analyzed with \u003cspan\u003e\u003cspan\u003ewww.Fruitfly.org\u003c/span\u003e\u003c/span\u003e tool to confirm that all splice sites had either been removed or reduced to below the 0.75 threshold. MicroRNA binding sites were identified using \u003cspan\u003e\u003cspan\u003ewww.Genecards.org\u003c/span\u003e\u003c/span\u003e. The website identified the miRNA binding site hsa-mir-146a-5p for CFH, however as this is present in the 3\u0026rsquo;UTR sequence, this does not impact the transgene in the vector. All sequences were manually checked for tandem duplicate codons, and where these were found, the second codon was changed to the next most commonly used codon in Homo sapiens (using the SnapGene codon usage table). The overall GC content was checked to ensure that it was as close to 50% as possible (range 49\u0026ndash;65%).\u003c/p\u003e\n \u003cp\u003eThe amino acid sequence of aflibercept was acquired from \u003cspan\u003e\u003cspan\u003ewww.drugbank.ca\u003c/span\u003e\u003c/span\u003e and aligned with human DNA sequence of VEGFR1 (NM_001159920), VEGFR2 (NM_002253) and IgG to determine the WT human sequence. The aflibercept sequence was then CO with Tools 1\u0026ndash;4 as above, and at the time of this work the COOL algorithm had become unavailable. Therefore, the \u003cem\u003eGenewiz\u003c/em\u003e webtool (\u003cspan\u003e\u003cspan\u003ehttps://clims4.genewiz.com\u003c/span\u003e\u003c/span\u003e) was used as replacement. Further manual optimization was performed including removal of TATA box and TF binding sites as follow:\u003c/p\u003e\n \u003cp\u003e\u003cspan\u003ea. TATA box consensus\u0026thinsp;=\u0026thinsp;TATAWAW (W\u0026thinsp;=\u0026thinsp;A or T)\u003cbr\u003e\u003c/span\u003e \u003cspan\u003eb. E-box consensus\u0026thinsp;=\u0026thinsp;CANNTG\u003cbr\u003e\u003c/span\u003e \u003cspan\u003ec. Sp-1 consensus\u0026thinsp;=\u0026thinsp;KGGGCGGRRY\u003cbr\u003e\u003c/span\u003e \u003cspan\u003ed. Ap-1 consensus\u0026thinsp;=\u0026thinsp;5\u0026rsquo;-TGASTCA-3\u0026rsquo;\u003cbr\u003e\u003c/span\u003e \u003cspan\u003ee. CAT boxes \u0026ndash; GGCCAATCT\u003cbr\u003e\u003c/span\u003e \u003cspan\u003ef. Poly A signals AATAAA\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eAny restriction sites that could be used for cloning were disrupted. Direct repeats over 10 nucleotides were identified with (\u003cspan\u003e\u003cspan\u003ehttp://bioserver1.physics.iisc.ernet.in/cgi-bin/fair4/fair/indx.pl\u003c/span\u003e\u003c/span\u003e) and then disrupted. Sequences were subjected to BLAST to identify any sequences with homology to other regions of the genome and these were disrupted if found. Tandem duplicate codons were removed, as for FHL-1 and the GC content was modified to fall within a range of 50\u0026ndash;60%. Each of the steps above was repeated until all elements had been resolved. The output of these modifications yielded 10 sequences per transgene (5 basic, and 5 with further manual optimization).\u003c/p\u003e\n \u003cp\u003eTo generate monocistronic DNA constructs, WT or CO FHL-1 or aflibercept cDNA sequences with a CFH signal peptide sequence were cloned into a synthesized AAV genome backbone, consisting of 5\u0026prime; and 3\u0026rsquo; AAV2 inverted terminal repeats (ITR), a CAG promoter (comprised of a chicken \u0026beta;-actin promoter, a cytomegalovirus enhancer and a rabbit \u0026beta;-globulin intron, collectively termed CAG promoter) and a bovine growth hormone polyadenylation (bGHpA) site as previously described[86]. Additionally, a modified Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was added downstream of the cDNA sequence to enhance expression through increasing mRNA stability and extranuclear transport[87,88].\u003c/p\u003e\n \u003cp\u003eFor the generation of bicistronic DNA constructs, the selected FHL-1 or Aflibercept CO cDNA sequences containing a CFH signal peptide were subcloned in different positions into the AAV genome backbone separated by a furin cleavage site (RRKR) followed by a GSG-linker and foot and mouth disease virus 2A (F2A) element plus 11aa upstream 1D sequence[89]. Expression was controlled by either a cytomegalovirus (CMV) or CAG promoter and with/without a WPRE or mutant WPRE (WPRE3[90]) downstream of the transgene based on not exceeding the AAV genome packaging capacity of ~\u0026thinsp;4.7 kb. In addition, a canonical 13 nucleotide core binding site for the hepatic transcription factor HNF-1alpha located within the WT AAV2 3\u0026rsquo;UTR adjacent to the 3\u0026rsquo;ITR sequence was removed from the AAV bicistronic constructs as it has been shown to confer liver-specific enhancer-promoter activity[91].\u003c/p\u003e\n \u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eCell Culture\u003c/h2\u003e\n \u003cp\u003eAll cell culture work was performed in a biological safety cabinet and cells were cultured in 37\u0026ordm;C incubators with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n \u003cp\u003eHEK293 (DSMZ) or ARPE-19 (ATCC, CRL-2302) cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM)\u0026thinsp;+\u0026thinsp;Glutamax media (Gibco)\u0026thinsp;+\u0026thinsp;10% Fetal Bovine Serum (FBS) (Gibco) in T75 flasks. Once cells reached 70% confluency, cells were expanded into T175 flasks and cultured for 2 weeks prior to seeding. To expand cells, media was removed and replaced with 3 ml TrypLE express (Gibco) and cells were incubated at 37\u0026ordm;C until detached. Cells were then collected with the addition of 7 ml DMEM (Gibco)\u0026thinsp;+\u0026thinsp;10% FBS (Gibco) media. The cell suspension was pipetted up and down to break up any cell clumps and 10 \u0026micro;l of this suspension was removed and mixed with 10 \u0026micro;l of Trypan blue (Gibco) in a separate tube. The cell suspension and Trypan blue mix was then added to a cell counting slide and cells were counted using the Countess II FL (Thermo Scientific). HEK293 cells were seeded at either 1e4 or 2e4 cells/cm\u003csup\u003e2\u003c/sup\u003e and ARPE19 cells were seeded at 2e4 cells/cm\u003csup\u003e2\u003c/sup\u003e to maintain culture and split every 3\u0026ndash;4 days once ~\u0026thinsp;70% confluence was reached.\u003c/p\u003e\n \u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003eTransient Transfection of APRE-19 cells\u003c/h2\u003e\n \u003cp\u003e0.25 \u0026micro;g plasmid DNA was transfected in duplicate into 70% confluent ARPE-19 cells in a 48-well plate using PEIpro transfection reagent (Polyplus) as per the manufacturer\u0026rsquo;s instructions in DMEM/Glutamax supplemented with 10% FBS. The day after transfection, media was aspirated and replaced with 125 \u0026micro;l fresh serum-free media. Supernatant was harvested 48 hr after media change, spun at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4\u0026ordm;C then supernatant was transferred to a fresh tube and stored at -80\u0026ordm;C until ready for use.\u003c/p\u003e\n \u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003erAAV transduction of HEK293 and ARPE19 cells\u003c/h2\u003e\n \u003cp\u003eHEK293 cells were seeded into 24-well plates prior to transduction using the cell splitting protocol described above. Cells were seeded at 1.25e5 cells/well (4.17e5 cells/ml) with 300 \u0026micro;l of DMEM (Gibco)\u0026thinsp;+\u0026thinsp;10% FBS (Gibco) media used per well. Cells were incubated at 37\u0026ordm;C for 24 hr. Cells were visually inspected to ensure 60\u0026ndash;70% confluency was reached before transduction. Media was removed from each well and cells were washed with 300 \u0026micro;l of Opti-MEM serum free media (Gibco) to remove any residual DMEM (Gibco)\u0026thinsp;+\u0026thinsp;10% FBS (Gibco) media. rAAV vectors were diluted in Opti-MEM to achieve a final multiplicity of infection (MOI) of 1e4. Opti-MEM was removed from cells and 300 \u0026micro;l of vector and Opti-MEM mix was added to each well. Two replicate wells were transduced per rAAV vector. Cells were then incubated at 37\u0026ordm;C. After 24 hr of incubation, the rAAV vector and Opti-MEM mix was removed and 300 \u0026micro;l of fresh Opti-MEM added to each well. Cells were then incubated at 37\u0026ordm;C. After 48 hr, supernatants were collected from each well by centrifugation at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4\u0026ordm;C to remove any cell debris. Supernatants were then transferred to fresh Eppendorf tubes and stored at -20\u0026ordm;C.\u003c/p\u003e\n \u003cp\u003eAPRE-19 cells were seeded into 48-well tissue culture-treated plates at 1e5 cells per well in 200 \u0026micro;l DMEM\u0026thinsp;+\u0026thinsp;10% FBS and incubated at 37\u0026ordm;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. 24 hr later, with cells at 60\u0026ndash;80% confluency, each well was transduced with rAAV2 vectors at MOI of 1e3. Media was changed to 125 \u0026micro;l fresh serum-free media after 24 hr. After a further 48 hr, the supernatant was harvested to low protein binding tubes, centrifuged at 14,000 rpm (VWR Micro Star 17R) for 10 min at 4\u0026ordm;C to remove any cell debris, then transferred to fresh low protein-binding tubes.\u003c/p\u003e\n \u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003eProduction of monocistronic rAAV vectors\u003c/h2\u003e\n \u003cp\u003eHEK293 cells (DSMZ) were seeded in 2x 10 cm TC-treated dishes per vector at 5e6 cells per dish in 10 ml DMEM\u0026thinsp;+\u0026thinsp;10% FBS. 24 hr later the media was aspirated and replaced with 10 ml DMEM/Glutamax with 5% FBS. After 4 hr, cells were triple transfected: 5 \u0026micro;g total plasmid per dish (transgene plasmid, pRepCap2 or pRepCap8 and pHelper) was mixed with PEI per dish and incubated at room temperature (RT) for 30 min before adding dropwise to the cells in their dishes. The following day, sodium butyrate was added to each dish. After a further 48 hr, the supernatant from both dishes was harvested, pooled and mixed then centrifuged at 1000 rpm (Eppendorf 5810R) for 10 min to remove cell debris. The supernatant was transferred to a fresh tube and 1:5 volume of AAVanced reagent (System Biosciences) (i.e. 5 ml in 20 ml) was added and gently mixed by inverting the tube. The mixture was incubated at 4\u0026deg;C for 72 hr.\u003c/p\u003e\n \u003cp\u003eFor concentration of vector, the tube was inverted several times to mix then centrifuged at 1000 rpm for 30 min at 4\u0026deg;C. The supernatant was discarded, and the pellet was resuspended in 500 \u0026micro;l PBS then transferred to a 1.5 ml microcentrifuge tube and centrifuged for 3 min at 1500 g. The supernatant was discarded, and the remaining pellet was resuspended in 200 \u0026micro;l (1/100 original volume) and stored at -80\u0026deg;C.\u003c/p\u003e\n \u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003eProduction of bicistronic rAAV vectors\u003c/h2\u003e\n \u003cp\u003eFour T-75 flasks were seeded with 5e6 adherent HEK293 (DSMZ) cells per flask in 10 ml DMEM with 10% FBS. 24 hr later the media was aspirated and replaced with 10 ml DMEM/Glutamax with 5% FBS. After 4 hr, cells were triple transfected: 5 \u0026micro;g total plasmid per dish (transgene plasmid, pRepCap8 and pHelper) was mixed with PEI per dish and incubated at RT for 30 min before adding dropwise to the cells in their dishes. The following day, sodium butyrate was added to each dish. 72 hr later, 1M MgCl2 stock and Denerase (250 U/\u0026micro;l) were added to each flask and incubated at 37\u0026deg;C for 30\u0026ndash;60 min. Following incubation, media release solution was added to each flask and incubated for a further 30\u0026ndash;60 min at 37\u0026deg;C. Finally, the supernatant from all 4 flasks was pooled and mixed, then centrifuged at 150 g (Eppendorf 5810R) for 5 min to remove cell debris, then passed through a 0.2 \u0026micro;M syringe filter and stored at -80\u0026deg;C until FPLC purification.\u003c/p\u003e\n \u003cp\u003eAll vectors were purified over 0.2 ml AAVX columns (BioservUK) on a BioRad NGC system and eluted under low pH conditions as per manufacturer\u0026rsquo;s protocol. Fractions were collected and neutralized in 10% v/v titration buffer, then buffer exchanged into formulation buffer, aliquoted and stored at -80\u0026deg;C.\u003c/p\u003e\n \u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003eAAV genome titration by qPCR analysis\u003c/h2\u003e\n \u003cp\u003erAAV vector samples were analyzed by qPCR to measure AAV genome titres. Samples underwent DNase I digestion by incubation with DNase I enzyme (Invitrogen). 10 \u0026micro;l of sample was added to a mix of 5 \u0026micro;l DNase I enzyme (Invitrogen), 5 \u0026micro;l 10x DNase I buffer (Invitrogen) and 30 \u0026micro;l of nuclease free water (NFW). Samples were incubated at 37\u0026deg;C for 30 min in a thermocycler. A DNase I positive control (1 \u0026micro;l of linearized reference plasmid DNA and 9 \u0026micro;l NFW) and a DNase I negative control (10 \u0026micro;l NFW) were also prepared and incubated at 37\u0026deg;C for 30 min. To deactivate the DNase I, a mix of 20 \u0026micro;l 25 nM EDTA (Invitrogen) and 30 \u0026micro;l NFW was added to each sample and control. Samples and controls were then heated at 75\u0026deg;C for 30 min followed by 5 min at 4\u003csup\u003eo\u003c/sup\u003eC in a thermocycler. A proteinase K digestion step was then performed to break down the AAV capsid. 50 \u0026micro;l of DNase I digested sample was then added to 5 \u0026micro;l PK enzyme (Qiagen) and 45 \u0026micro;l PBS and heated in a thermocycler using the following program: 56\u003csup\u003eo\u003c/sup\u003eC for 2 hr, 95\u0026deg;C for 30 min, 4\u0026deg;C for 10 min. DNase I and PK digested samples were then diluted to an appropriate dilution factor to achieve a final Ct value within assay standard curve range. Samples were diluted with salmon sperm buffer (1 \u0026micro;l salmon sperm DNA stock (Invitrogen) diluted in 5 ml of NFW) in a serial dilution resulting in final sample dilution factor of 1e2-1e4. A standard curve was prepared by serial dilution of reference linearized plasmid DNA diluted in salmon sperm buffer to achieve final copy number/10 \u0026micro;l standard range of: 1e8, 2e7, 4e6, 8e5, 1.6e5, 3.2e4, 6.4e3, 1.28e3. qPCR mix was prepared by mixing forward and reverse primers (final concentration 0.25 \u0026micro;M), Sybr Green SSOAdvanced PCR supermix 2x (Bio-Rad) and NFW. Forward and reverse primers were designed to target the bGHpA sequence present in all rAAV constructs used (F primer: CCTTCTAGTTGCCAGCCATC, R primer: ATGACACCTACTCAGACAATGC). 15 \u0026micro;l of the qPCR master mix was added to each well of a 96-well plate and 10 \u0026micro;l of diluted sample, standard or control was added. For each sample two dilution factors were analyzed. The plate was sealed and then transferred to a CFX96 thermocycler (Bio-Rad) where the following program was run: 95\u0026deg;C for 3 min, 40X cycles (95\u0026deg;C for 10 sec, 60\u0026deg;C for 30 sec), melting curve (95\u0026deg;C for 10 sec, 60\u0026deg;C for 5 sec, 95\u0026deg;C for 30 sec). The results were analyzed using the CFX96 software (Bio-Rad) and the resultant Ct values were extrapolated from the standard curve to calculate titre values for each sample.\u003c/p\u003e\n \u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003eAflibercept ELISA\u003c/h2\u003e\n \u003cp\u003eAflibercept protein levels were measured in supernatant samples using Aflibercept ELISA kit (Immunoguide, ABIN3172721) according to the manufacturer\u0026rsquo;s instructions. Supernatant samples were diluted from 1:50\u0026thinsp;\u0026minus;\u0026thinsp;1:100 in the supplied dilution buffer to obtain values within the range of the assay. Absorbance measurements at 450 nm were measured using the Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve with 4PL curve fit using GraphPad Prism.\u003c/p\u003e\n \u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003eFHL-1 ELISA\u003c/h2\u003e\n \u003cp\u003eAn internally developed FHL-1 quantitative ELISA was used to measure FHL-1 expression levels from constructs. 96-well plates were coated with primary antibody diluted in 1X coating buffer (Bio-Rad, BUF030B) overnight at 4\u0026deg;C. Plates were blocked for 2 hr with 1% BSA (Sigma, 05479) in PBS-0.05% Tween 20 (PBST) (Sigma, P1379). Wells were washed with PBST (Sigma, P1379) using ELx405 Microplate washer (BioTek) and tapped on absorbent paper to remove residual liquid. Wash steps were repeated 3 times and performed after each incubation with blocking buffer, sample and antibodies. Samples and standards were diluted in sample buffer (1% BSA/PBST). A Standard curve was generated ranging from 200 ng/ml to 1.56 ng/ml using human recombinant FHL-1 (GTP, custom made). Samples were analyzed using two dilution factors from (1:100-1:5) to achieve absorbance values within the standard curve range. Standards and samples were loaded into the plate and incubated at RT for 1 hr. Primary anti-FHL-1 Fab antibody (AbD33594.1) was diluted to a final concentration of 3 \u0026micro;g/ml. Secondary biotinylated anti-OX24 (final concentration of 0.05 \u0026micro;g/mL, Thermo-Fisher) and tertiary streptavidin-HRP antibodies (1:40,000) were diluted in 1% BSA/PBST, added to wells and incubated for 1 hr at RT. Development was carried out by adding 1 step ultra TMB-ELISA reagent (Thermo Scientific, 34028) to each well and incubating for 15 min. The reaction was stopped with 1M sulphuric acid (Hach, 93153). Absorbance was measured at 450 nm using a Sunrise Microplate reader (Tecan).\u003c/p\u003e\n \u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003eBradford Assay\u003c/h2\u003e\n \u003cp\u003eCell supernatant samples were thawed on ice and protein concentration was quantified using Bradford reagent (Sigma). A BSA (Pierce) standard curve was prepared ranging from 2000-0 \u0026micro;g/ml. BSA standard samples were diluted in the same matrix as supernatant samples (Opti-Mem serum free media (Gibco)). 5 \u0026micro;l of each standard or supernatant sample was added to a 96-well plate. 250 \u0026micro;l of Coomassie reagent (Sigma) was added to each well, the plate was covered and manually shaken to mix sample and reagent. The plate was incubated at RT for 10 min and the absorbance at 595 nm was measured using Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve using 4PL curve fit by GraphPad Prism.\u003c/p\u003e\n \u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003eWestern blot\u003c/h2\u003e\n \u003cp\u003eCell supernatant samples were analyzed by Western blot to detect the presence of aflibercept and FHL-1 protein. Cell supernatant samples were prepared for gel electrophoresis by mixing with Laemmli (4x) reducing buffer (Bio-Rad) and NFW (Gibco). A final protein concentration of 500 ng was loaded in each well. Samples were then incubated at 70\u0026deg;C for 10 min to denature proteins prior to gel electrophoresis. Mini-PROTEAN TGX gel chambers (Bio-Rad) were filled with 1x TGX running buffer (Bio-Rad). 15 \u0026micro;l of each sample was loaded onto a 4\u0026ndash;20% 15-well Mini-PROTEAN TGX pre-cast gel (Bio-Rad, 456\u0026ndash;1096). Gels were run at 100V for 1 hr and then transferred to a PVDF membrane using the Trans-Blot turbo transfer pack (Bio-Rad, 170\u0026ndash;4156) and the Trans-blot Turbo transfer system (Bio-Rad) at 1.3A, 25V for 7 min. Membranes were then blocked in 5% milk (Sigma) /TRIS Buffered Saline -Tween (0.05%) (TBST) for 1 hr at RT. Membranes were probed using anti-human CFH primary antibody (1:5000, Quidel) diluted in 5% milk/TBST at 4\u0026deg;C overnight. The next day membranes were washed 3 times for 5 min in TBST and probed with rabbit anti-Goat HRP secondary antibody (1:2000, Dako) for 1 hr at RT. Membranes were then washed 3 times for 5 min in TBST as previously described. Membranes were then developed using the ECL detection reagent (Amersham, RPN2232). Chemiluminescence was then measured using the ChemiDoc Imaging system (Bio-Rad). Image Lab was used to perform densitometry analysis. To detect aflibercept expression, membranes were probed with only the anti-human IgG- HRP antibody (1:20000, Thermo) at 4\u0026deg;C overnight. The next day membranes were washed and immediately developed as described.\u003c/p\u003e\n \u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003eDensitometric analysis\u003c/h2\u003e\n \u003cp\u003eDensitometric analysis was performed using ImageJ software. The bands representing RC001 (WT FHL-1) and RC288 (non-CO aflibercept) were used as the reference bands. The square selection tool was used to select each band and a background square containing no sample was used as the background reference. ImageJ software was then used to subtract the background level from each band. A relative quantity was calculated compared to the reference band.\u003c/p\u003e\n \u003cdiv id=\"Sec19\"\u003e\n \u003ch2\u003eHUVEC proliferation assay\u003c/h2\u003e\n \u003cp\u003eHUVECs (ATCC\u0026reg; PCS-100-013\u0026trade;) were seeded in a 96-well tissue culture dish at 5e3 cells/cm\u003csup\u003e2\u003c/sup\u003e in 180 \u0026micro;l HUVEC media (as instructed by ATCC) with either 0 or 15 ng/ml (360 nM) VEGF, avoiding the edge wells. 3\u0026ndash;4 hr later, 20 \u0026micro;l of either OptiMEM (GIBCO), aflibercept diluted in OptiMEM, or cell supernatant containing aflibercept expressed from transduced HEK293 cells diluted in OptiMEM was added to each well. 200 \u0026micro;l PBS was added to each edge well. The 96-well plates were incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e for 5 days, after which they were harvested. Cell media was gently tipped off and the plate was blotted on tissue paper to remove excess. 100 \u0026micro;l 10% TCA (trichloroacetic acid) solution was applied to each well for 20 min at RT, then tipped off into a reservoir for disposal. The plate was rinsed three times by dunking the plate into a container of distilled water and flicking off. The plate was blotted on tissue paper to dry, then 100 \u0026micro;l SRB (sulphorhodamine B reagent was added per well and incubated for 15 min before tipping off. Plates were blotted again, then washed three times with 100 \u0026micro;l 1% acetic acid. The plate was then left to dry in dark at ambient temperature overnight. Once all plates were harvested and dried, the SRB dye was solubilized by adding 100 \u0026micro;l 10 mM Tris base per well and incubated for 10 min under shaking at RT. The absorbance was read at 544 nm on a Tecan Sunrise microplate reader.\u003c/p\u003e\n \u003cdiv id=\"Sec20\"\u003e\n \u003ch2\u003eVEGF binding assay\u003c/h2\u003e\n \u003cp\u003eCell supernatant containing vector-derived aflibercept from transduction were incubated with 250 pg/ml recombinant human VEGF (R\u0026amp;D systems) to assess the binding affinity of expressed aflibercept to VEGF. Aflibercept containing cell supernatant were diluted in Opti-MEM serum free media to achieve a molar ratio range of aflibercept:VEGF at 20:1 to 1024:1. Aflibercept concentrations in cell supernatant samples were determined by Aflibercept ELISA (as previously described). Eylea\u0026reg; (recombinant aflibercept) was used as a positive control for VEGF binding. Reactions were incubated at 37 \u0026ordm;C for 1 hr at 350 rpm. The levels of unbound VEGF were measured using human VEGF Quantikine ELISA kit (R\u0026amp;D systems, DVE00) according to the manufacturer\u0026rsquo;s instructions. A standard curve ranging from 100\u0026thinsp;\u0026minus;\u0026thinsp;15.6 pg/ml of VEGF was prepared using standard material provided in the kit. The absorbance at 595 nm was measured using Sunrise Microplate reader (Tecan). Concentration values were extrapolated from standard curve using 4PL curve fit by GraphPad Prism. The concentration of unbound VEGF was plotted for each molar ratio of aflibercept:VEGF and an IC\u003csub\u003e50\u003c/sub\u003e value was calculated for each sample using GraphPad Prism.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eIn Vitro\u003c/strong\u003e \u003cstrong\u003eC3b Binding assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eAn \u003cem\u003ein vitro\u003c/em\u003e C3b binding assay was performed to determine the biological activity of human FHL-1 expressed from bicistronic constructs. Concentration of FHL-1 in supernatants was determined using FHL-1 ELISA (as previously described). Human recombinant FHL-1 protein (GTP, custom made) was used as a control. Reactions were prepared at a 1:4 molar ratio of CFI:FHL-1. Reactions containing 50 ng human CFI recombinant protein (Comptech, A138), 1 \u0026micro;g of human recombinant C3b (Comptech, A113) and the required volume of FHL-1 supernatant or control were prepared on ice. Reactions were incubated at 37\u0026deg;C for 20 min in a Thermoblock. After incubation reactions were immediately frozen at -80\u0026deg;C to stop the reaction. The incubation of FHL-1 and CFI with C3b leads to the cleavage of the \u0026alpha;-chain of C3b to generate the iC3b by-product. The amount of iC3b produced in this reaction was quantified using an iC3b ELISA.\u003c/p\u003e\n \u003cdiv id=\"Sec21\"\u003e\n \u003ch2\u003eiC3b quantitative ELISA\u003c/h2\u003e\n \u003cp\u003eAn internal iC3b quantitative ELISA was developed to measure the functional activity of FHL-1 for C3b breakdown with CFI. 96-well plates were coated with mouse anti-C3 primary antibody diluted in 1X coating buffer (Bio-Rad, BUF030B) to a final concentration of 3 \u0026micro;g/ml and incubated overnight at 4\u0026deg;C. Plates were blocked for 1 hr with 2% BSA (Sigma, 05479-50)/PBS. Wells were washed with PBST (Sigma, P1379) using the ELx405 Microplate washer (BioTek) and tapped on absorbent paper to remove any residual liquid. Wash steps were repeated 3 times and performed after each incubation with blocking buffer, samples, and antibodies. Samples and standards were diluted in sample buffer (PBST with 10 mM EDTA). A standard curve was generated ranging from 2 mg/ml to 31.25 ng/ml using human purified iC3b protein (CompTech, A115). Samples were analyzed using two dilution factors (1:100 and 1:400). Standards and samples were loaded onto the plate and incubated at RT for 2 hr. Rat anti-C3g secondary antibody (Hycult) diluted in 1% BSA/PBST to a final concentration of 0.25 \u0026micro;g/ml and mouse anti-rat HRP tertiary antibodies (1:5000, Hycult) were incubated in the wells for 1 hr at RT. Plates were developed by adding 1-step ultra TMB-ELISA reagent (Thermo Scientific, 34028) to each well and incubating for 15 min. Reaction was stopped with 2M sulphuric acid (Hach, 93153). Absorbance was measured at 450 nm using a Sunrise Microplate reader (Tecan).\u003c/p\u003e\n \u003cdiv id=\"Sec22\"\u003e\n \u003ch2\u003eAnimal care and handling\u003c/h2\u003e\n \u003cp\u003eInbred male C57BL/6JRj mice aged eight weeks at arrival (Janvier Labs, France) were housed in groups of three to five in individually ventilated cages with aspen bedding, nesting material (Populus tremula, Tapvei\u0026acirc; Estonia O\u0026Uuml;, Estonia) and polycarbonate red igloos (Datesand group, USA) as enrichment, at a constant temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C), relative humidity (50\u0026thinsp;\u0026plusmn;\u0026thinsp;10%) and in a light-controlled environment (lights on from 7 am to 7 pm) with \u003cem\u003ead libitum\u003c/em\u003e access to food (Rat/Mouse maintenance V1534-000, ssniff Spezialdi\u0026auml;ten GmbH, Germany) and tap water. Experiments started after a minimum of one-week quarantine and acclimatization in the vivarium.\u003c/p\u003e\n \u003cp\u003eAll animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, the EC Directive 2010/63/EU of the European Parliament and of the Council on the Protection of animals used for Scientific Purposes and using protocols approved and monitored by the Animal Experiment Board of Finland (Experimentica Ltd. animal license number ESAVI-10750-2020). The study is reported in accordance with ARRIVE guidelines (\u003cspan\u003e\u003cspan\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv id=\"Sec23\"\u003e\n \u003ch2\u003eAnesthesia and reversal\u003c/h2\u003e\n \u003cp\u003eFor all the procedures the animals were anesthetized with a subcutaneous injection of a mixture containing ketamine (30 mg/Kg) (Ketaminol Vet 50 mg/ml. Intervet, The Netherlands) and medetomidine (0.4 mg/kg) (Cepetor Vet 1 mg/ml. Vetmedic, Finland). Anesthesia was reversed by \u0026alpha;2-antagonist for medetomidine (2.5 mg/kg) (Revertor Vet 5 mg/ml; Vetmedic, Finland). During the anesthesia, mice received a subcutaneous injection of sodium lactate solution to prevent dehydration (Ringer-Lactate Animalcare, Ecuphar NV, Belgium).\u003c/p\u003e\n \u003cdiv id=\"Sec24\"\u003e\n \u003ch2\u003eSubretinal Injections of rAAV vectors\u003c/h2\u003e\n \u003cp\u003eThe anesthetized animals were placed under a stereomicroscope (Leica Microsystems), and a drop of iodine was applied on the cornea and allowed to spread evenly (Minims Povidione Iodine 5%, Bausch \u0026amp; Lomb, Canada). A small incision in the temporal side of the conjunctiva/sclera was performed to expose the choroid. A 30 G needle was used to create a small hole in the temporal side of the choroid and the cornea was also punctured in order to reduce the intraocular pressure. A micro-syringe (Hamilton Bonaduz AG, Bonaduz, Switzerland) was filled with 1 \u0026micro;l solution of vector and the vector was introduced into the subretinal space through the exposed choroid. The solution was injected into the subretinal space for 10 sec and the needle was kept in place for an additional 30 sec. before being removed. The success of the injection was confirmed using \u003cem\u003ein vivo\u003c/em\u003e SD-OCT imaging (Bioptigen Envisu R2200; Bioptigen Inc./Leica Microsystems, Morrisville, NC, USA). Chloramphenicol ointment was applied after the injection (Oftan Chlora, Santen Oy, Finland). All vectors were administered unilaterally into the right eye. The contralateral eye was left as healthy control.\u003c/p\u003e\n \u003cdiv id=\"Sec25\"\u003e\n \u003ch2\u003eIntravitreal administration of aflibercept\u003c/h2\u003e\n \u003cp\u003eThe positive control compound was Eylea\u0026reg; (Bayer Pharma AG, Germany), a ready-to-use solution for IVT injections at a concentration of 40 mg/mL (formulated in 10 mM sodium phosphate, 40 mM sodium chloride, 0.03% polysorbate 20, and 5% sucrose, pH 6.2). Aflibercept was administered intravitreally into the right eye (OD) at a volume of 2 \u0026micro;l (80 \u0026micro;g/eye) immediately after the CNV induction.\u003c/p\u003e\n \u003cdiv id=\"Sec26\"\u003e\n \u003ch2\u003eLaser-induced Choroidal Neovascularization\u003c/h2\u003e\n \u003cp\u003eThe anaesthetized animals received a drop of 0.5% tropicamide (Oftan Tropicamid, Santen Oy) to dilate the pupils. A drop of Viscotears (Dr. Gerhard Mann Chem. -Pharm., Germany) was applied on the eye and a coverslip was used to applanate the cornea. Three laser lesions were executed unilaterally on the right eye around the optic nerve head using a 532 nm diode laser (spot size: 100 \u0026micro;m; power: 130 mW; time: 120 ms. Oculight TX. Iridex Corp., USA). The success on perforating the BrM was verified by FA and SD-OCT \u003cem\u003ein vivo\u003c/em\u003e imaging.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eIn Vivo\u003c/strong\u003e \u003cstrong\u003eImaging\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe success of the subretinal injections was confirmed using SD-OCT imaging. SD-OCT was performed prior CNV induction, and the CNV lesions were monitored using FA and SD-OCT on day 0 after CNV induction, and at days 4 and 7 for all the study groups.\u003c/p\u003e\n \u003cdiv id=\"Sec27\"\u003e\n \u003ch2\u003eFluorescein Angiography (FA)\u003c/h2\u003e\n \u003cp\u003eVascular leakage at the choroid level was examined using a Heidelberg Spectralis HRA system (Heidelberg Engineering, Germany). Briefly, a drop of 0.5% tropicamide (Oftan Tropicamid. Santen Oy) was administered on the cornea of the anaesthetized mouse to dilate the pupils, and the mouse was positioned onto the mouse holder. After aligning the optic nerve head at the retina level, with the use of the infrared reflectance camera, a solution of 2.5% sodium fluorescein (Sigma-Aldrich, Finland) was administered as a subcutaneous injection (30 \u0026micro;l/10 g). Consecutive fluorescent images (Sensitivity: 45; ART Mean: 5 frames) were taken every 60 sec from the retinal and choroidal focus levels for a period of 5 min after the fluorescein administration.\u003c/p\u003e\n \u003cdiv id=\"Sec28\"\u003e\n \u003ch2\u003eSpectral Domain Optical Coherence Tomography (SD-OCT)\u003c/h2\u003e\n \u003cp\u003eSD-OCT was performed to verify the subretinal administration, prior and after the CNV induction, and at days 4 and 7 after CNV induction. Immediately after the FA imaging the mouse was examined using the SD-OCT system Envisu R2200 (Bioptigen Inc./Leica Microsystems, USA). The scanned area covers a 1.4 x 1.4 mm\u003csup\u003e2\u003c/sup\u003e of the retina centered around the optic nerve. Each scan is composed of 100 B Scans each one composed of 1000 A Scans.\u003c/p\u003e\n \u003cdiv id=\"Sec29\"\u003e\n \u003ch2\u003eQuantitative and qualitative analysis of CNV\u003c/h2\u003e\n \u003cp\u003eThe lasered spots were qualitatively graded from FA images for evidence of vascular leak. SD-OCT scans were used for additional confirmation. FA scans were analyzed by a proprietary algorithm, which uses a combination of convolutional neural network (CNN) designed for semantic segmentation and traditional computer vision algorithms. The neural network was trained to recognize and quantify CNV lesions using transfer learning approach. The results from the model were reviewed and adjusted, if necessary, by a scientist blinded to the treatments.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003ch3\u003eAnimal Sacrifice and Tissue Collection\u003c/h3\u003e\n\u003cp\u003eMice were sacrificed by anesthesia with a subcutaneous injection of a mixture containing ketamine (30 mg/kg) (Ketaminol Vet 50 mg/ml; Intervet) and medetomidine (0.4 mg/kg) (Cepetor Vet 1 mg/ml; CP-Pharma Handelsgesellschaft MbH) and then decapitation on day 7 after CNV induction. All treated/induced eyes (OD) and two contralateral eyes per group (OS) were enucleated and choroidal flat mounts were prepared for neovascularization analysis.\u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eQuantification vector genomes in mouse eyecups\u003c/h2\u003e \u003cp\u003e50 \u0026micro;l RNAlater (Invitrogen) was added to each frozen eyecup and allowed to thaw on ice. Each eyecup was cut into 10\u0026ndash;20 pieces using dissecting scissors then plunged into liquid nitrogen for 30 sec. 50 \u0026micro;l β-mercaptoethanol-supplemented RLT buffer (Qiagen) was added, and the tissue was disrupted using an electric micro-pestle for 2 min. An additional 200 \u0026micro;l β-mercaptoethanol-supplemented RLT was added and mixed by pipetting. The sample was stored at -80\u0026deg;C overnight. Following thawing, the sample was passed through a QIAshredder (Qiagen) to further homogenize the tissues, then RNA was extracted as per RNeasy fibrous tissue kit (Qiagen) and eluted in 50 \u0026micro;l RNase-free water. DNase I digestion was performed on-column as part of the RNeasy fibrous tissue kit protocol. cDNA was reverse transcribed from 200 ng RNA using a SuperScript III Reverse Transcriptase Kit (Invitrogen 11752-050). Standard curves were prepared by serial dilution of linearized plasmid DNA. qPCR mix was prepared by mixing forward and reverse primers (F: CATCGCATTGTCTGAGTAGGT R: AGCATGCCTGCTATTGTCTT) to a final concentration of 0.25 \u0026micro;M with 2x SybrGreen SSOadvanced PCR supermix (Bio-Rad) and NFW. 15 \u0026micro;l of qPCR master mix was added to each well of a 96-well plate and 10 \u0026micro;l of diluted sample, standard or control was added. The plate was sealed and transferred to a CFX96 thermocycler (Bio-Rad) where the following program was run: 95\u0026deg;C for 3 min, 40X cycles (95\u0026deg;C for 10 sec, 60\u0026deg;C for 30 sec), melting curve (95\u0026deg;C for 10 sec, 60\u0026deg;C for 5 sec, 95\u0026deg;C for 30 sec). The results were analyzed using the CFX96 software (Bio-Rad) and the resultant Ct values were extrapolated from the standard curve to calculate concentration values for each sample.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eAflibercept ELISA measurement in mouse ocular fluids\u003c/h2\u003e \u003cp\u003eAflibercept protein levels were measured in ocular fluid samples using Aflibercept ELISA kit (Immunoguide, ABIN3172721) according to the manufacturer\u0026rsquo;s instructions. Ocular fluids were diluted 1:15 in the supplied dilution buffer to obtain values within the range of the assay. Absorbance measurements at 450 nm were measured using the Sunrise Microplate reader (Tecan). Concentration values were extrapolated from the standard curve with 4PL curve fit using GraphPad Prism.\u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003eFHL-1 MSD measurement in mouse ocular fluids\u003c/h2\u003e \u003cp\u003eFHL-1 protein levels were measured in ocular fluid samples by MSD. MSD SECTOR plates were coated with coating protein anti-FHL-1-biotin spycatch (AbD33594rab, BioRad). Ocular fluid and standard samples were incubated for 1 hr at RT (shaking at 750 rpm) and in-house sulfo-tagged antibody (anti-FH Ox-24, MA170057, Invitrogen) was used for detection. The plate was read using MSD read buffer T and the ocular fluid samples were compared to an 8-point standard curve. The plates were read by an MSD plate reader and analyzed using MSD Discovery Workbench software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003eCNV staining\u003c/h2\u003e \u003cp\u003eChoroidal flat mounts were stained with fluorescein labeled Griffonia Simplicifolia Lectin I (GSLI) Isolectin B\u003csub\u003e4\u003c/sub\u003e (FL-1201, Vector Laboratories, USA) to evaluate the neovascularization. Briefly, the flat mounts were washed with Tris-buffered saline (TBS) and blocked with 10% normal goat serum (NGS), 0.5% Triton X-100 in TBS pH 7.4 (TBST) for 1 hr in RT. Samples were washed with TBS and incubated with fluorescein labeled Isolectin GS-IB\u003csub\u003e4\u003c/sub\u003e (1:200, Vector Laboratories) overnight at +\u0026thinsp;4\u0026deg;C in 1% NGS diluted in 0.1% TBST. Thereafter the samples were washed 3 x 10 min with 1% NGS diluted in 0.1% TBST, counterstained with DAPI and mounted with Fluoroshield\u0026trade; mounting medium (Sigma-Aldrich) on microscopic slides. Choroidal samples were imaged using a DMi8 THUNDER 3D microscope (Leica Microsystems, Germany). The stained areas were outlined, and the stained area was measured using the image processing software FIJI[92].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eQuantitative data were graphed, analyzed and presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical analyses were performed using the GraphPad Prism software (v10.1.1 GraphPad Software, USA). Differences were considered statistically significant at the p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 level. Imaging data distribution was normalized by square root transformation and One-way ANOVA followed by Dunnett\u0026rsquo;s multiple comparison tests were performed. Outliers were identified and removed using the ROUT method (Q\u0026thinsp;=\u0026thinsp;0.2%).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;All data generated and/or analyzed in this study are included in this published article. Materials may be made available subjected to legal obligations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigures 1, 2A, 4A, 5A and 6A were generated with BioRender.com.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eL.C.S.T wrote the manuscript, supervised the project and conception of idea. J.J conducted codon optimization, designed the bicistronic vectors, conducted \u003cem\u003ein vitro\u003c/em\u003e experiments and established the qPCR assay for measuring \u003cem\u003ein vivo\u003c/em\u003e RNA expression. D.S designed and conducted data analysis for the \u003cem\u003ein vivo\u003c/em\u003e experiments. A.L. conducted the \u003cem\u003ein vitro\u003c/em\u003e experiments. A.W. assisted with codon optimization. R.A-D supported and collected data for the \u003cem\u003ein vivo\u003c/em\u003e experiments. M.D. and J.H. supported vector manufacturing. J.E-R supervised the \u003cem\u003ein vivo\u003c/em\u003e experiments, revised the manuscript and conception of idea. S.E. revised the manuscript and conception of idea. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported and funded by Gyroscope Therapeutics (A Novartis Company).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eL.C.S.T, D.S, R.A-D and J.H are employed by Gyroscope Therapeutics (A Novartis Company). J.J, A.L, A.W, M.D, J.E-R and S.E were previously employed by Gyroscope Therapeutics (A Novartis Company) while engaged in the research project.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eEconomic Burden of Ageing Eye conditions estimated on the scale of up to billions in USA, Germany and Bulgaria. \u003cem\u003ehttps://retina-international.org/wsd2022-amdimpact/\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eKwak, N., Okamoto, N., Wood, J. M. \u0026amp; Campochiaro, P. A. VEGF is major stimulator in model of choroidal neovascularization. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 3158\u0026ndash;64 (2000).\u003c/li\u003e\n\u003cli\u003eOkamoto, N. \u003cem\u003eet al.\u003c/em\u003e Transgenic mice with increased expression of vascular endothelial growth factor in the retina: a new model of intraretinal and subretinal neovascularization. \u003cem\u003eAm J Pathol\u003c/em\u003e \u003cstrong\u003e151\u003c/strong\u003e, 281\u0026ndash;91 (1997).\u003c/li\u003e\n\u003cli\u003eBhutto, I. \u0026amp; Lutty, G. Understanding age-related macular degeneration (AMD): relationships between the photoreceptor/retinal pigment epithelium/Bruch\u0026rsquo;s membrane/choriocapillaris complex. \u003cem\u003eMol Aspects Med\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 295\u0026ndash;317 (2012).\u003c/li\u003e\n\u003cli\u003eHeier, J. S. \u003cem\u003eet al.\u003c/em\u003e Intravitreal aflibercept (VEGF trap-eye) in wet age-related macular degeneration. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, 2537\u0026ndash;48 (2012).\u003c/li\u003e\n\u003cli\u003eDaruich, A. \u003cem\u003eet al.\u003c/em\u003e Mechanisms of macular edema: Beyond the surface. \u003cem\u003eProg Retin Eye Res\u003c/em\u003e \u003cstrong\u003e63\u003c/strong\u003e, 20\u0026ndash;68 (2018).\u003c/li\u003e\n\u003cli\u003eSchmidt-Erfurth, U. \u003cem\u003eet al.\u003c/em\u003e Guidelines for the management of neovascular age-related macular degeneration by the European Society of Retina Specialists (EURETINA). \u003cem\u003eBr J Ophthalmol\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 1144\u0026ndash;67 (2014).\u003c/li\u003e\n\u003cli\u003eFaatz, H. \u003cem\u003eet al.\u003c/em\u003e Vascular Analysis of Type 1, 2, and 3 Macular neovascularization in age-related macular degeneration using swept-source optical coherence tomography angiography shows new insights into differences of pathologic vasculature and may lead to a more personalized understanding. \u003cem\u003eBiomedicines\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, (2022).\u003c/li\u003e\n\u003cli\u003eArmento, A., Ueffing, M. \u0026amp; Clark, S. J. The complement system in age-related macular degeneration. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 4487\u0026ndash;4505 (2021).\u003c/li\u003e\n\u003cli\u003eSchwartz, S. G., Hampton, B. M., Kovach, J. L. \u0026amp; Brantley, M. A. Genetics and age-related macular degeneration: a practical review for the clinician. \u003cem\u003eClin Ophthalmol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1229\u0026ndash;35 (2016).\u003c/li\u003e\n\u003cli\u003eFritsche, L. G. \u003cem\u003eet al.\u003c/em\u003e A large genome-wide association study of age-related macular degeneration highlights contributions of rare and common variants. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 134\u0026ndash;143 (2016).\u003c/li\u003e\n\u003cli\u003eTan, P. L., Bowes Rickman, C. \u0026amp; Katsanis, N. AMD and the alternative complement pathway: genetics and functional implications. \u003cem\u003eHum Genomics\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 23 (2016).\u003c/li\u003e\n\u003cli\u003eKumar-Singh, R. The role of complement membrane attack complex in dry and wet AMD - From hypothesis to clinical trials. \u003cem\u003eExp Eye Res\u003c/em\u003e \u003cstrong\u003e184\u003c/strong\u003e, 266\u0026ndash;277 (2019).\u003c/li\u003e\n\u003cli\u003eReis, E. S., Mastellos, D. C., Hajishengallis, G. \u0026amp; Lambris, J. D. New insights into the immune functions of complement. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 503\u0026ndash;516 (2019).\u003c/li\u003e\n\u003cli\u003eKauppinen, A., Paterno, J. J., Blasiak, J., Salminen, A. \u0026amp; Kaarniranta, K. Inflammation and its role in age-related macular degeneration. \u003cem\u003eCellular and Molecular Life Sciences\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 1765\u0026ndash;1786 (2016).\u003c/li\u003e\n\u003cli\u003eJensen, E. G., Jakobsen, T. S., Thiel, S., Askou, A. L. \u0026amp; Corydon, T. J. Associations between the Complement System and Choroidal Neovascularization in Wet Age-Related Macular Degeneration. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 9752 (2020).\u003c/li\u003e\n\u003cli\u003eAmbati, J., Atkinson, J. P. \u0026amp; Gelfand, B. D. Immunology of age-related macular degeneration. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 438\u0026ndash;451 (2013).\u003c/li\u003e\n\u003cli\u003eGrossniklaus, H. E. \u0026amp; Green, W. R. Choroidal neovascularization. \u003cem\u003eAm J Ophthalmol\u003c/em\u003e \u003cstrong\u003e137\u003c/strong\u003e, 496\u0026ndash;503 (2004).\u003c/li\u003e\n\u003cli\u003eCampa, C. \u003cem\u003eet al.\u003c/em\u003e Inflammatory Mediators and Angiogenic Factors in Choroidal Neovascularization: Pathogenetic Interactions and Therapeutic Implications. \u003cem\u003eMediators Inflamm\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, 1\u0026ndash;14 (2010).\u003c/li\u003e\n\u003cli\u003eCruz-Guilloty, F. \u003cem\u003eet al.\u003c/em\u003e Infiltration of Proinflammatory M1 Macrophages into the Outer Retina Precedes Damage in a Mouse Model of Age-Related Macular Degeneration. \u003cem\u003eInt J Inflam\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, 1\u0026ndash;12 (2013).\u003c/li\u003e\n\u003cli\u003eNatoli, R. \u003cem\u003eet al.\u003c/em\u003e Retinal Macrophages Synthesize C3 and Activate Complement in AMD and in Models of Focal Retinal Degeneration. \u003cem\u003eInvestigative Opthalmology \u0026amp; Visual Science\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 2977 (2017).\u003c/li\u003e\n\u003cli\u003eKrause, T. A., Alex, A. F., Engel, D. R., Kurts, C. \u0026amp; Eter, N. VEGF-Production by CCR2-Dependent Macrophages Contributes to Laser-Induced Choroidal Neovascularization. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, e94313 (2014).\u003c/li\u003e\n\u003cli\u003eIshikawa, K., Kannan, R. \u0026amp; Hinton, D. R. Molecular mechanisms of subretinal fibrosis in age-related macular degeneration. \u003cem\u003eExp Eye Res\u003c/em\u003e \u003cstrong\u003e142\u003c/strong\u003e, 19\u0026ndash;25 (2016).\u003c/li\u003e\n\u003cli\u003eHinton, D. R., He, S. \u0026amp; Lopez, P. F. Apoptosis in Surgically Excised Choroidal Neovascular Membranes in Age-Related Macular Degeneration. \u003cem\u003eArchives of Ophthalmology\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e, (1998).\u003c/li\u003e\n\u003cli\u003eLambert, V. \u003cem\u003eet al.\u003c/em\u003e Laser-induced choroidal neovascularization model to study age-related macular degeneration in mice. \u003cem\u003eNat Protoc\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 2197\u0026ndash;2211 (2013).\u003c/li\u003e\n\u003cli\u003eRohrer, B. \u003cem\u003eet al.\u003c/em\u003e The alternative pathway is required, but not alone sufficient, for retinal pathology in mouse laser-induced choroidal neovascularization. \u003cem\u003eMol Immunol\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, e1\u0026ndash;e8 (2011).\u003c/li\u003e\n\u003cli\u003eBora, P. S. \u003cem\u003eet al.\u003c/em\u003e Role of Complement and Complement Membrane Attack Complex in Laser-Induced Choroidal Neovascularization. \u003cem\u003eThe Journal of Immunology\u003c/em\u003e \u003cstrong\u003e174\u003c/strong\u003e, 491\u0026ndash;497 (2005).\u003c/li\u003e\n\u003cli\u003eLoyet, K. M. \u003cem\u003eet al.\u003c/em\u003e Activation of the Alternative Complement Pathway in Vitreous is Controlled by Genetics in Age-Related Macular Degeneration. \u003cem\u003eInvestigative Opthalmology \u0026amp; Visual Science\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 6628 (2012).\u003c/li\u003e\n\u003cli\u003eSchick, T. \u003cem\u003eet al.\u003c/em\u003e Local complement activation in aqueous humor in patients with age-related macular degeneration. \u003cem\u003eEye\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 810\u0026ndash;813 (2017).\u003c/li\u003e\n\u003cli\u003eWykoff, C. C. \u003cem\u003eet al.\u003c/em\u003e Impact of Anti-VEGF Treatment and Patient Characteristics on Vision Outcomes in Neovascular Age-related Macular Degeneration. \u003cem\u003eOphthalmology Science\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 100421 (2024).\u003c/li\u003e\n\u003cli\u003eHolekamp, N. M. \u003cem\u003eet al.\u003c/em\u003e Clinical utilization of anti-VEGF agents and disease monitoring in neovascular age-related macular degeneration. \u003cem\u003eAm J Ophthalmol\u003c/em\u003e \u003cstrong\u003e157\u003c/strong\u003e, (2014).\u003c/li\u003e\n\u003cli\u003eCiulla, T. A., Hussain, R. M., Taraborelli, D., Pollack, J. S. \u0026amp; Williams, D. F. Longer-Term Anti-VEGF Therapy Outcomes in Neovascular Age-Related Macular Degeneration, Diabetic Macular Edema, and Vein Occlusion-Related Macular Edema. \u003cem\u003eOphthalmol Retina\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 796\u0026ndash;806 (2022).\u003c/li\u003e\n\u003cli\u003eObeid, A. \u003cem\u003eet al.\u003c/em\u003e Loss to Follow-up Among Patients With Neovascular Age-Related Macular Degeneration Who Received Intravitreal Anti\u0026ndash;Vascular Endothelial Growth Factor Injections. \u003cem\u003eJAMA Ophthalmol\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, 1251 (2018).\u003c/li\u003e\n\u003cli\u003eJones, R., Stratton, I. M., Scanlon, P. H. \u0026amp; Theodoropoulou, S. Disengagement and loss to follow-up in intravitreal injection clinics for neovascular age-related macular degeneration. \u003cem\u003eEye\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 3186\u0026ndash;3190 (2023).\u003c/li\u003e\n\u003cli\u003eShahzad, H. \u003cem\u003eet al.\u003c/em\u003e Non-adherence and non-persistence to intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy: a systematic review and meta-analysis. \u003cem\u003eSyst Rev\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 92 (2023).\u003c/li\u003e\n\u003cli\u003eMehta, H. \u003cem\u003eet al.\u003c/em\u003e \u0026lt;p\u0026gt;Trends in Real-World Neovascular AMD Treatment Outcomes in the UK\u0026lt;/p\u0026gt;. \u003cem\u003eClinical Ophthalmology\u003c/em\u003e \u003cstrong\u003eVolume 14\u003c/strong\u003e, 3331\u0026ndash;3342 (2020).\u003c/li\u003e\n\u003cli\u003eXu, L. \u003cem\u003eet al.\u003c/em\u003e GEOGRAPHIC ATROPHY IN PATIENTS RECEIVING ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR FOR NEOVASCULAR AGE-RELATED MACULAR DEGENERATION. \u003cem\u003eRetina\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 176\u0026ndash;186 (2015).\u003c/li\u003e\n\u003cli\u003eGrunwald, J. E. \u003cem\u003eet al.\u003c/em\u003e Incidence and Growth of Geographic Atrophy during 5 Years of Comparison of Age-Related Macular Degeneration Treatments Trials. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e124\u003c/strong\u003e, 97\u0026ndash;104 (2017).\u003c/li\u003e\n\u003cli\u003eRofagha, S., Bhisitkul, R. B., Boyer, D. S., Sadda, S. R. \u0026amp; Zhang, K. Seven-Year Outcomes in Ranibizumab-Treated Patients in ANCHOR, MARINA, and HORIZON. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 2292\u0026ndash;2299 (2013).\u003c/li\u003e\n\u003cli\u003eGrunwald, J. E. \u003cem\u003eet al.\u003c/em\u003e Risk of Geographic Atrophy in the Comparison of Age-related Macular Degeneration Treatments Trials. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e121\u003c/strong\u003e, 150\u0026ndash;161 (2014).\u003c/li\u003e\n\u003cli\u003eFoss, A., Rotsos, T., Empeslidis, T. \u0026amp; Chong, V. Development of Macular Atrophy in Patients with Wet Age-Related Macular Degeneration Receiving Anti-VEGF Treatment. \u003cem\u003eOphthalmologica\u003c/em\u003e \u003cstrong\u003e245\u003c/strong\u003e, 204\u0026ndash;217 (2022).\u003c/li\u003e\n\u003cli\u003eEshtiaghi, A., Issa, M., Popovic, M. M., Muni, R. H. \u0026amp; Kertes, P. J. GEOGRAPHIC ATROPHY INCIDENCE AND PROGRESSION AFTER INTRAVITREAL INJECTIONS OF ANTI-VASCULAR ENDOTHELIAL GROWTH FACTOR AGENTS FOR AGE-RELATED MACULAR DEGENERATION. \u003cem\u003eRetina\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 2424\u0026ndash;2435 (2021).\u003c/li\u003e\n\u003cli\u003eTanaka, E., Chaikitmongkol, V., Bressler, S. B. \u0026amp; Bressler, N. M. Vision-Threatening Lesions Developing with Longer-Term Follow-up after Treatment of Neovascular Age-Related Macular Degeneration. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e122\u003c/strong\u003e, 153\u0026ndash;161 (2015).\u003c/li\u003e\n\u003cli\u003eGemenetzi, M., Lotery, A. J. \u0026amp; Patel, P. J. Risk of geographic atrophy in age-related macular degeneration patients treated with intravitreal anti-VEGF agents. \u003cem\u003eEye\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 1\u0026ndash;9 (2017).\u003c/li\u003e\n\u003cli\u003eYan, Q. \u003cem\u003eet al.\u003c/em\u003e Genome-wide analysis of disease progression in age-related macular degeneration. \u003cem\u003eHum Mol Genet\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 929\u0026ndash;940 (2018).\u003c/li\u003e\n\u003cli\u003eKeir, L. S. \u003cem\u003eet al.\u003c/em\u003e VEGF regulates local inhibitory complement proteins in the eye and kidney. \u003cem\u003eJournal of Clinical Investigation\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 199\u0026ndash;214 (2016).\u003c/li\u003e\n\u003cli\u003eTanaka, K. \u003cem\u003eet al.\u003c/em\u003e Changes in complement activation products after anti-VEGF injection for choroidal neovascularization in age-related macular degeneration and pachychoroid disease. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 8464 (2021).\u003c/li\u003e\n\u003cli\u003eRasmussen, A. \u003cem\u003eet al.\u003c/em\u003e A 4-Year Longitudinal Study of 555 Patients Treated with Ranibizumab for Neovascular Age-related Macular Degeneration. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 2630\u0026ndash;2636 (2013).\u003c/li\u003e\n\u003cli\u003eEhlken, C. \u003cem\u003eet al.\u003c/em\u003e Switch of anti-VEGF agents is an option for nonresponders in the treatment of AMD. \u003cem\u003eEye\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 538\u0026ndash;545 (2014).\u003c/li\u003e\n\u003cli\u003eChen, G. \u003cem\u003eet al.\u003c/em\u003e Pharmacogenetics of Complement Factor H Y402H Polymorphism and Treatment of Neovascular AMD with Anti-VEGF Agents: A Meta-Analysis. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 14517 (2015).\u003c/li\u003e\n\u003cli\u003eSengul, E. A. \u003cem\u003eet al.\u003c/em\u003e Pharmacogenetic Aspect of Intravitreal Ranibizumab Treatment in Neovascular Age-Related Macular Degeneration: A Five-Year Follow-Up. \u003cem\u003eOcul Immunol Inflamm\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 971\u0026ndash;977 (2018).\u003c/li\u003e\n\u003cli\u003eCastro, B. F. M., Steel, J. C. \u0026amp; Layton, C. J. AAV-Based Strategies for Treatment of Retinal and Choroidal Vascular Diseases: Advances in Age-Related Macular Degeneration and Diabetic Retinopathy Therapies. \u003cem\u003eBioDrugs\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 73\u0026ndash;93 (2024).\u003c/li\u003e\n\u003cli\u003eChaney, J. L. \u0026amp; Clark, P. L. Roles for Synonymous Codon Usage in Protein Biogenesis. \u003cem\u003eAnnu Rev Biophys\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 143\u0026ndash;166 (2015).\u003c/li\u003e\n\u003cli\u003eYu, C.-H. \u003cem\u003eet al.\u003c/em\u003e Codon Usage Influences the Local Rate of Translation Elongation to Regulate Co-translational Protein Folding. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 744\u0026ndash;754 (2015).\u003c/li\u003e\n\u003cli\u003eHanson, G. \u0026amp; Coller, J. Codon optimality, bias and usage in translation and mRNA decay. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 20\u0026ndash;30 (2018).\u003c/li\u003e\n\u003cli\u003eQuax, T. E. F., Claassens, N. J., S\u0026ouml;ll, D. \u0026amp; van der Oost, J. Codon Bias as a Means to Fine-Tune Gene Expression. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 149\u0026ndash;161 (2015).\u003c/li\u003e\n\u003cli\u003eInouye, S., Sahara-Miura, Y., Sato, J. \u0026amp; Suzuki, T. Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons. \u003cem\u003eProtein Expr Purif\u003c/em\u003e \u003cstrong\u003e109\u003c/strong\u003e, 47\u0026ndash;54 (2015).\u003c/li\u003e\n\u003cli\u003eFu, H. \u003cem\u003eet al.\u003c/em\u003e Codon optimization with deep learning to enhance protein expression. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 17617 (2020).\u003c/li\u003e\n\u003cli\u003eLeWitt, P. A. \u003cem\u003eet al.\u003c/em\u003e AAV2-GAD gene therapy for advanced Parkinson\u0026rsquo;s disease: a double-blind, sham-surgery controlled, randomised trial. \u003cem\u003eLancet Neurol\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 309\u0026ndash;319 (2011).\u003c/li\u003e\n\u003cli\u003eXue, K. \u003cem\u003eet al.\u003c/em\u003e Beneficial effects on vision in patients undergoing retinal gene therapy for choroideremia. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 1507\u0026ndash;1512 (2018).\u003c/li\u003e\n\u003cli\u003eWoodley, E. \u003cem\u003eet al.\u003c/em\u003e Efficacy of a bicistronic vector for correction of Sandhoff Disease in a mouse model. \u003cem\u003eMol Ther Methods Clin Dev\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 47\u0026ndash;57 (2019).\u003c/li\u003e\n\u003cli\u003eLiu, Y. \u003cem\u003eet al.\u003c/em\u003e AAV8-antiVEGFfab ocular gene transfer for neovascular age-related macular degeneration. \u003cem\u003eMolecular Therapy\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 542\u0026ndash;549 (2018).\u003c/li\u003e\n\u003cli\u003eMizuguchi, H., Xu, Z., Ishii-Watabe, A., Uchida, E. \u0026amp; Hayakawa, T. IRES-Dependent Second Gene Expression Is Significantly Lower Than Cap-Dependent First Gene Expression in a Bicistronic Vector. \u003cem\u003eMolecular Therapy\u003c/em\u003e \u003cstrong\u003e1\u003c/strong\u003e, 376\u0026ndash;382 (2000).\u003c/li\u003e\n\u003cli\u003ede Lima, J. G. S. \u0026amp; Lanza, D. C. F. 2A and 2A-like Sequences: Distribution in Different Virus Species and Applications in Biotechnology. \u003cem\u003eViruses\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 2160 (2021).\u003c/li\u003e\n\u003cli\u003eAhier, A. \u0026amp; Jarriault, S. Simultaneous Expression of Multiple Proteins Under a Single Promoter in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e via a Versatile 2A-Based Toolkit. \u003cem\u003eGenetics\u003c/em\u003e \u003cstrong\u003e196\u003c/strong\u003e, 605\u0026ndash;613 (2014).\u003c/li\u003e\n\u003cli\u003eDonnelly, M. L. L. \u003cem\u003eet al.\u003c/em\u003e The \u0026lsquo;cleavage\u0026rsquo; activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring \u0026lsquo;2A-like\u0026rsquo; sequences. \u003cem\u003eJournal of General Virology\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 1027\u0026ndash;1041 (2001).\u003c/li\u003e\n\u003cli\u003eFurler, S., Paterna, J.-C., Weibel, M. \u0026amp; B\u0026uuml;eler, H. Recombinant AAV vectors containing the foot and mouth disease virus 2A sequence confer efficient bicistronic gene expression in cultured cells and rat substantia nigra neurons. \u003cem\u003eGene Ther\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 864\u0026ndash;873 (2001).\u003c/li\u003e\n\u003cli\u003eChng, J. \u003cem\u003eet al.\u003c/em\u003e Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells. \u003cem\u003eMAbs\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 403\u0026ndash;412 (2015).\u003c/li\u003e\n\u003cli\u003eLiu, Z. \u003cem\u003eet al.\u003c/em\u003e Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 2193 (2017).\u003c/li\u003e\n\u003cli\u003eHolash, J. \u003cem\u003eet al.\u003c/em\u003e VEGF-Trap: A VEGF blocker with potent antitumor effects. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 11393\u0026ndash;11398 (2002).\u003c/li\u003e\n\u003cli\u003eSingh, R. P. \u003cem\u003eet al.\u003c/em\u003e A single-arm, investigator-initiated study of the efficacy, safety and tolerability of intravitreal aflibercept injection in subjects with exudative age-related macular degeneration, previously treated with ranibizumab or bevacizumab: 6-month interim analysis. \u003cem\u003eBritish Journal of Ophthalmology\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, i22\u0026ndash;i27 (2014).\u003c/li\u003e\n\u003cli\u003eMannes, M., Dopler, A., Huber-Lang, M. \u0026amp; Schmidt, C. Q. Tuning the Functionality by Splicing: Factor H and Its Alternative Splice Variant FHL-1 Share a Gene but Not All Functions. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eBorras, C. \u003cem\u003eet al.\u003c/em\u003e Mechanisms of FH Protection Against Neovascular AMD. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eClark, S. J. \u003cem\u003eet al.\u003c/em\u003e Identification of Factor H\u0026ndash;like Protein 1 as the Predominant Complement Regulator in Bruch\u0026rsquo;s Membrane: Implications for Age-Related Macular Degeneration. \u003cem\u003eThe Journal of Immunology\u003c/em\u003e \u003cstrong\u003e193\u003c/strong\u003e, 4962\u0026ndash;4970 (2014).\u003c/li\u003e\n\u003cli\u003eRanaghan, M. J., Li, J. J., Laprise, D. M. \u0026amp; Garvie, C. W. Assessing optimal: inequalities in codon optimization algorithms. \u003cem\u003eBMC Biol\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 36 (2021).\u003c/li\u003e\n\u003cli\u003eMoradian, H., Gossen, M. \u0026amp; Lendlein, A. Co-delivery of genes can be confounded by bicistronic vector design. \u003cem\u003eMRS Commun\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 145\u0026ndash;153 (2022).\u003c/li\u003e\n\u003cli\u003eAskou, A. L. \u003cem\u003eet al.\u003c/em\u003e Suppression of Choroidal Neovascularization by AAV-Based Dual-Acting Antiangiogenic Gene Therapy. \u003cem\u003eMol Ther Nucleic Acids\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 38\u0026ndash;50 (2019).\u003c/li\u003e\n\u003cli\u003eTripepi, D. \u003cem\u003eet al.\u003c/em\u003e The Role of Subretinal Injection in Ophthalmic Surgery: Therapeutic Agent Delivery and Other Indications. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 10535 (2023).\u003c/li\u003e\n\u003cli\u003eDalkara, D. \u003cem\u003eet al.\u003c/em\u003e In Vivo\u0026ndash;Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous. \u003cem\u003eSci Transl Med\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, (2013).\u003c/li\u003e\n\u003cli\u003ePavlou, M. \u003cem\u003eet al.\u003c/em\u003e Novel AAV capsids for intravitreal gene therapy of photoreceptor disorders. \u003cem\u003eEMBO Mol Med\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eSinger, M. A. \u003cem\u003eet al.\u003c/em\u003e HORIZON: An Open-Label Extension Trial of Ranibizumab for Choroidal Neovascularization Secondary to Age-Related Macular Degeneration. \u003cem\u003eOphthalmology\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, 1175\u0026ndash;1183 (2012).\u003c/li\u003e\n\u003cli\u003eSeitz, I. P. \u003cem\u003eet al.\u003c/em\u003e Superior Retinal Gene Transfer and Biodistribution Profile of Subretinal Versus Intravitreal Delivery of AAV8 in Nonhuman Primates. \u003cem\u003eInvestigative Opthalmology \u0026amp; Visual Science\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 5792 (2017).\u003c/li\u003e\n\u003cli\u003eKotterman, M. A. \u003cem\u003eet al.\u003c/em\u003e Antibody neutralization poses a barrier to intravitreal adeno-associated viral vector gene delivery to non-human primates. \u003cem\u003eGene Ther\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 116\u0026ndash;126 (2015).\u003c/li\u003e\n\u003cli\u003eYiu, G. \u003cem\u003eet al.\u003c/em\u003e Suprachoroidal and Subretinal Injections of AAV Using Transscleral Microneedles for Retinal Gene Delivery in Nonhuman Primates. \u003cem\u003eMol Ther Methods Clin Dev\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 179\u0026ndash;191 (2020).\u003c/li\u003e\n\u003cli\u003eBooij, J. C. \u003cem\u003eet al.\u003c/em\u003e A New Strategy to Identify and Annotate Human RPE-Specific Gene Expression. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, e9341 (2010).\u003c/li\u003e\n\u003cli\u003eDreismann, A. K. \u003cem\u003eet al.\u003c/em\u003e Functional expression of complement factor I following AAV-mediated gene delivery in the retina of mice and human cells. \u003cem\u003eGene Ther\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 265\u0026ndash;276 (2021).\u003c/li\u003e\n\u003cli\u003ePatr\u0026iacute;cio, M. I., Barnard, A. R., Orlans, H. O., McClements, M. E. \u0026amp; MacLaren, R. E. Inclusion of the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances AAV2-Driven Transduction of Mouse and Human Retina. \u003cem\u003eMol Ther Nucleic Acids\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 198\u0026ndash;208 (2017).\u003c/li\u003e\n\u003cli\u003eZufferey, R., Donello, J. E., Trono, D. \u0026amp; Hope, T. J. Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors. \u003cem\u003eJ Virol\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 2886\u0026ndash;2892 (1999).\u003c/li\u003e\n\u003cli\u003eMinskaia, E., Nicholson, J. \u0026amp; Ryan, M. D. Optimisation of the foot-and-mouth disease virus 2A co-expression system for biomedical applications. \u003cem\u003eBMC Biotechnol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 67 (2013).\u003c/li\u003e\n\u003cli\u003eChoi, J.-H. \u003cem\u003eet al.\u003c/em\u003e Optimization of AAV expression cassettes to improve packaging capacity and transgene expression in neurons. \u003cem\u003eMol Brain\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 17 (2014).\u003c/li\u003e\n\u003cli\u003eLogan, G. J. \u003cem\u003eet al.\u003c/em\u003e Identification of liver-specific enhancer\u0026ndash;promoter activity in the 3\u0026prime; untranslated region of the wild-type AAV2 genome. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 1267\u0026ndash;1273 (2017).\u003c/li\u003e\n\u003cli\u003eSchindelin, J. \u003cem\u003eet al.\u003c/em\u003e Fiji: an open-source platform for biological-image analysis. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 676\u0026ndash;682 (2012).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Gene therapy, age-related macular degeneration (AMD), adeno-associated virus (AAV), anti-vascular endothelial growth factor (anti-VEGF), Factor H-like protein 1 (FHL-1), bicistronic vector","lastPublishedDoi":"10.21203/rs.3.rs-4636180/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4636180/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAge-related macular degeneration (AMD) continues to be a leading cause of severe vision impairment affecting millions worldwide. The late stages of AMD are characterized by outer retinal atrophy (geographic atrophy, GA), or neovascularization associated with subretinal and/or intraretinal exudation (exudative neovascular or \u0026lsquo;wet\u0026rsquo; AMD). Intravitreal (IVT) administration of anti-vascular endothelial growth factor (VEGF) therapies has dramatically improved vision preservation for wet AMD (wAMD) patients. However, current Standard of Care (SoC) has significant shortcomings and the benefits of anti-VEGF therapy in the real-world setting fall short of the vision gains observed in randomized clinical trials. This is thought to be attributable to drug burden to patients, lack of therapeutic durability due to progression of underlying macular atrophy and refractility to treatment. Vectorized anti-VEGF therapy has been shown to be effective in reducing drug burden clinically but is unlikely to address the progression of the underlying GA driven by complement-mediated inflammation. Here, we aim to address this unmet need by developing a bicistronic gene therapy vector co-expressing aflibercept and Factor H-like protein 1 (FHL-1) to target the pro-angiogenic and pro-inflammatory environment of wAMD. \u003cem\u003eIn vitro\u003c/em\u003e assays confirmed the anti-angiogenic and complement inhibitory properties of the bicistronic vector. Recombinant AAV8 (rAAV8)-mediated co-expression was detected for up to 4 weeks following subretinal delivery in wild type (WT) mice. In a mouse laser-induced choroidal neovascularization (CNV) model, subretinal delivery of bicistronic vectors significantly reduced both CNV leakage and lesion. These results demonstrate that a single subretinal administration of bicistronic vector may provide an effective treatment option for wAMD and may also prolong patient\u0026rsquo;s visual outcomes by preventing the underlying progression of GA.\u003c/p\u003e","manuscriptTitle":"Preclinical development of a dual targeting bicistronic gene therapy approach for the treatment of wet age-related macular degeneration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 21:05:06","doi":"10.21203/rs.3.rs-4636180/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7b3c1771-d696-40ac-aa19-549548fd506e","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-20T08:38:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-22 21:05:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4636180","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4636180","identity":"rs-4636180","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0