Full text
22,135 characters
· extracted from
preprint-html
· click to expand
Molecular identification of Ageratum conyzoides Linn (asteracea) leaf using DNA barcoding technique | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Molecular identification of Ageratum conyzoides Linn (asteracea) leaf using DNA barcoding technique View ORCID Profile Jacinta Enoh Apitikori-Owumi , View ORCID Profile Othuke Bensandy Odeghe , Marvellous Agbabune , View ORCID Profile Mubo Adeola Sonibare , View ORCID Profile Sayed Mohammed Firdous doi: https://doi.org/10.1101/2025.10.08.681161 Jacinta Enoh Apitikori-Owumi 1,3 Department of Pharmacognosy and Traditional Medicine, Faculty of Pharmacy, Delta State University , Abraka, Nigeria Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jacinta Enoh Apitikori-Owumi For correspondence: jeowumi{at}delsu.edu.ng Othuke Bensandy Odeghe 2 Dpartment of Medical Biochemistry, Faculty of Basic Medical Sciences, Delta State University , Abraka, Nigeria Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Othuke Bensandy Odeghe Marvellous Agbabune 1,3 Department of Pharmacognosy and Traditional Medicine, Faculty of Pharmacy, Delta State University , Abraka, Nigeria Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mubo Adeola Sonibare 4 Department of Pharmacognosy and Herbal Medicine, Faculty of Pharmacy, University of Ibadan , Oyo State Nigeria Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mubo Adeola Sonibare Sayed Mohammed Firdous 5 Department of Pharmacology, Calcutta Institute of Pharmaceutical Technology & AHS , Uluberia, Howrah, Calcutta, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sayed Mohammed Firdous Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Background and Aims Reliable and accurate identification of medicinal plants is very pivotal for their safe use and handling in new drug development. This study is aimed at identifying the leaf of A . conyzoides Linn plant by using popular DNA barcode technique. Methods Genomic DNA was isolated from the plant sample followed its amplification through polymerase chain reaction convectional method. DNA barcoding specifically, Mat-K was used to identify and classify the plant sample. Consequently, plant sample was purified and sequenced. An evolutionary tree was constructed to assess A. conyzoides common ancestry. Results The plant sample showed a high degree of homology with known sequences in NCBI database after blasting analysis. Conclusions The findings indicated that DNA barcoding is a reliable and effective for medicinal plant identification and Maturase K (mat-K gene) is a reliable option for this application. INTRODUCTION In the past few years, with the increase awareness in public health, herbal dietary supplement have gained growing acceptance among individuals owing to their therapeutic qualities. Researches showed that the global yearly sales of these herbal dietary supplements were forecast to increase and exceed US$140 billion as recorded in 2024. Nevertheless, the intricacy of species of plants and their financial values have led to unintentional and intentional adulteration of medicinal plants. It is noteworthy to say that herbal dietary supplements are governor by food law in USA and Europe while in some counties like Nigeria, they are taken as drugs ( Li et al. 2024 ). Accurate species identification of the medicinal plants is a major aspect of quality control but accurate identification is dependent on morphological features such as shape, color, taste, texture, and scent, and accurate identification relies on the skills of the expert. It is important to note that morphological features are influenced by environmental and genetic factors, and therefore, expert identification of medicinal plants is subject to error ( Hyder et al. 2024 ) Several studies have shown that using only morphological characters for identification of plants results in errors. Therefore, the use of DNA-based technique would provide a definitive authentication to distinguish plant species. This new trend to rapidly identify and assess organisms, including plants, animals, and microorganisms, is based on the sequence of the DNA extracted from a tiny sample of the individual organism. It can also detect any new species that may be present, and is a potential tool for solving the error common to species identification, since this method often integrates similarity-based DNA barcoding and morphology to address taxonomic problems and any stage of plant growth can be used ( Alade et al. 2023 ). Ageratum conyzoides is a tropical species of plant in the family Asteraceae, commonly called goat weed, that originated in Central and South America and has spread to other tropical and subtropical areas, especially in Africa, Asia, and South America, growing in a variety of habitats, including grasslands, disturbed areas, roadsides, and agricultural fields ( Joseph et al. 2024 ). Ageratum conyzoides has traditionally been used for medicinal purposes and incorporated into the traditional medicine of diverse cultures; indigenous peoples from the native range of the plant have used the leaves, stems, and roots in fresh form or as a dried powder for a variety of health conditions, including wounds, fever, inflammation, respiratory infections, gastrointestinal disorders, and reproductive issues. Ageratum conyzoides is valued for its analgesic, anti-inflammatory, antimicrobial, antidiarrheal, and antipyretic effects and has been used as a decoction, infusion, poultice, or topical application by traditional healers and herbalists ( Joseph et al . 2024 ). MATERIAL AND METHOD Plant collection and identification Fresh plant sample of Ageratum conyzoides Linn was collected from the surrounding of Pharmacy, Delta State, Nigeria. Plant sample was identified and authenticate in the herbarium of the Department of Plant Biotechnology, University of Benin. A voucher specimen with a voucher number: UBH-A344 for Ageratum conyzoides Linn was deposited at the herbarium. Molecular identification of plant sample Extraction of DNA of plant samples were done using a ZR Plant/seed Quick-DNA mini prep extraction kit supplied by Inqaba, South Africa. The process involved homogenizing 150 mg of respective plant samples. This was quickly followed by series of centrifugation of homogenized samples and various transfer steps were conducted out to purify the DNA. The isolated DNA was quantified using the Nanodrop 1000 spectrophotometer. SHV genes obtained from the isolates were amplified using the MATK-1RKIM-F: 5’ A CCCAGTCCATCTGGAAATCTTGGTT C-3’ and MATK-3FKIM-R: 5’-CGTACAGTACTTTTGTGTTTACGAG-3’ primers on an ABI 9700 Applied Biosystems thermal cycler at a final volume of 30 microliters for 35 cycles. The products were analyzed using 1% agarose gel electrophoresis at 200V for 15 minutes and visualized on a blue light imaging system for 900 bp product (Heckenhauer, 2016). Sequencing was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. The sequencing was done at a final volume of 10ul, the components included 0.25 ul BigDye terminator v1.1/v3.1, 2.25ul of 5 x BigDye sequencing buffer, 10uM Primer PCR primer, and 2-10ng PCR template per 100bp. The sequencing conditions were as follows 32 cycles of 96°C for 10s, 55°C for 5s and 60°C for 4min ( Diep, 2019 ). Phylogenetic analysis of the sequences was carried out using bioinformatics algorithm Trace edit, hit sequences downloaded from NCBI database using BLASTIN. Alignment of the sequence was done using ClustaIX. MEGA 6.0 was used for construction tree based on evolutionary history through Neigbor-Joining Method. The bootstrap consensus tree inferred from 500 replicates ( Felsenstein, 1985 ) is taken to represent the evolutionary history of the taxa analysed. The evolutionary distances were computed using the Jukes-Cantor method ( Jukes and Cantor, 1969 ). RESULTS Plants description A description of Ageratum conyzoides plant used for molecular identification is shown in the table below. View this table: View inline View popup Download powerpoint Table 1. Ageratum conyzoides plant for isolation of DNA Agarose gel electrophoresis of MAT-k gene of A. conyzoides and P. clematidea The purity of extracted DNA from A. conyzoides Figure 3) were determined by 1 % agarose gel electrophoresis. The sample showed a single band of three lanes, P, 1 and 2. 900 bp and 100 bp. Lanes 1-2 represent MAT-K gene bands (900 bp). Lane P represents the 100 bp Molecular ladder. Phylogenetic analysis of Ageratum conyzoides and P. clematidea plants samples The obtained Mat-K sequence from the plants produced an exact match during the megablast search for highly similar sequences from the NCBI non-redundant nucleotide (nr/nt) database. The MatK of the plants showed a percentage similarity to other species at 100%. The evolutionary distances computed using the Jukes-Cantor method were in agreement with the phylogenetic placement of the MatK of the plants within the Ageratum sp revealed a closely relatedness to Ageratum conyzoides ( Figure 2 ). 4.0 DISCUSSION Accurate identification of medicinal plant species is a fundamental requirement for monitoring and conserving large-scale biodiversity. DNA barcoding is a rapid sequencing approach for identify a species that compares the sequence of an unknown specimen against barcodes in a reference database of known species based on similarity. Nowadays, four standard barcode regions (Mat-K, ITS, rbc and tmH-psbA) are routinely used for plant species identification through the DNA barcoding method. The Mat-K region is an effective and reliable DNA barcoding for identifying medicinal plants of varied geographical origins. This study is aimed at identifying A . conyzoides plant using popular DNA barcode technique. The 900 bp bands observed for the DNA extracted from both plants suggested that the polymerase chain reaction (PCR) was successful in amplifiying of the Mat-K gene, the targeted gene, consequently shows uncontaminated DNA ( Alade et al ., 2023 ). The size of the band (900 bp) corresponds to the expected size of the target gene suggesting specificity in the PCR reaction. The small size of the brand (100 bp) might indicate the amplification of a short fragment or specific region within the gene as a result of contamination of the chloroplast DNA or degraded DNA. The sequences obtained by direct sequencing of the PCR product was of high quality, with simple-to-score evenly spaced peaks in the sequence traces. MatK may be a starting point for quality control and assurance of plant materials used in research, manufacturing, customs, and forensics ( Abdelsalam et al. 2022 ). The Maturase K (matK) gene of plant chloroplast is a strong marker in studying plant molecular systematics, evolution, and genetic polymorphism and is considered as the standard DNA barcode for plants. The gene has an important role in the phylogenetic reconstruction of terrestrial plant (Rani, 2023). The Maturase K (mat-k) gene has recently become popular in plant molecular systematics and evolution because of the genes rapid evolution at nucleotide and corresponding amino acid levels ( Barthet et al. 2020 ). The degree to which a plant species resembles one that has already been identified in the database is known as maximum identity. Accuracy of identification is defined as a maximum similarity of at least 95 percent ( Alade et al ., 2023 ). One hundred percent (100%) maximum identity was found for A. Conyzoides ( Figure 1 ) following the blasting the samples against NCBI database. The 100% identity of A. conyzoides match suggests that the query sequence is from same species as the target (subject) sequence which can be useful for identifying plant species. High percentage identity matches can indicate conserved species which can provide insights into the revolutionary relationships between organisms. Furthermore, the high identity matches can be useful in various applications such as phylogenetic analysis, gene cloning or diagnostic testing. The research on medicinal plants genomes has improved rapidly through DNA barcoding and high-throughput sequencing and their contributions to enhancing the accuracy and reliability of plant identification and limitation by their huge genome size and high repetitive sequence has been overcome ( Cheng et al ., 2021 , Wang et al ., 2024 ). Indisputably, genomic regions differ significantly in their potential phylogenetic explanatoriness and their inputs in solving a taxonomic group over a designated period ( Udensi et al ., 2017 ) Download figure Open in new tab Figure 1. Agarose gel electrophoresis of MAT-k gene of Ageratum conyzoides . Lanes 1-2 represent MAT-K gene bands (900 bp). Lane P represents the 100 bp Molecular ladder. Download figure Open in new tab Figure 2. Phylogenetic tree of Ageratum conyzoides CONCLUSION The results from this study successfully showed that DNA barcoding is a robust technique and reliable application for identifying local medicinal plant. Likewise, A. conyzoides identification in this study will be helpful in the development of new experiments with other medicinal plants in Delta State. Informed Consent Informed consent was obtained from authors Authors’ contributions A.J.E, M.A.S, O.B.O, M.A: Concept/Design, A.J.E: Drafting Manuscript: A,J.E/S.M.F: Results Interpretation Financial disclosure The author declared no financial support References ↵ Abdelsalam NR , Hasan ME , Javed T , Rabie SMA , El-Wakeel HEMF , Zaitoun AF , Abdelsalam AZ , Aly HM , Ghareeb RY , Hemeida AA , Shah AN ( 2022 ). Endorsement and phylogenetic analysis of some Fabaceae plants based on DNA barcoding . Mol Biol Rep 49 ( 6 ): 5645 – 5657 OpenUrl PubMed ↵ Alade GO , Iyede N. Okpoji KA , Ajibesin KK ( 2023 ). Molecular Identification of Phyllanthus amarus Schumach. & Thonn. Phyllanthaceae . Glob J Pharmaceu Sci 10 ( 4 ): 555793 OpenUrl ↵ Barthet MM , Pierpont CL , Tavernier EK ( 2020 ). Unraveling the role of the enigmatic MatK maturase in chloroplast group IIA intron excision . Plant Direct 4 ( 3 ): e00208 . OpenUrl ↵ Cheng Q , Ouyang Y , Tang ZY , Lao CC , Zhang YY , Cheng CS , Zhou H ( 2021 ). Review on the development and applications of medicinal plant genomes . Front. Plant Sci 12 : 791219 OpenUrl CrossRef PubMed ↵ Diep RG . ( 2019 ). Dye-terminator DNA sequencing protocols doi: 10.17504/protocols.io.baq7idzn . Date visited: 30-10-2025 . OpenUrl CrossRef ↵ Felsenstein J ( 1985 ). Confidence limits on phylogenies: An approach using the bootstrap . Evolution 39 : 783 – 791 OpenUrl CrossRef GeoRef PubMed Web of Science Heckenhauer J , Barfuss MH , Samuel R ( 2016 ). Universal multiplexable matK primers for DNA barcoding of angiosperms . Appl Plant Sci 8; 4 ( 6 ):apps.1500137. ↵ Hyder Z , Rizwani GH , Shareef , H , Azhar I , Zehra M ( 2024 ). Authentication of important medicinal herbal species through DNA-based molecular characterization . Saudi J Biol Sci 5; 31 ( 6 ): 103985 OpenUrl PubMed ↵ Joseph DA , Oseni MO , Oseni OA ( 2024 ). Biochemical investigations and green synthesis characterization using aqueous extract of Ageratum conyzoides L. leaf . Journal of Biochemicals and Phytomedicine 3 ( 2 ): 9 – 19 OpenUrl ↵ Munro HN Jukes TH , Cantor R. ( 1969 ). Evolution of protein molecules . In Munro HN , editor, Mammalian Protein Metabolism , pp. 21 – 132 , Academic Press , New York . ↵ Li H , Cui H , Chen H , Li H , Xie Y , Song W , Rong Chen R ( 2024 ). Rapid colorimetric and fluorescence identification of Pinelliae Rhizoma and adulterate Rhizoma Typhonii Flagelliformis using direct-LAMP assay . Food Chemistry 437 : 1 OpenUrl Rani J , Nandagopalan V ( 2023 ). Molecular characterization of maturase K gene and protein prediction of Vanda spathulata (L.). An Ayur informatics Approaches . Int. J. Pharm. Sci. Drug Res 15 ( 3 ): 382 – 393 OpenUrl ↵ Udensi OU , Ita EE , Ikpeme EV , Ubi G Emeagi LI ( 2017 ). Sequence analysis of maturase K (Matk): a chloroplast-encoding gene in some selected pulses . Global Journal of Pure and Applied Sciences 23 : 213 – 230 OpenUrl ↵ Wang M , Lin H , Lin H , Du P , Zhang S ( 2024 ). From species to varieties: How modern sequencing technologies are shaping medicinal plant identification . Genes (Basel) 26; 16 ( 1 ): 16 OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted October 10, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Molecular identification of Ageratum conyzoides Linn (asteracea) leaf using DNA barcoding technique Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Molecular identification of Ageratum conyzoides Linn (asteracea) leaf using DNA barcoding technique Jacinta Enoh Apitikori-Owumi , Othuke Bensandy Odeghe , Marvellous Agbabune , Mubo Adeola Sonibare , Sayed Mohammed Firdous bioRxiv 2025.10.08.681161; doi: https://doi.org/10.1101/2025.10.08.681161 Share This Article: Copy Citation Tools Molecular identification of Ageratum conyzoides Linn (asteracea) leaf using DNA barcoding technique Jacinta Enoh Apitikori-Owumi , Othuke Bensandy Odeghe , Marvellous Agbabune , Mubo Adeola Sonibare , Sayed Mohammed Firdous bioRxiv 2025.10.08.681161; doi: https://doi.org/10.1101/2025.10.08.681161 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genomics Subject Areas All Articles Animal Behavior and Cognition (7637) Biochemistry (17705) Bioengineering (13899) Bioinformatics (41970) Biophysics (21463) Cancer Biology (18605) Cell Biology (25526) Clinical Trials (138) Developmental Biology (13385) Ecology (19911) Epidemiology (2067) Evolutionary Biology (24329) Genetics (15615) Genomics (22514) Immunology (17743) Microbiology (40424) Molecular Biology (17194) Neuroscience (88650) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4827) Physiology (7648) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.