Mucopolysaccharidosis type II in Tunisian families: IDS gene Variations Disrupting Substrate Binding and A Novel deep Intronic Deletion Reducing IDS expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mucopolysaccharidosis type II in Tunisian families: IDS gene Variations Disrupting Substrate Binding and A Novel deep Intronic Deletion Reducing IDS expression Roua Ltaifa, Chayma Jellali, Chayma Sahli, Hajer Foddha, hela Boudabous, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8540917/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 11 You are reading this latest preprint version Abstract Abstract: Hunter syndrome is an X linked recessive lysosomal storage disease. This syndrome is caused by the deficiency of iduronate-2-sulfatase enzyme (IDS, EC3.1.6.13) that is involved in the degradation of macromolecules glycosaminoglycans, dermatan sulfate and heparan sulfate. Materials and Methods: This study involved three MPS II patients (WB, HMR, and BN) from three unrelated families (F1, F2, and F3) originating respectively from Kef, Ksar Saïd, and Tbolba. Genetic alterations were identified using DNA sequencing. To characterize the functional impact of a large intronic deletion and to assess the expression level of the IDS gene, the total mRNA was extracted from peripheral blood. Bioinformatics tools, including the SWISS-MODEL server and DynaMut, were used for structural modeling and to predict the impact of the mutations on protein stability and mechanism catalytic. Results: Two missense mutations, p.R88P and p.H138Y in the IDS gene were identified. A novel large intronic deletion in intron 3 was discovered in patient with severe MPS II phenotypes, while a previously reported missense mutation p.R88P and p.H138Y was found in two patients with mild phenotypes. Moreover, we identified a large number of single nucleotides sequences’ variants in hemizygous status. The real- time PCR expression analysis demonstrated a marked reduction in IDS mRNA levels, suggesting a deleterious effect of the large intronic deletion on transcript stability and IDS gene expression level. Structural analysis revealed that the two missense mutations cause structural deformation of IDS protein, and disrupts the protein’s substrate-binding site resulting in a complete loss of enzymatic activity. Conclusion: This study reports a novel deep intronic deletion in the IDS gene in Tunisian MPS II patients, alongside the previously described mutations. The findings enhance understanding of the molecular basis of MPS II. Hunter syndrome IDS deep intronic deletion bioinformatics analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Mucopolysaccharidosis type II or Hunter syndrome is an X linked recessive lysosomal storage disease. This syndrome is caused by the deficiency of the acid hydrolase enzyme iduronate-2-sulfatase (IDS, EC3.1.6.13) which is involved in the degradation of macromolecules glycosaminoglycans (GAGs), dermatan sulfate (DS) and heparan sulfate (HS). MPS II disease regroups two clinical forms including the severe and mild forms. The severe form is characterized by the early onset of symptoms at the age of 2 to 4 years, with skeletal deformities, hepatosplenomegaly, cardiomyopathy in most MPS II patients. The neurological decline and severe cognitive impairment appear in childhood. The mild form is characterized by milder somatic symptoms with minimal neurological involvement, and survive into adulthood. The diagnosis procedures of the Hunter syndrome include the following steps: quantitative and qualitative analysis of urinary GAGs, iduronate-2 sulfate sulfatase (IDS) enzymatic activity assay and molecular analysis [ 1 ] The IDS gene is located on the X q 28 chromosome and consists of 9 exons encoding a 550 amino acid IDS protein. Currently, more than 800 mutations are reported on the Human Gene Mutation Database (HGMD). Among them, 323 are missense or nonsense, 59 splicing substitutions, 119 small deletions, 49 small insertions/duplications, 14 small indels, 52 gross deletions, 4 gross insertions/duplications, and 20 complex rearrangements. The allelic heterogeneity correlates with the phenotypic heterogeneity observed in MPS II patients [ 2 ] . The treatment of MPS II includes enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) [ 3 ]. However, these strategies are not available in Tunisia due to financial constraints, and patients are generally hospitalized because of their umbilical hernias and bronchopulmonary problems. Nevertheless, genetic diagnosis plays a crucial role in the management of this disease. It not only provides a reliable diagnosis but also ensures genetic counseling for at-risk families. This genetic diagnosis makes it possible to assess the risk of hereditary transmission and consider prenatal screening options. This study emphasizes the crucial role of genetic analysis of IDS gene in patients within MPS II to identify the genetic variations and to functionally characterize large intronic deletion in order to clarify their contribution to disease pathogenesis. Materials And Methods Clinical Diagnosis This study involved three MPS II patients (WB, HMR, and BN) from three unrelated families (F1, F2, and F3) originating respectively from Kef, Ksar Saïd, and Tbolba. These patients were diagnosed in the pediatric department of La Rabta Hospital, Tunisia. Each case was classified as type I or II of MPS. All investigated patients were offspring of non-consanguineous marriages (Fig.1). This study was approved by the Ethics Committee of the La Rabta Hospital in Tunisia since 2018, and the families provided informed consent prior to collecting blood samples. All procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000 and approved by the Ethics Committees of the respective Tunisian hospitals. The studied patients were evaluated through a series of assessments, including detailed medical history, physical examination, routine biochemical tests and measurement of leukocyte IDS activity. Subsequently, genetic testing was conducted to explore potential pathogenic mutations associated with MPS. Family histories and main clinical data are reported in Table 1 . Family 1/Patient WB The patient, WB, aged 7, from Kef of Tunisia, is being treated as an outpatient for mucopolysaccharidosis type II (MPS II). In 2020, the patient WB presented bilateral inguinal hernias and bronchial congestion associated with chronic rhinorrhea. Initially, patient WB was treated in the private sector, then transferred to the pediatric department of La Rabta Hospital, where MPS II was diagnosed. The patient's clinical picture includes macroglossia, splenomegaly, dorsal kyphosis, extensive Mongolian spots, umbilical hernia, and speech delay. The clinical features of this patient are available in Table 1 . In 2023, the diagnosis of the MPS type was confirmed by measuring the enzymatic activity of iduronate-2-sulfatase in leukocytes of patient WB. The leukocyte IDS activity is presented in Table 1. In 2024, patient WB was admitted to the cardio surgery department where he underwent ventriculoperitoneal shunting. Currently, the patient WB is treated with Elaprase. Family 2 / Patient HR Patient HR, aged 10 years and 3 months, from Ksar Saïd of Tunisia. In 2023 the patient HR was suspected of mucopolysaccharidosis (MPS), in particular type II. This suspicion was based on the presence of characteristic facial dysmorphia, associated with behavioral disorders (agitation, hyperactivity, bulimia), psychomotor retardation, and recurrent otolaryngological (ENT) infections. In 2024, the patient HR presented an improvement in school integration revealed by a better intellectual capacity. During the psychological assessment, patient HR was capable of learning, although specific support remains necessary. At the end of 2024, the diagnosis of MPS type II was confirmed by measuring enzyme activity using the fluorometric method. The leukocyte IDS activity is presented in Table 1. Family 3/ patient BN Patient BN from family (F3), aged 12 years from Tbolba (Monastir). This patient BN had coarse features with a thick tongue and moderate facial dysmorphia. The leukocyte IDS activity and the main clinical signs of this patient are illustrated in Table 1. Molecular Diagnosis The two biochemical and molecular tests were carried out according to the previously reported procedure [4]. Mutational analysis Peripheral blood was obtained from patients and genomic DNA was isolated using a standard salting-out procedure [5]. For identification of genetics variations, we sequenced the entire of IDS gene (NC_000023.11) as described previously [1]. Expression Analysis of IDS gene RNA Extraction Total RNA was extracted from peripheral blood leukocytes using TRIzol™ reagent. After phase separation with chloroform, RNA was precipitated with isopropanol, washed with 75% ethanol, air-dried briefly, and resuspended in RNase-free water. RNA quality and purity were assessed before downstream applications. First-strand cDNA synthesis was performed using total RNA as a template. The initial reaction mixture contained 11 µL of total RNA (495 ng), 1 µL of oligo(dT) primer (25 nmol), and 1 µL of dNTPs (10 mM), in a final volume of 13 µL. The mixture was incubated at 65 °C for 5 minutes to denature RNA secondary structures and facilitate oligo(dT) primer annealing. The tube was then immediately placed on ice to stabilize the formed hybrids prior to the addition of the enzymatic mix. The reverse transcription reaction was initiated by adding 4 µL of 5× reaction buffer, 2 µL of DTT (0.1 M), and 1 µL of MMLV reverse transcriptase, bringing the final reaction volume to 20 µL. The reaction was incubated at 42 °C for 60 minutes to allow complete cDNA synthesis, followed by enzyme inactivation at 70 °C for 10 minutes. Reverse transcription 1 µg of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Primer sequences of cDNA amplification are provided in Table 2. Real-time PCR was performed using a three-step thermocycling program. The first step, consisted in an initial denaturation at 95 °C for 10 minutes to ensure complete denaturation of the cDNA template and activation of the Taq DNA polymerase. The second step, corresponding to the cycling stage, comprised 40 successive cycles, each including denaturation at 95 °C for 15 seconds, primer annealing at 57 °C for 30 seconds, and extension at 72 °C for 30 seconds, allowing exponential amplification of the target sequence. The third step, corresponding to the melt curve stage, was performed to assess the specificity of the amplified products and included three successive temperature steps: 95 °C, 60 °C for 1 minute, and 95 °C for 15 seconds, enabling analysis of the double-stranded DNA dissociation profile. At the end of the reaction, cycle threshold (Ct) values were automatically determined by the instrument software. These values represent the cycle at which fluorescence exceeds the detection threshold and reflect the initial amount of cDNA. Melt curves were also analyzed to confirm the specificity of amplification and the absence of nonspecific products or primer-dimer formation. Quantitative Real-Time PCR IDS expression was quantified by SYBR Green–based RT-qPCR. Primers targeted exons unaffected by the intronic deletion in patient BN. Beta-actin was used as the endogenous control. Reactions were performed in triplicate, and relative expression levels were calculated using the 2^-ΔΔCt method, comparing patient BN with a healthy control. Pathogenicity Prediction and IDS Structural Modeling In the first time, missense variants were evaluated using the online prediction program PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2), and classified as benign, possibly damaging, or probably damaging based on structural and evolutionary criteria. Then the IDS 3D structure (PDB ID: 5FQL) was analyzed with PyMOL. Wild-type and mutant residues localized into a 3D model using Deep View Swiss-Pdb Viewer 4.1 and POV-Ray 3.6 software and compared to assess effects on hydrogen bonding, domain organization, and active site proximity, providing insights into potential structural destabilization. Results Clinical features and IDS activity The clinical characteristics of each patient, their leukocyte IDS activities, and identified genotypes are summarized in Table 1. IDS mutations analysis Complete sequencing of the entire IDS gene was performed for the three unrelated patients suspected of MPS II. We identified three mutations: two missense mutations p.H138Y and p.R88P (Fig.2) and one novel deep intronic deletion which is absent in over 50 unrelated individuals. Additionally, a large number of polymorphisms were identified. The first mutation, NM_000202.8(IDS): c.412C>T (p.His138Tyr) in exon 3, was previously reported in the literature and was detected in patients HR in hemizygous state and associated with a severe form of MPS II. This mutation involves a substitution at codon 138, resulting in a histidine-to-thyrosine change (p.His138Tyr). The second mutation, NM_000202.8(IDS): c.263G>T (p.Arg88Leu) in exon 3, was also previously reported and was identified in patient WB in hemizygous state and associated with a severe form of MPS II. This mutation is due to a substitution at codon 88, resulting in an arginine to leucine change (p.Arg88Leu). In patient BN, we sequenced all exons and junction exons/introns of IDS gene. Although no pathogenic exonic mutations were identified, a large number of polymorphisms were detected. Consequently, the intron 3 for IDS gene which considered a variable region, was further analyzed. A deep intronic deletion of intron 3 of IDS gene was identified in patient BN. This unreported mutation was detected in patient BN in hemizygous state and associated in mild form of MPS II. Functional assessment of IDS gene expression was conducted in patient BN using RT-qPCR to evaluate the transcriptional impact of this large intronic deletion. In fact, the RT -qPCR showed a markedly lower initial amount of IDS mRNA in patient BN compared with the control. This decrease was reflected by a significantly higher Ct value of IDS gene in patient (approximately 35.7-36.9). In contrast, the Ct values of the housekeeping gene β -actin ( approximately 22.6–23.3) in both the patient BN and the control confirm the good quality of the extracted RNA and the reliability of the quantitative analysis ( Table 3 ). Furthermore, the analysis of the ∆Ct values (IDS – β-actin) showed significantly higher values in the patient (13.1–14.3) than in the control (5.3–11.3) (Table 4) , suggesting a strong reduction in the relative IDS gene . Since higher ∆Ct values correspond to lower gene expression, sugging a marked downregulation of IDS expression in patient BN . In addition, the analysis of the ∆∆Ct values revealed a marked difference in IDS gene expression between the patient BN and the control subject. Using the 2⁻ ΔΔ Ct method , the calculated relative expression levels of IDS gene were 0.004, 0.123, and 0.055 . The mean of these values estimated ≈ 0.06 , indicates that IDS mRNA expression in the patient BN is approximately 17-fold lower than in the control (1/0.06 ≈ 16.7) ( Fig.3 ). This result confirms a severe downregulation of IDS gene expression in the patient BN. Bioinformatic finding Wild-type IDS- His138 3D structure Crystallographic analysis of the wild-type IDS structure (PDB ID: 5FQL) was performed using PyMOL to evaluate the functional impact of genetic variants. In the native enzyme, His138 occupies a central position within the active site (Fig.4a) , and develops stable hydrogen bonds (~3.0–3.2 Å) with Lys135, Phe137, and the catalytic residue ALS84 (oxidized cysteine, formylglycine) (Fig.4b). The imidazole side chain of His138 facilitates proton transfer, stabilizing the active site geometry and ensuring optimal orientation of residues involved in catalytic mechanism . Mutant IDS-Tyr138 3D Structure The mutant residue Tyr138 is predicted to create a steric clash and alters tremendously the active site of IDS protein. (Fig. 4c). The measured distances to Lys135, Phe137, and ALS84 increased to approximately 6.2 Å, 8.8 Å, and 8.3 Å, respectively, exceeding the typical hydrogen bond range and leading to loss of these stabilizing interactions (Fig.4d). This steric hindrance, combined with disrupted hydrogen bonding, distorts the local geometry of the active site, destabilizing the catalytic network and likely impairing enzyme activity. These structural perturbations provide a mechanistic explanation for the pathogenicity of the p.H138Y mutation. Wild-Type IDS-Arg88 3D Structure The crystallographic structure of iduronate-2-sulfatase, visualized using PyMOL, shows that arginine 88, a positively charged amino acid, forms two types of interactions within the active site (Fig.5a). On one hand, it is predicted to create a hydrogen bond with lysine 135. On another hand, it participates in four salt bridge interactions, combining electrostatic and hydrogen bonds, involving residues Asp334 and Asp45, respectively (Fig.5b). These multiple interactions highlight the essential stabilizing role of Arg88 in the architecture of the catalytic site. Furthermore, residue Arg88 is located at the catalytic core of the protein, within the highly conserved “CXPSR” pattern, common to all sulfatases and indispensable for the formation of the active site. This region is involved in the post-translational conversion of cysteine to formylglycine, a crucial step for the enzymatic activity of iduronate-2-sulfatase. Mutant IDS-Pro88 3D Structure The substitution of arginine 88 with proline results in the complete loss of stabilizing interactions (hydrogen bonds and salt bridges) with the catalytic residues of the active site (Asp45, Lys135, Asp334) (Fig.5c). This loss of hydrogen bonds and salt bridges between position 88 and the catalytic site residues leads to destabilization of the enzymatic core (Fig.5d). The catalytic pattern is predicted to become disorganized, leading to disrupt the orientation of amino acids which is involved in substrate recognition and the desulfation reaction. This structural imbalance may explain the loss of IDS activity observed in patient WB. Discussion This present report is the continuation of several studies performed on Tunisian MPS II patients [1] [6]. The mucopolysaccharidosis type II (OMIM; # 309900, MPS II, Hunter syndrome; 309900) is a rare X-linked recessive lysosomal storage disorder caused by mutations in the IDS (gene EC 3.1.6.13), encoding iduronate-2-sulfatase (IDS), which is essential for degrading glycosaminoglycans (GAGs) such as dermatan sulfate and heparan sulfate [1]. IDS deficiency disrupts cellular metabolism, resulting in hepatosplenomegaly, dysostosis multiplex, cardiac anomalies, and respiratory complications. The clinical spectrum ranges from severe to attenuated forms [7]. The clinical presentation of MPS II is highly variable. In our study, patients WB and HR presented a severe form of the disease, while patient BN exhibited a moderate form. In patient WB, the early-onset symptoms appear at the age of 2 years, including bilateral inguinal hernias and chronic bronchial congestion, consistent with severe MPS II observed in the most MPS II patients [8] [9]. In contrast, patient BN manifested an attenuated phenotype with preserved cognition, milder skeletal and dysmorphic features, and symptom onset at almost 10 years, aligning with prior reports of slowly progressing, late-onset forms [10]. The p.H138Y mutation, identified in patient HR was already described [11]. But the impact of this missense mutation on protein structure has not been studied. These gaps highlight the need for our study. Crystallographic studies showed that the histidine residue is located in the core of IDS site active involved in substrate binding. The thyrosine 138 residue, with bulkier aromatic side chain, likely disrupts the hydrogen bonding and distorts the local geometry of the active site. The disruption is thought to destabilize the catalytic network and to likely impair enzyme activity. Consequently, the undetectable catalytic activity could be associated with the severe phenotype observed in patient HB. Patient WB is hemizygous for missense p.R88P mutation in exon 3 of IDS gene [4]. Crystallographic studies showed that Arg88 within the highly conserved “CXPSR” pattern, which plays a crucial role in post-translational conversion of cysteine to formylglycine and which is essential for enzymatic activity [12]. Substitution of arginine 88 with a proline, results in the complete loss of stabilizing interactions (hydrogen bonds and salt bridges) with the catalytic residues of the active site (Asp45, Lys135, Asp334), thereby, disrupts the catalytic core. This disruption is thought to reduce substrate affinity and impair enzymatic activity and desulfation, explaining the loss of IDS activity. PolyPhen-2 predicted this mutation as highly deleterious, underscoring the genotype-phenotype correlation for catalytic-site variants [13] [2]. Patient BN exhibited a large intronic deletion in intron 3 of IDS gene, associated with significantly reduced mRNA expression (~0.06 relative to control; p = 0.048). Residual transcription likely allows synthesis of partially functional IDS protein, accounting for the moderate phenotype, preserved cognitive abilities, and milder visceral and skeletal involvement. This finding aligns with reports showing that intronic deletions may reduce splicing efficiency or mRNA stability without abolishing gene expression [14] ; [15] ; [16] . These findings raise an important hypothesis: the large intronic deletion identified in patient BN may induce exon 4 skipping which could be potentially affecting residues that are non-essential for IDS catalytic activity or result in partial intron excision. This may explain the mild phenotype of MPS II disease observed in patient BN. Overall, these findings showed strong evidence for a significant decrease in the IDS gene expression in the patient hemizygote for the intronic deletion , which may disrupt normal splicing, lead to mRNA instability, or trigger nonsense-mediated decay (NMD) . Further studies are required to elucidate and clarify the importance of the molecular defect of this deep intronic deletion to better understand the pathophysiology of MPS II. In the present study, based on our results and genetics data from several other studies, the exon 3 of the IDS gene is considered as a hypervariable locus. It is characterized by the presence of numerous genetic variations [17] ,[18]. These variations include point substitutions, insertions, deep deletions, and other alterations that can modify the coding sequence or regulatory regions of the IDS gene. This genetic diversity contributes directly to the phenotypic heterogeneity observed in patients with MPS II, explaining the variability in clinical presentation, which can range from severe to mild forms of the disease similar to those observed respectively in patients HB, WB and BN. The study of this hypervariable exon 3 of IDS gene is therefore crucial for understanding the molecular mechanisms underlying the pathogenesis of MPS II and may also guide the diagnosis and personalized management of patients. Conclusion The present report has provided additional information that the MPS II is a highly heterogeneous genetic disorder leading to the absence of correlation genotype-phenotype in MPSII patients. Further studies including mutational functional test would be essential for the better understanding of the MPSII molecular mechanism. This would help providing the genetic counseling, and prenatal diagnosis to prevent the early death of patients. Declarations Ethics approval and consent to participate The patients gave informed consent before with drawal of blood samples and written informed consent was obtained and signed by all patients, in addition the verbal consent was also obtained during consultation. The study was approved by the ethics committees for scientific research of La Rabta Hospital, Tunis, Tunisia. All procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000 and approved by the Ethics Committees of the respective Tunisian hospitals. Consent to publication: Written informed consent was obtained from the parents or legal guardians of the patients for their participation and publication of this work. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Availability of data and materials: The datasets analyzed during the current study are available in the ensemble database (https://www.ensembl.org/index.html) p.His138Tyr, NM_000202.8(IDS): https://www.ncbi.nlm.nih.gov/clinvar/variation/3255707/ Variation ID: 3255707 Accession: VCV003255707.3 p.Arg88Leu, NM_000202.8(IDS): https://www.ncbi.nlm.nih.gov/clinvar/variation/3255643/ Variation ID: 3255643 Accession: VCV003255643.2 The datasets analysed during the current study are available in the ensemble database (https://www.ensembl.org/index.html) Competing interests: The authors declare that they have no competing interests. Funding: This work was not financially supported. Authors’ Contributions LC, RL, CJ, CS and HF, carried out all the experiments, data analyses, LC and RL: wrote the manuscript. TM, HBA, HB and SF supported the analysis and interpretation of the data. LC: revised the manuscript. All authors participated in the writing of the manuscript and approved the final version. Acknowledgements: We thank all clinicians for their fruitful participation in this work. We also thank all patients with cystinosis for participating in this study. References Chkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9. Zanetti A, D’Avanzo F, Tomanin R. Molecular basis of mucopolysaccharidosis type II (Hunter syndrome): first review and classification of published IDS gene variants. Hum Genomics. 2024;18:134. https://doi.org/10.1186/s40246-024-00701-w. Mao S-J, Chen Q-Q, Dai Y-L, Dong G-P, Zou C-C. The diagnosis and management of mucopolysaccharidosis type II. Ital J Pediatr. 2024;50:207. https://doi.org/10.1186/s13052-024-01769-9. Chkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215. https://doi.org/10.1093/nar/16.3.1215. Chkioua L, Khedhiri S, Ferchichi S, Tcheng R, Chahed H, Froissart R, et al. Molecular analysis of iduronate -2- sulfatase gene in Tunisian patients with mucopolysaccharidosis type II. Diagn Pathol. 2011;6:42. https://doi.org/10.1186/1746-1596-6-42. D’Avanzo F, Rigon L, Zanetti A, Tomanin R. Mucopolysaccharidosis Type II: One Hundred Years of Research, Diagnosis, and Treatment. Int J Mol Sci. 2020;21:1258. https://doi.org/10.3390/ijms21041258. Hashmi MS, Gupta V. Mucopolysaccharidosis Type II. In: StatPearls. Treasure Island (FL): StatPearls Publishing; 2025. Muenzer J, Burton BK, Amartino HM, Harmatz PR, Gutiérrez-Solana LG, Ruiz-Garcia M, et al. Neurodevelopmental status and adaptive behavior of pediatric patients with mucopolysaccharidosis II: a longitudinal observational study. Orphanet J Rare Dis. 2023;18:357. https://doi.org/10.1186/s13023-023-02805-3. Giugliani R. Mucopolysacccharidoses: From understanding to treatment, a century of discoveries. Genet Mol Biol. 2012;35 4 Suppl:924–31. Froissart R, Maire I, Millat G, Cudry S, Birot AM, Bonnet V, et al. Identification of iduronate sulfatase gene alterations in 70 unrelated Hunter patients. Clin Genet. 1998;53:362–8. https://doi.org/10.1111/j.1399-0004.1998.tb02746.x. Villani GR, Daniele A, Balzano N, Di Natale P. Expression of five iduronate-2-sulfatase site-directed mutations. Biochim Biophys Acta. 2000;1501:71–80. https://doi.org/10.1016/s0925-4439(00)00006-5. Chkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9. Wong JH, Shigemizu D, Yoshii Y, Akiyama S, Tanaka A, Nakagawa H, et al. Identification of intermediate-sized deletions and inference of their impact on gene expression in a human population. Genome Med. 2019;11:44. https://doi.org/10.1186/s13073-019-0656-4. Lowther C, Speevak M, Armour CM, Goh ES, Graham GE, Li C, et al. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression. Genet Med Off J Am Coll Med Genet. 2017;19:53–61. https://doi.org/10.1038/gim.2016.54. Yamamoto-Shimojima K, Akagawa H, Yanagi K, Kaname T, Okamoto N, Yamamoto T. Deep intronic deletion in intron 3 of PLP1 is associated with a severe phenotype of Pelizaeus-Merzbacher disease. Hum Genome Var. 2021;8:14. https://doi.org/10.1038/s41439-021-00144-y. Lualdi S, Pittis MG, Regis S, Parini R, Allegri AE, Furlan F, et al. Multiple cryptic splice sites can be activated by IDS point mutations generating misspliced transcripts. J Mol Med Berl Ger. 2006;84:692–700. https://doi.org/10.1007/s00109-006-0057-1. Hisama FM, Lessel D, Leistritz D, Friedrich K, McBride KL, Pastore MT, et al. Coronary artery disease in a Werner syndrome-like form of progeria characterized by low levels of progerin, a splice variant of lamin A. Am J Med Genet A. 2011;155A:3002–6. https://doi.org/10.1002/ajmg.a.34336. Tables Table 1 : Clinical, biological and molecular finding of Tunisian MPS II patients Families F1 F2 F3 Patients WB HR BN Sex M M M Origin Kef (Siliana) Gafsa Tbolba (Monastir) Age (years) 7 10 11 Hepatosplenomegaly +++ +++ +++ Coarse facial features: broad nose, macroglossia, enlarged tongue ++ +++ ++ Psychomotor delay ++ ++ + Multiple dysostosis: joint stiffness, ovoid vertebrae ++ ++ ++ Osteopenia ++ ++ ++ Intellectual disability +++ +++ + Respiratory problems: nasal obstruction, sleep apnea ++ ++ ++ Cardiovascular involvement: arrhythmia, congestive signs ++ ++ ++ Leukocytes IDS activity (nmol/h/mg protein) 0.3 0.2 <0,8(LOD) µmol/L/h Usual values (nmol/h/mg protein) 25-95 25-95 ≥ 5,6 µmol/L/h Under treatment Elaprase None Elaprase Mutations (exon/intron) p.H138Y p.R88P Deep intronic deletion Exon 3 Exon 3 Intron 3 Polymorphisms (exon/intron) rs782594123C>T ; rs1754501C>T rs135828282625C>T ; rs70986A>G rs1734484A>G ; rs781996090C>T Exon 3 rs74318341 (-TAT) ; rs781786692A>G Exon 4 rs1204168804A>C Exon 5 rs1237518698G>T Exon 6 rs1263154314T>A Exon 7 Phenotype Severe Severe Mild Table 2: Primer for cDNA amplification Name Sequence 5’>3’ IDS gene AF: CACAGCCTCCTCTTCCAGAA AR: CAGGTTGGCATGGAGTTCTC Inter: CACGCTGGAAACTTCTCCAC RB: CATCAGGGACCTCGGGATC Reference gene β-actin F :5’TGAGGAGCACCCTGTGCT3’ R: 5’CCAGAGGCATACAGGGAC3’ Table 3: Ct values from blood samples of the patient BN and control measured by RT -qPCR Patient BN Control Gene of Interest ( IDS ) Housekeeping Gene ( β-actin ) Gene of Interest ( IDS ) Housekeeping Gene ( β-actin ) Reaction 1: AF+AR Ct = 35.86 Ct = 22.66 Ct = 28.63 Ct = 23.37 Reaction 2: AF+Internal Ct = 36.96 Ct = 22.66 Ct = 34.63 Ct = 23.37 Reaction 3: AF+RB Ct = 35.77 Ct = 22.66 Ct = 32.31 Ct = 23.37 Table 4: ∆Ct values from patient and control blood samples by RT-qPCR Patient BN Control Reaction 1: AF+AR ∆Ct = 13.2 ∆Ct = 5.26 Reaction 2: AF+Internal ∆Ct = 14.3 ∆Ct =11.28 Reaction 3: AF+RB ∆Ct = 13.1 ∆Ct =8.94 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 06 Feb, 2026 Reviews received at journal 05 Feb, 2026 Reviews received at journal 29 Jan, 2026 Reviewers agreed at journal 20 Jan, 2026 Reviews received at journal 19 Jan, 2026 Reviewers agreed at journal 16 Jan, 2026 Reviewers agreed at journal 16 Jan, 2026 Reviewers invited by journal 14 Jan, 2026 Editor assigned by journal 09 Jan, 2026 Submission checks completed at journal 09 Jan, 2026 First submitted to journal 07 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8540917","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":575776600,"identity":"5eef2e9c-fe65-4d77-a674-db00c02c12f0","order_by":0,"name":"Roua Ltaifa","email":"","orcid":"","institution":"Research Laboratory of Human Genome and Multifactorial Diseases","correspondingAuthor":false,"prefix":"","firstName":"Roua","middleName":"","lastName":"Ltaifa","suffix":""},{"id":575776606,"identity":"77514061-4d3c-4ec3-bd74-7f45d68cf033","order_by":1,"name":"Chayma Jellali","email":"","orcid":"","institution":"Research Laboratory of Human Genome and Multifactorial Diseases","correspondingAuthor":false,"prefix":"","firstName":"Chayma","middleName":"","lastName":"Jellali","suffix":""},{"id":575776619,"identity":"f30ae70d-53b1-41db-90bf-b0aa921af374","order_by":2,"name":"Chayma Sahli","email":"","orcid":"","institution":"Biochemistry Laboratory (LR00SP03),","correspondingAuthor":false,"prefix":"","firstName":"Chayma","middleName":"","lastName":"Sahli","suffix":""},{"id":575776627,"identity":"43858827-2654-4880-8263-f75598deaddf","order_by":3,"name":"Hajer Foddha","email":"","orcid":"","institution":"Research Laboratory of Human Genome and Multifactorial Diseases","correspondingAuthor":false,"prefix":"","firstName":"Hajer","middleName":"","lastName":"Foddha","suffix":""},{"id":575776635,"identity":"f8835ab3-5cd9-4faa-9029-6ff4a9474387","order_by":4,"name":"hela Boudabous","email":"","orcid":"","institution":"Laboratory of Pediatrics,","correspondingAuthor":false,"prefix":"","firstName":"hela","middleName":"","lastName":"Boudabous","suffix":""},{"id":575776643,"identity":"d792c282-4aeb-4a3c-b9be-0b51d24f9048","order_by":5,"name":"Taieb Massoud","email":"","orcid":"","institution":"Biochemistry Laboratory (LR00SP03),","correspondingAuthor":false,"prefix":"","firstName":"Taieb","middleName":"","lastName":"Massoud","suffix":""},{"id":575776649,"identity":"9d28ca61-7454-4b90-b685-959868cd44f8","order_by":6,"name":"Hassen Ben Abdennebi","email":"","orcid":"","institution":"Research Laboratory of Human Genome and Multifactorial Diseases","correspondingAuthor":false,"prefix":"","firstName":"Hassen","middleName":"Ben","lastName":"Abdennebi","suffix":""},{"id":575776654,"identity":"148eabe1-45b7-4490-8200-6a907a2ad289","order_by":7,"name":"Salima Ferchichi","email":"","orcid":"","institution":"Laboratory of Biochemistry","correspondingAuthor":false,"prefix":"","firstName":"Salima","middleName":"","lastName":"Ferchichi","suffix":""},{"id":575776660,"identity":"871c57d9-5987-4525-81cd-de7da02113ce","order_by":8,"name":"Latifa Chkioua","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIUlEQVRIie3SsUrEMBjA8S8cVIfv7JqjR32FHAUXi/cqDUJcbnA6Cg42FOJyD1C5wYfwBXIE2qU4n+hw7gqVWwRFbDnHtnCbSP5DviH5kQwBsNn+YtQBXY8xAEkqiCm6BwkMmp169hIEh8gMytAfLfSOoO4msCNAMqJEwNZRP3GXiut3dYbuXSqTD8fw5PF1sr2MQ0Cv3dDnXK9u1TnSnEi5QMPlchZ4WSkAj6JWwuhFYoZqgJCTmw1Sw1NvxryhMjDF9of9kms8bm75YoarURl8NgQ7idA1MchqkmIkAqR44vURuhbRKnsocJJzmY516FMU81MsBXYRNxNBVc2vfN8UL/Ltm+K0MPdPGId+F2nrkDXrHqD+KZt9TttsNtv/7wc72V52ZOHovgAAAABJRU5ErkJggg==","orcid":"","institution":"Research Laboratory of Human Genome and Multifactorial Diseases","correspondingAuthor":true,"prefix":"","firstName":"Latifa","middleName":"","lastName":"Chkioua","suffix":""}],"badges":[],"createdAt":"2026-01-07 11:38:55","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8540917/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8540917/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100610335,"identity":"28dbe7f1-46db-405e-a7c3-a98228ce3e9f","added_by":"auto","created_at":"2026-01-19 16:32:09","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59915,"visible":true,"origin":"","legend":"","description":"","filename":"Article221225.docx","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/53b991a7e951804829d434b0.docx"},{"id":100610362,"identity":"cfe8830c-eb72-4290-bdd4-28a25f1f5de8","added_by":"auto","created_at":"2026-01-19 16:32:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3213790,"visible":true,"origin":"","legend":"","description":"","filename":"Fig171225.docx","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/c566ca900c8e125868ac119c.docx"},{"id":100610382,"identity":"fca43bb4-1df0-4d4b-a5e6-06eead4501b0","added_by":"auto","created_at":"2026-01-19 16:32:55","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20443,"visible":true,"origin":"","legend":"","description":"","filename":"TableArticleIDS.docx","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/e127f90035097dee0dae109d.docx"},{"id":100610488,"identity":"4751c283-9d74-4e1f-8903-253e27494b85","added_by":"auto","created_at":"2026-01-19 16:34:03","extension":"json","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10609,"visible":true,"origin":"","legend":"","description":"","filename":"32afb13e69754cee9d5f01304de26d76.json","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/7f92446352d88ece0793cea2.json"},{"id":100610512,"identity":"b4f67d7e-b89f-4b8f-a23f-1c6017044f0a","added_by":"auto","created_at":"2026-01-19 16:34:04","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":94610,"visible":true,"origin":"","legend":"","description":"","filename":"32afb13e69754cee9d5f01304de26d761enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/061fafc5f2bb3151fac693b7.xml"},{"id":100610442,"identity":"466852fe-8f0e-4e97-be47-fcd9d3ff2d45","added_by":"auto","created_at":"2026-01-19 16:33:30","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/23121cd2604bfb4f75ef1591.jpeg"},{"id":100610443,"identity":"908387b0-deba-461d-87bb-80cfac151e16","added_by":"auto","created_at":"2026-01-19 16:33:31","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":467035,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/ca74f38f3fa435e4da3108e9.png"},{"id":100610350,"identity":"05d859b3-a7ef-4f8b-b307-045340372cbf","added_by":"auto","created_at":"2026-01-19 16:32:26","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77215,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/f865ad12e674f22fe53cf540.png"},{"id":100610345,"identity":"c417b09f-99ab-4af9-af0a-8b2076e26091","added_by":"auto","created_at":"2026-01-19 16:32:21","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1330324,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/30ec3785fb55e6401b219c15.png"},{"id":100610541,"identity":"b9e6d9fb-0209-4799-a1a6-d83d1476eb68","added_by":"auto","created_at":"2026-01-19 16:34:16","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":811051,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/8db2c28dcee5706acdea1850.jpeg"},{"id":100610361,"identity":"02b0fe61-0f5d-4d19-8dc7-9369d0d28ed6","added_by":"auto","created_at":"2026-01-19 16:32:36","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":40487,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/3b462016f3e4ba1c06886698.jpeg"},{"id":100610348,"identity":"44e2e2d4-7831-47b5-989f-ef482e341d8a","added_by":"auto","created_at":"2026-01-19 16:32:25","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/c5ce80f1670e5ff959044fb3.jpeg"},{"id":100610308,"identity":"1d9d1e9c-2a19-41aa-afe7-7ed7ca04d297","added_by":"auto","created_at":"2026-01-19 16:32:01","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36776,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/4b819dc848693f97b02e7e03.jpeg"},{"id":100610371,"identity":"13162d81-cfa1-42f3-b011-baea4eff6a9a","added_by":"auto","created_at":"2026-01-19 16:32:45","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/2c9250f0702f9ba2efaef314.png"},{"id":100610481,"identity":"f30c578a-eee7-4c21-8fbe-8e5bbe107487","added_by":"auto","created_at":"2026-01-19 16:33:49","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50302,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/59491747f7aae5c58a4a5f9c.png"},{"id":100610202,"identity":"1735520b-ccaf-44b5-813d-f511a8f51b8b","added_by":"auto","created_at":"2026-01-19 16:31:24","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13166,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/2743ebbe0a67016b138eb99b.png"},{"id":100610344,"identity":"cef4dbf8-d78e-4d3d-afbd-beb60c76d8bd","added_by":"auto","created_at":"2026-01-19 16:32:18","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":206452,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/c193cf44a34072cf34911aa0.png"},{"id":100610398,"identity":"6f4db69b-0379-4c84-afbd-7783ef437d51","added_by":"auto","created_at":"2026-01-19 16:33:02","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":217445,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/70daa2dd997a537a49cc3b1e.png"},{"id":100610480,"identity":"5aea4647-f3d9-4662-8417-8fa90641825b","added_by":"auto","created_at":"2026-01-19 16:33:48","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7220,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/7f150a79d2bf850d201f7756.png"},{"id":100610379,"identity":"d5a5c0c7-504c-4bf8-8218-aaf43da936dd","added_by":"auto","created_at":"2026-01-19 16:32:54","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/1a2abf370bf4fd75e270b7ac.png"},{"id":100610300,"identity":"879934b7-c7d6-4272-b8f5-bae0df9282b9","added_by":"auto","created_at":"2026-01-19 16:31:49","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8623,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/fee16d8a13bddbb6513993c3.png"},{"id":100610538,"identity":"2e89bd8c-17ab-45af-a48e-9f104fb8e6b5","added_by":"auto","created_at":"2026-01-19 16:34:09","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92471,"visible":true,"origin":"","legend":"","description":"","filename":"32afb13e69754cee9d5f01304de26d761structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/0816a19b85e9d63be83dade4.xml"},{"id":100610403,"identity":"add13605-9b37-4277-8692-3c77a5ea1757","added_by":"auto","created_at":"2026-01-19 16:33:04","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106438,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/3bf8f906cd85e94ece809734.html"},{"id":100610299,"identity":"d3876a46-73a5-45e4-be6e-2c8f221cc3cc","added_by":"auto","created_at":"2026-01-19 16:31:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":40632,"visible":true,"origin":"","legend":"\u003cp\u003ePedigrees of the MPS II Tunisian families. Squares represent males, and circles represent females. Filled symbols denote affected individuals, while open symbols indicate unaffected individuals.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/74a0e5954e340b87125dc03c.png"},{"id":100610396,"identity":"964080d1-bd2c-439d-bb5d-fa64efc44f87","added_by":"auto","created_at":"2026-01-19 16:33:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":490123,"visible":true,"origin":"","legend":"\u003cp\u003eThe left panel shows the electropherogram sequence of the reported mutation p.His138Tyr in exon 3, detected in patients BH. The right panel illustrates the reported mutation p.Arg88Leu in exon 3, found in patient BW. In the left panel, the top row (A) represents the normal control sequence, while the bottom row (B) corresponds to the hemizygous mutation state. In the right panel the upper row indicates the hemizygous missense mutation whereas the bottom the normal control.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/6cf8515cb43e97bbf9a7c42d.png"},{"id":100610369,"identity":"d2a68a16-ba73-4949-960a-7ca30aacafe9","added_by":"auto","created_at":"2026-01-19 16:32:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":107223,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of IDS mRNA expression levels between patient BN and control\u003c/p\u003e\n\u003cp\u003eUsing the \u003cstrong\u003e2⁻ΔΔCt method,\u003c/strong\u003e the calculated relative expression levels of IDS gene were\u003cstrong\u003e 0.004, 0.123, and 0.055. \u003c/strong\u003eThe mean of these values estimated \u003cstrong\u003e≈ 0.06,\u003c/strong\u003e indicates that \u003cstrong\u003eIDS mRNA expression in the patient BN is approximately 17-fold lower than in the control \u003c/strong\u003e(1/0.06 ≈ 16.7). This difference is statistically significant (p = 0.048 \u0026lt; 0.05), confirming that the large intronic deletion has a major functional impact on IDS gene expression.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/40e70c0ed4188f9db2aa9422.png"},{"id":100610412,"identity":"6e4674db-ba2d-4292-8fb2-021f7e93224b","added_by":"auto","created_at":"2026-01-19 16:33:15","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":857653,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCrystallographic structure analysis of the Human iduronate-2-sulfate.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a):\u003c/strong\u003e the IDS protein is composed of 2 subdomains: the first subdomain (SD1) spanning residues 34 to 443, the catalytic site is located almost in the middle of the SD1. The second subdomain (SD2), extending from residues 455 to 550. The \u003cem\u003ewild-type\u003c/em\u003e residue H138 located in the SD1 domain contributes in substrate binding by stabilizing the active site through hydrogen bonds (\u003cstrong\u003eb\u003c/strong\u003e) (green hydrogen bonds). \u003cstrong\u003e(c)\u003c/strong\u003eThe mutant residue Arg138 alters its interactions with neighboring residues by introducing a negatively charged side chain, which disrupt to hydrogen bonds. This change in charge disrupts the molecular interactions with nearby residues.\u003cstrong\u003e(d)\u003c/strong\u003e The result of the variation on active site stability after the introduction of the reported mutation p.His138Arg using DynaMut software.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/50918647ffcbc10dbcadcbb1.png"},{"id":100610411,"identity":"e5e6806a-bc83-4270-953a-87e66dc3e127","added_by":"auto","created_at":"2026-01-19 16:33:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":778631,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCrystallographic structure analysis of the Human iduronate-2-sulfate.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a):\u003c/strong\u003e the IDS protein is composed of 2 subdomains: the first subdomain (SD1) spanning residues 34 to 443, the catalytic site is located almost in the middle of the SD1. The second subdomain (SD2), extending from residues 455 to 550.The residue Arg88 located in helices α of SD1 catalytic domain. Arg88 is found in conserved consensus sequence: C-X-P-S-R (c) and forms hydrogen bonds and salt bridges with adjacent acidic residues, contributing to the stabilization of the catalytic core (\u003cstrong\u003eb\u003c/strong\u003e). The mutant residue Pro88 alters its interactions with neighboring residues and disrupts to hydrogen bonds \u003cstrong\u003e(c)\u003c/strong\u003e. This change in charge disrupts the ionic interactions \u003cstrong\u003e(e).\u003c/strong\u003e The result of the variation on active site stability after the introduction of the reported mutation p.Arg88His using DynaMut software.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/6b712e58f5af5d9940364fcd.png"},{"id":100796196,"identity":"b5a03d4a-65a8-4245-8c53-36892556172e","added_by":"auto","created_at":"2026-01-21 13:41:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3627423,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8540917/v1/7c75a8bf-9d75-45b8-bd30-934c79b82d08.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mucopolysaccharidosis type II in Tunisian families: IDS gene Variations Disrupting Substrate Binding and A Novel deep Intronic Deletion Reducing IDS expression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMucopolysaccharidosis type II or Hunter syndrome is an X linked recessive lysosomal storage disease. This syndrome is caused by the deficiency of the acid hydrolase enzyme iduronate-2-sulfatase (IDS, EC3.1.6.13) which is involved in the degradation of macromolecules glycosaminoglycans (GAGs), dermatan sulfate (DS) and heparan sulfate (HS).\u003c/p\u003e \u003cp\u003eMPS II disease regroups two clinical forms including the severe and mild forms. The severe form is characterized by the early onset of symptoms at the age of 2 to 4 years, with skeletal deformities, hepatosplenomegaly, cardiomyopathy in most MPS II patients. The neurological decline and severe cognitive impairment appear in childhood. The mild form is characterized by milder somatic symptoms with minimal neurological involvement, and survive into adulthood. The diagnosis procedures of the Hunter syndrome include the following steps: quantitative and qualitative analysis of urinary GAGs, iduronate-2 sulfate sulfatase (IDS) enzymatic activity assay and molecular analysis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eIDS\u003c/em\u003e gene is located on the X\u003cem\u003eq\u003c/em\u003e28 chromosome and consists of 9 exons encoding a 550 amino acid IDS protein. Currently, more than 800 mutations are reported on the Human Gene Mutation Database (HGMD). Among them, 323 are missense or nonsense, 59 splicing substitutions, 119 small deletions, 49 small insertions/duplications, 14 small indels, 52 gross deletions, 4 gross insertions/duplications, and 20 complex rearrangements. The allelic heterogeneity correlates with the phenotypic heterogeneity observed in MPS II patients [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] \u003cb\u003e.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe treatment of MPS II includes enzyme replacement therapy (ERT) and hematopoietic stem cell transplantation (HSCT) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, these strategies are not available in Tunisia due to financial constraints, and patients are generally hospitalized because of their umbilical hernias and bronchopulmonary problems. Nevertheless, genetic diagnosis plays a crucial role in the management of this disease. It not only provides a reliable diagnosis but also ensures genetic counseling for at-risk families. This genetic diagnosis makes it possible to assess the risk of hereditary transmission and consider prenatal screening options. This study emphasizes the crucial role of genetic analysis of \u003cem\u003eIDS gene\u003c/em\u003e in patients within MPS II to identify the genetic variations and to functionally characterize large intronic deletion in order to clarify their contribution to disease pathogenesis.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003ch3\u003eClinical Diagnosis \u0026nbsp;\u003c/h3\u003e\n\u003cp\u003eThis study involved three MPS II patients (WB, HMR, and BN) from three unrelated families (F1, F2, and F3) originating respectively from Kef, Ksar Sa\u0026iuml;d, and Tbolba. These patients were diagnosed in the pediatric department of La Rabta Hospital, Tunisia. Each case was classified as type I or II of MPS. All investigated patients were offspring of non-consanguineous marriages (Fig.1).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethics Committee of the\u0026nbsp;La Rabta Hospital\u0026nbsp;in Tunisia since 2018, and the families provided informed consent prior to collecting blood samples. All procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000 and approved by the Ethics Committees of the respective Tunisian hospitals.\u003c/p\u003e\n\u003cp\u003eThe studied patients were evaluated through a series of assessments, including detailed medical history, physical examination, routine biochemical tests and measurement of leukocyte IDS activity. \u0026nbsp;Subsequently, genetic testing was conducted to explore potential pathogenic mutations associated with MPS. Family histories and main clinical data are reported in \u003cstrong\u003eTable 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFamily 1/Patient\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eWB\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe patient, WB, aged 7, from Kef of Tunisia, is being treated as an outpatient for mucopolysaccharidosis type II (MPS II).\u003c/p\u003e\n\u003cp\u003eIn 2020, the patient WB presented bilateral inguinal hernias and bronchial congestion associated with chronic rhinorrhea. Initially, patient WB was treated in the private sector, then transferred to the pediatric department of La Rabta Hospital, where MPS II was diagnosed. The patient\u0026apos;s clinical picture includes macroglossia, splenomegaly, dorsal kyphosis, extensive Mongolian spots, umbilical hernia, and speech delay. The clinical features of this patient are available in \u003cstrong\u003eTable 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eIn 2023, the diagnosis of the MPS type was confirmed by measuring the enzymatic activity of iduronate-2-sulfatase in leukocytes of patient WB. The leukocyte IDS activity is presented in \u003cstrong\u003eTable 1.\u003c/strong\u003e In 2024, patient WB was admitted to the cardio surgery department where he underwent ventriculoperitoneal shunting. Currently, the patient WB is treated with Elaprase.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFamily 2 / Patient HR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatient HR, aged 10 years and 3 months, from Ksar Sa\u0026iuml;d of Tunisia. In 2023 the patient HR was suspected of mucopolysaccharidosis (MPS), in particular type II. This suspicion was based on the presence of characteristic facial dysmorphia, associated with behavioral disorders (agitation, hyperactivity, bulimia), psychomotor retardation, and recurrent otolaryngological (ENT) infections.\u003c/p\u003e\n\u003cp\u003eIn 2024, the patient HR presented an improvement in school integration revealed by a better intellectual capacity. During the psychological assessment, patient HR was capable of learning, although specific support remains necessary. At the end of 2024, the diagnosis of MPS type II was confirmed by measuring enzyme activity using the fluorometric method. The leukocyte IDS activity is presented in \u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFamily 3/ patient BN\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePatient BN from family (F3), aged 12 years from Tbolba (Monastir). This patient BN had coarse features with a thick tongue and moderate facial dysmorphia. \u0026nbsp;The leukocyte IDS activity and the main clinical signs of this patient are illustrated in \u003cstrong\u003eTable 1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular Diagnosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe two biochemical and molecular tests were carried out according to the previously reported procedure\u0026nbsp;[4].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eMutational analysis\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeripheral blood was obtained from patients and genomic DNA was isolated using a standard\u0026nbsp;salting-out procedure [5].\u0026nbsp;For identification of genetics variations, we sequenced the entire of\u0026nbsp;\u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene\u003cem\u003e\u0026nbsp;\u003c/em\u003e(NC_000023.11) as described\u0026nbsp;previously\u0026nbsp;[1].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExpression Analysis of \u003cem\u003eIDS\u003c/em\u003e gene\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eRNA Extraction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from peripheral blood leukocytes using TRIzol\u0026trade; reagent. After phase separation with chloroform, RNA was precipitated with isopropanol, washed with 75% ethanol, air-dried briefly, and resuspended in RNase-free water. RNA quality and purity were assessed before downstream applications.\u003c/p\u003e\n\u003cp\u003eFirst-strand cDNA synthesis was performed using total RNA as a template. The initial reaction mixture contained 11 \u0026micro;L of total RNA (495 ng), 1 \u0026micro;L of oligo(dT) primer (25 nmol), and 1 \u0026micro;L of dNTPs (10 mM), in a final volume of 13 \u0026micro;L. The mixture was incubated at 65 \u0026deg;C for 5 minutes to denature RNA secondary structures and facilitate oligo(dT) primer annealing. The tube was then immediately placed on ice to stabilize the formed hybrids prior to the addition of the enzymatic mix. The reverse transcription reaction was initiated by adding 4 \u0026micro;L of 5\u0026times; reaction buffer, 2 \u0026micro;L of DTT (0.1 M), and 1 \u0026micro;L of MMLV reverse transcriptase, bringing the final reaction volume to 20 \u0026micro;L. The reaction was incubated at 42 \u0026deg;C for 60 minutes to allow complete cDNA synthesis, followed by enzyme inactivation at 70 \u0026deg;C for 10 minutes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eReverse transcription\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1 \u0026micro;g of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Primer sequences of cDNA amplification are provided in Table 2.\u0026nbsp;Real-time PCR was performed using a three-step thermocycling program. The first step, consisted in an initial denaturation at 95 \u0026deg;C for 10 minutes to ensure complete denaturation of the cDNA template and activation of the Taq DNA polymerase. The second step, corresponding to the cycling stage, comprised 40 successive cycles, each including denaturation at 95 \u0026deg;C for 15 seconds, primer annealing at 57 \u0026deg;C for 30 seconds, and extension at 72 \u0026deg;C for 30 seconds, allowing exponential amplification of the target sequence. The third step, corresponding to the melt curve stage, was performed to assess the specificity of the amplified products and included three successive temperature steps: 95 \u0026deg;C, 60 \u0026deg;C for 1 minute, and 95 \u0026deg;C for 15 seconds, enabling analysis of the double-stranded DNA dissociation profile.\u003c/p\u003e\n\u003cp\u003eAt the end of the reaction, cycle threshold (Ct) values were automatically determined by the instrument software. These values represent the cycle at which fluorescence exceeds the detection threshold and reflect the initial amount of cDNA. Melt curves were also analyzed to confirm the specificity of amplification and the absence of nonspecific products or primer-dimer formation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eQuantitative Real-Time PCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIDS expression was quantified by SYBR Green\u0026ndash;based RT-qPCR. Primers targeted exons unaffected by the intronic deletion in patient BN. Beta-actin was used as the endogenous control. Reactions were performed in triplicate, and relative expression levels were calculated using the 2^-\u0026Delta;\u0026Delta;Ct method, comparing patient BN with a healthy control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathogenicity Prediction\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and IDS Structural Modeling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the first time, missense variants were evaluated using the online prediction program PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2), and classified as benign, possibly damaging, or probably damaging based on structural and evolutionary criteria. Then the IDS 3D structure (PDB ID: 5FQL) was analyzed with PyMOL. Wild-type and mutant residues localized into a 3D model using Deep View Swiss-Pdb Viewer 4.1 and POV-Ray 3.6 software and compared to assess effects on hydrogen bonding, domain organization, and active site proximity, providing insights into potential structural destabilization.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eClinical features and IDS activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe clinical characteristics of each patient, their leukocyte IDS activities, and identified genotypes are summarized in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIDS mutations analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eComplete sequencing of the entire \u003cem\u003eIDS gene\u0026nbsp;\u003c/em\u003ewas performed for the three unrelated patients suspected of MPS II. We identified three mutations: two missense mutations\u0026nbsp;p.H138Y and p.R88P (Fig.2) and one novel deep intronic deletion which is absent in over 50 unrelated individuals. Additionally, a large number of polymorphisms\u0026nbsp;were identified.\u003c/p\u003e\n\u003cp\u003eThe first mutation, NM_000202.8(IDS): c.412C\u0026gt;T (p.His138Tyr) in exon 3, was previously reported in the literature and was detected in patients HR in hemizygous state and associated with a severe form of MPS II. This mutation involves a substitution at codon 138, resulting in a histidine-to-thyrosine change (p.His138Tyr).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe second mutation, NM_000202.8(IDS): c.263G\u0026gt;T (p.Arg88Leu) in exon 3, was also previously reported and was identified in patient\u0026nbsp;WB in hemizygous state and associated with a severe form of MPS II. This mutation is due to a substitution at codon 88, resulting in an arginine to leucine change (p.Arg88Leu).\u003c/p\u003e\n\u003cp\u003eIn patient BN, we sequenced all exons and junction exons/introns of IDS gene. Although no pathogenic exonic mutations were identified, a large number of polymorphisms were detected. Consequently, the intron 3 for IDS gene which considered a variable region, was further analyzed.\u003c/p\u003e\n\u003cp\u003eA deep intronic deletion of intron 3 of \u003cem\u003eIDS\u003c/em\u003e gene was identified in patient BN. This unreported mutation was detected in patient BN in hemizygous state and associated in mild form of MPS II. \u003cstrong\u003eFunctional assessment of \u003cem\u003eIDS\u003c/em\u003e gene expression\u003c/strong\u003e was conducted in patient BN using \u003cstrong\u003eRT-qPCR\u003c/strong\u003e to evaluate the transcriptional impact of this large intronic deletion. In fact, the RT\u003cstrong\u003e-qPCR\u003c/strong\u003e showed a markedly lower initial amount of IDS mRNA in patient BN compared with the control. This decrease was reflected by a significantly higher Ct value of \u003cem\u003eIDS\u003c/em\u003e gene in patient (approximately\u0026nbsp;35.7-36.9). In contrast, the Ct values of the \u003cstrong\u003ehousekeeping gene\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026beta;\u003c/strong\u003e\u003cstrong\u003e-actin (\u003c/strong\u003eapproximately\u003cstrong\u003e\u0026nbsp;22.6\u0026ndash;23.3)\u003c/strong\u003e in both the patient BN and the control confirm the \u003cstrong\u003egood quality of the extracted RNA\u003c/strong\u003e and the \u003cstrong\u003ereliability of the quantitative analysis\u0026nbsp;\u003c/strong\u003e(\u003cstrong\u003eTable 3\u003c/strong\u003e). Furthermore, the analysis of the \u003cstrong\u003e∆Ct values (IDS \u0026ndash; \u0026beta;-actin)\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eshowed \u003cstrong\u003esignificantly higher values in the patient (13.1\u0026ndash;14.3) than in the control (5.3\u0026ndash;11.3) (Table 4)\u003c/strong\u003e, suggesting a\u003cstrong\u003e\u0026nbsp;\u003cstrong\u003estrong reduction in the relative \u003cem\u003eIDS\u003c/em\u003e gene\u003c/strong\u003e.\u0026nbsp;\u003c/strong\u003eSince higher ∆Ct values correspond to lower gene expression, sugging a \u003cstrong\u003emarked downregulation of IDS expression in patient BN\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn addition, the analysis of the ∆∆Ct values revealed a marked difference in \u003cstrong\u003e\u003cem\u003eIDS gene\u0026nbsp;\u003c/em\u003eexpression\u003c/strong\u003e between the patient BN and the control subject. Using the \u003cstrong\u003e2⁻\u003c/strong\u003e\u003cstrong\u003e\u0026Delta;\u0026Delta;\u003c/strong\u003e\u003cstrong\u003eCt method\u003c/strong\u003e\u003cstrong\u003e,\u003c/strong\u003e the calculated relative expression levels of \u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene were \u003cstrong\u003e0.004, 0.123, and 0.055\u003c/strong\u003e. The mean of these values estimated \u003cstrong\u003e\u0026asymp; \u003cstrong\u003e0.06\u003c/strong\u003e,\u003c/strong\u003e indicates that \u003cstrong\u003eIDS mRNA expression in the patient BN is approximately 17-fold lower than in the control\u003c/strong\u003e (1/0.06 \u0026asymp; 16.7) (\u003cstrong\u003eFig.3\u003c/strong\u003e). This result confirms a \u003cstrong\u003esevere downregulation of \u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene expression\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ein the patient BN.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatic finding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWild-type IDS- His138 3D structure\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCrystallographic analysis of the wild-type IDS structure (PDB ID: 5FQL) was performed using PyMOL to evaluate the functional impact of genetic variants. In the native enzyme, His138 occupies a central position within the active site \u003cstrong\u003e(Fig.4a)\u003c/strong\u003e, and develops stable hydrogen bonds (~3.0\u0026ndash;3.2 \u0026Aring;) with Lys135, Phe137, and the catalytic residue ALS84 (oxidized cysteine, formylglycine) \u003cstrong\u003e(Fig.4b).\u003c/strong\u003e The imidazole side chain of His138 facilitates proton transfer, stabilizing the active site geometry and ensuring optimal orientation of residues involved in catalytic mechanism\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eMutant IDS-Tyr138 3D Structure\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe mutant residue Tyr138 is predicted to create a steric clash and alters tremendously the active site of IDS protein. \u0026nbsp;\u003cstrong\u003e(Fig. 4c).\u003c/strong\u003e The measured distances to Lys135, Phe137, and ALS84 increased to approximately 6.2 \u0026Aring;, 8.8 \u0026Aring;, and 8.3 \u0026Aring;, respectively, exceeding the typical hydrogen bond range and leading to loss of these stabilizing interactions \u003cstrong\u003e(Fig.4d).\u003c/strong\u003e This steric hindrance, combined with disrupted hydrogen bonding, distorts the local geometry of the active site, destabilizing the catalytic network and likely impairing enzyme activity. These structural perturbations provide a mechanistic explanation for the pathogenicity of the p.H138Y mutation.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eWild-Type IDS-Arg88 3D Structure\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe crystallographic structure of iduronate-2-sulfatase, visualized using PyMOL, shows that arginine 88, a positively charged amino acid, forms two types of interactions within the active site (Fig.5a). On one hand, it is predicted to create\u0026nbsp;a hydrogen bond with lysine 135. On another hand, it participates in four salt bridge interactions, combining electrostatic and hydrogen bonds, involving residues Asp334 and Asp45, respectively (Fig.5b). These multiple interactions highlight the essential stabilizing role of Arg88 in the architecture of the catalytic site.\u003c/p\u003e\n\u003cp\u003eFurthermore, residue Arg88 is located at the catalytic core of the protein, within the highly conserved \u0026ldquo;CXPSR\u0026rdquo; pattern, common to all sulfatases and indispensable for the formation of the active site. This region is involved in the post-translational conversion of cysteine to formylglycine, a crucial step for the enzymatic activity of iduronate-2-sulfatase.\u0026nbsp;\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003eMutant IDS-Pro88 3D Structure\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe substitution of arginine 88 with proline results in the complete loss of stabilizing interactions (hydrogen bonds and salt bridges) with the catalytic residues of the active site (Asp45, Lys135, Asp334) (Fig.5c). This loss of hydrogen bonds and salt bridges between position 88 and the catalytic site residues leads to destabilization of the enzymatic core (Fig.5d). The catalytic pattern is predicted to become disorganized, leading to disrupt the orientation of amino acids which is involved in substrate recognition and the desulfation reaction. This structural imbalance may explain the loss of IDS activity observed in patient WB.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis present report is the continuation of several studies performed on Tunisian MPS II patients [1] [6].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe mucopolysaccharidosis type II (OMIM; \u003cstrong\u003e#\u003c/strong\u003e 309900, MPS II, Hunter syndrome; 309900) is a rare X-linked recessive lysosomal storage disorder caused by mutations in the \u003cem\u003eIDS\u003c/em\u003e (gene EC 3.1.6.13), encoding iduronate-2-sulfatase (IDS), which is essential for degrading glycosaminoglycans (GAGs) such as dermatan sulfate and heparan sulfate [1]. \u0026nbsp;IDS deficiency disrupts cellular metabolism, resulting in hepatosplenomegaly, dysostosis multiplex, cardiac anomalies, and respiratory complications. The clinical spectrum ranges from severe to attenuated forms [7].\u003c/p\u003e\n\u003cp\u003eThe clinical presentation of MPS II is highly variable.\u0026nbsp;\u0026nbsp;In our study, patients WB and HR presented a severe form of the disease, while patient BN exhibited a moderate form. In patient WB, the early-onset symptoms appear at the age of 2 years, including bilateral inguinal hernias and chronic bronchial congestion, consistent with severe MPS II observed in the most MPS II patients [8] [9].\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eIn contrast, patient BN manifested an attenuated phenotype with preserved cognition, milder skeletal and dysmorphic features, and symptom onset at \u0026nbsp;almost 10 years, aligning with prior reports of slowly progressing, late-onset forms [10].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe p.H138Y mutation, identified in patient HR\u0026nbsp;was already described\u0026nbsp;[11]. But the impact of this missense mutation on protein structure has not been studied. These gaps highlight the need for our study. Crystallographic studies showed that the histidine residue is located in the core of IDS site active involved in substrate binding. The thyrosine 138 residue, with\u0026nbsp;bulkier aromatic side chain,\u0026nbsp;likely disrupts\u0026nbsp;the hydrogen bonding and distorts the local geometry of the active site. The disruption is\u0026nbsp;thought to\u0026nbsp;destabilize the catalytic network and to likely impair enzyme activity.\u0026nbsp;Consequently, the undetectable catalytic activity could be associated with the severe phenotype observed in patient HB.\u003c/p\u003e\n\u003cp\u003ePatient WB is hemizygous for missense p.R88P mutation in exon 3 of \u003cem\u003eIDS gene\u0026nbsp;\u003c/em\u003e[4].\u0026nbsp;Crystallographic studies showed that\u0026nbsp;Arg88 within the highly conserved \u0026ldquo;CXPSR\u0026rdquo; pattern, which plays a crucial role in post-translational conversion of cysteine to formylglycine and which is essential for enzymatic activity\u0026nbsp;[12]. Substitution of arginine 88 with a proline, results in the complete loss of stabilizing interactions (hydrogen bonds and salt bridges) with the catalytic residues of the active site (Asp45, Lys135, Asp334), thereby, disrupts the catalytic core. This disruption\u0026nbsp;is thought to reduce substrate affinity and impair enzymatic activity\u0026nbsp;and desulfation, explaining the loss of IDS activity. PolyPhen-2 predicted this mutation as highly deleterious, underscoring the genotype-phenotype correlation for catalytic-site variants\u0026nbsp;[13]\u0026nbsp;[2].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePatient BN exhibited a large intronic deletion in intron 3 of \u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene, associated with significantly reduced mRNA expression (~0.06 relative to control; p = 0.048). Residual transcription likely allows synthesis of partially functional IDS protein, accounting for the moderate phenotype, preserved cognitive abilities, and milder visceral and skeletal involvement. This finding aligns with reports showing that intronic deletions may reduce splicing efficiency or mRNA stability without abolishing gene expression [14]\u003cstrong\u003e;\u0026nbsp;\u003c/strong\u003e[15]\u003cstrong\u003e;\u0026nbsp;\u003c/strong\u003e[16]\u003cstrong\u003e.\u0026nbsp;\u003c/strong\u003eThese findings raise an important hypothesis: the large intronic deletion identified in patient BN may induce exon 4 skipping which could be potentially affecting residues that are non-essential for IDS catalytic activity or result in partial intron excision. This may explain the mild phenotype of MPS II disease observed in patient BN.\u003c/p\u003e\n\u003cp\u003eOverall, these findings showed strong evidence for a \u003cstrong\u003esignificant decrease in the \u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene\u003cem\u003e\u0026nbsp;\u003c/em\u003eexpression in the patient hemizygote for the intronic deletion\u003c/strong\u003e, which may disrupt normal splicing, lead to mRNA instability, or trigger \u003cstrong\u003enonsense-mediated decay (NMD)\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u0026nbsp; Further studies are required to elucidate and clarify the importance of the molecular defect of this deep intronic deletion to better understand the pathophysiology of MPS II.\u003c/p\u003e\n\u003cp\u003eIn the present study, based on our results and genetics data from several other studies, the exon 3 of the \u003cem\u003eIDS\u0026nbsp;\u003c/em\u003egene\u003cem\u003e\u0026nbsp;\u003c/em\u003eis considered as a hypervariable locus. It is \u0026nbsp; characterized by the presence of numerous genetic variations [17] ,[18]. These variations include point substitutions, insertions, deep deletions, and other alterations that can modify the coding sequence or regulatory regions of the \u003cem\u003eIDS\u003c/em\u003e gene. This genetic diversity contributes directly to the phenotypic heterogeneity observed in patients with MPS II, explaining the variability in clinical presentation, which can range from severe to mild forms of the disease similar to those observed respectively in patients HB, WB and BN.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe study of this hypervariable exon 3 of \u003cem\u003eIDS\u003c/em\u003e gene is therefore crucial for understanding the molecular mechanisms underlying the pathogenesis of MPS II and may also guide the diagnosis and personalized management of patients.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003e The present report has provided additional information that the MPS II is a highly heterogeneous genetic disorder leading to the absence of correlation genotype-phenotype in MPSII patients. Further studies including mutational functional test would be essential for the better understanding of the MPSII molecular mechanism. This would help providing the genetic counseling, and prenatal diagnosis to prevent the early death of patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe patients gave informed consent before with drawal of blood samples and written informed consent was obtained and signed by all patients, in addition the verbal consent was also obtained during consultation. The study was approved by the ethics committees for scientific research of La Rabta Hospital, Tunis, Tunisia. All procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2000 and approved by the Ethics Committees of the respective Tunisian hospitals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publication:\u0026nbsp;\u003c/strong\u003eWritten informed consent was obtained from the parents or legal guardians of the patients for their participation and publication of this work. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u0026nbsp; \u0026nbsp;datasets \u0026nbsp; analyzed \u0026nbsp; during \u0026nbsp; \u0026nbsp;the \u0026nbsp; current \u0026nbsp; study \u0026nbsp; \u0026nbsp;are \u0026nbsp; available \u0026nbsp; in \u0026nbsp; \u0026nbsp;the \u0026nbsp; ensemble \u0026nbsp; database (https://www.ensembl.org/index.html)\u003c/p\u003e\n\u003cp\u003ep.His138Tyr, NM_000202.8(IDS): https://www.ncbi.nlm.nih.gov/clinvar/variation/3255707/\u003c/p\u003e\n\u003cp\u003eVariation ID: 3255707\u0026nbsp;Accession: VCV003255707.3\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u0026nbsp;p.Arg88Leu, NM_000202.8(IDS): https://www.ncbi.nlm.nih.gov/clinvar/variation/3255643/\u003c/p\u003e\n\u003cp\u003eVariation ID: 3255643\u0026nbsp;Accession: VCV003255643.2\u003c/p\u003e\n\u003cp\u003eThe \u0026nbsp; datasets \u0026nbsp; \u0026nbsp;analysed \u0026nbsp; during \u0026nbsp; the \u0026nbsp; \u0026nbsp;current \u0026nbsp; study \u0026nbsp; are \u0026nbsp; \u0026nbsp;available \u0026nbsp; in \u0026nbsp; the \u0026nbsp; \u0026nbsp;ensemble \u0026nbsp; database\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e(https://www.ensembl.org/index.html)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was not financially supported.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLC, RL, CJ, CS and HF, carried out all the experiments, data analyses, LC and RL: \u0026nbsp;wrote the manuscript. TM, HBA, HB and SF supported the analysis and interpretation of the data. LC: revised the manuscript. All authors participated in the writing of the manuscript and approved the final version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u0026nbsp;\u003c/strong\u003eWe thank all clinicians for their fruitful participation in this work. We also thank all patients with cystinosis for participating in this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9.\u003c/li\u003e\n\u003cli\u003eZanetti A, D\u0026rsquo;Avanzo F, Tomanin R. Molecular basis of mucopolysaccharidosis type II (Hunter syndrome): first review and classification of published IDS gene variants. Hum Genomics. 2024;18:134. https://doi.org/10.1186/s40246-024-00701-w.\u003c/li\u003e\n\u003cli\u003eMao S-J, Chen Q-Q, Dai Y-L, Dong G-P, Zou C-C. The diagnosis and management of mucopolysaccharidosis type II. Ital J Pediatr. 2024;50:207. https://doi.org/10.1186/s13052-024-01769-9.\u003c/li\u003e\n\u003cli\u003eChkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9.\u003c/li\u003e\n\u003cli\u003eMiller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215. https://doi.org/10.1093/nar/16.3.1215.\u003c/li\u003e\n\u003cli\u003eChkioua L, Khedhiri S, Ferchichi S, Tcheng R, Chahed H, Froissart R, et al. Molecular analysis of iduronate -2- sulfatase gene in Tunisian patients with mucopolysaccharidosis type II. Diagn Pathol. 2011;6:42. https://doi.org/10.1186/1746-1596-6-42.\u003c/li\u003e\n\u003cli\u003eD\u0026rsquo;Avanzo F, Rigon L, Zanetti A, Tomanin R. Mucopolysaccharidosis Type II: One Hundred Years of Research, Diagnosis, and Treatment. Int J Mol Sci. 2020;21:1258. https://doi.org/10.3390/ijms21041258.\u003c/li\u003e\n\u003cli\u003eHashmi MS, Gupta V. Mucopolysaccharidosis Type II. In: StatPearls. Treasure Island (FL): StatPearls Publishing; 2025.\u003c/li\u003e\n\u003cli\u003eMuenzer J, Burton BK, Amartino HM, Harmatz PR, Guti\u0026eacute;rrez-Solana LG, Ruiz-Garcia M, et al. Neurodevelopmental status and adaptive behavior of pediatric patients with mucopolysaccharidosis II: a longitudinal observational study. Orphanet J Rare Dis. 2023;18:357. https://doi.org/10.1186/s13023-023-02805-3.\u003c/li\u003e\n\u003cli\u003eGiugliani R. Mucopolysacccharidoses: From understanding to treatment, a century of discoveries. Genet Mol Biol. 2012;35 4 Suppl:924\u0026ndash;31.\u003c/li\u003e\n\u003cli\u003eFroissart R, Maire I, Millat G, Cudry S, Birot AM, Bonnet V, et al. Identification of iduronate sulfatase gene alterations in 70 unrelated Hunter patients. Clin Genet. 1998;53:362\u0026ndash;8. https://doi.org/10.1111/j.1399-0004.1998.tb02746.x.\u003c/li\u003e\n\u003cli\u003eVillani GR, Daniele A, Balzano N, Di Natale P. Expression of five iduronate-2-sulfatase site-directed mutations. Biochim Biophys Acta. 2000;1501:71\u0026ndash;80. https://doi.org/10.1016/s0925-4439(00)00006-5.\u003c/li\u003e\n\u003cli\u003eChkioua L, Grissa O, Leban N, Gribaa M, Boudabous H, Turkia HB, et al. The mutational spectrum of hunter syndrome reveals correlation between biochemical and clinical profiles in Tunisian patients. BMC Med Genet. 2020;21:111. https://doi.org/10.1186/s12881-020-01051-9.\u003c/li\u003e\n\u003cli\u003eWong JH, Shigemizu D, Yoshii Y, Akiyama S, Tanaka A, Nakagawa H, et al. Identification of intermediate-sized deletions and inference of their impact on gene expression in a human population. Genome Med. 2019;11:44. https://doi.org/10.1186/s13073-019-0656-4.\u003c/li\u003e\n\u003cli\u003eLowther C, Speevak M, Armour CM, Goh ES, Graham GE, Li C, et al. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression. Genet Med Off J Am Coll Med Genet. 2017;19:53\u0026ndash;61. https://doi.org/10.1038/gim.2016.54.\u003c/li\u003e\n\u003cli\u003eYamamoto-Shimojima K, Akagawa H, Yanagi K, Kaname T, Okamoto N, Yamamoto T. Deep intronic deletion in intron 3 of PLP1 is associated with a severe phenotype of Pelizaeus-Merzbacher disease. Hum Genome Var. 2021;8:14. https://doi.org/10.1038/s41439-021-00144-y.\u003c/li\u003e\n\u003cli\u003eLualdi S, Pittis MG, Regis S, Parini R, Allegri AE, Furlan F, et al. Multiple cryptic splice sites can be activated by IDS point mutations generating misspliced transcripts. J Mol Med Berl Ger. 2006;84:692\u0026ndash;700. https://doi.org/10.1007/s00109-006-0057-1.\u003c/li\u003e\n\u003cli\u003eHisama FM, Lessel D, Leistritz D, Friedrich K, McBride KL, Pastore MT, et al. Coronary artery disease in a Werner syndrome-like form of progeria characterized by low levels of progerin, a splice variant of lamin A. Am J Med Genet A. 2011;155A:3002\u0026ndash;6. https://doi.org/10.1002/ajmg.a.34336.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e: Clinical, biological and molecular finding of Tunisian MPS II patients\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"623\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eFamilies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eF3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003ePatients\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eWB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eHR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eBN\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eOrigin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eKef (Siliana)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGafsa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eTbolba (Monastir)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 170px;\"\u003e\n \u003cp\u003eHepatosplenomegaly\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eCoarse facial features: broad nose, macroglossia, enlarged tongue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003ePsychomotor delay\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eMultiple dysostosis: joint stiffness, ovoid vertebrae\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eOsteopenia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eIntellectual disability\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e+++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 170px;\"\u003e\n \u003cp\u003eRespiratory problems: nasal obstruction, sleep apnea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 170px;\"\u003e\n \u003cp\u003eCardiovascular involvement: arrhythmia, congestive signs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eLeukocytes IDS activity (nmol/h/mg protein)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e0.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e0.2\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e\u0026lt;0,8(LOD)\u0026nbsp;\u0026micro;mol/L/h\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eUsual values (nmol/h/mg protein)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e25-95\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e25-95\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026ge; 5,6 \u0026micro;mol/L/h\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eUnder treatment\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eElaprase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eNone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eElaprase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eMutations (exon/intron)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003ep.H138Y\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003ep.R88P\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eDeep intronic deletion\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003eExon 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eExon 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eIntron 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"10\" valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003ePolymorphisms (exon/intron)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"10\" valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"10\" valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003ers782594123C\u0026gt;T ; rs1754501C\u0026gt;T\u003c/p\u003e\n \u003cp\u003ers135828282625C\u0026gt;T\u0026nbsp;; rs70986A\u0026gt;G\u003c/p\u003e\n \u003cp\u003ers1734484A\u0026gt;G\u0026nbsp;; rs781996090C\u0026gt;T\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eExon 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003ers74318341 (-TAT)\u0026nbsp;; rs781786692A\u0026gt;G\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eExon 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003ers1204168804A\u0026gt;C\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eExon 5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003ers1237518698G\u0026gt;T\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eExon 6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003ers1263154314T\u0026gt;A\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 236px;\"\u003e\n \u003cp\u003eExon 7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 170px;\"\u003e\n \u003cp\u003ePhenotype\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Severe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eSevere\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 236px;\"\u003e\n \u003cp\u003eMild\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2:\u0026nbsp;\u003c/strong\u003ePrimer for cDNA amplification\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eName\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence 5\u0026rsquo;\u0026gt;3\u0026rsquo;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003e\u003cem\u003eIDS\u003c/em\u003e gene\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003eAF: CACAGCCTCCTCTTCCAGAA\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eAR: CAGGTTGGCATGGAGTTCTC\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eInter: CACGCTGGAAACTTCTCCAC\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eRB: CATCAGGGACCTCGGGATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003eReference gene \u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003eF :5\u0026rsquo;TGAGGAGCACCCTGTGCT3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eR: 5\u0026rsquo;CCAGAGGCATACAGGGAC3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3:\u003c/strong\u003e Ct values from blood samples of the patient BN and control measured by RT\u003cstrong\u003e-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePatient BN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 302px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene of Interest (\u003cem\u003eIDS\u003c/em\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHousekeeping Gene (\u003c/strong\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene of Interest (\u003cem\u003eIDS\u003c/em\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHousekeeping Gene (\u003c/strong\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 604px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction 1: AF+AR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 35.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 22.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 28.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 23.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 604px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction\u0026nbsp;2: AF+Internal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 36.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 22.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 34.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 23.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 604px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction 3: AF+RB\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 35.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 22.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 32.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 151px;\"\u003e\n \u003cp\u003eCt\u0026nbsp;= 23.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4:\u003c/strong\u003e ∆Ct values from patient and control blood samples by RT-qPCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePatient BN\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 621px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction 1: AF+AR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct\u0026nbsp;= 13.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct\u0026nbsp;= 5.26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 621px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction\u0026nbsp;2: AF+Internal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct = 14.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct =11.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 621px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReaction 3: AF+RB\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct = 13.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 311px;\"\u003e\n \u003cp\u003e∆Ct =8.94\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Hunter syndrome, IDS, deep intronic deletion, bioinformatics analysis","lastPublishedDoi":"10.21203/rs.3.rs-8540917/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8540917/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eAbstract: \u003c/strong\u003eHunter syndrome is an X linked recessive lysosomal storage disease. This syndrome is caused by the deficiency of iduronate-2-sulfatase enzyme (IDS, EC3.1.6.13) that is involved in the degradation of macromolecules glycosaminoglycans, dermatan sulfate and heparan sulfate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and Methods: \u003c/strong\u003eThis study involved three MPS II patients (WB, HMR, and BN) from three unrelated families (F1, F2, and F3) originating respectively from Kef, Ksar Saïd, and Tbolba. Genetic alterations were identified using DNA sequencing. To characterize the functional impact of a large intronic deletion and to assess the expression level of the \u003cem\u003eIDS\u003c/em\u003e gene, the total mRNA was extracted from peripheral blood. Bioinformatics tools, including the SWISS-MODEL server and DynaMut, were used for structural modeling and to predict the impact of the mutations on protein stability and mechanism catalytic.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eTwo missense mutations, p.R88P and p.H138Y in the \u003cem\u003eIDS \u003c/em\u003egene\u003cem\u003e \u003c/em\u003ewere identified. A novel large intronic deletion in intron 3 was discovered in patient with severe MPS II phenotypes, while a previously reported missense mutation p.R88P and p.H138Y was found in two patients with mild phenotypes.\u003cstrong\u003e \u003c/strong\u003eMoreover, we identified a large number of single nucleotides sequences’ variants in hemizygous status. The real- time PCR expression analysis demonstrated a marked reduction in IDS mRNA levels, suggesting a deleterious effect of the large intronic deletion on transcript stability and \u003cem\u003eIDS \u003c/em\u003egene expression level.\u003c/p\u003e\n\u003cp\u003eStructural analysis revealed that the two missense mutations cause structural deformation of IDS protein, and disrupts the protein’s substrate-binding site resulting in a complete loss of enzymatic activity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study reports a novel deep intronic deletion in the \u003cem\u003eIDS \u003c/em\u003egene\u003cem\u003e \u003c/em\u003ein Tunisian MPS II patients, alongside the previously described mutations. The findings enhance understanding of the molecular basis of MPS II.\u003c/p\u003e","manuscriptTitle":"Mucopolysaccharidosis type II in Tunisian families: IDS gene Variations Disrupting Substrate Binding and A Novel deep Intronic Deletion Reducing IDS expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-19 15:37:13","doi":"10.21203/rs.3.rs-8540917/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-06T11:32:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-05T12:52:44+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-29T09:21:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"71185994021836806688498662987835421825","date":"2026-01-20T05:02:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-19T05:07:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"268255432868737461986788602201038181442","date":"2026-01-16T13:05:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"98782742865040900913239922807191511011","date":"2026-01-16T10:57:35+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-14T07:06:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-09T15:16:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-09T15:14:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2026-01-07T11:29:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5ada38f5-9d6d-472f-9b6a-ce6d2f7b547c","owner":[],"postedDate":"January 19th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-04-08T10:33:15+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-19 15:37:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8540917","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8540917","identity":"rs-8540917","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.