Development of a species-specific qPCR assay for the detection of invasive African Sharptooth catfish (Clarias gariepinus) using environmental DNA

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Detection and monitoring of target species is the primary strategy in the management and control of biological invasions. Traditional methods to detect invasive species are time consuming and cumbersome with a requisite for trained taxonomists for identification of aquatic species. Environmental DNA (eDNA)-based molecular methods offer an alternative, as they are quick, cost-effective and requires minimal manpower. In this study, we design and optimize a reliable eDNA-based quantitative PCR assay to detect the African Sharptooth catfish, a highly invasive and banned species in India. Here, we delineate the step-by-step processes involved in the design and optimization of the assay, and show its performance through field-testing in selected water bodies in and around the city of Hyderabad. The present workflow can be used to design assays to detect a wide range of aquatic species.
Full text 66,851 characters · extracted from preprint-html · click to expand
Development of a species-specific qPCR assay for the detection of invasive African Sharptooth catfish (Clarias gariepinus) using environmental DNA | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of a species-specific qPCR assay for the detection of invasive African Sharptooth catfish (Clarias gariepinus) using environmental DNA Gopi Krishnan, Meher Sunkara, Rajeev Raghavan, Govindhaswamy Umapathy This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1850303/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Detection and monitoring of target species is the primary strategy in the management and control of biological invasions. Traditional methods to detect invasive species are time consuming and cumbersome with a requisite for trained taxonomists for identification of aquatic species. Environmental DNA (eDNA)-based molecular methods offer an alternative, as they are quick, cost-effective and requires minimal manpower. In this study, we design and optimize a reliable eDNA-based quantitative PCR assay to detect the African Sharptooth catfish, a highly invasive and banned species in India. Here, we delineate the step-by-step processes involved in the design and optimization of the assay, and show its performance through field-testing in selected water bodies in and around the city of Hyderabad. The present workflow can be used to design assays to detect a wide range of aquatic species. Invasive species Environmental DNA Clarias gariepinus Quantitative PCR Figures Figure 1 Figure 2 Figure 3 Introduction The intricate connection of biological invasions with increasing globalization, trade, culture, and human and climate-mediated events makes prevention and control of invasive species an exceptional challenge (Meyerson et al. 2022 ). With predictions that the number of alien species, as well as the intensity of biological invasions will accelerate on most continents (Seebens et al. 2021 ), there is an urgent need to develop and implement effective solutions for control, monitoring and management. Such strategies are particularly required in regions noted for their exceptional biodiversity and endemism, and where threats from alien species are remarkably high (see Dawson et al. 2017 ). In India, a mega-diversity country, threats to biodiversity from alien invasive species are on the rise, but management and control of such species is inadequate because of insufficient research, funding and policies (Goyal et al. 2021 ; Mungi et al. 2019 ). A recent synthesis by Bang et al. ( 2022 ) revealed that the Indian economy had incurred a loss of at least US $ 127.3 billion between 1960 and 2020 due to invasive species, with an average annual cost of US $ 2.1 billion. Bang et al. ( 2022 ) further cautioned that these calculations could likely be gross underestimations, since they contribute to only a small fraction of the actual costs incurred. About 7.2% of global fish diversity occurs in India (Froese & Pauly 2022). Though there is no comprehensive assessment, or a list of alien invasive fish species in India, it has been estimated that > 600 fish species have been introduced into the country, with 55 of them having established sustainable reproductive populations (Sandilyan 2022 ). Among those 55 species, the National Biodiversity Authority (NBA) has declared 14 inland and freshwater species as ‘highly invasive’ (Sandilyan et al. 2018 ), which includes Clarias gariepinus (African sharptooth catfish). Further this species has been banned from farming and selling by the Government of India since the year 1997 (Gopi and Radhakrishnan 2002 ). Clarias gariepinus is widely regarded as one of the world’s most successful aquatic invader due to its generalist (but mostly piscivorous and predatory) feeding habits, high fecundity, fast growth and eurytopic physiological traits (Booth et al. 2010 ). The species has a widespread presence in around 30 countries, including India, impacting native fish and other aquatic species through competition and predation. Despite its significance as an invasive alien species, only few studies have focused on the occurrence and distribution of C. gariepinus in the country (Krishnakumar et al. 2011 , Singh et al. 2013 , Roshni et al. 2020 ), and no attempt has been made so far to map its distribution in India. Traditional methods to detect invasive fish species such as visual observations, using traps, nets, bioacoustics, etc., and also employing morphological and behavioural data can be biased, intrusive and requires some level of taxonomic expertise (Beng et al, 2020). An alternative method that has been highly favoured by conservationists in recent years is the use of environmental DNA (eDNA) to detect aquatic species. eDNA, which is a complex mixture of DNA obtained from different organisms in soil, sediment, water and even air (Taberlet 2012), can be exploited to detect aquatic species including invasive species (Jo et al. 2021 ) with high accuracy at relatively low cost. With sequencing techniques becoming more affordable and easily available, eDNA based molecular methods are increasingly adopted in conservation science. With a big chasm in invasion biology research in India, detection of target species remains the crucial step in the control and management of invasive species. Here, we successfully show the validation of a quantitative PCR based assay utilising eDNA, rigorously designed, optimized, and tested to specifically detect the invasive Clarias gariepinus . Methods Primer designing and screening We targeted the ‘Cytochrome b’ region of the mitochondria to design primers, and retrieved the sequences of three species of Clariids, Clarias gariepinus , C. dussumieri and C. batrachus from NCBI GenBank (accession numbers: NC_027661.1:14366–15503, NC_037193.1:14365–15502, NC_023923.1:14361–15498 respectively). These sequences were subsequently aligned using Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ), and the alignment file was imported to the primer designing module of ssPRIMER ( https://www.mattortonapps.com/shiny/ssPRIMER ), a GUI based tool used for designing species specific primers for qPCR assays. Potential primer pairs were designed by selecting appropriate parameters (see supplementary file). From the list of designed primers, the primer pairs that had a higher propensity to form primer dimers were omitted from consideration for qPCR assay. To further screen the primers, shortlisted primers were assessed in silico using NCBI’s Primer-Blast tool, and any primers that amplified other sympatric species were excluded. The details of the finalised primer pair are shown in Table 1 . Table 1 Selected primer pair and their sequence used for detecting African shartooth catfish Clarias gariepinus . Primer Sequence 5’-> 3’ Length (bp) Tm (°C) Target amplicon length (bp) Cgar_CytB_F TAGCCATACACTACACTTCTGA 22 58 171 Cgar_CytB_R GGTATGAGCCGTAGTAAAGACC 22 In vitro testing of primers Since the DNA sequence databases were not complete with sequences of all extant species, in silico analysis alone does not determine specificity of the screened primer pair. Hence, we tested them for specificity in vitro as well. Upon optimizing the PCR conditions (see supplementary file) for the selected primer pair, we tested the primers in vitro against the genomic DNA extractions of C. gariepinus and a few additional non-target species by performing a PCR assay. The non-target species selected for this assay comprised phylogenetically closely related sympatric species within the genus Clarias ( C. dussumieri, C. magur and C. batrachus ), sympatric species within Siluriformes ( Glyptothorax gracilis, Pangasianodon hypophthalmus, Horabagrus brachysoma and Plotosus canius ) and a few distantly related sympatric species from orders other than Siluriformes ( Labeo rohita, Labeo catla, Cyprinus carpio, Oreochromis niloticus and Tenualosa ilisha ). The PCR products were then visualised in 2% agarose gel. qPCR assay optimization To determine efficiency of the primers and linear range, a standard curve was generated by including dilutions of standards, i.e., known copies of target amplicons comprising the target sequence. The standards were prepared in the laboratory through PCR reactions followed by purification of the amplicons and calculation of their copy number (see supplementary file). A standard curve was generated with the dilutions of standards ranging from 10 0 copies/ reaction to 10 5 copies/ reaction. To determine the Limit of Detection (lowest initial DNA concentration with 95% detection) and Limit of Quantification (lowest initial DNA concentration quantifiable with a coefficient of variation below 35%), we performed a qPCR assay using 4-fold dilutions of standards ranging from 1 copy/reaction to 1024 copies/ reaction. The Limits of Detection and Quantification were calculated using the LOD/LOQ calculator (Klymus et al. 2020 a). All qPCR experiments were performed in Roche Lightcycler 480 II instrument, and components of the qPCR reaction mixture for each reaction are given in the supplementary file. Sampling for field testing To test the performance of the assay in field conditions, we randomly selected 11 lakes in and around Hyderabad, Telangana State, India, for the pilot study. Two litres of water were collected in triplicate from each site during the month of January 2021 and filtered in the laboratory on the same day. 250 ml of water from each sample was filtered using disposable 50 ml syringes through mixed cellulose ester membrane of 47 mm in diameter and of 0.45 µm pore size (Merck life science Pvt. Ltd.). After filtration, the filter paper was cut into two halves, with one half utilised for DNA isolation and the other stored in -30°C. Besides the 11 lakes, we also included a sample from a pond located inside the Nehru Zoological Park in Hyderabad as the positive control, where the presence of C. gariepinus was visually confirmed. Since we could not reliably identify any natural water body in and around Hyderabad where C. gariepinus is confirmed to be absent, we included a sample from our laboratory aquarium as the environmental negative control. Between filtration of each sample, the filter assemblies were bleached with 4% Sodium hypochlorite solution to prevent contamination between samples. eDNA was extracted from the filters by the standard Phenol-Chloroform-Isoamyl alcohol method. After eDNA extraction, the DNA concentrations of all samples were adjusted to 20 ng/µl for the subsequent qPCR assay. qPCR detection of eDNA Each eDNA sample was loaded in three technical replicates, along with negative controls, and the assay was run in Roche Lightcycler 480 II. The copy numbers of the target gene in each eDNA sample were calculated with the help of the standard curve generated during the qPCR assay optimization stage. For the reactions where primer dimers were observed through the Melt curve analysis, the assay was repeated for the respective samples. The qPCR assays did not involve any additional probes, since the designed primers were highly specific to the target species. All qPCR assays were performed in a separate laboratory space in a different floor/section of the building dedicated for qPCR experiments to avoid contamination. The components of the qPCR reaction mixture and the reaction conditions are given in the supplementary file. The qPCR products were purified and sequenced by the Sanger sequencing method. The sequences were then analysed in NCBI’s nucleotide BLAST tool to verify the species identity of the amplified product. Results Selected primer pair After rigorous screening of the designed primers and their in silico analysis, we finalised the following primer pair (Table 1 ) for the study. In vitro primer specificity assay Figure 1 provides details of the PCR products of tissue DNA samples from the target and non-target species amplified with the selected primer pair. A crisp band was observed only in the PCR product of C. gariepinus DNA sample at the expected range of 171 bp, while no other bands were observed for the closely related and other non-target species. qPCR assay standardization To estimate the absolute copy number of the target gene in eDNA samples, we generated the standard curve with the R 2 value of 0.9973, efficiency of 96.5% and the y-intercept value (the predicted Cp of a reaction with 1 copy of the target sequence) at 34.76 cycles (Fig. 2 ). Through LOD/LOQ assay, the limit of detection was found to be four copies and the limit of quantification was found to be nine copies. eDNA detection in representative samples Of the 12 lake-water samples, 11 produced amplifications, including the positive sample from the pond inside the Nehru Zoological Park (Fig. 3 ). Only one sample (site KC) was negative. The copy numbers calculated for all the positive samples using the standard curve were above the limit of detection and quantification, confidently indicating the presence of C. gariepinus . No amplification was observed in the environmental negative control (ENC) as well as in the no template controls. To confirm the species identity of positive detections in eDNA samples, sequences of the amplified products were analysed using NCBI nucleotide BLAST. All sequences were confirmed to represent C. gariepinus with > 98% identity. Discussion While real-time quantitative PCR assays have been used in various fields involving detection and quantification of specific nucleotide sequences (Kubista et al. 2006 ), its potential as a tool for environmental DNA studies is only recently emerging. In this study, we designed a cost-effective eDNA based qPCR assay for the detection of North African sharptooth catfish in natural aquatic ecosystems. Before embarking on a large-scale eDNA based study to map the distribution of any target species, a pilot study is recommended to standardize the design, including the development and validation of assay, as well as considerations for contamination and suitable analysis methods (Goldberg et al. 2016 ). Such a pilot study also enables re-optimization and validation of the assay when applied in different geographical regions. Mitochondrial gene sequences are preferred as the target sequence for eDNA studies as it increases the chances of detection because of the high copy number in cells (Rees et al. 2014 ), despite their inability to distinguish hybrids (Evans et al. 2017). Also, incorporation of specificity (i.e., detection of only the target species) and sensitivity (i.e., detection of target DNA at low quantities) assessments is vital to make the assay more reliable (Klymus et al. 2020 b). While the in silico and in vitro validation of primers against the non-target species informs about the specificity of the assay, the limit of Detection (LOD) and Limit of Quantification (LOQ) assessments inform about sensitivity. To ensure that the primers are specific to the target species, it is imperative to include the phylogenetically closely related species and distantly related sympatric species in the in vitro specificity assay. In addition, verification of the positive detections by sequencing the PCR products adds another layer to assay integrity. Keskin ( 2014 ) and Elberri et al. ( 2020 ) have previously demonstrated the importance of qPCR based eDNA studies to detect C. gariepinus . However, the primers used in their studies were amplifying other Indian congeneric Clarias species (e.g., C. magur , C. dussumieri ) as well. Hence, our assay was optimized to detect C. gariepinus in India with high specificity, by including all native species of the genus Clarias , and selected species of other closely related families in the in vitro validation. For future studies outside India, we suggest revalidation of the specificity of our assay by including other co-occurring closely related species in the geographical range of interest. Since our assay does not include any additional probes, this has reduced the cost involved and can be used by any laboratory equipped with a basic qPCR machine. The goal of developing, optimizing and testing a species-specific qPCR assay for eDNA based studies with stringent quality control measures is to detect the target species. This pilot study will serve as a foundation to map the distribution of invasive C. gariepinus , and also as a useful tool to inform management authorities for timely control and regular monitoring of this species. Finally, the workflow employed in this study can also serve as a template to design and optimize eDNA based assays to detect other invasive and/or threatened species for improved aquatic management and conservation. Declarations ACKNOWLEDGMENTS We acknowledge the support provided by Nehru Zoological Park, Hyderabad. We thank Shivakumara Manu and Manisha Ray for their constant support and suggestions throughout the work. FUNDING The study was funded by the Department of Biotechnology (DBT), Govt. of India, vide grant no. BT/PR29032/FCB/125/4/2018 received by Govindhaswamy Umapathy. Gopi Krishnan was supported by a PhD fellowship from Council of Scientific & Industrial Research, Govt. of India. AVAILABILITY OF DATA AND MATERIAL Data are available from the corresponding author upon reasonable request. ETHICS DECLARATIONS Conflict of interest: The authors declare that they have no conflict of interest. The authors have no relevant financial or non-financial interests to disclose. Ethical approval: The study was carried out by complying with the institutional ethical standards. References Bang A, Cuthbert RN, Haubrock PJ, Fernandez RD, Moodley D, Diagne C, Turbelin AJ, Renault D, Dalu T, Courchamp F (2022) Massive economic costs of biological invasions despite widespread knowledge gaps: a dual setback for India. Biol Invasions 5:1-23. https://doi.org/10.1007/s10530-022-02780-z Beng KC, Corlett RT (2020) Applications of environmental DNA (eDNA) in ecology and conservation: opportunities, challenges and prospects. Biodivers Conserv 29(7):2089-121. https://doi.org/10.1007/s10531-020-01980-0 Booth AJ, Traasg GR, Weyl OL (2010) Adult African sharptooth catfish, Clarias gariepinus, population dynamics in a small invaded warm-temperate impoundment. Afr Zool 45(2):299-308. https://doi.org/10.1080/15627020.2010.11657279 Dawson W, Moser D, Van Kleunen M, Kreft H, Pergl J, Pyšek P, Weigelt P, Winter M, Lenzner B, Blackburn TM, Dyer EE (2017) Global hotspots and correlates of alien species richness across taxonomic groups. Nat Ecol Evol 1(7):1-7. https://doi.org/10.1038/s41559-017-0186 Elberri AI, Galal-Khallaf A, Gibreel SE, El-Sakhawy SF, El-Garawani I, ElNabi SE, Mohammed-Geba K (2020) DNA and eDNA-based tracking of the North African sharptooth catfish Clarias gariepinus. Mol Cell Probes 51:101535. https://doi.org/10.1016/j.mcp.2020.101535 Evans NT, Lamberti GA (2018) Freshwater fisheries assessment using environmental DNA: A primer on the method, its potential, and shortcomings as a conservation tool. Fish Res 197:60-6. https://doi.org/10.1016/j.fishres.2017.09.013 Froese R, Pauly D. FishBase. World Wide Web electronic publication, version 2022-02. www.fishbase.org Goyal N, Krishna S, Shah K, Rashid I, Sharma GP (2021) Integrating the biological invasion paradigm in the policy framework in India. Trop Ecol 62(1):144-8. https://doi.org/10.1007/s42965-020-00117-2 Goldberg CS, Turner CR, Deiner K, Klymus KE, Thomsen PF, Murphy MA, Spear SF, McKee A, Oyler‐McCance SJ, Cornman RS, Laramie MB (2016) Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol Evol 7(11):1299-307. https://doi.org/10.1111/2041-210X.12595 Gopi KC, Radhakrishnan C (2002) Impact assessment of African Catfish (Clarias gariepinus) infestation on indigenous fish diversity in Manalur Grama Panchayat, Thrissur District, Kerala: a case study. ENVIS Newsletter, Zoological Survey of India 9(1-2):9-12 Jo T, Ikeda S, Fukuoka A, Inagawa T, Okitsu J, Katano I, Doi H, Nakai K, Ichiyanagi H, Minamoto T (2021) Utility of environmental DNA analysis for effective monitoring of invasive fish species in reservoirs. Ecosphere 12(6):e03643. https://doi.org/10.1002/ecs2.3643 Keskin E (2014) Detection of invasive freshwater fish species using environmental DNA survey. Biochem Syst Ecol 1;56:68-74. https://doi.org/10.1016/j.bse.2014.05.003 Klymus KE, Merkes CM, Allison MJ, Goldberg CS, Helbing CC, Hunter ME, Jackson CA, Lance RF, Mangan AM, Monroe EM, Piaggio AJ (2020) Reporting the limits of detection and quantification for environmental DNA assays. Environ DNA 2(3):271-82. https://doi.org/10.1002/edn3.29 Klymus KE, Ramos DV, Thompson NL, Richter CA (2020) Development and testing of species-specific quantitative PCR assays for environmental DNA applications. J Visualized Exp 5(165):e61825. https://doi.org/10.3791/61825 Krishnakumar K, Ali A, Pereira B, Raghavan R (2011) Unregulated aquaculture and invasive alien species: a case study of the African Catfish Clarias gariepinus in Vembanad Lake (Ramsar Wetland), Kerala, India. J Threat Taxa 26;3(5):1737-44. https://doi.org/10.11609/JoTT.o2378.1737-44 Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonák J, Lind K, Sindelka R, Sjöback R, Sjögreen B, Strömbom L, Ståhlberg A (2006) The real-time polymerase chain reaction. Mol Aspects Med 1;27(2-3):95-125. https://doi.org/10.1016/j.mam.2005.12.007 Meyerson LA, Pauchard A, Brundu G, Carlton JT, Hierro JL, Kueffer C, Pandit MK, Pyšek P, Richardson DM, Packer JG (2022) Moving Toward Global Strategies for Managing Invasive Alien Species. In: Clements DR, Upadhyaya MK, Joshi S, Shrestha A (ed) Global Plant Invasions, Springer, Cham, pp 331-360. https://doi.org/10.1007/978-3-030-89684-3_16 Mungi NA, Kaushik M, Mohanty NP, Rastogi R, Antony Johnson J, Qureshi Q (2019) Identifying knowledge gaps in the research and management of invasive species in India. Biologia 74(6):623-9. https://doi.org/10.2478/s11756-018-00186-8 Rees HC, Maddison BC, Middleditch DJ, Patmore JR, Gough KC (2014) The detection of aquatic animal species using environmental DNA–a review of eDNA as a survey tool in ecology J Appl Ecol 51(5):1450-9. https://doi.org/10.1111/1365-2664.12306 Roshni K, Renjithkumar CR, Raghavan R, Dahanukar N, Kutty R (2020) Population dynamics and management strategies for the invasive African Catfish Clarias gariepinus (Burchell, 1822) in the Western Ghats hotspot. J Threat Taxa 26;12(10):16380-4. https://doi.org/10.11609/jott.6222.12.10.16380-16384 Sandilyan S, Meenakumari B, Babu CR, Mandal R (2018) Invasive alien species of India. Centre for Biodiversity Policy and Law (CEBPOL), National Biodiversity Authority, MoEFCC, Govt. of India Sandilyan S (2022) Alien fish species in Indian inland wetlands: current status and future challenges. Wetlands Ecol Manage 13:1-5. Wetlands Ecol Manage 30, 423–437 (2022). https://doi.org/10.1007/s11273-022-09870-8 Seebens H, Bacher S, Blackburn TM, Capinha C, Dawson W, Dullinger S, Genovesi P, Hulme PE, van Kleunen M, Kühn I, Jeschke JM (2021) Projecting the continental accumulation of alien species through to 2050. Global Change Biol 27(5):970-82. https://doi.org/10.1111/gcb.15333 Singh AK, Kumar D, Srivastava SC, Ansari A, Jena JK, Sarkar UK (2013) Invasion and impacts of alien fish species in the Ganga River, India. Aquat. Ecosyst. Health Manage 1;16(4):408-14. https://doi.org/10.1080/14634988.2013.857974 Taberlet P, Coissac E, Hajibabaei M, Rieseberg LH. Environmental dna (2012) Mol Ecol 21(8):1789-93. https://doi.org/10.1111/j.1365-294X.2012.05542.x Supplementary Files SupplementaryfileAfricancatfishassaypaper.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 28 Jul, 2022 Reviewers invited by journal 18 Jul, 2022 Editor invited by journal 16 Jul, 2022 Editor assigned by journal 16 Jul, 2022 First submitted to journal 12 Jul, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1850303","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":121942850,"identity":"f2f10eb1-55ce-4182-843e-f52d507debbe","order_by":0,"name":"Gopi Krishnan","email":"","orcid":"","institution":"Centre for Cellular and Molecular Biology CSIR","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gopi","middleName":"","lastName":"Krishnan","suffix":""},{"id":121942851,"identity":"ca9d52f8-852d-4f67-9af4-3b7487913d9f","order_by":1,"name":"Meher Sunkara","email":"","orcid":"","institution":"Centre for Cellular and Molecular Biology CSIR","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Meher","middleName":"","lastName":"Sunkara","suffix":""},{"id":121942852,"identity":"804a08d2-5d7f-4fe5-ba80-339b371fc448","order_by":2,"name":"Rajeev Raghavan","email":"","orcid":"","institution":"Kerala University of Fisheries and Ocean Studies","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rajeev","middleName":"","lastName":"Raghavan","suffix":""},{"id":121942853,"identity":"75523db2-6344-442d-851b-31b7fcd0a7d9","order_by":3,"name":"Govindhaswamy Umapathy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYLCCD0BsAGFKEKeDcQbJWph5EFqIAPIR2YmfbWrsos0ZeB8+/MFgkUdQi+GN3M3SOceSc3c2sBsb8zBIFBPWMiN3g3Ruw4HcDQfY2KSBfklsIELL5t+WEC3sP38Qo0VeInebNCPUFgYeYrQY8LzdZtkD8kszG7M0jwExtrTnbr7xo8Yudzt7G+PHHxV1RNhyAMZiBnMJqQfZQtDQUTAKRsEoGAUAZWk32hvI27YAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-4086-7445","institution":"Centre for Cellular and Molecular Biology CSIR","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Govindhaswamy","middleName":"","lastName":"Umapathy","suffix":""}],"badges":[],"createdAt":"2022-07-12 11:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1850303/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1850303/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":24301941,"identity":"919882d9-930f-463b-805a-8b1cc7b3d3a5","added_by":"auto","created_at":"2022-07-25 17:35:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":373551,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e PCR validation of primers against the target species \u003cem\u003eC. gariepinus\u003c/em\u003e and 12 additional non-target species.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1850303/v1/04fe06e24a90e367c7ad2435.png"},{"id":24301942,"identity":"bfd2deec-fdfd-49d3-8652-73f98c69cf93","added_by":"auto","created_at":"2022-07-25 17:35:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":30021,"visible":true,"origin":"","legend":"\u003cp\u003eA linear regression forming the standard curve derived from the amplification of standards of 10-fold dilutions ranging from 1 copy to 10\u003csup\u003e5\u003c/sup\u003e copies. The Cp value or crossing point value is the threshold for cycle at quantitation.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1850303/v1/3a843a61dca9601ef8978412.png"},{"id":24302205,"identity":"3b3bd670-485c-4603-ada0-08f46c9c9032","added_by":"auto","created_at":"2022-07-25 17:40:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":22359,"visible":true,"origin":"","legend":"\u003cp\u003eMean copy number of initial target DNA per reaction for each lake/sample. OS = Osmansagar, AP= Ameenpur, MAN = Manjeera, MA = Mir Alam tank, PU = Pushparahil Cheruvu, TC = Tallakunta, KC = Kandi Cheruvu, LH = Langar-houz Talab, MC = Mantrala Cheruvu, MT = Meerpet Talab, MS = Mehaboob Sagar, Z= Nehru zoological park, ENC = Environmental negative control\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1850303/v1/5a1b70b60fcc62797e9a648c.png"},{"id":24302206,"identity":"be1bf8f0-e0c5-4c2a-ada4-ad61d4fb5d23","added_by":"auto","created_at":"2022-07-25 17:40:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":331422,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1850303/v1/039d17fb-4323-4f0a-9fc0-a06e34da3c09.pdf"},{"id":24301944,"identity":"eedff3e7-cac7-406b-a22a-4e32fbd765a7","added_by":"auto","created_at":"2022-07-25 17:35:28","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":912008,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryfileAfricancatfishassaypaper.docx","url":"https://assets-eu.researchsquare.com/files/rs-1850303/v1/ce1385e5ab8402f9559c4c64.docx"}],"financialInterests":"","formattedTitle":"Development of a species-specific qPCR assay for the detection of invasive African Sharptooth catfish (Clarias gariepinus) using environmental DNA","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe intricate connection of biological invasions with increasing globalization, trade, culture, and human and climate-mediated events makes prevention and control of invasive species an exceptional challenge (Meyerson et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). With predictions that the number of alien species, as well as the intensity of biological invasions will accelerate on most continents (Seebens et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), there is an urgent need to develop and implement effective solutions for control, monitoring and management. Such strategies are particularly required in regions noted for their exceptional biodiversity and endemism, and where threats from alien species are remarkably high (see Dawson et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn India, a mega-diversity country, threats to biodiversity from alien invasive species are on the rise, but management and control of such species is inadequate because of insufficient research, funding and policies (Goyal et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Mungi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A recent synthesis by Bang et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) revealed that the Indian economy had incurred a loss of at least US\u003cspan\u003e$\u003c/span\u003e 127.3\u0026nbsp;billion between 1960 and 2020 due to invasive species, with an average annual cost of US\u003cspan\u003e$\u003c/span\u003e 2.1\u0026nbsp;billion. Bang et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) further cautioned that these calculations could likely be gross underestimations, since they contribute to only a small fraction of the actual costs incurred.\u003c/p\u003e \u003cp\u003eAbout 7.2% of global fish diversity occurs in India (Froese \u0026amp; Pauly 2022). Though there is no comprehensive assessment, or a list of alien invasive fish species in India, it has been estimated that \u0026gt;\u0026thinsp;600 fish species have been introduced into the country, with 55 of them having established sustainable reproductive populations (Sandilyan \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Among those 55 species, the National Biodiversity Authority (NBA) has declared 14 inland and freshwater species as \u0026lsquo;highly invasive\u0026rsquo; (Sandilyan et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), which includes \u003cem\u003eClarias gariepinus\u003c/em\u003e (African sharptooth catfish). Further this species has been banned from farming and selling by the Government of India since the year 1997 (Gopi and Radhakrishnan \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2002\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eClarias gariepinus\u003c/em\u003e is widely regarded as one of the world\u0026rsquo;s most successful aquatic invader due to its generalist (but mostly piscivorous and predatory) feeding habits, high fecundity, fast growth and eurytopic physiological traits (Booth et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The species has a widespread presence in around 30 countries, including India, impacting native fish and other aquatic species through competition and predation. Despite its significance as an invasive alien species, only few studies have focused on the occurrence and distribution of \u003cem\u003eC. gariepinus\u003c/em\u003e in the country (Krishnakumar et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Singh et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Roshni et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and no attempt has been made so far to map its distribution in India.\u003c/p\u003e \u003cp\u003eTraditional methods to detect invasive fish species such as visual observations, using traps, nets, bioacoustics, etc., and also employing morphological and behavioural data can be biased, intrusive and requires some level of taxonomic expertise (Beng et al, 2020). An alternative method that has been highly favoured by conservationists in recent years is the use of environmental DNA (eDNA) to detect aquatic species. eDNA, which is a complex mixture of DNA obtained from different organisms in soil, sediment, water and even air (Taberlet 2012), can be exploited to detect aquatic species including invasive species (Jo et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) with high accuracy at relatively low cost. With sequencing techniques becoming more affordable and easily available, eDNA based molecular methods are increasingly adopted in conservation science. With a big chasm in invasion biology research in India, detection of target species remains the crucial step in the control and management of invasive species. Here, we successfully show the validation of a quantitative PCR based assay utilising eDNA, rigorously designed, optimized, and tested to specifically detect the invasive \u003cem\u003eClarias gariepinus\u003c/em\u003e.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePrimer designing and screening\u003c/h2\u003e \u003cp\u003eWe targeted the \u0026lsquo;Cytochrome b\u0026rsquo; region of the mitochondria to design primers, and retrieved the sequences of three species of Clariids, \u003cem\u003eClarias gariepinus\u003c/em\u003e, \u003cem\u003eC. dussumieri\u003c/em\u003e and \u003cem\u003eC. batrachus\u003c/em\u003e from NCBI GenBank (accession numbers: NC_027661.1:14366\u0026ndash;15503, NC_037193.1:14365\u0026ndash;15502, NC_023923.1:14361\u0026ndash;15498 respectively). These sequences were subsequently aligned using Clustal Omega (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/Tools/msa/clustalo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the alignment file was imported to the primer designing module of ssPRIMER (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mattortonapps.com/shiny/ssPRIMER\u003c/span\u003e\u003cspan address=\"https://www.mattortonapps.com/shiny/ssPRIMER\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), a GUI based tool used for designing species specific primers for qPCR assays. Potential primer pairs were designed by selecting appropriate parameters (see supplementary file). From the list of designed primers, the primer pairs that had a higher propensity to form primer dimers were omitted from consideration for qPCR assay. To further screen the primers, shortlisted primers were assessed \u003cem\u003ein silico\u003c/em\u003e using NCBI\u0026rsquo;s Primer-Blast tool, and any primers that amplified other sympatric species were excluded. The details of the finalised primer pair are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSelected primer pair and their sequence used for detecting African shartooth catfish \u003cem\u003eClarias gariepinus\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence 5\u0026rsquo;-\u0026gt; 3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLength (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTm (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTarget amplicon length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgar_CytB_F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGCCATACACTACACTTCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCgar_CytB_R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTATGAGCCGTAGTAAAGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro testing of primers\u003c/h2\u003e \u003cp\u003eSince the DNA sequence databases were not complete with sequences of all extant species, \u003cem\u003ein silico\u003c/em\u003e analysis alone does not determine specificity of the screened primer pair. Hence, we tested them for specificity \u003cem\u003ein vitro\u003c/em\u003e as well. Upon optimizing the PCR conditions (see supplementary file) for the selected primer pair, we tested the primers \u003cem\u003ein vitro\u003c/em\u003e against the genomic DNA extractions of \u003cem\u003eC. gariepinus\u003c/em\u003e and a few additional non-target species by performing a PCR assay. The non-target species selected for this assay comprised phylogenetically closely related sympatric species within the genus \u003cem\u003eClarias\u003c/em\u003e (\u003cem\u003eC. dussumieri, C. magur and C. batrachus\u003c/em\u003e), sympatric species within Siluriformes (\u003cem\u003eGlyptothorax gracilis, Pangasianodon hypophthalmus, Horabagrus brachysoma and Plotosus canius\u003c/em\u003e) and a few distantly related sympatric species from orders other than Siluriformes (\u003cem\u003eLabeo rohita, Labeo catla, Cyprinus carpio, Oreochromis niloticus and Tenualosa ilisha\u003c/em\u003e). The PCR products were then visualised in 2% agarose gel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eqPCR assay optimization\u003c/h2\u003e \u003cp\u003eTo determine efficiency of the primers and linear range, a standard curve was generated by including dilutions of standards, i.e., known copies of target amplicons comprising the target sequence. The standards were prepared in the laboratory through PCR reactions followed by purification of the amplicons and calculation of their copy number (see supplementary file). A standard curve was generated with the dilutions of standards ranging from 10\u003csup\u003e0\u003c/sup\u003e copies/ reaction to 10\u003csup\u003e5\u003c/sup\u003e copies/ reaction. To determine the Limit of Detection (lowest initial DNA concentration with 95% detection) and Limit of Quantification (lowest initial DNA concentration quantifiable with a coefficient of variation below 35%), we performed a qPCR assay using 4-fold dilutions of standards ranging from 1 copy/reaction to 1024 copies/ reaction. The Limits of Detection and Quantification were calculated using the LOD/LOQ calculator (Klymus et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003ea). All qPCR experiments were performed in Roche Lightcycler 480 II instrument, and components of the qPCR reaction mixture for each reaction are given in the supplementary file.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSampling for field testing\u003c/h2\u003e \u003cp\u003eTo test the performance of the assay in field conditions, we randomly selected 11 lakes in and around Hyderabad, Telangana State, India, for the pilot study. Two litres of water were collected in triplicate from each site during the month of January 2021 and filtered in the laboratory on the same day. 250 ml of water from each sample was filtered using disposable 50 ml syringes through mixed cellulose ester membrane of 47 mm in diameter and of 0.45 \u0026micro;m pore size (Merck life science Pvt. Ltd.). After filtration, the filter paper was cut into two halves, with one half utilised for DNA isolation and the other stored in -30\u0026deg;C. Besides the 11 lakes, we also included a sample from a pond located inside the Nehru Zoological Park in Hyderabad as the positive control, where the presence of \u003cem\u003eC. gariepinus\u003c/em\u003e was visually confirmed. Since we could not reliably identify any natural water body in and around Hyderabad where \u003cem\u003eC. gariepinus\u003c/em\u003e is confirmed to be absent, we included a sample from our laboratory aquarium as the environmental negative control. Between filtration of each sample, the filter assemblies were bleached with 4% Sodium hypochlorite solution to prevent contamination between samples. eDNA was extracted from the filters by the standard Phenol-Chloroform-Isoamyl alcohol method. After eDNA extraction, the DNA concentrations of all samples were adjusted to 20 ng/\u0026micro;l for the subsequent qPCR assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eqPCR detection of eDNA\u003c/h2\u003e \u003cp\u003eEach eDNA sample was loaded in three technical replicates, along with negative controls, and the assay was run in Roche Lightcycler 480 II. The copy numbers of the target gene in each eDNA sample were calculated with the help of the standard curve generated during the qPCR assay optimization stage. For the reactions where primer dimers were observed through the Melt curve analysis, the assay was repeated for the respective samples. The qPCR assays did not involve any additional probes, since the designed primers were highly specific to the target species. All qPCR assays were performed in a separate laboratory space in a different floor/section of the building dedicated for qPCR experiments to avoid contamination. The components of the qPCR reaction mixture and the reaction conditions are given in the supplementary file. The qPCR products were purified and sequenced by the Sanger sequencing method. The sequences were then analysed in NCBI\u0026rsquo;s nucleotide BLAST tool to verify the species identity of the amplified product.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003eSelected primer pair\u003c/h2\u003e\n \u003cp\u003eAfter rigorous screening of the designed primers and their \u003cem\u003ein silico\u003c/em\u003e analysis, we finalised the following primer pair (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) for the study.\u003c/p\u003e\n \u003cp\u003e\u003cspan class=\"BoldItalic\" name=\"Emphasis\" type=\"BoldItalic\"\u003eIn vitro\u003c/span\u003e \u003cstrong\u003eprimer specificity assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eFigure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e provides details of the PCR products of tissue DNA samples from the target and non-target species amplified with the selected primer pair. A crisp band was observed only in the PCR product of \u003cem\u003eC. gariepinus\u003c/em\u003e DNA sample at the expected range of 171 bp, while no other bands were observed for the closely related and other non-target species.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003eqPCR assay standardization\u003c/h2\u003e\n \u003cp\u003eTo estimate the absolute copy number of the target gene in eDNA samples, we generated the standard curve with the R\u003csup\u003e2\u003c/sup\u003e value of 0.9973, efficiency of 96.5% and the y-intercept value (the predicted Cp of a reaction with 1 copy of the target sequence) at 34.76 cycles (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Through LOD/LOQ assay, the limit of detection was found to be four copies and the limit of quantification was found to be nine copies.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003eeDNA detection in representative samples\u003c/h2\u003e\n \u003cp\u003eOf the 12 lake-water samples, 11 produced amplifications, including the positive sample from the pond inside the Nehru Zoological Park (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Only one sample (site KC) was negative. The copy numbers calculated for all the positive samples using the standard curve were above the limit of detection and quantification, confidently indicating the presence of \u003cem\u003eC. gariepinus\u003c/em\u003e. No amplification was observed in the environmental negative control (ENC) as well as in the no template controls.\u003c/p\u003e\n \u003cp\u003eTo confirm the species identity of positive detections in eDNA samples, sequences of the amplified products were analysed using NCBI nucleotide BLAST. All sequences were confirmed to represent \u003cem\u003eC. gariepinus\u003c/em\u003e with \u0026gt;\u0026thinsp;98% identity.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eWhile real-time quantitative PCR assays have been used in various fields involving detection and quantification of specific nucleotide sequences (Kubista et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), its potential as a tool for environmental DNA studies is only recently emerging. In this study, we designed a cost-effective eDNA based qPCR assay for the detection of North African sharptooth catfish in natural aquatic ecosystems. Before embarking on a large-scale eDNA based study to map the distribution of any target species, a pilot study is recommended to standardize the design, including the development and validation of assay, as well as considerations for contamination and suitable analysis methods (Goldberg et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Such a pilot study also enables re-optimization and validation of the assay when applied in different geographical regions.\u003c/p\u003e \u003cp\u003eMitochondrial gene sequences are preferred as the target sequence for eDNA studies as it increases the chances of detection because of the high copy number in cells (Rees et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), despite their inability to distinguish hybrids (Evans et al. 2017). Also, incorporation of specificity (i.e., detection of only the target species) and sensitivity (i.e., detection of target DNA at low quantities) assessments is vital to make the assay more reliable (Klymus et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003eb). While the \u003cem\u003ein silico\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e validation of primers against the non-target species informs about the specificity of the assay, the limit of Detection (LOD) and Limit of Quantification (LOQ) assessments inform about sensitivity. To ensure that the primers are specific to the target species, it is imperative to include the phylogenetically closely related species and distantly related sympatric species in the \u003cem\u003ein vitro\u003c/em\u003e specificity assay. In addition, verification of the positive detections by sequencing the PCR products adds another layer to assay integrity.\u003c/p\u003e \u003cp\u003eKeskin (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and Elberri et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) have previously demonstrated the importance of qPCR based eDNA studies to detect \u003cem\u003eC. gariepinus\u003c/em\u003e. However, the primers used in their studies were amplifying other Indian congeneric \u003cem\u003eClarias\u003c/em\u003e species (e.g., \u003cem\u003eC. magur\u003c/em\u003e, \u003cem\u003eC. dussumieri\u003c/em\u003e) as well. Hence, our assay was optimized to detect \u003cem\u003eC. gariepinus\u003c/em\u003e in India with high specificity, by including all native species of the genus \u003cem\u003eClarias\u003c/em\u003e, and selected species of other closely related families in the \u003cem\u003ein vitro\u003c/em\u003e validation. For future studies outside India, we suggest revalidation of the specificity of our assay by including other co-occurring closely related species in the geographical range of interest. Since our assay does not include any additional probes, this has reduced the cost involved and can be used by any laboratory equipped with a basic qPCR machine.\u003c/p\u003e \u003cp\u003eThe goal of developing, optimizing and testing a species-specific qPCR assay for eDNA based studies with stringent quality control measures is to detect the target species. This pilot study will serve as a foundation to map the distribution of invasive \u003cem\u003eC. gariepinus\u003c/em\u003e, and also as a useful tool to inform management authorities for timely control and regular monitoring of this species. Finally, the workflow employed in this study can also serve as a template to design and optimize eDNA based assays to detect other invasive and/or threatened species for improved aquatic management and conservation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge the support provided by Nehru Zoological Park, Hyderabad. We thank Shivakumara Manu and Manisha Ray for their constant support and suggestions throughout the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFUNDING\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was funded by the Department of Biotechnology (DBT), Govt. of India, vide grant no. BT/PR29032/FCB/125/4/2018 received by Govindhaswamy Umapathy. Gopi Krishnan was supported by a PhD fellowship from Council of Scientific \u0026amp; Industrial Research, Govt. of India.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAVAILABILITY OF DATA AND MATERIAL\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are available from the corresponding author upon reasonable request.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS DECLARATIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConflict of interest: The authors declare that they have no conflict of interest. The authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003eEthical approval: The study was carried out by complying with the institutional ethical standards.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBang A, Cuthbert RN, Haubrock PJ, Fernandez RD, Moodley D, Diagne C, Turbelin AJ, Renault D, Dalu T, Courchamp F (2022) Massive economic costs of biological invasions despite widespread knowledge gaps: a dual setback for India. Biol Invasions 5:1-23. https://doi.org/10.1007/s10530-022-02780-z\u003c/li\u003e\n\u003cli\u003eBeng KC, Corlett RT (2020) Applications of environmental DNA (eDNA) in ecology and conservation: opportunities, challenges and prospects. Biodivers Conserv 29(7):2089-121. https://doi.org/10.1007/s10531-020-01980-0\u003c/li\u003e\n\u003cli\u003eBooth AJ, Traasg GR, Weyl OL (2010) Adult African sharptooth catfish, Clarias gariepinus, population dynamics in a small invaded warm-temperate impoundment. Afr Zool 45(2):299-308. https://doi.org/10.1080/15627020.2010.11657279\u003c/li\u003e\n\u003cli\u003eDawson W, Moser D, Van Kleunen M, Kreft H, Pergl J, Py\u0026scaron;ek P, Weigelt P, Winter M, Lenzner B, Blackburn TM, Dyer EE (2017) Global hotspots and correlates of alien species richness across taxonomic groups. Nat Ecol Evol 1(7):1-7. https://doi.org/10.1038/s41559-017-0186\u003c/li\u003e\n\u003cli\u003eElberri AI, Galal-Khallaf A, Gibreel SE, El-Sakhawy SF, El-Garawani I, ElNabi SE, Mohammed-Geba K (2020) DNA and eDNA-based tracking of the North African sharptooth catfish Clarias gariepinus. Mol Cell Probes 51:101535. https://doi.org/10.1016/j.mcp.2020.101535\u003c/li\u003e\n\u003cli\u003eEvans NT, Lamberti GA (2018) Freshwater fisheries assessment using environmental DNA: A primer on the method, its potential, and shortcomings as a conservation tool. Fish Res 197:60-6. https://doi.org/10.1016/j.fishres.2017.09.013\u003c/li\u003e\n\u003cli\u003eFroese R, Pauly D. FishBase. World Wide Web electronic publication, version 2022-02. www.fishbase.org\u003c/li\u003e\n\u003cli\u003eGoyal N, Krishna S, Shah K, Rashid I, Sharma GP (2021) Integrating the biological invasion paradigm in the policy framework in India. Trop Ecol 62(1):144-8. https://doi.org/10.1007/s42965-020-00117-2\u003c/li\u003e\n\u003cli\u003eGoldberg CS, Turner CR, Deiner K, Klymus KE, Thomsen PF, Murphy MA, Spear SF, McKee A, Oyler‐McCance SJ, Cornman RS, Laramie MB (2016) Critical considerations for the application of environmental DNA methods to detect aquatic species. Methods Ecol Evol 7(11):1299-307. https://doi.org/10.1111/2041-210X.12595\u003c/li\u003e\n\u003cli\u003eGopi KC, Radhakrishnan C (2002) Impact assessment of African Catfish (Clarias gariepinus) infestation on indigenous fish diversity in Manalur Grama Panchayat, Thrissur District, Kerala: a case study. ENVIS Newsletter, Zoological Survey of India 9(1-2):9-12\u003c/li\u003e\n\u003cli\u003eJo T, Ikeda S, Fukuoka A, Inagawa T, Okitsu J, Katano I, Doi H, Nakai K, Ichiyanagi H, Minamoto T (2021) Utility of environmental DNA analysis for effective monitoring of invasive fish species in reservoirs. Ecosphere 12(6):e03643. https://doi.org/10.1002/ecs2.3643\u003c/li\u003e\n\u003cli\u003eKeskin E (2014) Detection of invasive freshwater fish species using environmental DNA survey. Biochem Syst Ecol 1;56:68-74. https://doi.org/10.1016/j.bse.2014.05.003\u003c/li\u003e\n\u003cli\u003eKlymus KE, Merkes CM, Allison MJ, Goldberg CS, Helbing CC, Hunter ME, Jackson CA, Lance RF, Mangan AM, Monroe EM, Piaggio AJ (2020) Reporting the limits of detection and quantification for environmental DNA assays. Environ DNA 2(3):271-82. https://doi.org/10.1002/edn3.29\u003c/li\u003e\n\u003cli\u003eKlymus KE, Ramos DV, Thompson NL, Richter CA (2020) Development and testing of species-specific quantitative PCR assays for environmental DNA applications. J Visualized Exp 5(165):e61825. https://doi.org/10.3791/61825\u003c/li\u003e\n\u003cli\u003eKrishnakumar K, Ali A, Pereira B, Raghavan R (2011) Unregulated aquaculture and invasive alien species: a case study of the African Catfish Clarias gariepinus in Vembanad Lake (Ramsar Wetland), Kerala, India. J Threat Taxa 26;3(5):1737-44. https://doi.org/10.11609/JoTT.o2378.1737-44\u003c/li\u003e\n\u003cli\u003eKubista M, Andrade JM, Bengtsson M, Forootan A, Jon\u0026aacute;k J, Lind K, Sindelka R, Sj\u0026ouml;back R, Sj\u0026ouml;green B, Str\u0026ouml;mbom L, St\u0026aring;hlberg A (2006) The real-time polymerase chain reaction. Mol Aspects Med 1;27(2-3):95-125. https://doi.org/10.1016/j.mam.2005.12.007\u003c/li\u003e\n\u003cli\u003eMeyerson LA, Pauchard A, Brundu G, Carlton JT, Hierro JL, Kueffer C, Pandit MK, Py\u0026scaron;ek P, Richardson DM, Packer JG (2022) Moving Toward Global Strategies for Managing Invasive Alien Species. In: Clements DR, Upadhyaya MK, Joshi S, Shrestha A (ed) Global Plant Invasions, Springer, Cham, pp 331-360. https://doi.org/10.1007/978-3-030-89684-3_16\u003c/li\u003e\n\u003cli\u003eMungi NA, Kaushik M, Mohanty NP, Rastogi R, Antony Johnson J, Qureshi Q (2019) Identifying knowledge gaps in the research and management of invasive species in India. Biologia 74(6):623-9. https://doi.org/10.2478/s11756-018-00186-8\u003c/li\u003e\n\u003cli\u003eRees HC, Maddison BC, Middleditch DJ, Patmore JR, Gough KC (2014) The detection of aquatic animal species using environmental DNA\u0026ndash;a review of eDNA as a survey tool in ecology J Appl Ecol 51(5):1450-9. https://doi.org/10.1111/1365-2664.12306\u003c/li\u003e\n\u003cli\u003eRoshni K, Renjithkumar CR, Raghavan R, Dahanukar N, Kutty R (2020) Population dynamics and management strategies for the invasive African Catfish Clarias gariepinus (Burchell, 1822) in the Western Ghats hotspot. J Threat Taxa 26;12(10):16380-4. https://doi.org/10.11609/jott.6222.12.10.16380-16384\u003c/li\u003e\n\u003cli\u003eSandilyan S, Meenakumari B, Babu CR, Mandal R (2018) Invasive alien species of India. Centre for Biodiversity Policy and Law (CEBPOL), National Biodiversity Authority, MoEFCC, Govt. of India\u003c/li\u003e\n\u003cli\u003eSandilyan S (2022) Alien fish species in Indian inland wetlands: current status and future challenges. Wetlands Ecol Manage 13:1-5. Wetlands Ecol Manage 30, 423\u0026ndash;437 (2022). https://doi.org/10.1007/s11273-022-09870-8\u003c/li\u003e\n\u003cli\u003eSeebens H, Bacher S, Blackburn TM, Capinha C, Dawson W, Dullinger S, Genovesi P, Hulme PE, van Kleunen M, K\u0026uuml;hn I, Jeschke JM (2021) Projecting the continental accumulation of alien species through to 2050. Global Change Biol 27(5):970-82. https://doi.org/10.1111/gcb.15333\u003c/li\u003e\n\u003cli\u003eSingh AK, Kumar D, Srivastava SC, Ansari A, Jena JK, Sarkar UK (2013) Invasion and impacts of alien fish species in the Ganga River, India. Aquat. Ecosyst. Health Manage 1;16(4):408-14. https://doi.org/10.1080/14634988.2013.857974\u003c/li\u003e\n\u003cli\u003eTaberlet P, Coissac E, Hajibabaei M, Rieseberg LH. Environmental dna (2012) Mol Ecol 21(8):1789-93. https://doi.org/10.1111/j.1365-294X.2012.05542.x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"biological-invasions","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"binv","sideBox":"Learn more about [Biological Invasions](https://www.springer.com/journal/10530)","snPcode":"10530","submissionUrl":"https://submission.nature.com/new-submission/10530/3","title":"Biological Invasions","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Invasive species, Environmental DNA, Clarias gariepinus, Quantitative PCR","lastPublishedDoi":"10.21203/rs.3.rs-1850303/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1850303/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDetection and monitoring of target species is the primary strategy in the management and control of biological invasions. Traditional methods to detect invasive species are time consuming and cumbersome with a requisite for trained taxonomists for identification of aquatic species. Environmental DNA (eDNA)-based molecular methods offer an alternative, as they are quick, cost-effective and requires minimal manpower. In this study, we design and optimize a reliable eDNA-based quantitative PCR assay to detect the African Sharptooth catfish, a highly invasive and banned species in India. Here, we delineate the step-by-step processes involved in the design and optimization of the assay, and show its performance through field-testing in selected water bodies in and around the city of Hyderabad. The present workflow can be used to design assays to detect a wide range of aquatic species.\u003c/p\u003e","manuscriptTitle":"Development of a species-specific qPCR assay for the detection of invasive African Sharptooth catfish (Clarias gariepinus) using environmental DNA","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-07-25 17:35:26","doi":"10.21203/rs.3.rs-1850303/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2022-07-28T11:53:19+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-07-18T11:29:45+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Biological Invasions","date":"2022-07-16T13:29:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-07-16T08:00:27+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biological Invasions","date":"2022-07-12T07:42:45+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"biological-invasions","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"binv","sideBox":"Learn more about [Biological Invasions](https://www.springer.com/journal/10530)","snPcode":"10530","submissionUrl":"https://submission.nature.com/new-submission/10530/3","title":"Biological Invasions","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"121cd1a9-b6e3-403c-a6d3-1c5803623331","owner":[],"postedDate":"July 25th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-11-10T15:34:51+00:00","versionOfRecord":[],"versionCreatedAt":"2022-07-25 17:35:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1850303","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1850303","identity":"rs-1850303","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0