Sexual Dimorphic Role of CD14 (Cluster of Differentiation 14) in Salt-Sensitive Hypertension and Renal Injury.

OA: closed
⚙ AI-generated summary by gemini-2.5-flash-lite, 2026-07-14 ⓘ

CD14 knockout exacerbated salt-sensitive hypertension and renal injury in female but not male Dahl rats, with the effect attributed to hematopoietic cells and abrogated by ovariectomy.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

⚙ AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text ⓘ

This study used age-matched male and female Dahl SS rats and CRISPR/Cas9-generated CD14 knockout animals to examine how CD14 influences salt-sensitive hypertension and kidney injury, including whether effects were sex-dependent and mediated by hematopoietic cells versus other tissues. In high-salt feeding experiments, CD14 protein levels shifted with diet, and while CD14 knockout did not alter salt-induced blood pressure or renal damage in males, it worsened these outcomes in females, coinciding with increased renal macrophage infiltration and greater glomerular injury marker nephrin excretion. Bone marrow chimeras showed that loss of CD14 specifically in hematopoietic/immune cells recapitulated the female exacerbation of blood pressure, renal damage, and macrophage infiltration, and ovariectomy abolished the sex-differential phenotype. The paper does not explicitly state a limitation in the provided text, but the study is confined to the Dahl SS salt-challenge model. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Genomic sequence and gene expression association studies in animals and humans have identified genes that may be integral in the pathogenesis of various diseases. CD14 (cluster of differentiation 14)-a cell surface protein involved in innate immune system activation-is one such gene associated with cardiovascular and hypertensive disease. We previously showed that this gene is upregulated in renal macrophages of Dahl salt-sensitive animals fed a high-salt diet; here we test the hypothesis that CD14 contributes to the elevated pressure and renal injury observed in salt-sensitive hypertension. Using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat-associated 9), we created a targeted mutation in the CD14 gene on the Dahl SS (SS/JrHSDMcwi) background and validated the absence of CD14 peptides via mass spectrometry. Radiotelemetry was used to monitor blood pressure in wild-type and CD14-/- animals challenged with high salt and identified infiltrating renal immune cells via flow cytometry. Germline knockout of CD14 exacerbated salt-sensitive hypertension and renal injury in female animals but not males. CD14-/- females demonstrated increased infiltrating macrophages but no difference in infiltrating lymphocytes. Transplant of CD14+/+ or CD14-/- bone marrow was used to isolate the effects of CD14 knockout to hematopoietic cells and confirmed that the differential phenotype observed was due to knockout of CD14 in hematopoietic cells. Ovariectomy was used to remove the influence of female sex hormones, which completely abrogated the effect of CD14 knockout. These studies provide a novel treatment target and evidence of a new dichotomy in immune activation between sexes within the context of hypertensive disease where CD14 regulates immune cell activation and renal injury.
Full text 19,130 characters · extracted from pmc-nxml · 4 sections · click to expand

Methods

The data that support the findings of this study are available from the corresponding author upon reasonable request. Some experiments were performed on age-matched male and female, inbred Dahl SS rats (SS/JrHSDMcwi). Other experiments were performed on littermate male and female, wild type, or homozygous knockout for CD14 animals born from heterozygous breeders (CD14 em2Mcwi ; Rat Genome Database ID:12790610). This strain of SS rats was created by the MCW Gene Editing Rat Resource Center using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeat–associated 9) mutagenesis as we have described previously. 30 , 31 Briefly, these animals were produced by injecting a pX330 plasmid 32 encoding SpCas9 and sgRNA targeting the CD14 coding sequence GGAGTACCTTCCTAAAGCGTGTGG (protospacer adjacent motif underlined) into SS rat embryos. Founder animals were genotyped by Cel-1 assay and confirmed by Sanger sequencing to identify a founder animal harboring a net 7-bp deletion (deleted TAAAGCGT, inserted C; Figure 2A ) within the CRISPR target site. This founder was backcrossed to the parental SS strain, and a breeding colony was established. Offspring will be referred to as CD14 +/+ or CD14 −/− . The colony of breeders was maintained on a 0.4% NaCl diet (AIN-76A; Dyets). For high-salt challenge studies, animals received indwelling carotid catheter radiotelemeter implantation at 7 weeks of age as described below. After recovery and baseline pressure recordings, rats were switched to a 4.0% NaCl diet (AIN-76A) for 21 days. At the end of the study period, animals were deeply anesthetized under isoflurane gas inhalation and the kidneys flushed and excised. For bone marrow transplant experiments, recipients received total body irradiation (11 Gy) as described previously. 2 , 33 Donor animals were euthanized by barbiturate overdose (beauthanasia-D; Midwest Veterinary Supply), both femurs extracted, and bone marrow collected in Dulbecco’s phosphate buffered saline. Bone marrow solution (0.3 mL/recipient) was transplanted into the recipients via conscious tail vein injection. Animals were allowed to recover for 2 weeks before being implanted with telemeters as in the high-salt challenge protocol. To assess the role of female sex hormones, ovariectomy was performed at 6 weeks of age and the female rats allowed to recover before receiving radiotelemeter implantation and high-salt challenge. All experimental animal procedures were approved by the Medical College of Wisconsin Institutional Animal Care and Use Committee. At 7 weeks of age, rats underwent a carotid telemeter implantation surgery as described previously. 4 , 34 Briefly, the rats were deeply anesthetized under isoflurane gas inhalation. Using aseptic technique, the carotid artery was exposed, and a telemetry catheter was inserted into the artery. Telemetry units (HDS10; Data Sciences International, St. Paul, MN) were placed under the skin at the nape of the neck. Analgesics (0.3 mg/kg buprenorphine SR) and antibiotics (25 mg/kg cefazolin) were administered postsurgically. For some experiments, female CD14 +/+ and CD14 −/− rats received an ovariectomy in the sixth week of age. To do this, animals were deeply anesthetized under isoflurane gas inhalation, bilateral flank incisions made, the ovaries located, and a ligature tied tightly around the superior-most end of each horn of the uterus. The ovaries were excised, uterus horns returned to the peritoneum, muscle layer sutured, and the skin closed with absorbable suture. Analgesics (0.3 mg/kg buprenorphine SR) and antibiotics (25 mg/kg cefazolin) were administered postsurgically. For experiments in SS parental animals, overnight urine collections were performed while on the low-salt diet or at the end of the high-salt period, whereas in experiments on CD14 wild-type and knockout animals, collections were performed on days-1, 7, 14, and 21 of the experimental protocol. Urine creatinine values were measured by an autoanalyzer (ACE; Alfa Wasserman, Fairfield, NJ) with an assay based on the Jaffé reaction. Urine albumin was quantified with a fluorescent assay that utilized Albumin Blue 580 dye (Sigma-Aldrich, St. Louis, MO) and a fluorescent plate reader (FL-600; BioTek, Winooski, VT). Urinary protein was quantified utilizing Weichselbaum biuret reagent and an autoanalyzer (Alfa Wasserman). Urine CD14 (Lifespan Bioscience), KIM-1 (kidney injury molecule-1; R&D Systems), and nephrin (Ethos Biosciences) were measured by ELISA according to the manufacturers’ instructions. Immune cells in the kidney were isolated as described previously. 34 , 35 Briefly, the left kidney was minced and incubated in RPMI 1640 media containing L-glutamine, HEPES, collagenase type IV, and DNase. The solution was then passed through a series of 100, 70, and 40-μm filters. Mononuclear cells were separated by Percoll density gradient centrifugation (400 g ×30 minutes at room temperature) and washed with a wash buffer (2% HI-FBS, 5 mmol/L EDTA DPBS). Cells from the kidney were then pelleted and resuspended in the wash buffer solution, and the concentration of cells was determined by counting on a hemocytometer. General characterization of immune cell types was performed as described previously. 34 , 35 Mononuclear cells were incubated with Fc receptor blocking CD32 for 5 minutes followed by an incubation for 30 minutes in a solution containing antibodies for the following extracellular markers: anti-CD3 (eBioscience) for T cells, anti-CD4 (BioLegend) for helper T cells, anti-CD8 (BioLegend) for cytotoxic T cells, anti-CD45R (BD Bioscience) for B cells, and anti-CD11b/c (eBioscience) for monocytes and macrophages. All cells were then analyzed by flow cytometry (LSRII Becton Dickinson) with FACSDIVA software (Becton Dickinson) and FlowJo Software (TreeStar). The gating strategy can be found in Figure S2 in the Data Supplement . Peritoneal macrophages were isolated from CD14 +/+ and CD14 −/− animals and flash frozen. Cells were lysed and proteins digested with trypsin. The resulting peptide mixture was analyzed by data-dependent acquisition to inform identifiable peptides corresponding to CD14. Subsequently, peptide sequences identified as matching wild-type or mutant CD14 sequences were then assayed by parallel reaction monitoring for targeted peptide detection and relative abundance determination. A detailed description of these methods is provided in the Data Supplement . 36 – 38 One-way ANOVA with a Holm-Sidak post hoc, 2-way ANOVA, 2-way Repeated Measures-ANOVA, or Student t test was used where appropriate. Data are expressed as means±SE. A value of P <0.05 was considered statistically significant. SigmaPlot 12.5 software (Systat Software, Inc) or Prism 8 software (GraphPad) was used for all statistical analyses.

Results

Parental Dahl SS males and females on a high-salt diet demonstrated lower serum CD14 compared with those maintained on a low-salt diet ( Figure 1A ; P <0.01 in males, P <0.05 in females). Males also exhibited elevated renal outer medullary CD14 when on the high-salt diet ( Figure 1B ; P <0.01). Urinary CD14 was increased in male rats fed high salt relative to urinary albumin ( Figure 1C ; P <0.001) and creatinine ( Figure 1E ; P <0.001)—a trend consistent in females ( Figure 1D and 1F ). CRISPR/Cas9 was used to target CD14 early in the second exon, which caused an indel resulting from an 8-base pair deletion and 1-base pair insertion ( Figure 2A ). This frameshift deletion at bases 248 to 254 results in a predicted premature stop codon. Targeted analysis of peptide sequences by parallel reaction monitoring demonstrated that genetic knockout of CD14 eliminated detectable CD14 protein as seen by loss of almost all CD14 tryptic peptides ( Figure 2B ). CD14 knockout did not significantly affect the salt-sensitive increase in blood pressure ( Figure 3A ; P >0.05) nor the amount of renal damage as assessed by proteinuria and albuminuria ( Figure 3C and 3E ; P >0.05) in male animals. In contrast, CD14 −/− females demonstrated an augmentation of the salt-induced blood pressure response ( Figure 3B ; P <0.05) and an exacerbation in renal damage assessed by albuminuria and proteinuria ( Figure 3D and 3F ; P <0.05) compared with CD14 +/+ littermates. At the end of the 21-day high-salt challenge, urinary nephrin excretion was increased in CD14 −/− females ( P <0.01) but not CD14 −/− male animals ( Figure S1A and S1B ) indicating damage to the glomerulus. Excretion of KIM-1 was not statistically different between the CD14 +/+ and CD14 −/− rats of either sex ( Figure S1C and S1D ). After the high-salt challenge, the number of infiltrating immune cells in the kidney was evaluated by flow cytometry. CD14 +/+ and CD14 −/− male animals demonstrated a similar number of infiltrating renal immune cells ( Figure 4A through 4C ; P >0.05). In contrast, knockout of CD14 in females resulted in an elevation in infiltrating macrophages ( Figure 4E ; P 0.05). As CD14 is a gene expressed across various tissues, 39 our next goal was to determine whether loss of CD14 specifically in circulating immune cells was responsible for the augmented salt-sensitive response observed in the CD14 −/− female rats. CD14 +/+ female recipients received total body irradiation to eliminate their host immune system followed by bone marrow transfer from either CD14 +/+ or CD14 −/− donor females. The resultant chimeras were CD14 +/+ in all solid tissue but either CD14 +/+ or CD14 −/− in hematopoietic cells. Consistent with what was observed in the germline-whole body knockout, those deficient in CD14 only in hematopoietic cells demonstrated exacerbated renal damage ( Figure 5A ; P <0.05), augmented blood pressure response ( Figure 5B ; P <0.05), and renal macrophage infiltration ( Figure 5D ; P <0.01). An additional elevation in infiltrating B cells was also observed ( Figure 5E ; P <0.05). Representative flow cytometry plots of these renal infiltrating immune cell populations can be found in Figure S2 . Due to the sexual dimorphic effect of knocking out CD14, we assessed whether female sex hormones contribute to this dichotomy. Ovariectomy was performed on CD14 +/+ and CD14 −/− females who were then subjected to a high-salt challenge. Unlike what was observed in Figures 3 through 5 , CD14 +/+ and CD14 −/− OVX females no longer demonstrated differential renal damage ( Figure 6A ; P >0.05), elevation in blood pressure ( Figure 6B ; P >0.05), or immune cell infiltration ( Figure 6C through 6E ; P >0.05).

Discussion

Due to an established relationship between CD14 and hypertension in human populations, we aimed to understand its role in a model of salt-sensitive hypertension, the Dahl SS rat. An initial experiment demonstrated that Dahl SS rats on a high-salt diet have depressed levels of soluble CD14 in the serum compared with those on a low-salt diet. This was accompanied by a reciprocal effect on the urinary levels of CD14, where a high-salt diet in SS rats raised urinary CD14. The increase in renal CD14 is consistent with our previous reports 28 , 29 and is similar to the reported increased urinary soluble CD14 protein observed in patients with rheumatoid arthritis, another condition of sterile inflammation. 40 , 41 In these studies, a highly sensitive mass spectrometry technique was used to confirm a robust and complete knockout of the CD14 protein by CRISPR/Cas9. This approach provided antibody-independent evidence that truncated protein products were not being produced—a frequent concern that arises in genetic knockout studies. This work demonstrated that genetic deletion of CD14 on the Dahl SS background exacerbates salt-sensitive phenotypes including renal damage, hypertension, and macrophage infiltration, establishing a regulatory role for CD14-dependent signaling. It is notable that this exacerbation was only observed in female animals, which would implicate that the regulatory role of CD14 may be estrogen dependent. This conclusion is consistent with the fact that ovariectomy eliminated the differential response to the salt challenge observed in CD14 −/− females. These studies have also shown that CD14-dependent signaling specifically in hematopoietic cells plays this regulatory role. It is interesting to note that mean arterial pressure in female CD14 −/− rats reached similar levels to that of male rats even though the absolute magnitude of urinary renal damage markers and renal immune cell infiltration was approximately half of what was observed in males. As female rats are more often smaller than males, we were not surprised to observe a smaller magnitude in albumin excretion even when blood pressures reached similar levels, consistent with previous reports of Dahl SS rats. 42 Likewise, female kidneys are considerably smaller than male kidneys, which is reflected in a smaller absolute number of infiltrating immune cells in females. Nonetheless, the effect of CD14 knockout in females is clear and eliminates, to some degree, the protection normally observed. Though not assessed in these studies, CD14 −/− mice show enhanced neutrophil recruitment to sites of infection, which provides a beneficial clearance of bacteria. 43 It is possible that, in our model, CD14 −/− female rats may show increased renal neutrophil recruitment, which may cause sterile inflammation to persist. Additional literature has shown that CD14 plays a regulatory role in host immunity. CD14 −/− macrophages show enhanced TNFα (tumor necrosis factor alpha) production in response to Borrelia burgdorferi and importantly, a failure to upregulate negative regulators such as SOCS genes through the p38/MAPK (mitogen-activated protein kinases) pathway. 44 Interestingly, SOCS3 is one of those negative regulators that is upregulated in the renal outer medulla 28 and renal T cells 45 when Dahl SS animals are on a high-salt diet. Work by these authors has also shown that CD14-null animals show persistent inflammation in Lyme disease 46 and postulate that CD14-independent signaling is more “destructive” than CD14-dependent signaling. One of the more striking observations in these studies was that CD14 −/− females showed an exacerbated salt-sensitive response, whereas knockout in male animals had no effect, indicating that female sex hormones may be involved. This was then confirmed by performing ovariectomy before the high-salt challenge, which eliminated the differential response to salt between CD14 +/+ and CD14 −/− females. A possible explanation for these results is that female sex hormones augment inflammatory mechanisms and CD14-dependent signaling regulates this enhancement, where these 2 factors play opposing roles in regulating inflammatory activation. This contradicts the well-established protective role of estrogens observed in the Dahl SS rat. 47 Estradiol (E2) has been shown to upregulate surface expression of the CD14 protein. 48 Treating primary microglia (a type of macrophage) with E2 enhances the proinflammatory response to lipopolysaccharide in ovariectomized female rats. 49 E2 also promotes M1 proinflammatory activation upregulating iNOS (inducible NO synthase) and IL-1β and prevents M2 activation by downregulating IL-10 and arginase. This increase in inflammation seen with E2 treatment may be due to increased cadherin-11–dependent signaling, 50 another gene upregulated in the renal outer medulla of Dahl rats on a high-salt diet. 28 Two important studies by Calippe et al 51 , 52 demonstrated that the inflammatory response to E2 was via estrogen receptor alpha, which increased NFκB (nuclear factor kappa B) p65 transcriptional activity, downregulated the inhibitory PI3K/AKT pathway, and increased the production of IL-1β, IL-6, and TNFα. Notably, these effects were observed with chronic E2 treatment but not with acute treatment. Though these results are from animal models, peritoneal macrophages isolated from human patients showed the exact same effects of enhanced IL-6 and TNFα production with E2 treatment. This was even more pronounced if macrophages came from patients with endometriosis—a state where there is chronic inflammation. 53 Though female sex is associated with protection from cardiovascular disease, females are more likely to be diagnosed with an autoimmune disease. Various investigators have documented that polymorphisms in the human CD14 gene are associated with increased incidence of autoimmune diseases such as autoimmune thyroid disease, 54 Parkinson disease, 55 celiac disease, 56 – 58 and systemic lupus erythematosus (SLE). 59 Interestingly, multiple reports have shown there is no such relationship between CD14 polymorphisms and rheumatoid arthritis. 59 – 63 Women with SLE have reduced monocyte surface expression of CD14 compared with healthy controls, and expression is also reduced when comparing females with SLE to males with SLE. 64 This is consistent with the results of the present studies where loss of CD14 enhanced the disease process. As reviewed by Moulton, 65 estrogen signaling, particularly through ERα, appears to be proinflammatory and contributes to the inflammatory activity of SLE, again consistent with the present results. Though there is a pronounced increased incidence of hypertension in women with SLE, 66 it is unclear how or whether CD14 contributes to this relationship. The results of the present studies may be informative for understanding the relationship between biological sex and prevalence of autoimmune diseases. The mechanistic connection between CD14 and female sex hormones is not yet clear, and we do not yet know whether the effects of these signaling pathways on inflammatory balance are through shared or parallel pathways. Importantly, these studies reinforce the relationship between increased arterial blood pressure, renal immune cell infiltration, and renal injury. Consistent with previous work, 67 increased renal perfusion pressure drives immune cells to infiltrate into the kidney interstitium, which we speculate is in response to increasing pressure-induced tissue damage. These infiltrating immune cells then contribute to the accumulating tissue damage and renal dysfunction, further potentiating the hypertensive phenotype.

Perspectives

CD14—a gene associated with cardiovascular disease in human populations—is also upregulated in Dahl SS rats when on a high-salt diet. We created a genetic knockout of CD14 on the Dahl SS background to demonstrate a novel regulatory role for CD14-dependant signaling in hematopoietic cells. In addition, we show that this is female specific, and the exacerbation of disease seen in CD14 −/− animals is eliminated by ovariectomy. This sexual dimorphism in innate immune system activation was previously unappreciated and provides a new understanding of the difference in pathogenesis between males and females, as well as a targetable pathway.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-09-27T09:11:36.575535+00:00
unpaywall
last seen: 2026-10-03T06:31:36.481334+00:00