Anti-inflammatory effect of Quercetin and rapamycin in rat rheumatoid arthritis model by targeting PI3K/AKT/mTOR pathway

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-04 · read from full text

This preprint studied the anti-inflammatory and disease-modifying effects of quercetin versus the mTOR inhibitor rapamycin in a Freund’s adjuvant-induced rat model of rheumatoid arthritis, using 24 male Sprague Dawley rats grouped into control, arthritic, quercetin (150 mg/kg), and rapamycin treatment. Across the study, both quercetin and rapamycin improved paw diameter/oedema and functional measures (arthritic and gaiting scores) and reduced inflammation-associated markers (serum RF, CRP, IL-1β, and TNF-α), alongside decreased mTOR and p-AKT expression by western blotting/real-time PCR; histology (H&E) supported reduced joint inflammation, though rapamycin fully normalized oedema while quercetin remained higher than control at the end. The authors explicitly note the work is a preprint and not peer reviewed, and the findings are limited to this animal model. Relevance to endometriosis: the paper does not explicitly discuss endometriosis or adenomyosis, so any relationship is limited to its mechanistic PI3K/AKT/mTOR inflammatory signaling theme that is commonly investigated across pelvic inflammatory disorders.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Rheumatoid arthritis (RA) is one of the most prevalent chronic autoimmune disorders that primarily affects the articular tissue and is associated with significant systemic comorbidities. While numerous disease modifying anti-rheumatic drugs (DMARDs) are available for therapy, they are still not enough for most of patients to relieve pain. In addition to having several adverse effects, patients continue to have functional decline despite the use of these drugs. Quercetin, a natural bioflavonoid known for its potent anti-inflammatory and antioxidant properties, presents a promising alternative in the treatment of RA. Thus, our study estimated the effect of quercetin in a Freund’s Adjuvant-induced rat model of RA to test the effectiveness of quercetin through suppression of the PI3K/AKT/mTOR signalling pathways. Furthermore, we compared Quercetin's effects with those of Rapamycin (an established mTOR inhibitor) to validate the pathway's involvement in RA pathogenesis. Twenty-four rats Sprague Dawley of male sex were classified into four groups: negative control, arthritic group, rapamycin treated group, quercetin treated group. At the end of the study, before scarification, assessments of all the following were done, ankle diameter, arthritic score, and gaiting score. Then, animals were scarified, and the following markers were estimated: serum rheumatoid factor (RF) and CRP, and serum IL-1β and TNF-α. mTOR was estimated by western blotting and real-time PCR. p-AKT was evaluated by western blotting. The joint tissues were stained for H&E to detect the main histopathological alterations. Quercetin and rapamycin improved ankle diameter, arthritic score, gaiting score, and decreased joint inflammation markers, as well as decreased mTOR and p-AKT expression. Histopathological examination confirmed the effects of quercetin and rapamycin as detected by light microscopy. Quercetin can modulate pathological and biochemical alternations in Freund adjuvant induced arthritis and can be considered a new possible disease modifying antirheumatic option for rheumatoid arthritis through its effect on PI3K/AKT/mTOR pathway.
Full text 158,358 characters · extracted from preprint-html · click to expand
Anti-inflammatory effect of Quercetin and rapamycin in rat rheumatoid arthritis model by targeting PI3K/AKT/mTOR pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Anti-inflammatory effect of Quercetin and rapamycin in rat rheumatoid arthritis model by targeting PI3K/AKT/mTOR pathway Doaa Hellal, Wafaa Abdelaziz Emam, Amena Rezk Mohammed, Nora Elshehawy Helal, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8540432/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Rheumatoid arthritis (RA) is one of the most prevalent chronic autoimmune disorders that primarily affects the articular tissue and is associated with significant systemic comorbidities. While numerous disease modifying anti-rheumatic drugs (DMARDs) are available for therapy, they are still not enough for most of patients to relieve pain. In addition to having several adverse effects, patients continue to have functional decline despite the use of these drugs. Quercetin, a natural bioflavonoid known for its potent anti-inflammatory and antioxidant properties, presents a promising alternative in the treatment of RA. Thus, our study estimated the effect of quercetin in a Freund’s Adjuvant-induced rat model of RA to test the effectiveness of quercetin through suppression of the PI3K/AKT/mTOR signalling pathways. Furthermore, we compared Quercetin's effects with those of Rapamycin (an established mTOR inhibitor) to validate the pathway's involvement in RA pathogenesis. Twenty-four rats Sprague Dawley of male sex were classified into four groups: negative control, arthritic group, rapamycin treated group, quercetin treated group. At the end of the study, before scarification, assessments of all the following were done, ankle diameter, arthritic score, and gaiting score. Then, animals were scarified, and the following markers were estimated: serum rheumatoid factor (RF) and CRP, and serum IL-1β and TNF-α. mTOR was estimated by western blotting and real-time PCR. p-AKT was evaluated by western blotting. The joint tissues were stained for H&E to detect the main histopathological alterations. Quercetin and rapamycin improved ankle diameter, arthritic score, gaiting score, and decreased joint inflammation markers, as well as decreased mTOR and p-AKT expression. Histopathological examination confirmed the effects of quercetin and rapamycin as detected by light microscopy. Quercetin can modulate pathological and biochemical alternations in Freund adjuvant induced arthritis and can be considered a new possible disease modifying antirheumatic option for rheumatoid arthritis through its effect on PI3K/AKT/mTOR pathway. Health sciences/Diseases Biological sciences/Drug discovery Biological sciences/Immunology Health sciences/Medical research Health sciences/Rheumatology Rheumatoid arthritis Quercetin rapamycin Freund Adjuvant mammalian target of rapamycin Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Rheumatoid arthritis (RA) is classified as an inflammatory disorder of immunologic origin affecting synovial joints in a chronic way. RA is characterised by infiltration of the articular tissue with inflammatory cells and hyperplasia of the synovium, leading to production of pannus and damage of the cartilages and matrix of bone within the joints [1] . RA is a highly disabling disease resulting in persistent pain, joint and bone damage, and muscle weakness, which needs treatment for the whole life [2] . Moreover, it causes lesions in extraarticular tissues, such as the lungs, heart, and vasculature, seriously influencing the patient’s health and life quality, and has a heavy load on both families and the community [3] . RA is affecting approximately 1% of the population across the world [4] . The main RA pathology is excessive hyperplasia of the joint synovium. Being in contact with immune cells, growth factors, and inflammatory cytokines such as IL-1 and TNF-α is the main activator of fibroblast-like synoviocytes (FLS) within the joints. After being stimulated, FLS produce multiple proinflammatory cytokines, cathepsin chemokines, and matrix metalloproteinases to degrade the extracellular matrix and joint cartilages [5]. Therefore, potential therapeutic targets for RA include preventing pro-inflammatory mediator release, inhibiting proteolytic enzyme production, and controlling FLS and abnormal synovial hyperplasia in the joint. The mammalian target of rapamycin (mTOR) signalling pathway is a critical regulator of fundamental cellular processes, including cell growth, differentiation, proliferation, apoptosis, and tumour pathogenesis. This pathway is particularly relevant in Rheumatoid Arthritis (RA), as previous research has demonstrated that abnormal, hyperplastic fibroblast-like synoviocytes (FLS) exhibit malignant-like, aggressive behavior [6] . Rapamycin is an effective suppressor of mTOR pathway. Laragione and Gulko declared that the mTOR signalling had a major role in the regulation of FLS's ability to invade the joint tissue and that rapamycin, by its ability to inhibit mTOR signalling pathway, significantly reduced the FLS infiltrative power. So, the mTOR signalling could be a recent goal for the treatment of RA [7] . Regarding available treatments for RA, they include DMARDs, monoclonal antibodies and analgesics, steroidal and non-steroidal anti-inflammatory drugs [8] . However, these drugs have several harmful adverse effects, such as nephrotoxicity, gastric upset, proteinuria. They also have immunosuppressive effects, and their actions don’t have specific targets, so they have multiple toxic effects on different organs that affect patient health and quality of life [9] . As a result, it is important to further search for a new therapeutic option for RA with the fewest side effects. The most common flavonoid in nature is quercetin, with well-known prominent anti-inflammatory and antioxidant activates, indicating its potential anti-rheumatic activity [10] . Black tea, vegetables, berries, and different fruits, especially their skins, are rich in quercetin [11]. Quercetin showed its effectiveness in the suppression of many inflammatory pathways in various previous studies at different disorders, like atherosclerosis [12] , tumours [13] , and diabetes mellites [14] , and a previous study has shown that quercetin effectively decreases inflammation in Collagen induced arthritis (CIA) rats [15] and prevents the occurrence of arthritis in mice [16] . Moreover, quercetin ameliorated oxidative stress in the articular tissue of arthritic rats, suggesting a therapeutic benefit that is independent of its classic anti-inflammatory effects [17] . Acting as a dual inhibitor of the PI3K/mTOR pathways, Quercetin can suppress mTOR activity through multiple mechanisms. This makes the bioflavonoid a potential therapeutic candidate for the management of tumors and other mTOR signalling-dysregulation [18]. Building upon the need for developing effective disease-modifying treatment for RA, this study investigated the anti-arthritic effects of Quercetin via suppression of the PI3K/AKT/mTOR signalling pathway in a rat model of RA. We further compared Quercetin's efficacy with that of Rapamycin (an established mTOR inhibitor) to validate the role of this pathway in RA pathogenesis. 2. Results 2.1. Effect of quercetin and rapamycin on paw diameter in RA rats: Initial measurements recorded on day 0 revealed no significant differences in paw volume (PV) across treatment and control groups. By day 7, the arthritic group developed a statistically significant increase in paw diameter compared to the control group. In contrast, both rapamycin and quercetin treatments significantly attenuated this effect, resulting in a marked reduction of paw diameter relative to the arthritic group Table (1) fig 1&2. By Day 14, paw oedema in the arthritic group remained significantly higher than in controls. Although both rapamycin and quercetin treatments produced a significant anti-oedema effect relative to the arthritic group, their values were still statistically greater than the control levels Table (1) Fig 1&2. By Day 21, the arthritic group continued to display a significantly higher level of paw oedema relative to the control group. While both rapamycin and quercetin treatments significantly reduced oedema relative to the arthritic group, only the rapamycin-treated group showed normalization to a level that was not significantly different from the control. In contrast, the quercetin-treated group still exhibited significant oedema relative to the control Table (1) Fig 1&2. In the final assessment, paw oedema in the arthritic group remained significantly elevated relative to the control. Both rapamycin and quercetin treatments produced a significant anti-oedematous effect relative to the arthritic group. However, only rapamycin fully normalized the response, as the quercetin group continued to exhibit a statistically significant level of oedema compared to the control Table (1) Fig 1&2. The results indicate that quercetin, administered at a dose of 150 mg/kg, produced a significant reduction in paw oedema compared to the arthritic control. The magnitude of this inhibitory effect was statistically comparable to that achieved by rapamycin, suggesting that quercetin possesses a similar therapeutic potential for mitigating arthritis-associated oedema in this model. Table (1): Paw diameter (mm) in the study groups Variables Control group [N=6] RA group [N=6] Rapamycin group [N=6] Quercetin group [N=6] Test of Sign. Day 0 4.967 ± 0.077 4.967 ± 0.137 5.040 ± 0.143 5.037 ± 0.136 F= 0.648 P = 0.594 Day 7 4.930 ± 0.144 9.857 ± 0.207 a 6.290 ± 1.253 b 5.823 ± 1.438 b F= 30.337 P < 0.001** P1 0.242 < 0.001** 0.040* 0.200 Day 14 5 ± 0.080 10.7 ± 0.498 a 6.657 ± 1.024 a, b 6.290 ± 0.553 a, b F= 90.493 P < 0.001** P1 0.278 < 0.001** 0.019* 0.002* Day 21 5.003 ± 0.184 8.533 ± 0.524 a 5.297 ± 0.221 b 5.737 ± 0.254 a, b F= 179.780 P < 0.001** P1 0.453 < 0.001** 0.025* 0.999 Day 28 4.970 ± 0.108 8.257 ± 0.587 a 5.373 ± 0.441 b 5.743 ± 0.349 a, b F= 78.215 P < 0.001** P1 0.915 < 0.001** 0.790 0.081 N: number, Results are reported as mean ± standard deviation (SD) F: one way ANOVA test *: Statistically significant (p < 0.05), **: Highly statistically significant (p < 0.001) P: significance between groups. P1: comparison with the control group. a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups. 2.2.Effect of quercetin and rapamycin on arthritic score in RA rats: Our results showed that there was a significant rise in the arthritic score in rheumatoid arthritis group relative to the control group, and the rapamycin treated group showed a significant decline of arthritic scoring when compared to rheumatoid arthritis control group. The quercetin-treated group exhibited a statistically significant reduction in arthritic score compared to the rheumatoid arthritis control group. However, the scores in the quercetin group remained significantly elevated relative to the normal control group Table 2 figure 2 Table (2): arthritic score and gait score in study groups Variables Control group [N=6] RA group [N=6] Rapamycin group [N=6] Quercetin group [N=6] Test of Sign. Arthritic score 0 4 (3 – 4) a 1 (0 – 1) b 1 (1 – 2) a, b KW = 20.165 P < 0.001 ** Gait score 0 3 (2 – 3) a 1 (0 – 2) b 2 (1 – 2) a, b KW = 18.666 P = 0.001 ** N: number, Data are expressed as Median (Range) KW: Kruskal Wallis test *: Statistically significant (p < 0.05), **: Highly statistically significant (p <0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups. 2.3. Effect of quercetin and rapamycin on gait score in RA rats: Our results showed that there was a significant rise in the gait score in rheumatoid arthritis group relative to the control group, and the rapamycin treated group showed a significant decline of gait scoring relative to rheumatoid arthritis control group. Quercetin treated group showed a significant decline in the gait score relative to the rheumatoid arthritis control group, but still significantly higher relative to the normal control group Table 2 figure 2 2.4. Effect of quercetin and rapamycin on serum Rheumatoid Factor (RF) & serum C - reactive protein (CRP) in RA rats: To analyse the therapeutic efficacy of quercetin and rapamycin, serum levels of CRP and RF were quantified in the rat model of rheumatoid arthritis (Table 3, figures 3). The levels of CRP and RF were all elevated in serum of the RA group in relation to the control group. Treatment with both quercetin and rapamycin inhibited the elevated levels of CRP and RF relative to the arthritic groups, but still significantly higher in relation to the control group. Table (3): Effect of quercetin and rapamycin on serum CRP, serum RF in RA rats Variables Control group [N=6] RA group [N=6] Rapamycin group [N=6] Quercetin group [N=6] Test of Sign. CRP (mg/L) 1.267 ± 0.186 3.033 ± 0.273 a 2 ± 0.322 a, b 2.167 ± 0.314 a, b F= 40.484 P < 0.001* RF (IU/ml) 2.833 ± 0.186 11.2 ± 2.688 a 5.7 ± 0.587 a, b 6.7 ± 0.498 a, b F= 36.855 P < 0.001* N: number, Data are expressed as mean ± standard deviation (SD) F for ANOVA test *: Statistically significant (p < 0.05), **: Highly statistically significant (p <0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups. Effect of quercetin and rapamycin on the serum levels of IL-1 β and TNF-α in RA rats: To analyse the effectiveness of Quercetin and rapamycin in treatment of RA rats, the levels of proinflammatory cytokines, such as TNF-α, IL-1 β in the serum of rats were detected by ELISA (Table 4, figure 4). TNF-α, IL-1 β were all elevated in serum of the RA group in relation to the control group. Treatment of rats with quercetin and rapamycin respectively prevented this elevation, but still significantly higher in relation to the control group. Table (4): Effect of quercetin and rapamycin on serum TNF -α IL-1 β in RA rats Variables Control group [N=6] RA group [N=6] Rapamycin group [N=6] Quercetin group [N=6] Test of Sign. TNF-α (pg/ml) 32.7 ± 5.655 97.23 ± 15.317 a 56.9 ± 9.732 a, b 69.3 ± 5.969 a, b F= 43.588 P < 0.001* IL-1(pg/ml) 22.167 ± 2.284 57.667 ± 6.909 a 37.533 ± 4.317 a, b 41.667 ± 4.142 a, b F= 57.586 P < 0.001* N: number, Results are presented as mean ± standard deviation (SD) F for ANOVA test *: Statistically significant (p < 0.05), **: Highly statistically significant (p < 0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups. 2.5.Effect of Quercetin and rapamycin on mTOR mRNA in the ankle joints of RA rats: The effects of quercetin and rapamycin on the PI3K/AKT/mTOR pathway in the ankle joints of RA rats were detected through measuring of mTOR gene expression by PCR Relative to the control group, the RA group had significantly elevated protein levels of mTOR (Table 5, Fig.5). The quercetin and rapamycin groups had lower protein levels of mTOR as compared to arthritic group but as regard to quercetin treated group still had significantly elevated level of mTOR relative to the control group (Table 5, Fig.5). According to these results, Quercetin and rapamycin protect against joint damage in RA rats by suppressing the PI3K/AKT/mTOR pathway. 2.6.Effect of quercetin and rapamycin on phosphorylation degree of mTOR and AKT (p-mTOR and p-Akt) using western blot technique in the ankle joints of RA rats: The effects of quercetin and rapamycin on the PI3K/AKT/mTOR pathway in the ankle joints of RA rats were detected through measuring p-mTOR and p-Akt using western blot technique. Compared to the control group, RA group exhibited significantly elevated protein levels of p-mTOR and p-Akt (p < 0.05 for both) (Table 5. Fig. 6). The quercetin and rapamycin groups had declined protein levels of p-mTOR and p-Akt (all P < 0.05) (Table 5., Fig. 6) but still significantly elevated when compared to the control group. According to these results, Quercetin and rapamycin protect against joint damage in RA rats by suppressing the PI3K/AKT/mTOR pathway. Table (5): Effect of quercetin and rapamycin on PI3K/AKT/mTOR pathway Variables Control group [N=6] RA group [N=6] Rapamycin group [N=6] Quercetin group [N=6] Test of Sign. mTOR 1.004 ± 0.004 5.398 ± 1.100 a 1.911 ± 0.468 b 2.193 ± 0.513 a, b F= 52.089 P < 0.001* p-mTOR 1.005 ± 0.008 3.807 ± 0.510 a 1.850 ± 0.334 a, b 2.045 ± 0.499 a, b F= 53.615 P < 0.001* p-AKT 1.037 ± 0.053 3.645 ± 0.468 a 2.117 ± 0.351 a, b 1.715 ± 0.232 a, b F= 73.478 P < 0.001* N: number Data are expressed as mean ± standard deviation (SD) F for ANOVA test *: Statistically significant (p <0.05), **: Highly statistically significant (p < 0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups. 2.7.Histopathological studies of the paw tissue: Haematoxylin and eosin-stained joint slices of the control group revealed a standard structure with intact ankles and no arthritic pathological changes were observed; the joint cavity, cartilage lining, and the morphology of bone tissue appeared normal, and no inflammatory cell infiltrate was detected. RA group showed a disturbed joint architecture; the joint tissue exhibited significant abnormality with marked inflammatory cell infiltrate. Rapamycin treatment showed preserved architecture and efficiently alleviated the arthritic changes; the joint structure appeared nearly like the control with absent inflammatory cell infiltrate. Quercetin treatment significantly attenuated the arthritic changes (figure 7) (Table 6) . Table (6). Analysis of histopathological changes of the ankle joint of different groups: Groups Edema Degree of Erosion Inflammatory cellular infiltration Control normal 0 0 0 Arthritic group ++++ ++++ ++++ Rapamycin treated group + 0 0 Quercetin treated group ++ + + Note: The extent of histopathological alterations was scored based on the percentage of tissue affected: no observed abnormality (0); + (1–25%), ++ (26–50%), +++ (51–75%), and ++++ (>75%). 3. Discussion RA is one of the commonest inflammatory disorders affecting joints that behaves as a chronic disease with articular and extraarticular affections such as interstitial lung disease, affections of the heart and blood vessels, and tumours [19] . RA, by all these manifestations, has a heavy burden on patient health and life, and affects also his family. So, RA is one of the universal issues of public health [20]. Despite the availability of DMARDs, chronic pain is a common complaint of most patients of RA. Severe functional decline that progresses to deformity and disability is also common among them. Moreover, the currently available DMARDs have many adverse effects and toxicities [21]. There is a crucial need for developing safe and efficient alternative disease modifying treatment for RA [22] . Natural products with anti-inflammatory and antioxidant characters can be utilized for arthritis as alternative therapies [23]. Thus, our study estimated the effectiveness of quercetin rat model of rheumatoid arthritis induced by Freund’s Adjutant by examining the effect of quercetin through inhibition of the PI3K/AKT/mTOR signalling and comparing it with rapamycin. The results exhibited amelioration of gait score, degree of paw oedema, and arthritis score in Freund’s Adjutant induced arthritis after treatment with either of these two drugs. Additionally, either of the drugs prevents the elevated serum concentrations of the inflammatory markers, IL-1β, TNF-α, decreases expression of PI3K/AKT/mTOR, and improves the articular configuration determined by H&E. Freund adjuvant-induced arthritis model is one of the commonest RA animal models, which is beneficial in demonstrating the mechanisms of the pathogenesis of RA in details involving autoimmunity mechanisms, inflammatory pathways involvement and how the damage of articular bone and cartilage occurs in RA [24] . Subcutaneous injection of Freund adjuvant caused inflammation of the synovial tissue, which is the main characteristic feature of RA. This inflammation of synovium appears as swelling of the joint with excessive infiltration with leukocytes [25]. There was a significant increase in the arthritic score and paw diameter in RA group relative to the control group but the group that was treated with rapamycin had a significant decline in the arthritic score and paw diameter relative to the rheumatoid arthritis control group which is incompatible with [6]. Rapamycin decreases paw oedema, arthritic and gait scoring which may be attributed to its effects on immunological cells as treatment with rapamycin markedly improved the ratios between T-helper cell 17 (Th17) with pro-inflammatory effects to regulatory T cells (Tregs) with anti-inflammatory effects [26,27]. As a disturbed T effectors/Tregs ratio plays a critical role in RA disease progression as effector T cells such as Th17, Th2, and Th1 cells direct macrophages or monocytes to produce many inflammatory mediators destructing the articular tissues . On the other hand, regulatory T cells (Tregs) stimulate the production of inhibitory mediators to suppress the activation and proliferation of autoreactive T cells and support the immunological haemostasis. PI3K/AKT/mTOR signalling is crucial in the production and activation of T cells [28]. Quercetin treated group also showed a significant decline in the arthritic score and paw diameter relative to the rheumatoid arthritis group which is incompatible withprevious studies who reported thatquercetin remarkably decreased the paw oedema, arthritis index scores, improving the total pathological score; these effects may be attributed to its ability to inhibit nuclear factor (NF)-κB activation [29,30]. As regards to gait score, our results showed that there was a significant increase in the gait score in rheumatoid arthritis group relative to the control group. Both rapamycin and quercetin treated groups showed a significant decline in the gait score relative to the rheumatoid arthritis group. This was the same as previous study wherequercetin attenuates cartilage damage in a rat model of osteoarthritis [31]. The serum concentration of RF and CRP were significantly elevated in the arthritic control group relative to the normal control group and were decreased in quercetin treated group which were in accordance with previous study [32]. Rapamycin treated group also showed a significant reduction in CRP&RF which agreed with previous studywho had found that rapamycin improves inflammatory markers including CRP in patients with juvenile rheumatoid arthritis [33]. The immunological markers CRP, RF are produced when bone and cartilage become inflamed, starting the pathogenesis of RA [34]. RF is produced because of disorders in the cellular and humoral immune reaction, leading to immigration of B-and T- lymphocytes into the synovium and stimulation of monocytes and macrophages [35]. Consequently, inflammatory mediators as TNF-α and ILs start excessive infiltration in the synovial membrane of the joints. An increased number of these cytokines increases the secretion of C-reactive proteins, increased proteolytic enzymes in the synovial cavity, degenerating the cartilages and bones. Also, cellular accumulation of prostaglandins, kinins, and histamines is increased by these cytokines, resulting in severe joint pain, progressive joint destruction, and deformity that progress to disability, and affecting negatively the patient's quality of life and his overall health [36] Injection of CFA in our experiment resulted in elevation in IL-1β and TNF-α concentrations, which are the major cytokines driving RA pathology [37]. In contrast, Rapamycin treatment prevented the elevated levels of IL-1β and TNF-α which was the same as the results of [6]. Quercetin also showed a reduction of TNFα and IL-1 β . These results were the same as the results of previous study [32]. Quercetin can prevent the release of inflammatory cytokines, T cells, NF-κB, decreasing joint inflammation, and can suppress the function of the osteoclasts, decreasing its ability to destruct the joints [31]. PI3K/AKT/mTOR signalling is very important in regulating the release of the inflammatory cytokines, oxidative stress, cell apoptosis, andautophagy [38,39]. This pathway is critical for proper immune function and maintaining immune homeostasis and is important for stimulation and proliferation of both T and B cells in RA [28,40]. Past experiments have verified that the PI3K/Akt/mTOR signalling is involved in many pathological alternations in RA, including bone erosion, destruction of the cartilages, synovial inflammation, and synovial pannus formation [41] . Inhibition of PI3K/AKT/mTOR signalling was identified as a promising target for clinical application in RA [42] as this pathway promotes apoptosis of RA‐FLSs bypreventing cell cycle arrest [43]. Also, AKT inhibited the proliferation of chondrocytes and promoted autophagy and apoptosis in RA rats by acting in harmony as a part of the PI3K/AKT/mTOR signalling [44]. PI3K/Akt/mTOR signalling role in RA is confirmed in our study by analysis of mRNA expression in synovial tissue which obviously showed that the expression of mTOR was elevated in the rheumatoid arthritis relative to the control group which agreed with [6]. RT‐PCR expression levels of mTOR significantly decreased in rapamycin treated group. Similarly, Western blotting analysis results indicated that the protein expression of p‐AKT/AKT, p‐mTOR/mTOR ratios were also significantly declined. Previous study proved that rapamycin treatment inhibits the apoptosis and proliferation of FLSs by preventing the activation of AKT and mTOR [43]. To further explore whether quercetin is an applicable inhibitor of mTOR pathway, expression changes in the PI3K/AKT/mTOR were estimated. Our results showed that quercetin showed similar effects as rapamycin at PI3K/AKT/mTOR signalling pathway, supporting the positive influence of quercetin on the treatment of RA. The ameliorating activity of quercetin on PI3K/AKT/mTOR pathway was previously exhibited in previous studies [45,46]. The histopathology of ankle joint in the arthritic rat revealed marked inflammatory infiltrate, oedema, and hyperplastic synovium. RA is characterized by transformation of the synovium into hyperplastic invasive tissue, destructing the cartilage and bone. FLS are potent effector cells that contribute to RA pathogenesis [47] . Abnormal proliferation of FLS is mainly through increased inflammatory cytokines as TNFα and IL-1β [6]. Stimulated macrophages continuously produce TNF-α and IL-1 to keep fibroblasts of the synovium in an inflamed and activated state. The increased levels of synovial inflammatory mediators resulted in varying degrees of joint damage because IL-1, IL-6 and TNF-α stimulates osteoclasts to resorb bone in an aggressive manner by stimulating the expression of the receptor activator of NF-κB ligand (RANKL) which is the main activator of the osteoclasts [29]. Stimulation of PI3K/AKT/mTOR signalling is the main principal driver in the pathogenesis of RA as it enhances NF-κB activation and stimulates the release of many inflammatory cytokines (TNF-α, IL-6, and IL-1β) and adhesion molecules leading to an inflammatory reaction, resulting in pathological changes observed in RA [46]. Rapamycin improves the histopathological alternations observed in the arthritic group. This result agreed withprevious study of Dai et al. [6]. Rapamycin exerted inhibitory effects on FLSs, inhibiting their proliferation, promoting their apoptosis, and reducing joint bone damage mainly by suppressing the PI3K/AKT/mTOR signalling [46] . Quercetin improves the histopathological changes observed in the arthritic group. These results were in accordance with previous studies [36,32] . Quercetin inhibits the release of inflammatory markers by suppressing the pathway of NF-κB. Furthermore, quercetin effectively prevents angiogenesis during inflammatory reaction in arthritis and prevents synovial hyperplasia, indicating that quercetin is a promising new as anti-rheumatic drug [48]. Additionally, other experiments displayed thatquercetin limits inflammatory cell production and delays bone loss in rheumatoid arthritis rats [16,36]. As previously mentioned, the anti-inflammatory and proliferative activities of quercetin are mainly through its inhibitory effect on PI3K/AKT/mTOR signalling. Conclusion This study displays that CAF induced RA model in rats showed several arthritic features: physical abnormalities (ankle diameter, arthritic score, gaiting score), biochemical and histological alteration. This is strongly related to activation PI3K/AKT/mTOR molecular pathway with subsequent inflammatory activation and joint and bone damage. The main result of our study displayed that both rapamycin and quercetin treatment significantly decreased CAF induced RA model in rats, presumably by downregulation of PI3K/AKT/mTOR molecular pathway with subsequent suppression of inflammatory cytokines, joint, and bone damage. Quercetin could be a potential safe, alternative disease modifying RA therapy which needs further evaluation. 4. Materials and methods 4.1. Chemicals and Reagents: Quercetin (a yellow powder; catalogue number 849061-97-8) was sourced from Sigma Aldrich (St. Louis, MO, USA). We obtained Complete Freund’s adjuvant from M. P. Biomedicals (France), and Rapamycin (Sirolimus oral solution, C51H79NO13) was procured from Hangzhou Zhongmei Huadong Pharmaceutical Co., Ltd (China). 4.2.Experimental animals: A cohort of twenty-four adult male Sprague Dawley rats (body weight: 170–200 g) were sourced from the Medical Experimental Research Centre (MERC). Faculty of medicine Mansoura university. Housing was provided in individual cages under standard laboratory conditions, with a temperature regime of 18–22°C and a fixed 12-hour light/dark cycle. Access to a standard diet and potable water was provided ad libitum. A two-week period was allowed for the rats to acclimate to the housing conditions prior to initiating the study. All experimental work was performed in the Clinical Pharmacology Department, Faculty of Medicine, Mansoura University, in accordance with the guidelines authorized by the institutional Research Ethics Committee (Approval number: MU-ACUC (MED.R.23.01.8). 4.3.Study design and animal grouping After acclimatization, random allocation procedure was used to assign the rats into four distinct experimental cohorts, each consisting of six rats (n=6). Group 1 (Negative Control): Received a daily oral gavage of the vehicle (0.9% sodium chloride, dosed at 1 mL per 100 g of body weight) for two weeks. Group 2 (Arthritic group): Arthritis was induced on day 0 by A single 0.1 mL dose of Complete Freund's Adjuvant (CFA) delivered via subcutaneous injection to the plantar surface of the right hind paw. This group also received the vehicle daily via oral gavage for two weeks. Group 3 (Rapamycin-treated group): Following arthritis induction as in Group 2, this group was treated with rapamycin at a daily dose of 2.5 mg/kg via oral gavage, commencing on day 13 and continuing for a period of two weeks [6]. Group 4 (Quercetin-treated group): After the same arthritis induction protocol, this group received quercetin (150 mg/kg body weight) orally gavaged daily beginning on day 13 and continuing for two weeks [15] 4.4. Assessments of ankle diameter, arthritic score, gaiting score: At the end of the experiment before scarification, all the following were determined: 1- Determination of ankle diameter: we measured the antero-posterior diameter of the hind paw to determine the ankle diameters at days 0, 7, 14,21, and 28. 2- Arthritic score: Joint inflammation was graded for assessment on a standardized 5-point scale: 0: No observable inflammation. 1: Swelling and/or redness confined to one digit. 2: Moderate swelling and erythema. 3: Severe swelling and erythema affecting the whole limb. 4: Severe inflammation with visible deformity and inability to use the limb [49]. 3- Gait score Limping and pain were assessed using a 0–3-point scale: 0: normal gait; 1: slight lameness; 2: pronounced lameness (weight-bearing on toes only); 3: complete inability to bear weight on the limb [50]. 4.5. Sample collection and processing: Upon completion of the treatment protocol and assessments of ankle diameter, arthritic score and gaiting score, the rats were anesthetized using intraperitoneal injection of pentobarbital (40 mg/kg) [39]. until loss of consciousness, followed by euthanasia via decapitation, in accordance with ethical standards for animal research. Blood was drawn via terminal cardiac puncture from the left ventricle using a sterile syringe. Following a 30-minute clotting period at room temperature, centrifugation was carried out (3000 × g, 10 minutes, 4°C) to obtain serum. The resulting serum was then stored at -80°C. Hind paw joints were dissected; one portion was rinsed with PBS, blotted dry, minced into <30 mg fragments, and stored in RNA-later at 4°C overnight before long-term storage at -80°C. The remaining tissue was fixed in 10% neutral buffered formalin (NBF) for a minimum of 48 hours for histopathological examination. 4.6.Biochemical assays: C-Reactive Protein (CRP) and Rheumatoid Factor (RF): Serum CRP was quantified using an automated clinical chemistry analyser (Cobas c 311; Roche Diagnostics). Serum RF was measured using a commercial latex agglutination turbidimetric assay kit (Fujifilm, Cat# 000). Cytokine Analysis (ELISA): The serum concentrations of TNF-α and IL-1β were quantified using commercially available enzyme-linked immunosorbent assay (ELISA) kits (IL-1β: Boster, Cat# EK0394; TNF-α: Boster, Cat# EK0527). All samples were assayed in duplicate. The absorbance for each well was measured at 450 nm, and cytokine concentrations were interpolated from a standard curve generated in parallel. 4.7. Quantitative Real-Time PCR (qPCR) Analysis of mTOR Gene Expression: Total RNA was isolated from joint tissues utilizing the Direct-zol RNA Miniprep Plus kit (Zymo Research, Cat# R2072). RNA purity was confirmed spectrophotometrically (A260/A280 ratio of 1.8–2.1). cDNA was synthesized from 1 μg total RNA using the Superscript IV One-Step RT-PCR kit (Thermo Fisher, Cat# 12594100). qPCR was performed on a Step One Plus Real-Time PCR System (Applied Biosystems) using SYBR Green master mix. The PCR protocol was 45°C for 20 min (reverse transcription); 98°C for 2 min; 40 cycles of 95°C for 10 s, 55°C for 10 s, 72°C for 30 s; followed by melt curve analysis. The 2−ΔΔCT method was used for analysis [51]. Primer sequences: mTOR (RefSeq: NM_019906.1): Forward 5′- GCAATGGGCACGAGTTTGTT -3′ Reverse 5′- AGTGTGTTCACCAGGCCAAA -3′ GAPDH (RefSeq: XM_039107008.1): Forward 5′ CCCATCACCATCTTCCAGGAG -3′ Reverse 5′- GAAGGGGCGGAGATGATGAC -3′ 4.8.Western Blot Analysis: Total protein was isolated from the joint tissue homogenates utilizing the Ready-Prep protein extraction kit (Bio-Rad, Cat# 163-2086). Total protein concentration was determined via Bradford assay (Bio Basic Inc., Cat# SK3041) against a BSA standard curve. Samples (20 μg) were denatured in 2X Laemmli buffer at 95°C for 5 min, separated on a 10% TGX Stain-Free Fast-Cast gel (Bio-Rad, Cat# 1610181) at 200 V for 30–40 min, and electrophoretically transferred onto a PVDF membrane with the Trans-Blot Turbo Transfer System (Bio-Rad) using a constant voltage of 25 V applied for 7 minutes. The membrane was blocked using a solution of 5% bovine serum albumin (BSA) in Tris-buffered saline with Tween-20 (TBST) and subsequently probed with the designated primary antibodies (rabbit anti-p-mTOR (Ser2448) (1:1000, Cell Signalling, #5536S) and rabbit anti-p-Akt (Ser473) (1:2000, Cell signalling, #4060S) overnight at 4°C. Following a series of washes, the membrane was probed with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (1:3000, Novus, Cat# NB7160). We visualized the protein bands with the Clarity Western ECL Substrate (Bio-Rad, Cat# 1705060) and imaged on a ChemiDoc MP System (Bio-Rad). Band intensity was quantified by densitometric analysis using Image Lab software (Bio-Rad). The signals were normalized against total protein and β-actin as loading controls (mouse anti-β-actin, 1:5000, Sigma-Aldrich, Cat# A5441). 4.9.Histopathological Examination: Joint tissues were immersion-fixed in 10% neutral buffered formalin (NBF) and decalcified in 10% ethylenediaminetetraacetic acid (EDTA) (solution refreshed every 4 days). Following decalcification, the tissue specimens were processed through a series of increasing ethanol concentrations for dehydration, cleared using xylene, and subsequently embedded in paraffin wax. Sections of 5 µm thickness were subsequently prepared and stained using Haematoxylin and Eosin (H&E) for microscopic evaluation. Histopathological analysis was performed based on established criteria [36]. 4.10.Statistical data and analysis Data were analysed using SPSS v25.0. The normality of data distribution was evaluated using the Shapiro-Wilk test. For parametric data, a one-way analysis of variance (ANOVA) was performed, followed by Tukey's post-hoc analysis for multiple comparisons; non-parametric datasets were analysed using the Kruskal-Wallis test. A p-value of less than 0.05 was deemed statistically significant Declarations Authors' contributions : All authors contributed to the study conception and design. N.H. examined the joint tissue specimens, interpreted the histological results, D.H. and E.A. established the study model and concerned with animal housing and administration of therapies. W.A and A.R performed the biochemical and molecular analysis and interpreted the results. B.A., M.S., A.S., M.S., M.A., A.E., I.G., M.S., A.M., N.M., participated in the study model and animal housing. All authors contributed to the conception of the study, revised the manuscript, and approved the submitted manuscript. Corresponding author Correspondence to Doaa Hellal Declarations Data availability: The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethical approval The method for animal use was approved by the Institutional Research Board (IRB) Faculty of Medicine, Mansoura University, in accordance with the guidelines authorized by the institutional Research Ethics Committee (Approval number: MU-ACUC (MED.R.23.01.8). Competing interests The authors declare that they have no competing interests. • Funding resources The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. The authors declare that they have no competing interests. References Marino, Angela, Irene Paterniti, Marika Cordaro, Rossana Morabito, Michela Campolo, Michele Navarra, et al. "Role of natural antioxidants and potential use of bergamot in treating rheumatoid arthritis." PharmaNutrition 3, no. 2 (2015): 53-59 Leonidas Mitrogiannis, M. D., M. D. Evangelos Theodorou, Aikaterini Kitsouli, Georgios Mitrogiannis, M. D. Panagiotis Kanavaros, Ioannis Mitrogiannis, and M. D. Panagiotis Kitsoulis. "Surgical Treatment of Juvenile Idiopathic Arthritis: A Review." Bulletin of the NYU Hospital for Joint Diseases 77, no. 2 (2019): 99-114. Yuan, Hui, and Wenguo Cui. "The lubricated matter in body." Progress in Materials Science 146 (2024): 101334. Shi, Guang, Xun Liao, Zhao Lin, Wei Liu, Xue Luo, Hongrui Zhan, and Xiyu Cai. "Estimation of the global prevalence, incidence, years lived with disability of rheumatoid arthritis in 2019 and forecasted incidence in 2040: results from the Global Burden of Disease Study 2019." Clinical Rheumatology 42, no. 9 (2023): 2297-2309. Igarashi, Hideya, Ayano Yahagi, Taro Saika, Jun Hashimoto, Tetsuya Tomita, Hideki Yoshikawa, et al. "A pro-inflammatory role for A20 and ABIN family proteins in human fibroblast-like synoviocytes in rheumatoid arthritis." Immunology Letters 141, no. 2 (2012): 246-253. Dai, Qiaoding, Di Zhou, Liping Xu, and Xinwei Song. "Curcumin alleviates rheumatoid arthritis-induced inflammation and synovial hyperplasia by targeting mTOR pathway in rats." Drug design, development and therapy (2018): 4095-4105. Laragione, Teresina, and Pércio S. Gulko. "mTOR regulates the invasive properties of synovial fibroblasts in rheumatoid arthritis." Molecular medicine 16, no. 9-10 (2010): 352-358. Mrid, Reda Ben, Najat Bouchmaa, Hassan Ainani, Rachid El Fatimy, Gabriel Malka, and Loubna Mazini. "Anti-rheumatoid drugs advancements: New insights into the molecular treatment of rheumatoid arthritis." Biomedicine & Pharmacotherapy 151 (2022): 113126 Sooriakumaran, Prasanna. "COX-2 inhibitors and the heart: are all coxibs the same?." Postgraduate medical journal 82, no. 966 (2006): 242-245. Hannan, Abdul, Bushra Akhtar, Ali Sharif, Fozia Anjum, Imran Pasha, Ahrar Khan, et al. "Quercetin-loaded chitosan nanoparticles ameliorate adjuvant-induced arthritis in rats by regulating anti-oxidant enzymes and downregulating pro-and inflammatory cytokines." Inflammopharmacology 31, no. 1 (2023): 287-300. Takahashi, Shota, Hitoshi Muguruma, Naomi Osakabe, Hitoshi Inoue, and Tatsuya Ohsawa. "Electrochemical determination with a long-length carbon nanotube electrode of quercetin glucosides in onion, apple peel, and tartary buckwheat." Food Chemistry 300 (2019): 125189. Luo, Zhen, Mingfu Tian, Ge Yang, Qiaoru Tan, Yubing Chen, Geng Li, et al "Hypoxia signaling in human health and diseases: implications and prospects for therapeutics." Signal transduction and targeted therapy 7, no. 1 (2022): 218. Murakami, Akira, Hitoshi Ashida, and Junji Terao. "Multitargeted cancer prevention by quercetin." Cancer letters 269, no. 2 (2008): 315-325. Yan, Lei, Mostafa Vaghari-Tabari, Faezeh Malakoti, Soheila Moein, Durdi Qujeq, Bahman Yousefi, et al. "Quercetin: an effective polyphenol in alleviating diabetes and diabetic complications." Critical reviews in food science and nutrition 63, no. 28 (2023): 9163-9186. Gardi, C., K. Bauerova, B. Stringa, V. Kuncirova, L. Slovak, S. Ponist, et al. "Quercetin reduced inflammation and increased antioxidant defense in rat adjuvant arthritis." Archives of biochemistry and biophysics 583 (2015): 150-157. Haleagrahara, Nagaraja, Socorro Miranda-Hernandez, Md Abdul Alim, Linda Hayes, Guy Bird, and Natkunam Ketheesan. "Therapeutic effect of quercetin in collagen-induced arthritis." Biomedicine & Pharmacotherapy 90 (2017): 38-46. Souza, Kaiany S., Lucas S. Moreira, Bruna Thais Silva, Byanca PM Oliveira, Amarilis S. Carvalho, Patrícia S. Silva, et al. "Low dose of quercetin-loaded pectin/casein microparticles reduces the oxidative stress in arthritic rats." Life Sciences 284 (2021): 119910 Shah, Suprava, Rakesh Narang, Vikram J. Singh, Govindaiah Pilli, and Surendra Kumar Nayak. "A review on anticancer profile of flavonoids: Sources, chemistry, mechanisms, structure-activity relationship and anticancer activity." Current Drug Research Reviews Formerly: Current Drug Abuse Reviews 15, no. 2 (2023): 122-148. Deane, Kevin D., and Tsang Tommy Cheung. "Rheumatoid arthritis prevention: challenges and opportunities to change the paradigm of disease management." Clinical Therapeutics41, no. 7 (2019): 1235-1239. Zhang, Ziyi, Xiaopeng Gao, Shiwei Liu, Qingshuai Wang, Yingjie Wang, Shuai Hou, et al. "Global, regional, and national epidemiology of rheumatoid arthritis among people aged 20–54 years from 1990 to 2021." Scientific Reports 15, no. 1 (2025): 10736. Roubille, Camille, Vincent Richer, Tara Starnino, Collette McCourt, Alexandra McFarlane, Patrick Fleming, et al. "The effects of tumour necrosis factor inhibitors, methotrexate, non-steroidal anti-inflammatory drugs and corticosteroids on cardiovascular events in rheumatoid arthritis, psoriasis and psoriatic arthritis: a systematic review and meta-analysis." Annals of the rheumatic diseases 74, no. 3 (2015): 480-489. Radu, Andrei-Flavius, and Simona Gabriela Bungau. "Management of rheumatoid arthritis: an overview." Cells 10, no. 11 (2021): 2857. Lahiri, Manjari, Amelia Santosa, Lay Kheng Teoh, Jane A. Clayton, Sheen Yee Lim, Gim Gee Teng, et al. "Use of complementary and alternative medicines is associated with delay to initiation of disease‐modifying anti‐rheumatic drug therapy in early inflammatory arthritis." International Journal of Rheumatic Diseases 20, no. 5 (2017): 567-575. Choudhary, Narayan, Lokesh K. Bhatt, and Kedar S. Prabhavalkar. "Experimental animal models for rheumatoid arthritis." Immunopharmacology and immunotoxicology 40, no. 3 (2018): 193-200. McInnes, Iain B., and Georg Schett. "Pathogenetic insights from the treatment of rheumatoid arthritis." The Lancet 389, no. 10086 (2017): 2328-2337. Niu, Hong-Qing, Zhao-Hua Li, Wen-Peng Zhao, Xiang-Cong Zhao, Chen Zhang, Jing Luo, et al. "Sirolimus selectively increases circulating Treg cell numbers and restores the Th17/Treg balance in rheumatoid arthritis patients with low disease activity or in DAS28 remission who previously received conventional disease-modifying anti-rheumatic drugs." Clin Exp Rheumatol 38, no. 1 (2020): 58-66. Lin, Hong, Felipe Salech, Anthony Lim, Sara Vogrin, and Gustavo Duque. "The effect of rapamycin and its analogues on age-related musculoskeletal diseases: a systematic review." Aging Clinical and Experimental Research 34, no. 10 (2022): 2317-2333. Zhang, Fen, Ting Cheng, and Sheng-Xiao Zhang. "Mechanistic target of rapamycin (mTOR): a potential new therapeutic target for rheumatoid arthritis." Arthritis Research & Therapy 25, no. 1 (2023): 187 Haleagrahara, Nagaraja, Kelly Hodgson, Socorro Miranda-Hernandez, Samuel Hughes, Anupama Bangra Kulur, and Natkunam Ketheesan. "Flavonoid quercetin–methotrexate combination inhibits inflammatory mediators and matrix metalloproteinase expression, providing protection to joints in collagen-induced arthritis." Inflammopharmacology 26, no. 5 (2018): 1219-1232. Tang, Mengshi, Yan Zeng, Weijun Peng, Xi Xie, Yongyu Yang, Biting Ji, and Fen Li. "Pharmacological aspects of natural quercetin in rheumatoid arthritis." Drug Design, Development and Therapy (2023): 2043-2053. Mok, Sze-Wing, Sai-Chuen Fu, Yau-Chuk Cheuk, I-Ming Chu, Kai-Ming Chan, Ling Qin, et al. "Intra-articular delivery of quercetin using thermosensitive hydrogel attenuate cartilage degradation in an osteoarthritis rat model." Cartilage 11, no. 4 (2020): 490-499. El-Said, Karim Samy, Amira Atta, Maysa A. Mobasher, Mousa O. Germoush, Tarek M. Mohamed, and Maha M. Salem. "Quercetin mitigates rheumatoid arthritis by inhibiting adenosine deaminase in rats." Molecular Medicine 28, no. 1 (2022): 24. Foroncewicz, Bartosz, Krzysztof Mucha, Leszek Pączek, Andrzej Chmura, and Wojciech Rowiński. "Efficacy of rapamycin in patient with juvenile rheumatoid arthritis." Transplant international 18, no. 3 (2005): 366-368. Nagatomo, F., N. Gu, H. Fujino, T. Okiura, F. Morimatsu, I. Takeda, et al.. "Effects of exposure to hyperbaric oxygen on oxidative stress in rats with type II collagen-induced arthritis." Clinical and experimental medicine 10, no. 1 (2010): 7-13 Scherer, Hans Ulrich, Thomas Häupl, and Gerd R. Burmester. "The etiology of rheumatoid arthritis." Journal of autoimmunity 110 (2020): 102400. Alotaibi, Badriyah S., Muhammad Khurram Waqas, Sunabal Saleem, Haya Yasin, Zelal Kharaba, and Ghulam Murtaza. "Rheumatoid arthritis treatment potential of stearic acid nanoparticles of quercetin in rats." ACS omega 9, no. 6 (2024): 7003-7011. Simsek, Ismail. "TNF Inhibitors for Rheumatoid Arthritis." Bulletin of the NYU Hospital for Joint Diseases 69, no. 3 (2011). Fang, Shaohong, Xin Wan, Xiaoyi Zou, Song Sun, Xinran Hao, Chenchen Liang, et al. "Arsenic trioxide induces macrophage autophagy and atheroprotection by regulating ROS-dependent TFEB nuclear translocation and AKT/mTOR pathway." Cell death & disease 12, no. 1 (2021): 88. Hellal Doaa, Sarah Ragab Abd El-Khalik, Heba M. Arakeep, Doaa A. Radwan, Hend S. Abo Safia, and Eman AE Farrag. "Activation of sirtuin 3 and maintenance of mitochondrial homeostasis by artemisinin protect against diclofenac-induced kidney injury in rats." Naunyn-Schmiedeberg's Archives of Pharmacology 398, no. 5 (2025): 5593-5609. Tang, Yawei, Ziran Bai, Jingjing Qi, Zhimin Lu, Guan Wang, Minli Jin, et al. "Altered peripheral B lymphocyte homeostasis and functions mediated by IL-27 via activating the mammalian target of rapamycin signaling pathway in patients with rheumatoid arthritis." Clinical & Experimental Immunology 206, no. 3 (2021): 354-365. Lv, Mengying, Qiaoling Liang, Zhaoyong Luo, Bo Han, Tengyang Ni, Yang Wang, et al. "UPLC-LTQ-Orbitrap-Based cell metabolomics and network pharmacology analysis to reveal the potential antiarthritic effects of pristimerin: in vitro, in silico and in vivo study." Metabolites 12, no. 9 (2022): 839. Chen, Kun, Zhao-Wei Lin, Sheng-mao He, Cheng-qiang Wang, Jian-cheng Yang, Yao Lu, et al. "Metformin inhibits the proliferation of rheumatoid arthritis fibroblast-like synoviocytes through IGF-IR/PI3K/AKT/m-TOR pathway." Biomedicine & Pharmacotherapy 115 (2019): 108875. Zhang, FengQi, YiYang Zhang, JiaWang Zhou, Ying Cai, ZhiYu Li, Jing Sun, et al. "Metabolic effects of quercetin on inflammatory and autoimmune responses in rheumatoid arthritis are mediated through the inhibition of JAK1/STAT3/HIF-1α signaling." Molecular Medicine 30, no. 1 (2024): 170 Feng, Fa-Bo, and Hai-Yan Qiu. "RETRACTED: Effects of artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis." (2018): 1209-1220. Guo, Z., Zhang, J., Li, M., Xing, Z., Li, X., Qing, J., ... & Zou, X. (2024). Mechanism of action of quercetin in regulating cellular autophagy in multiple organs of Goto-Kakizaki rats through the PI3K/Akt/mTOR pathway. Frontiers in Medicine, 11, 1442071. Wang, D., Fu, N., & Liu, X. Mechanism of Quercetin Mediating PI3K/Akt/mTOR Pathway in Alleviating Cerebral Vascular Stenosis Caused by Vascular Endothelial Cell Injury. International Journal of Pharmacology, 21(3), 391-400. Liu, Chaohong, Nicole M. Chapman, Peer WF Karmaus, Hu Zeng, and Hongbo Chi. "mTOR and metabolic regulation of conventional and regulatory T cells." Journal of Leucocyte Biology 97, no. 5 (2015): 837-847. Guazelli, Carla FS, Larissa Staurengo-Ferrari, Ana C. Zarpelon, Felipe A. Pinho-Ribeiro, Kenji W. Ruiz-Miyazawa, Fabiana TMC Vicentin, et al. "Quercetin attenuates zymosan-induced arthritis in mice." Biomedicine & pharmacotherapy 102 (2018): 175-184 Kim, Kyung-Woon, Yong-Seung Shin, Kap-Sung Kim, Young-Chae Chang, Kwan-Kyu Park, Jae-Bok Park, et al. "Suppressive effects of bee venom on the immune responses in collagen-induced arthritis in rats." Phytomedicine15, no. 12 (2008): 1099-1107. Bush, K. A., B. W. Kirkham, and J. S. Walker. "The κ‐opioid agonist, asimadoline, alters cytokine gene expression in adjuvant arthritis." Rheumatology 40, no. 9 (2001): 1013-1021. Livak, Kenneth J., and Thomas D. Schmittgen. "Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method." methods 25, no. 4 (2001): 402-408. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 21 Apr, 2026 Reviews received at journal 15 Apr, 2026 Reviews received at journal 08 Apr, 2026 Reviews received at journal 30 Mar, 2026 Reviewers agreed at journal 26 Mar, 2026 Reviewers agreed at journal 25 Mar, 2026 Reviewers agreed at journal 25 Mar, 2026 Reviewers invited by journal 23 Mar, 2026 Editor assigned by journal 12 Feb, 2026 Editor invited by journal 11 Feb, 2026 Submission checks completed at journal 31 Jan, 2026 First submitted to journal 31 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8540432","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":610352571,"identity":"c9439e2c-1902-4f96-916c-157d1a88044f","order_by":0,"name":"Doaa Hellal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYDCCAwwMzAwMFjIM7MwHoEIJRGmR4GFgZoMpJV4LjwFxWviONz/8XFAhwcPfzPN1w88ddQz87DkGDB9+4dYieeaYsfSMMxI8Eod5t93sPXOYQbLnjQHjzD7cWgxuJBhI87YBHQbUcoO37QBQJMeAmbcHn5b0z795/0nwyB/meXbzb1sdgz1Iy1+8WnLMpHkbJHgMDvOw3eZtY2YwkABqYfiBzy9nyqx5jknwGB5mM7st23aYR+LMs4KDvQ24tfAdb998m6fGRk7uePOzm2/b6uT425M3PvjxB7cWDMADIg4wtpGgBQpIsWUUjIJRMAqGOwAArohSBk4C028AAAAASUVORK5CYII=","orcid":"","institution":"Mansoura University","correspondingAuthor":true,"prefix":"","firstName":"Doaa","middleName":"","lastName":"Hellal","suffix":""},{"id":610352572,"identity":"09e82441-d9ee-4f16-b8e4-894aa6b8c8fa","order_by":1,"name":"Wafaa Abdelaziz Emam","email":"","orcid":"","institution":"Al Azhar University","correspondingAuthor":false,"prefix":"","firstName":"Wafaa","middleName":"Abdelaziz","lastName":"Emam","suffix":""},{"id":610352573,"identity":"6aa5d7e5-f772-462e-8216-c0f680bb0609","order_by":2,"name":"Amena Rezk Mohammed","email":"","orcid":"","institution":"Al Azhar University","correspondingAuthor":false,"prefix":"","firstName":"Amena","middleName":"Rezk","lastName":"Mohammed","suffix":""},{"id":610352574,"identity":"e644d84b-c684-4518-aec4-8502328918ad","order_by":3,"name":"Nora Elshehawy Helal","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Nora","middleName":"Elshehawy","lastName":"Helal","suffix":""},{"id":610352575,"identity":"73274cf3-b41b-469e-8732-20d760558dea","order_by":4,"name":"Baraa Al-Ashker","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Baraa","middleName":"","lastName":"Al-Ashker","suffix":""},{"id":610352576,"identity":"0937f683-6264-4085-b771-3a2403239efa","order_by":5,"name":"Mohamed Saeed Abd-elfattah","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Saeed","lastName":"Abd-elfattah","suffix":""},{"id":610352577,"identity":"e6e65dd3-959e-4656-a744-b984e34d9132","order_by":6,"name":"Ahmed S. Elsaid","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"S.","lastName":"Elsaid","suffix":""},{"id":610352578,"identity":"e447db9d-7d1d-4d95-81b9-7dcc601f2b5d","order_by":7,"name":"Mirna Salah Keshta","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Mirna","middleName":"Salah","lastName":"Keshta","suffix":""},{"id":610352579,"identity":"96d8c6eb-2c0a-40bc-984e-f3a6a6542aa5","order_by":8,"name":"Mustafa Al sharabi","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Mustafa","middleName":"Al","lastName":"sharabi","suffix":""},{"id":610352580,"identity":"738a42f8-ddae-4340-90a6-eae64ab2a9d3","order_by":9,"name":"Ahmed Elbaz","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"","lastName":"Elbaz","suffix":""},{"id":610352581,"identity":"0b803b78-be6c-4e84-a02c-688922bdefb3","order_by":10,"name":"Israa Gabr","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Israa","middleName":"","lastName":"Gabr","suffix":""},{"id":610352582,"identity":"3424033c-8914-4a7a-9886-bbaf7d4674d7","order_by":11,"name":"Mariam S. Attalla","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Mariam","middleName":"S.","lastName":"Attalla","suffix":""},{"id":610352583,"identity":"dd76388b-5b5c-40e8-85df-b7f81135b2ec","order_by":12,"name":"Abdelrahman Mohamed El barashi","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Abdelrahman","middleName":"Mohamed El","lastName":"barashi","suffix":""},{"id":610352584,"identity":"3f0f163d-3fea-4cb2-b0eb-193c7476e56e","order_by":13,"name":"Nour M.Samer Kaj","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Nour","middleName":"M.Samer","lastName":"Kaj","suffix":""},{"id":610352585,"identity":"02bdf5a4-c838-4a62-8492-e70f040a1f2b","order_by":14,"name":"Eman A. E. Farrag","email":"","orcid":"","institution":"Mansoura University","correspondingAuthor":false,"prefix":"","firstName":"Eman","middleName":"A. E.","lastName":"Farrag","suffix":""}],"badges":[],"createdAt":"2026-01-07 10:53:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8540432/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8540432/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105564765,"identity":"28f814ad-b353-4498-8210-3b89328d45bd","added_by":"auto","created_at":"2026-03-27 12:50:47","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":49703,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of rapamycin and quercitrin on paw diameter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA: \u003c/strong\u003enormal control group \u003cstrong\u003eB:\u003c/strong\u003eRA control group \u003cstrong\u003eC:\u003c/strong\u003e rapamycin treated group \u003cstrong\u003eD:\u003c/strong\u003e quercitrin treated group\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/cb5c0d5ed86cf81f42d55dad.jpg"},{"id":105565085,"identity":"02f9e8d4-0a3a-4fe1-9545-315ecd0a2db2","added_by":"auto","created_at":"2026-03-27 12:51:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":33038,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of rapamycin and quercetin on paw diameter, arthritic score and gait score A: \u003c/strong\u003eeffect of rapamycin and quercetin on paw diameter in mm \u003cstrong\u003eB:\u003c/strong\u003e effect of rapamycin and quercetin on arthritic score \u003cstrong\u003eC:\u003c/strong\u003e effect of rapamycin and quercetin on gait score.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/997a663da7fdedf47f7b25df.png"},{"id":105354691,"identity":"2cff9c86-13f9-470e-9b63-bfdfe6f222c1","added_by":"auto","created_at":"2026-03-25 06:34:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":35413,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of quercetin and rapamycin on serum CRP, serum RF in RA rats A: \u003c/strong\u003eeffect of quercetin and rapamycin on serum CRP in RA rats \u003cstrong\u003eB:\u003c/strong\u003e effect of quercetin and rapamycin on serum RF in RA rat\u003cstrong\u003e.\u003c/strong\u003e Results are presented as mean ± standard deviation (SD) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/cc4a8061faca824979bc5410.png"},{"id":105354688,"identity":"c3206e90-a6ac-4098-9824-2df750dfc4fb","added_by":"auto","created_at":"2026-03-25 06:34:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":39925,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eeffect of Quercetin and rapamycin on serum TNF -α IL-1 β in RA rats A: \u003c/strong\u003eeffect of quercetin and rapamycin on serum TNF -α\u003cstrong\u003e \u003c/strong\u003ein RA\u003cstrong\u003e \u003c/strong\u003erats\u003cstrong\u003e B: \u003c/strong\u003eeffect of quercetin and rapamycin on serum TNF -α IL-1 β in RA rats. Data are expressed as mean ±SD, a: Significance relative to control group b: Significance relative to RA group\u003c/p\u003e\n\u003cp\u003ea,b: significantly different versus both control and RA groups.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/540456b2a6d94a9695717543.png"},{"id":105354690,"identity":"02f5be38-c788-474e-9018-c80a00b24435","added_by":"auto","created_at":"2026-03-25 06:34:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":24934,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eeffect of quercetin and rapamycin on mTOR mRNA in the ankle joints of RA rats.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are expressed as mean ±SD, a: Significance relative to control group\u003c/p\u003e\n\u003cp\u003eb: Significance relative to RA group a,b: significantly different versus both control and RA groups.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/26a7bf846084daf2e2301cca.png"},{"id":105354693,"identity":"ae6d6667-8278-41ec-86bb-33a117ec986b","added_by":"auto","created_at":"2026-03-25 06:34:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":44435,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eeffect of Quercetin and rapamycin on phosphorylation degree of mTOR (p-mTOR ) and AKT using western blot technique in the ankle joints of RA rats. A:\u003c/strong\u003e \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eeffect of Quercetin and rapamycin on phosphorylation degree of mTOR (p-mTOR) by western blot analysis in the ankle joint tissues from RA rats \u003cstrong\u003eB:\u003c/strong\u003e effect of Quercetin and rapamycin on phosphorylation degree of AKT by western blot analysis in the ankle joint tissues from RA rats. Data are expressed as mean ±SD, a: Significance in relation to control group b: Significance in relation to RA group a,b: significantly different versus both control and RA groups.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/583c3dbd7b6e62a11c4b8e8a.png"},{"id":105565275,"identity":"c3e5cfdc-8b74-4803-99a7-263e77e9e6d8","added_by":"auto","created_at":"2026-03-27 12:52:43","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":359618,"visible":true,"origin":"","legend":"\u003cp\u003eThe microscopic H\u0026amp;E-stained sections from paw tissues showing no damage or inflammation in control normal group, severe inflammation in periarticular tissues (thin black arrow) in RA group, oedema (*) and mild hyperplasia (arrow) in synovial membrane (thin black arrow) in treated group with Quer, no damage or inflammation in periarticular tissues in treated group with Rapa. Low magnification X: 40 bar 200.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/2a62fcf4e51311ef29b4732a.png"},{"id":105569710,"identity":"d81b0b3a-aa3b-477a-bb8b-edc1c6bf531e","added_by":"auto","created_at":"2026-03-27 13:13:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2497483,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8540432/v1/5962895e-4a7f-41ce-8159-580027730422.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anti-inflammatory effect of Quercetin and rapamycin in rat rheumatoid arthritis model by targeting PI3K/AKT/mTOR pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRheumatoid arthritis (RA) is classified as an inflammatory disorder of immunologic origin\u0026nbsp;affecting synovial joints in a chronic way. RA is characterised by infiltration of the articular tissue with\u0026nbsp;inflammatory cells and hyperplasia of the synovium, leading to production of pannus and damage of the cartilages and matrix of bone within the joints\u0026nbsp;\u003cstrong\u003e[1]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e RA is a highly disabling disease resulting in persistent pain, joint and bone damage, and muscle weakness, which needs treatment for the whole life\u0026nbsp;\u003cstrong\u003e[2]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Moreover, it causes lesions in extraarticular tissues, such as the lungs, heart, and vasculature, seriously influencing the patient’s health and life\u0026nbsp;quality,\u0026nbsp;and\u0026nbsp;has a heavy load on both families and the community\u0026nbsp;\u003cstrong\u003e[3]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e RA is affecting\u0026nbsp;approximately 1% of the population across the world\u0026nbsp;\u003cstrong\u003e[4]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe main RA pathology is excessive hyperplasia of the joint synovium. Being in contact with immune cells, growth factors, and inflammatory cytokines such as IL-1 and TNF-α is the main activator of fibroblast-like synoviocytes (FLS) within the joints. After being stimulated, FLS produce\u0026nbsp;multiple\u0026nbsp;proinflammatory cytokines,\u0026nbsp;cathepsin chemokines, and matrix metalloproteinases to degrade the extracellular matrix and joint cartilages\u0026nbsp;\u003cstrong\u003e[5].\u003c/strong\u003e Therefore, potential therapeutic targets for RA include preventing pro-inflammatory mediator release, inhibiting proteolytic enzyme production, and controlling FLS and abnormal synovial hyperplasia in the joint.\u003c/p\u003e\n\u003cp\u003eThe mammalian target of rapamycin (mTOR) signalling pathway is a critical regulator of fundamental cellular processes, including cell growth, differentiation, proliferation, apoptosis, and tumour pathogenesis. This pathway is particularly relevant in Rheumatoid Arthritis (RA), as previous research has demonstrated that abnormal, hyperplastic fibroblast-like synoviocytes (FLS) exhibit malignant-like, aggressive behavior\u0026nbsp;\u003cstrong\u003e[6]\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003eRapamycin is an effective suppressor of\u0026nbsp;mTOR\u0026nbsp;pathway.\u0026nbsp;\u003cstrong\u003eLaragione and Gulko\u003c/strong\u003e declared that the mTOR signalling had a major role in the regulation of FLS's ability to invade the joint tissue and that rapamycin, by its ability to inhibit mTOR signalling pathway, significantly reduced the FLS infiltrative power. So, the mTOR signalling could be a recent goal for the treatment of RA\u0026nbsp;\u003cstrong\u003e[7]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRegarding available treatments for RA, they include DMARDs, monoclonal antibodies and\u0026nbsp;analgesics, steroidal and non-steroidal anti-inflammatory drugs\u0026nbsp;\u003cstrong\u003e[8]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003eHowever, these drugs have several harmful adverse effects, such as nephrotoxicity, gastric upset, proteinuria. They also have immunosuppressive effects, and their actions don’t have specific targets, so they have multiple toxic effects on different organs that affect patient health and quality of life\u0026nbsp;\u003cstrong\u003e[9]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e As a result, it is important to further search for a new therapeutic option for RA with the fewest side effects.\u003c/p\u003e\n\u003cp\u003eThe most common flavonoid in nature is\u0026nbsp;quercetin,\u0026nbsp;with well-known prominent anti-inflammatory and antioxidant activates, indicating its potential anti-rheumatic activity\u0026nbsp;\u003cstrong\u003e[10]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Black tea, vegetables,\u0026nbsp;berries, and different fruits, especially their skins, are rich in quercetin\u0026nbsp;\u003cstrong\u003e[11].\u003c/strong\u003e Quercetin showed its effectiveness in the suppression of many inflammatory pathways\u0026nbsp;in various previous studies\u0026nbsp;at different disorders, like\u0026nbsp;atherosclerosis\u0026nbsp;\u003cstrong\u003e[12]\u003c/strong\u003e , tumours\u0026nbsp;\u003cstrong\u003e[13]\u003c/strong\u003e\u003cstrong\u003e,\u003c/strong\u003e\u0026nbsp; and diabetes mellites \u0026nbsp;\u003cstrong\u003e[14]\u003c/strong\u003e\u003cstrong\u003e,\u003c/strong\u003e and a previous study has shown that quercetin effectively decreases inflammation in Collagen induced arthritis (CIA) rats\u0026nbsp;\u003cstrong\u003e[15]\u003c/strong\u003e and prevents the occurrence of arthritis in mice\u0026nbsp;\u003cstrong\u003e[16]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Moreover, quercetin ameliorated oxidative stress in the articular tissue of arthritic rats, suggesting a therapeutic benefit that is independent of its classic anti-inflammatory effects\u0026nbsp;\u003cstrong\u003e[17]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Acting as a dual inhibitor of the PI3K/mTOR pathways, Quercetin can suppress mTOR activity through multiple mechanisms. This makes the bioflavonoid a potential therapeutic candidate for the management of tumors and other mTOR signalling-dysregulation\u0026nbsp;\u003cstrong\u003e[18].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBuilding upon the need for developing effective disease-modifying treatment for RA, this study investigated the anti-arthritic effects of Quercetin via suppression of the PI3K/AKT/mTOR signalling pathway in a rat model of RA. We further compared Quercetin's efficacy with that of Rapamycin (an established mTOR inhibitor) to validate the role of this pathway in RA pathogenesis.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003e\u003cstrong\u003e2.1. Effect of quercetin and rapamycin on paw diameter\u003c/strong\u003e \u003cstrong\u003ein RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInitial measurements recorded on day 0 revealed no significant differences in paw volume (PV) across treatment and control groups.\u003c/p\u003e\n\u003cp\u003eBy day 7, the arthritic group developed a statistically significant increase in paw diameter compared to the control group. In contrast, both rapamycin and quercetin treatments significantly attenuated this effect, resulting in a marked reduction of paw diameter relative to the arthritic group \u003cstrong\u003eTable\u003c/strong\u003e \u003cstrong\u003e(1) fig 1\u0026amp;2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBy Day 14, paw oedema in the arthritic group remained significantly higher than in controls. Although both rapamycin and quercetin treatments produced a significant anti-oedema effect relative to the arthritic group, their values were still statistically greater than the control levels \u003cstrong\u003eTable (1) Fig 1\u0026amp;2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBy Day 21, the arthritic group continued to display a significantly higher level of paw oedema relative to the control group. While both rapamycin and quercetin treatments significantly reduced oedema relative to the arthritic group, only the rapamycin-treated group showed normalization to a level that was not significantly different from the control. In contrast, the quercetin-treated group still exhibited significant oedema relative to the control\u003cstrong\u003e\u0026nbsp;Table (1) Fig 1\u0026amp;2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the final assessment, paw oedema in the arthritic group remained significantly elevated relative to the control. Both rapamycin and quercetin treatments produced a significant anti-oedematous effect relative to the arthritic group. However, only rapamycin fully normalized the response, as the quercetin group continued to exhibit a statistically significant level of oedema compared to the control \u003cstrong\u003eTable (1) Fig 1\u0026amp;2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results indicate that quercetin, administered at a dose of 150 mg/kg, produced a significant reduction in paw oedema compared to the arthritic control. The magnitude of this inhibitory effect was statistically comparable to that achieved by rapamycin, suggesting that quercetin possesses a similar therapeutic potential for mitigating arthritis-associated oedema in this model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (1): Paw diameter (mm) in the study groups\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"569\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eVariables\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003eControl group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRA group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRapamycin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eQuercetin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eTest of Sign.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDay 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e4.967 \u0026plusmn; 0.077\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e4.967 \u0026plusmn; 0.137\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.040 \u0026plusmn; 0.143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.037 \u0026plusmn; 0.136\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003eF= 0.648\u003c/p\u003e\n \u003cp\u003eP = 0.594\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDay 7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e4.930 \u0026plusmn; 0.144\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e9.857 \u0026plusmn; 0.207\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e6.290 \u0026plusmn; 1.253\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.823 \u0026plusmn; 1.438\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 30.337\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eP1\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e0.242\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.040*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e0.200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDay 14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e5 \u0026plusmn; 0.080\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e10.7 \u0026plusmn; 0.498\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e6.657 \u0026plusmn; 1.024\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e6.290 \u0026plusmn; 0.553\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 90.493\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e0.278\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.019*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;0.002*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDay 21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e5.003 \u0026plusmn; 0.184\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e8.533 \u0026plusmn; 0.524\u0026nbsp;\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.297 \u0026nbsp;\u0026plusmn; 0.221\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.737 \u0026plusmn; 0.254\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 179.780\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e0.453\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.025*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e0.999\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDay 28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e4.970 \u0026plusmn; 0.108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e8.257 \u0026plusmn; 0.587\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.373 \u0026plusmn; 0.441\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.743 \u0026plusmn; 0.349\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 78.215\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e0.915\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026lt; 0.001**\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e0.790\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e0.081\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eN: number, \u0026nbsp; \u0026nbsp; \u0026nbsp; Results are reported as mean \u0026plusmn; standard deviation (SD)\u003c/p\u003e\n\u003cp\u003eF: one way ANOVA test \u0026nbsp; *: Statistically significant (p \u0026lt; 0.05), \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e**: Highly statistically significant (p \u0026lt; 0.001) P: significance between groups. P1: comparison with the control group. a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2.Effect of quercetin and rapamycin on arthritic score in RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur results showed that there was a significant rise in the arthritic score in rheumatoid arthritis group relative to the control group, and the rapamycin treated group showed a significant decline of arthritic scoring when compared to rheumatoid arthritis control group. The quercetin-treated group exhibited a statistically significant reduction in arthritic score compared to the rheumatoid arthritis control group. However, the scores in the quercetin group remained significantly elevated relative to the normal control group \u003cstrong\u003eTable 2 figure 2\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (2): arthritic score and gait score in study groups\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"553\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eVariables\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003eControl group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eRA group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 93px;\"\u003e\n \u003cp\u003eRapamycin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003eQuercetin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003eTest of Sign.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eArthritic score\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003e4 (3 \u0026ndash; 4)\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 93px;\"\u003e\n \u003cp\u003e1 (0 \u0026ndash; 1)\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e1 (1 \u0026ndash; 2)\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eKW = 20.165\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001 **\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003eGait score\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 91px;\"\u003e\n \u003cp\u003e3 (2 \u0026ndash; 3)\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 93px;\"\u003e\n \u003cp\u003e1 (0 \u0026ndash; 2)\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 89px;\"\u003e\n \u003cp\u003e2 (1 \u0026ndash; 2)\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eKW = 18.666\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP = 0.001 **\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eN: number, \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Data are expressed as Median (Range) KW: Kruskal Wallis test \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e*: Statistically significant (p \u0026lt; 0.05), **: Highly statistically significant (p \u0026lt;0.001) \u0026nbsp;\u003c/p\u003e\n\u003cp\u003ea: Significance relative to control group b: Significance relative to RA group\u003c/p\u003e\n\u003cp\u003ea,b: significantly different versus both control and RA groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Effect of quercetin and rapamycin on gait score in RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur results showed that there was a significant rise in the gait score in rheumatoid arthritis group relative to the control group, and the rapamycin treated group showed a significant decline of gait scoring relative to rheumatoid arthritis control group. Quercetin treated group showed a significant decline in the gait score relative to the rheumatoid arthritis control group, but still significantly higher relative to the normal control group \u003cstrong\u003eTable 2 figure 2\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Effect of\u003c/strong\u003e \u003cstrong\u003equercetin and rapamycin on serum Rheumatoid Factor (RF) \u0026amp; serum C - reactive protein (CRP) in RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo analyse the therapeutic efficacy of quercetin and rapamycin, serum levels of CRP and RF were quantified in the rat model of rheumatoid arthritis \u003cstrong\u003e(Table 3, figures 3).\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe levels of CRP and RF were all elevated in serum of the RA group in relation to the control group. Treatment with both quercetin and rapamycin inhibited the elevated levels of CRP and RF relative to the arthritic groups, but still significantly higher in relation to the control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (3): Effect of quercetin and rapamycin on serum CRP, serum RF in RA rats\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"575\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eVariables\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eControl group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRA group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003eRapamycin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eQuercetin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eTest of Sign.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eCRP (mg/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e1.267 \u0026plusmn; 0.186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e3.033 \u0026plusmn; 0.273\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e2 \u0026plusmn; 0.322\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e2.167 \u0026plusmn; 0.314\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 40.484\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRF (IU/ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e2.833 \u0026plusmn; 0.186\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e11.2 \u0026plusmn; 2.688\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e5.7 \u0026plusmn; 0.587\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e6.7 \u0026plusmn; 0.498\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 36.855\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eN: number, \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Data are expressed as mean \u0026plusmn; standard deviation (SD)\u003c/p\u003e\n\u003cp\u003eF for ANOVA test \u0026nbsp; *: Statistically significant (p \u0026lt; 0.05), \u0026nbsp; **: Highly statistically significant (p \u0026lt;0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of quercetin and rapamycin on the serum levels of IL-1\u003c/strong\u003e \u003cstrong\u003e\u0026beta;\u003c/strong\u003e \u003cstrong\u003eand TNF-\u0026alpha; in RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo analyse the effectiveness of Quercetin and rapamycin in treatment of RA rats, the levels of proinflammatory cytokines, such as TNF-\u0026alpha;, IL-1 \u0026beta; in the serum of rats were detected by ELISA \u003cstrong\u003e(Table 4, figure 4).\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha;, IL-1 \u0026beta; were all elevated in serum of the RA group in relation to the control group. Treatment of rats with quercetin and rapamycin respectively prevented this elevation, but still significantly higher in relation to the control group.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (4): Effect of quercetin and rapamycin on serum TNF -\u0026alpha; IL-1 \u0026beta; in RA rats\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"575\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eVariables\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eControl group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRA group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003eRapamycin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eQuercetin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eTest of Sign.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha; (pg/ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e32.7 \u0026plusmn; 5.655\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e97.23 \u0026plusmn; 15.317\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e56.9 \u0026plusmn; 9.732\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e69.3 \u0026plusmn; 5.969\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 43.588\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eIL-1(pg/ml)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e22.167 \u0026plusmn; 2.284\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e57.667 \u0026plusmn; 6.909\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e37.533 \u0026plusmn; 4.317\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e41.667 \u0026plusmn; 4.142\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 57.586\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003eN: number, Results are presented as mean \u0026plusmn; standard deviation (SD) F for ANOVA test \u0026nbsp; *: Statistically significant (p \u0026lt; 0.05), \u0026nbsp; \u0026nbsp; \u0026nbsp;**: Highly statistically significant (p \u0026lt; 0.001) \u0026nbsp;a: Significance relative to control group b: Significance relative to RA group\u003c/p\u003e\n\u003cp\u003ea,b: significantly different versus both control and RA groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.Effect of Quercetin and rapamycin on mTOR mRNA in the ankle joints of RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effects of quercetin and rapamycin on the PI3K/AKT/mTOR pathway in the ankle joints of RA rats were detected through measuring of mTOR gene expression by PCR \u0026nbsp; \u0026nbsp; Relative to the control group, the RA group had significantly elevated protein levels of mTOR \u003cstrong\u003e(Table 5, Fig.5).\u003c/strong\u003e The quercetin and rapamycin groups had lower protein levels of mTOR as compared to arthritic group but as regard to quercetin treated group still had significantly elevated level of mTOR relative to the control group \u003cstrong\u003e(Table 5, Fig.5).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to these results, Quercetin and rapamycin protect against joint damage in RA rats by suppressing the PI3K/AKT/mTOR pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6.Effect of quercetin and rapamycin on\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ephosphorylation degree of mTOR and AKT (p-mTOR and p-Akt) using western blot technique in the ankle joints of RA rats:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effects of quercetin and rapamycin on the PI3K/AKT/mTOR pathway in the ankle joints of RA rats were detected through measuring p-mTOR and p-Akt using western blot technique.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Compared to the control group, RA group exhibited significantly elevated protein levels of p-mTOR and p-Akt (p \u0026lt; 0.05 for both) \u003cstrong\u003e(Table 5. Fig. 6).\u0026nbsp;\u003c/strong\u003eThe quercetin and rapamycin groups had declined protein levels of p-mTOR and p-Akt (all P \u0026lt; 0.05) \u003cstrong\u003e(Table 5., Fig. 6)\u0026nbsp;\u003c/strong\u003ebut still significantly elevated when compared to the control group.\u003c/p\u003e\n\u003cp\u003eAccording to these results, Quercetin and rapamycin protect against joint damage in RA rats by suppressing the PI3K/AKT/mTOR pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (5): Effect of quercetin and rapamycin on PI3K/AKT/mTOR pathway\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"553\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003eVariables\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003eControl group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRA group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eRapamycin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eQuercetin group\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e[N=6]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003eTest of Sign.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003emTOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1.004 \u0026plusmn; 0.004\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e5.398 \u0026plusmn; 1.100\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e1.911 \u0026plusmn; 0.468\u003c/p\u003e\n \u003cp\u003eb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e2.193 \u0026plusmn; 0.513\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 52.089\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003ep-mTOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1.005 \u0026plusmn; 0.008\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e3.807 \u0026plusmn; 0.510\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e1.850 \u0026plusmn; 0.334\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e2.045 \u0026plusmn; 0.499\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 53.615\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003ep-AKT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 90px;\"\u003e\n \u003cp\u003e1.037 \u0026plusmn; 0.053\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e3.645 \u0026plusmn; 0.468\u003c/p\u003e\n \u003cp\u003ea\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e2.117 \u0026plusmn; 0.351\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e1.715 \u0026plusmn; 0.232\u003c/p\u003e\n \u003cp\u003ea, b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 101px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eF= 73.478\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eP \u0026lt; 0.001*\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN: number \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Data are expressed as mean \u0026plusmn; standard deviation (SD)\u003c/p\u003e\n\u003cp\u003eF for ANOVA test \u0026nbsp; *: Statistically significant (p \u0026lt;0.05), \u0026nbsp; \u0026nbsp; **: Highly statistically significant (p \u0026lt; 0.001) a: Significance relative to control group b: Significance relative to RA group a,b: significantly different versus both control and RA groups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.7.Histopathological studies of the paw tissue:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHaematoxylin and eosin-stained joint slices of the control group revealed a standard structure with intact ankles and no arthritic pathological changes were observed; the joint cavity, cartilage lining, and the morphology of bone tissue appeared normal, and no inflammatory cell infiltrate was detected. \u0026nbsp;RA group showed a disturbed joint architecture; the joint tissue exhibited significant abnormality with marked inflammatory cell infiltrate. Rapamycin treatment showed preserved architecture and efficiently alleviated the arthritic changes; the joint structure appeared nearly like the control with absent inflammatory cell infiltrate. Quercetin treatment significantly attenuated the arthritic changes \u003cstrong\u003e(figure 7) (Table 6)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable (6). Analysis of histopathological changes of the ankle joint of different groups:\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"528\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; Groups\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eEdema\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003eDegree of Erosion\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003eInflammatory cellular infiltration\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003eControl normal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003eArthritic group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e++++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e++++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e++++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003eRapamycin treated group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 174px;\"\u003e\n \u003cp\u003eQuercetin treated group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e++\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 96px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eNote: The extent of histopathological alterations was scored based on the percentage of tissue affected: no observed abnormality (0); \u0026nbsp;+ (1\u0026ndash;25%), ++ (26\u0026ndash;50%), +++ (51\u0026ndash;75%), and ++++ (\u0026gt;75%).\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eRA is one of the commonest inflammatory disorders affecting joints that behaves as a chronic disease with articular and extraarticular affections such as\u0026nbsp;interstitial lung disease, affections of the heart and blood vessels, and tumours \u003cstrong\u003e[19]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e RA, by all these manifestations, has a heavy burden on patient health and life, and affects also his family. So, RA is one of the universal issues of public health \u003cstrong\u003e[20].\u003c/strong\u003eDespite the availability of DMARDs, chronic pain is a common complaint of most patients of RA. \u0026nbsp;Severe functional decline that progresses to deformity and disability is also common among them. Moreover, the currently available DMARDs have many adverse effects and toxicities \u003cstrong\u003e[21].\u003c/strong\u003eThere is a crucial need for developing safe and efficient alternative disease modifying treatment for RA \u003cstrong\u003e[22]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Natural products with anti-inflammatory and antioxidant characters can be utilized for arthritis as alternative therapies \u003cstrong\u003e[23].\u003c/strong\u003e\u0026nbsp; \u0026nbsp;Thus, our study estimated the effectiveness of quercetin rat model of rheumatoid arthritis induced by Freund’s Adjutant by examining the effect of quercetin through inhibition of the PI3K/AKT/mTOR signalling and comparing it with rapamycin. The results exhibited amelioration of gait score,\u0026nbsp;degree of paw oedema, and arthritis score in Freund’s Adjutant induced arthritis after treatment with either of these two drugs. Additionally, either of the drugs prevents the elevated serum concentrations of the inflammatory markers, IL-1β, TNF-α, decreases expression of PI3K/AKT/mTOR, and improves the articular configuration determined by H\u0026amp;E.\u003c/p\u003e\n\u003cp\u003eFreund adjuvant-induced arthritis model is one of the commonest RA animal models, which is beneficial in demonstrating the mechanisms of the pathogenesis of RA in details involving\u0026nbsp;autoimmunity mechanisms, inflammatory pathways involvement and how the damage of articular bone and cartilage occurs in RA\u0026nbsp;\u003cstrong\u003e[24]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Subcutaneous injection of Freund adjuvant caused inflammation of the synovial tissue, which is the main characteristic feature of RA. This inflammation of synovium appears as swelling of the joint with excessive infiltration with leukocytes \u003cstrong\u003e[25].\u003c/strong\u003eThere was a significant increase in the arthritic score and paw diameter in RA group relative to the control group but the group that was treated with rapamycin had a significant decline in the arthritic score and paw diameter relative to the rheumatoid arthritis control group which is incompatible with \u003cstrong\u003e[6].\u003c/strong\u003eRapamycin decreases paw oedema, arthritic and gait scoring which may be attributed to its effects on immunological cells as treatment with rapamycin markedly improved the ratios between T-helper cell 17 (Th17) with pro-inflammatory effects to regulatory T cells (Tregs)\u0026nbsp;with\u0026nbsp;anti-inflammatory effects \u003cstrong\u003e[26,27].\u003c/strong\u003e As a disturbed T effectors/Tregs ratio plays a critical role in RA disease progression as effector T cells such as Th17, Th2, and Th1 cells direct macrophages or monocytes to produce many inflammatory mediators destructing the articular tissues\u003cu\u003e.\u003c/u\u003e On the other hand, regulatory T cells (Tregs) stimulate the production of inhibitory mediators to suppress the activation and proliferation of autoreactive T cells and support the immunological haemostasis. PI3K/AKT/mTOR signalling is crucial in the production and activation of T cells \u003cstrong\u003e[28].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuercetin treated group also showed a significant decline in the arthritic score and paw diameter relative to the rheumatoid arthritis group which is incompatible withprevious studies who reported thatquercetin remarkably decreased the paw oedema, arthritis index scores, improving the total pathological score; these effects may be attributed to its ability to inhibit nuclear factor (NF)-κB activation\u0026nbsp;\u003cstrong\u003e[29,30].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs regards to gait score, our results showed that there was\u0026nbsp;a significant increase in the gait score in rheumatoid arthritis group relative to the control group. Both rapamycin and quercetin treated groups showed a significant decline in the gait score relative to the rheumatoid arthritis group. This was the same as previous study wherequercetin attenuates cartilage damage in a rat model of osteoarthritis \u003cstrong\u003e[31].\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe serum concentration of RF and CRP were significantly elevated in the arthritic control group relative to the normal control group and were decreased in quercetin treated group which were in accordance with previous study\u003cstrong\u003e\u0026nbsp;[32].\u0026nbsp;\u003c/strong\u003eRapamycin treated group also showed a significant reduction in CRP\u0026amp;RF which agreed with previous studywho had found that rapamycin improves inflammatory markers including CRP in patients with juvenile rheumatoid arthritis \u003cstrong\u003e[33].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe immunological markers CRP, RF are produced when bone and cartilage become inflamed, starting the pathogenesis of RA \u003cstrong\u003e[34].\u003c/strong\u003eRF is produced because of disorders in the cellular and humoral immune reaction, leading to immigration of B-and\u0026nbsp;T- lymphocytes into the synovium and stimulation of monocytes and macrophages \u003cstrong\u003e[35].\u003c/strong\u003e Consequently, inflammatory mediators as TNF-α and ILs start excessive infiltration in the synovial membrane of the joints.\u0026nbsp;An increased number of these cytokines increases\u0026nbsp;the secretion of C-reactive proteins, increased proteolytic enzymes in the synovial cavity, degenerating the cartilages and bones. Also, cellular accumulation of\u0026nbsp;prostaglandins, kinins, and histamines is increased by these cytokines, resulting in severe joint pain,\u0026nbsp;progressive joint destruction, and deformity that progress to disability, and affecting negatively the patient's\u0026nbsp;quality of life and his overall health \u003cstrong\u003e[36]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInjection of CFA in our experiment resulted in elevation in IL-1β and TNF-α concentrations, which are the major cytokines driving RA pathology \u003cstrong\u003e[37].\u003c/strong\u003e In contrast, Rapamycin treatment prevented the elevated levels of\u0026nbsp;IL-1β and TNF-α which was the same as the results of \u003cstrong\u003e[6].\u003c/strong\u003eQuercetin also showed a reduction of TNFα and IL-1 β\u003cstrong\u003e.\u003c/strong\u003e These results were the same as the results of previous study \u003cstrong\u003e[32].\u003c/strong\u003e Quercetin can prevent the release of inflammatory cytokines, T cells, NF-κB, decreasing joint inflammation, and can suppress the function of the osteoclasts, decreasing its ability to destruct the joints\u003cstrong\u003e\u0026nbsp;[31].\u003c/strong\u003e \u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePI3K/AKT/mTOR signalling is very important in regulating the release of the inflammatory cytokines, oxidative stress, cell apoptosis, andautophagy \u003cstrong\u003e[38,39].\u003c/strong\u003e \u0026nbsp;This pathway is critical for proper immune function and maintaining immune homeostasis and is important for stimulation and proliferation of both T and B cells in RA \u003cstrong\u003e[28,40].\u003c/strong\u003ePast experiments have verified that the PI3K/Akt/mTOR signalling is involved in many pathological alternations in RA, including bone erosion, destruction of the cartilages, synovial inflammation, and synovial pannus formation\u0026nbsp;\u003cstrong\u003e[41]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e Inhibition of PI3K/AKT/mTOR signalling was identified as a promising target for clinical application in RA\u003cstrong\u003e[42]\u003c/strong\u003e as this pathway promotes apoptosis of RA‐FLSs bypreventing cell cycle arrest\u003cstrong\u003e\u0026nbsp;[43].\u0026nbsp;\u003c/strong\u003eAlso, AKT inhibited the proliferation of chondrocytes and promoted autophagy and apoptosis in RA rats by acting in harmony as a part of the PI3K/AKT/mTOR signalling \u003cstrong\u003e[44].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePI3K/Akt/mTOR signalling role in RA is confirmed in our study by analysis of mRNA expression in synovial tissue which obviously showed that the expression of mTOR was elevated in the rheumatoid arthritis relative to the control group which agreed with \u003cstrong\u003e[6].\u003c/strong\u003e RT‐PCR expression levels of mTOR significantly decreased in rapamycin treated group. Similarly, Western blotting analysis results indicated that the protein expression of p‐AKT/AKT,\u0026nbsp;p‐mTOR/mTOR ratios were also significantly declined. Previous study proved that rapamycin treatment inhibits the apoptosis and\u0026nbsp;proliferation of FLSs by preventing the activation of AKT and mTOR \u003cstrong\u003e[43].\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further explore whether quercetin is an applicable inhibitor of mTOR pathway, expression changes in the PI3K/AKT/mTOR were estimated. Our results showed that quercetin showed similar effects as rapamycin at\u0026nbsp;PI3K/AKT/mTOR signalling pathway, supporting the positive influence of quercetin on the treatment of RA. The ameliorating activity of quercetin on PI3K/AKT/mTOR pathway was previously exhibited in previous studies \u003cstrong\u003e[45,46].\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe histopathology of ankle joint in the arthritic rat revealed marked inflammatory infiltrate, oedema, and hyperplastic synovium. RA is characterized by transformation of the synovium into hyperplastic invasive tissue, destructing the cartilage and bone. FLS are potent effector cells that contribute to RA pathogenesis \u003cstrong\u003e[47]\u003c/strong\u003e. Abnormal proliferation of FLS is mainly through increased inflammatory cytokines as TNFα and IL-1β\u003cstrong\u003e\u0026nbsp;[6].\u0026nbsp;\u003c/strong\u003eStimulated macrophages continuously produce TNF-α\u0026nbsp;and\u0026nbsp;IL-1 to keep fibroblasts\u0026nbsp;of the\u0026nbsp;synovium in an inflamed and activated state. The increased levels of synovial inflammatory mediators resulted in varying degrees of joint damage because IL-1, IL-6 and TNF-α stimulates osteoclasts to resorb bone in an aggressive manner by stimulating the expression of the receptor activator of NF-κB ligand (RANKL) which is the main activator of the osteoclasts \u003cstrong\u003e[29].\u003c/strong\u003eStimulation of PI3K/AKT/mTOR signalling is the main principal driver in the pathogenesis of RA as it enhances NF-κB activation and stimulates the release of many inflammatory cytokines (TNF-α, IL-6, and IL-1β) and adhesion molecules leading to an inflammatory reaction,\u0026nbsp;resulting in pathological changes observed in RA \u003cstrong\u003e[46].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Rapamycin improves the histopathological alternations observed in the arthritic group. This result agreed withprevious study of Dai et al.\u003cstrong\u003e\u0026nbsp;[6].\u0026nbsp;\u003c/strong\u003eRapamycin exerted inhibitory effects on FLSs, inhibiting their proliferation, promoting their apoptosis, and reducing joint bone damage mainly by suppressing the PI3K/AKT/mTOR signalling\u0026nbsp;\u003cstrong\u003e[46]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003e \u003c/p\u003e\n\u003cp\u003eQuercetin improves the histopathological changes observed in the arthritic group. These results were in accordance with previous studies\u003cstrong\u003e\u0026nbsp;[36,32]\u003c/strong\u003e\u003cstrong\u003e.\u003c/strong\u003eQuercetin inhibits the release of inflammatory markers by suppressing the pathway of NF-κB. Furthermore, quercetin effectively prevents angiogenesis during inflammatory reaction in arthritis and prevents synovial hyperplasia, indicating that quercetin is a promising new as anti-rheumatic drug \u003cstrong\u003e[48].\u003c/strong\u003eAdditionally,\u0026nbsp;other experiments\u0026nbsp;displayed\u0026nbsp;thatquercetin limits inflammatory cell production and delays bone loss in rheumatoid arthritis rats \u003cstrong\u003e[16,36].\u003c/strong\u003e As previously mentioned, the anti-inflammatory and proliferative activities of quercetin are mainly through its inhibitory effect on PI3K/AKT/mTOR signalling.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study displays that CAF induced RA model in rats showed several arthritic features: physical abnormalities (ankle diameter, arthritic score, gaiting score), biochemical and histological alteration. This is strongly related to activation PI3K/AKT/mTOR molecular pathway with subsequent inflammatory activation and joint and bone damage. The main result of our study displayed that both rapamycin and quercetin treatment significantly decreased CAF induced RA model in rats, presumably by downregulation of PI3K/AKT/mTOR molecular pathway with subsequent suppression of inflammatory cytokines, joint, and bone damage. Quercetin could be a potential safe, alternative disease modifying RA therapy which needs further evaluation.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"4. Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.1. Chemicals and Reagents:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQuercetin (a yellow powder; catalogue number 849061-97-8) was sourced from Sigma Aldrich (St. Louis, MO, USA). We obtained Complete Freund’s adjuvant from M. P. Biomedicals (France), and Rapamycin (Sirolimus oral solution, C51H79NO13) was procured from Hangzhou Zhongmei Huadong Pharmaceutical Co., Ltd (China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.2.Experimental animals:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA cohort of twenty-four adult male Sprague Dawley rats (body weight: 170–200 g) were sourced from the Medical Experimental Research Centre (MERC). Faculty of medicine Mansoura university. Housing was provided in individual cages under standard laboratory conditions, with a temperature regime of 18–22°C and a fixed 12-hour light/dark cycle. Access to a standard diet and potable water was provided ad libitum. A two-week period was allowed for the rats to acclimate to the housing conditions prior to initiating the study. All experimental work was performed in the Clinical Pharmacology Department, Faculty of Medicine, Mansoura University, in accordance with the guidelines authorized by the institutional Research Ethics Committee (Approval number: \u003cstrong\u003eMU-ACUC (MED.R.23.01.8).\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.3.Study design and animal grouping\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter acclimatization, random allocation procedure was used to assign the rats into four distinct experimental cohorts, each consisting of six rats (n=6).\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cstrong\u003eGroup 1 (Negative Control):\u003c/strong\u003e Received a daily oral gavage of the vehicle (0.9% sodium chloride, dosed at 1 mL per 100 g of body weight) for two weeks.\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eGroup 2 (Arthritic group):\u0026nbsp;\u003c/strong\u003eArthritis was induced on day 0 by A single 0.1 mL dose of Complete Freund's Adjuvant (CFA) delivered via subcutaneous injection to the plantar surface of the right hind paw. This group also received the vehicle daily via oral gavage for two weeks.\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eGroup 3 (Rapamycin-treated group):\u003c/strong\u003e Following arthritis induction as in Group 2, this group was treated with rapamycin at a daily dose of 2.5 mg/kg via oral gavage, commencing on day 13 and continuing for a period of two weeks\u003cstrong\u003e\u0026nbsp;[6].\u003c/strong\u003e\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eGroup 4 (Quercetin-treated group):\u0026nbsp;\u003c/strong\u003eAfter the same arthritis induction protocol, this group received quercetin (150 mg/kg body weight) orally gavaged daily beginning on day 13 and continuing for two weeks \u003cstrong\u003e[15]\u003c/strong\u003e\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003e\u003cstrong\u003e4.4. Assessments of ankle diameter, arthritic score, gaiting score:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt the end of the experiment before scarification, all the following were determined:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1-\u0026nbsp; \u0026nbsp;Determination of ankle diameter:\u0026nbsp;\u003c/strong\u003ewe measured\u0026nbsp;the antero-posterior diameter of the hind paw to determine the ankle diameters at days 0, 7, 14,21, and 28.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2-\u0026nbsp; \u0026nbsp;Arthritic score:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJoint inflammation was graded for assessment on a standardized 5-point scale:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;0:\u003c/strong\u003e No observable inflammation.\u003cstrong\u003e\u0026nbsp; 1:\u003c/strong\u003e Swelling and/or redness confined to one digit.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;2:\u003c/strong\u003e Moderate swelling and erythema.\u003cstrong\u003e\u0026nbsp;3:\u0026nbsp;\u003c/strong\u003eSevere swelling and erythema affecting the \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;whole limb.\u003cstrong\u003e\u0026nbsp; 4:\u003c/strong\u003e Severe inflammation with visible deformity and inability to use the limb\u0026nbsp;\u003cstrong\u003e[49].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3-\u0026nbsp; \u0026nbsp;Gait score\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLimping and pain were assessed using a 0–3-point scale: 0: normal gait; 1: slight lameness; 2: pronounced lameness (weight-bearing on toes only); 3: complete inability to bear weight on the limb\u003cstrong\u003e\u0026nbsp;[50].\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.5. Sample collection and processing:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUpon completion of the treatment protocol and assessments of ankle diameter, arthritic score and gaiting score, the rats were anesthetized using intraperitoneal injection of pentobarbital (40 mg/kg) \u003cstrong\u003e[39].\u003c/strong\u003e until loss of consciousness, followed by euthanasia via decapitation, in accordance with ethical standards for animal research. Blood was drawn via terminal cardiac puncture from the left ventricle using a sterile syringe. Following a 30-minute clotting period at room temperature, centrifugation was carried out (3000 × g, 10 minutes, 4°C) to obtain serum. The resulting serum was then stored at -80°C. Hind paw joints were dissected; one portion was rinsed with PBS, blotted dry, minced into \u0026lt;30 mg fragments, and stored in RNA-later at 4°C overnight before long-term storage at -80°C. The remaining tissue was fixed in 10% neutral buffered formalin (NBF) for a minimum of 48 hours for histopathological examination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.6.Biochemical assays:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC-Reactive Protein (CRP) and Rheumatoid Factor (RF):\u003c/strong\u003e Serum CRP was quantified using an automated clinical chemistry analyser (Cobas c 311; Roche Diagnostics). Serum RF was measured using a commercial latex agglutination turbidimetric assay kit (Fujifilm, Cat# 000).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCytokine Analysis (ELISA):\u003c/strong\u003e The serum concentrations of TNF-α and IL-1β were quantified using commercially available enzyme-linked immunosorbent assay (ELISA) kits (IL-1β: Boster, Cat# EK0394; TNF-α: Boster, Cat# EK0527). All samples were assayed in duplicate. The absorbance for each well was measured at 450 nm, and cytokine concentrations were interpolated from a standard curve generated in parallel.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;4.7.\u003cstrong\u003e\u003cu\u003eQuantitative Real-Time PCR (qPCR) Analysis of mTOR Gene Expression:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from joint tissues utilizing the Direct-zol RNA Miniprep Plus kit (Zymo Research, Cat# R2072). RNA purity was confirmed spectrophotometrically (A260/A280 ratio of 1.8–2.1). cDNA was synthesized from 1 μg total RNA using the Superscript IV One-Step RT-PCR kit (Thermo Fisher, Cat# 12594100). qPCR was performed on a Step One Plus Real-Time PCR System (Applied Biosystems) using SYBR Green master mix. The PCR protocol was 45°C for 20 min (reverse transcription); 98°C for 2 min; 40 cycles of 95°C for 10 s, 55°C for 10 s, 72°C for 30 s; followed by melt curve analysis. The 2−ΔΔCT method was used for analysis \u003cstrong\u003e[51].\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePrimer sequences:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emTOR\u003c/strong\u003e (RefSeq: NM_019906.1):\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eForward 5′- GCAATGGGCACGAGTTTGTT -3′\u003c/p\u003e\n\u003cp\u003eReverse 5′- AGTGTGTTCACCAGGCCAAA -3′\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e (RefSeq: XM_039107008.1):\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eForward 5′ CCCATCACCATCTTCCAGGAG -3′\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eReverse 5′- GAAGGGGCGGAGATGATGAC -3′\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.8.Western Blot Analysis:\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein was isolated from the joint tissue homogenates utilizing the Ready-Prep protein extraction kit (Bio-Rad, Cat# 163-2086). Total protein concentration was determined via Bradford assay (Bio Basic Inc., Cat# SK3041) against a BSA standard curve. Samples (20 μg) were denatured in 2X Laemmli buffer at 95°C for 5 min, separated on a 10% TGX Stain-Free Fast-Cast gel (Bio-Rad, Cat# 1610181) at 200 V for 30–40 min, and electrophoretically transferred onto a PVDF membrane with the Trans-Blot Turbo Transfer System (Bio-Rad) using a constant voltage of 25 V applied for 7 minutes. The membrane was blocked using a solution of 5% bovine serum albumin (BSA) in Tris-buffered saline with Tween-20 (TBST) and subsequently probed with the designated primary antibodies (rabbit anti-p-mTOR (Ser2448) (1:1000, Cell Signalling, #5536S) and rabbit anti-p-Akt (Ser473) (1:2000, Cell signalling, #4060S) overnight at 4°C. Following a series of washes, the membrane was probed with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (1:3000, Novus, Cat# NB7160). We visualized the protein bands with the Clarity Western ECL Substrate (Bio-Rad, Cat# 1705060) and imaged on a ChemiDoc MP System (Bio-Rad). Band intensity was quantified by densitometric analysis using Image Lab software (Bio-Rad). The signals were normalized against total protein and β-actin as loading controls (mouse anti-β-actin, 1:5000, Sigma-Aldrich, Cat# A5441).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.9.Histopathological Examination:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJoint tissues were immersion-fixed in 10% neutral buffered formalin (NBF) and decalcified in 10% ethylenediaminetetraacetic acid (EDTA) (solution refreshed every 4 days). Following decalcification, the tissue specimens were processed through a series of increasing ethanol concentrations for dehydration, cleared using xylene, and subsequently embedded in paraffin wax. Sections of 5 µm thickness were subsequently prepared and stained using Haematoxylin and Eosin (H\u0026amp;E) for microscopic evaluation. Histopathological analysis was performed based on established criteria \u003cstrong\u003e[36].\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cu\u003e4.10.Statistical data and analysis\u003c/u\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analysed using SPSS v25.0. The normality of data distribution was evaluated using the Shapiro-Wilk test. For parametric data, a one-way analysis of variance (ANOVA) was performed, followed by Tukey's post-hoc analysis for multiple comparisons; non-parametric datasets were analysed using the Kruskal-Wallis test. A p-value of less than 0.05 was deemed statistically significant\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. N.H. examined the joint tissue specimens, interpreted the histological results, D.H. and E.A. established the study model and concerned with animal housing and administration of therapies. W.A and A.R performed the biochemical and molecular analysis and interpreted the results. B.A., M.S., A.S., M.S., M.A., A.E., I.G., M.S., A.M., N.M., participated in the study model and animal housing. All authors contributed to the conception of the study, revised the manuscript, and approved the submitted manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Doaa Hellal\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe method for animal use was approved by the Institutional Research Board (IRB) Faculty of Medicine, Mansoura University, in accordance with the guidelines authorized by the institutional Research Ethics Committee (Approval number: \u003cstrong\u003eMU-ACUC (MED.R.23.01.8).\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e• \u0026nbsp;Funding resources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMarino, Angela, Irene Paterniti, Marika Cordaro, Rossana Morabito, Michela Campolo, Michele Navarra, et al. \"Role of natural antioxidants and potential use of bergamot in treating rheumatoid arthritis.\" PharmaNutrition 3, no. 2 (2015): 53-59\u003c/li\u003e\n\u003cli\u003eLeonidas Mitrogiannis, M. D., M. D. Evangelos Theodorou, Aikaterini Kitsouli, Georgios Mitrogiannis, M. D. Panagiotis Kanavaros, Ioannis Mitrogiannis, and M. D. Panagiotis Kitsoulis. \"Surgical Treatment of Juvenile Idiopathic Arthritis: A Review.\" Bulletin of the NYU Hospital for Joint Diseases 77, no. 2 (2019): 99-114.\u003c/li\u003e\n\u003cli\u003eYuan, Hui, and Wenguo Cui. \"The lubricated matter in body.\" Progress in Materials Science 146 (2024): 101334.\u003c/li\u003e\n\u003cli\u003eShi, Guang, Xun Liao, Zhao Lin, Wei Liu, Xue Luo, Hongrui Zhan, and Xiyu Cai. \"Estimation of the global prevalence, incidence, years lived with disability of rheumatoid arthritis in 2019 and forecasted incidence in 2040: results from the Global Burden of Disease Study 2019.\" Clinical Rheumatology 42, no. 9 (2023): 2297-2309.\u003c/li\u003e\n\u003cli\u003eIgarashi, Hideya, Ayano Yahagi, Taro Saika, Jun Hashimoto, Tetsuya Tomita, Hideki Yoshikawa, et al. \"A pro-inflammatory role for A20 and ABIN family proteins in human fibroblast-like synoviocytes in rheumatoid arthritis.\" Immunology Letters 141, no. 2 (2012): 246-253.\u003c/li\u003e\n\u003cli\u003eDai, Qiaoding, Di Zhou, Liping Xu, and Xinwei Song. \"Curcumin alleviates rheumatoid arthritis-induced inflammation and synovial hyperplasia by targeting mTOR pathway in rats.\" Drug design, development and therapy (2018): 4095-4105.\u003c/li\u003e\n\u003cli\u003eLaragione, Teresina, and P\u0026eacute;rcio S. Gulko. \"mTOR regulates the invasive properties of synovial fibroblasts in rheumatoid arthritis.\" Molecular medicine 16, no. 9-10 (2010): 352-358.\u003c/li\u003e\n\u003cli\u003eMrid, Reda Ben, Najat Bouchmaa, Hassan Ainani, Rachid El Fatimy, Gabriel Malka, and Loubna Mazini. \"Anti-rheumatoid drugs advancements: New insights into the molecular treatment of rheumatoid arthritis.\" Biomedicine \u0026amp; Pharmacotherapy 151 (2022): 113126\u003c/li\u003e\n\u003cli\u003eSooriakumaran, Prasanna. \"COX-2 inhibitors and the heart: are all coxibs the same?.\" Postgraduate medical journal 82, no. 966 (2006): 242-245.\u003c/li\u003e\n\u003cli\u003eHannan, Abdul, Bushra Akhtar, Ali Sharif, Fozia Anjum, Imran Pasha, Ahrar Khan, et al. \"Quercetin-loaded chitosan nanoparticles ameliorate adjuvant-induced arthritis in rats by regulating anti-oxidant enzymes and downregulating pro-and inflammatory cytokines.\" Inflammopharmacology 31, no. 1 (2023): 287-300.\u003c/li\u003e\n\u003cli\u003eTakahashi, Shota, Hitoshi Muguruma, Naomi Osakabe, Hitoshi Inoue, and Tatsuya Ohsawa. \"Electrochemical determination with a long-length carbon nanotube electrode of quercetin glucosides in onion, apple peel, and tartary buckwheat.\" Food Chemistry 300 (2019): 125189.\u003c/li\u003e\n\u003cli\u003eLuo, Zhen, Mingfu Tian, Ge Yang, Qiaoru Tan, Yubing Chen, Geng Li, et al \"Hypoxia signaling in human health and diseases: implications and prospects for therapeutics.\"\u0026nbsp;\u003cem\u003eSignal transduction and targeted therapy\u003c/em\u003e7, no. 1 (2022): 218.\u003c/li\u003e\n\u003cli\u003eMurakami, Akira, Hitoshi Ashida, and Junji Terao. \"Multitargeted cancer prevention by quercetin.\" Cancer letters 269, no. 2 (2008): 315-325.\u003c/li\u003e\n\u003cli\u003eYan, Lei, Mostafa Vaghari-Tabari, Faezeh Malakoti, Soheila Moein, Durdi Qujeq, Bahman Yousefi, et al. \"Quercetin: an effective polyphenol in alleviating diabetes and diabetic complications.\" Critical reviews in food science and nutrition 63, no. 28 (2023): 9163-9186.\u003c/li\u003e\n\u003cli\u003eGardi, C., K. Bauerova, B. Stringa, V. Kuncirova, L. Slovak, S. Ponist, et al. \"Quercetin reduced inflammation and increased antioxidant defense in rat adjuvant arthritis.\" Archives of biochemistry and biophysics 583 (2015): 150-157.\u003c/li\u003e\n\u003cli\u003eHaleagrahara, Nagaraja, Socorro Miranda-Hernandez, Md Abdul Alim, Linda Hayes, Guy Bird, and Natkunam Ketheesan. \"Therapeutic effect of quercetin in collagen-induced arthritis.\" Biomedicine \u0026amp; Pharmacotherapy 90 (2017): 38-46.\u003c/li\u003e\n\u003cli\u003eSouza, Kaiany S., Lucas S. Moreira, Bruna Thais Silva, Byanca PM Oliveira, Amarilis S. Carvalho, Patr\u0026iacute;cia S. Silva, et al. \"Low dose of quercetin-loaded pectin/casein microparticles reduces the oxidative stress in arthritic rats.\" Life Sciences 284 (2021): 119910\u003c/li\u003e\n\u003cli\u003eShah, Suprava, Rakesh Narang, Vikram J. Singh, Govindaiah Pilli, and Surendra Kumar Nayak. \"A review on anticancer profile of flavonoids: Sources, chemistry, mechanisms, structure-activity relationship and anticancer activity.\" Current Drug Research Reviews Formerly: Current Drug Abuse Reviews 15, no. 2 (2023): 122-148.\u003c/li\u003e\n\u003cli\u003eDeane, Kevin D., and Tsang Tommy Cheung. \"Rheumatoid arthritis prevention: challenges and opportunities to change the paradigm of disease management.\" Clinical Therapeutics41, no. 7 (2019): 1235-1239.\u003c/li\u003e\n\u003cli\u003eZhang, Ziyi, Xiaopeng Gao, Shiwei Liu, Qingshuai Wang, Yingjie Wang, Shuai Hou, et al. \"Global, regional, and national epidemiology of rheumatoid arthritis among people aged 20\u0026ndash;54 years from 1990 to 2021.\" Scientific Reports 15, no. 1 (2025): 10736.\u003c/li\u003e\n\u003cli\u003eRoubille, Camille, Vincent Richer, Tara Starnino, Collette McCourt, Alexandra McFarlane, Patrick Fleming, et al. \"The effects of tumour necrosis factor inhibitors, methotrexate, non-steroidal anti-inflammatory drugs and corticosteroids on cardiovascular events in rheumatoid arthritis, psoriasis and psoriatic arthritis: a systematic review and meta-analysis.\" Annals of the rheumatic diseases 74, no. 3 (2015): 480-489.\u003c/li\u003e\n\u003cli\u003eRadu, Andrei-Flavius, and Simona Gabriela Bungau. \"Management of rheumatoid arthritis: an overview.\" Cells 10, no. 11 (2021): 2857.\u003c/li\u003e\n\u003cli\u003e Lahiri, Manjari, Amelia Santosa, Lay Kheng Teoh, Jane A. Clayton, Sheen Yee Lim, Gim Gee Teng, et al. \"Use of complementary and alternative medicines is associated with delay to initiation of disease‐modifying anti‐rheumatic drug therapy in early inflammatory arthritis.\" International Journal of Rheumatic Diseases 20, no. 5 (2017): 567-575.\u003c/li\u003e\n\u003cli\u003eChoudhary, Narayan, Lokesh K. Bhatt, and Kedar S. Prabhavalkar. \"Experimental animal models for rheumatoid arthritis.\" Immunopharmacology and immunotoxicology 40, no. 3 (2018): 193-200.\u003c/li\u003e\n\u003cli\u003eMcInnes, Iain B., and Georg Schett. \"Pathogenetic insights from the treatment of rheumatoid arthritis.\" The Lancet 389, no. 10086 (2017): 2328-2337.\u003c/li\u003e\n\u003cli\u003eNiu, Hong-Qing, Zhao-Hua Li, Wen-Peng Zhao, Xiang-Cong Zhao, Chen Zhang, Jing Luo, et al. \"Sirolimus selectively increases circulating Treg cell numbers and restores the Th17/Treg balance in rheumatoid arthritis patients with low disease activity or in DAS28 remission who previously received conventional disease-modifying anti-rheumatic drugs.\" Clin Exp Rheumatol 38, no. 1 (2020): 58-66.\u003c/li\u003e\n\u003cli\u003eLin, Hong, Felipe Salech, Anthony Lim, Sara Vogrin, and Gustavo Duque. \"The effect of rapamycin and its analogues on age-related musculoskeletal diseases: a systematic review.\" Aging Clinical and Experimental Research 34, no. 10 (2022): 2317-2333.\u003c/li\u003e\n\u003cli\u003eZhang, Fen, Ting Cheng, and Sheng-Xiao Zhang. \"Mechanistic target of rapamycin (mTOR): a potential new therapeutic target for rheumatoid arthritis.\" Arthritis Research \u0026amp; Therapy 25, no. 1 (2023): 187\u003c/li\u003e\n\u003cli\u003eHaleagrahara, Nagaraja, Kelly Hodgson, Socorro Miranda-Hernandez, Samuel Hughes, Anupama Bangra Kulur, and Natkunam Ketheesan. \"Flavonoid quercetin\u0026ndash;methotrexate combination inhibits inflammatory mediators and matrix metalloproteinase expression, providing protection to joints in collagen-induced arthritis.\" Inflammopharmacology 26, no. 5 (2018): 1219-1232.\u003c/li\u003e\n\u003cli\u003eTang, Mengshi, Yan Zeng, Weijun Peng, Xi Xie, Yongyu Yang, Biting Ji, and Fen Li. \"Pharmacological aspects of natural quercetin in rheumatoid arthritis.\" Drug Design, Development and Therapy (2023): 2043-2053.\u003c/li\u003e\n\u003cli\u003eMok, Sze-Wing, Sai-Chuen Fu, Yau-Chuk Cheuk, I-Ming Chu, Kai-Ming Chan, Ling Qin, et al. \"Intra-articular delivery of quercetin using thermosensitive hydrogel attenuate cartilage degradation in an osteoarthritis rat model.\" Cartilage 11, no. 4 (2020): 490-499.\u003c/li\u003e\n\u003cli\u003eEl-Said, Karim Samy, Amira Atta, Maysa A. Mobasher, Mousa O. Germoush, Tarek M. Mohamed, and Maha M. Salem. \"Quercetin mitigates rheumatoid arthritis by inhibiting adenosine deaminase in rats.\" Molecular Medicine 28, no. 1 (2022): 24.\u003c/li\u003e\n\u003cli\u003eForoncewicz, Bartosz, Krzysztof Mucha, Leszek Pączek, Andrzej Chmura, and Wojciech Rowiński. \"Efficacy of rapamycin in patient with juvenile rheumatoid arthritis.\" Transplant international 18, no. 3 (2005): 366-368.\u003c/li\u003e\n\u003cli\u003eNagatomo, F., N. Gu, H. Fujino, T. Okiura, F. Morimatsu, I. Takeda, et al.. \"Effects of exposure to hyperbaric oxygen on oxidative stress in rats with type II collagen-induced arthritis.\" Clinical and experimental medicine 10, no. 1 (2010): 7-13\u003c/li\u003e\n\u003cli\u003eScherer, Hans Ulrich, Thomas H\u0026auml;upl, and Gerd R. Burmester. \"The etiology of rheumatoid arthritis.\" Journal of autoimmunity 110 (2020): 102400.\u003c/li\u003e\n\u003cli\u003eAlotaibi, Badriyah S., Muhammad Khurram Waqas, Sunabal Saleem, Haya Yasin, Zelal Kharaba, and Ghulam Murtaza. \"Rheumatoid arthritis treatment potential of stearic acid nanoparticles of quercetin in rats.\" ACS omega 9, no. 6 (2024): 7003-7011.\u003c/li\u003e\n\u003cli\u003eSimsek, Ismail. \"TNF Inhibitors for Rheumatoid Arthritis.\" Bulletin of the NYU Hospital for Joint Diseases 69, no. 3 (2011).\u003c/li\u003e\n\u003cli\u003eFang, Shaohong, Xin Wan, Xiaoyi Zou, Song Sun, Xinran Hao, Chenchen Liang, et al. \"Arsenic trioxide induces macrophage autophagy and atheroprotection by regulating ROS-dependent TFEB nuclear translocation and AKT/mTOR pathway.\" Cell death \u0026amp; disease 12, no. 1 (2021): 88.\u003c/li\u003e\n\u003cli\u003eHellal Doaa, Sarah Ragab Abd El-Khalik, Heba M. Arakeep, Doaa A. Radwan, Hend S. Abo Safia, and Eman AE Farrag. \"Activation of sirtuin 3 and maintenance of mitochondrial homeostasis by artemisinin protect against diclofenac-induced kidney injury in rats.\" Naunyn-Schmiedeberg's Archives of Pharmacology 398, no. 5 (2025): 5593-5609.\u003c/li\u003e\n\u003cli\u003eTang, Yawei, Ziran Bai, Jingjing Qi, Zhimin Lu, Guan Wang, Minli Jin, et al. \"Altered peripheral B lymphocyte homeostasis and functions mediated by IL-27 via activating the mammalian target of rapamycin signaling pathway in patients with rheumatoid arthritis.\" Clinical \u0026amp; Experimental Immunology 206, no. 3 (2021): 354-365.\u003c/li\u003e\n\u003cli\u003eLv, Mengying, Qiaoling Liang, Zhaoyong Luo, Bo Han, Tengyang Ni, Yang Wang, et al. \"UPLC-LTQ-Orbitrap-Based cell metabolomics and network pharmacology analysis to reveal the potential antiarthritic effects of pristimerin: in vitro, in silico and in vivo study.\" Metabolites 12, no. 9 (2022): 839.\u003c/li\u003e\n\u003cli\u003eChen, Kun, Zhao-Wei Lin, Sheng-mao He, Cheng-qiang Wang, Jian-cheng Yang, Yao Lu, et al. \"Metformin inhibits the proliferation of rheumatoid arthritis fibroblast-like synoviocytes through IGF-IR/PI3K/AKT/m-TOR pathway.\" Biomedicine \u0026amp; Pharmacotherapy 115 (2019): 108875.\u003c/li\u003e\n\u003cli\u003eZhang, FengQi, YiYang Zhang, JiaWang Zhou, Ying Cai, ZhiYu Li, Jing Sun, et al. \"Metabolic effects of quercetin on inflammatory and autoimmune responses in rheumatoid arthritis are mediated through the inhibition of JAK1/STAT3/HIF-1\u0026alpha; signaling.\" Molecular Medicine 30, no. 1 (2024): 170\u003c/li\u003e\n\u003cli\u003eFeng, Fa-Bo, and Hai-Yan Qiu. \"RETRACTED: Effects of artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis.\" (2018): 1209-1220.\u003c/li\u003e\n\u003cli\u003eGuo, Z., Zhang, J., Li, M., Xing, Z., Li, X., Qing, J., ... \u0026amp; Zou, X. (2024). Mechanism of action of quercetin in regulating cellular autophagy in multiple organs of Goto-Kakizaki rats through the PI3K/Akt/mTOR pathway. Frontiers in Medicine, 11, 1442071.\u003c/li\u003e\n\u003cli\u003eWang, D., Fu, N., \u0026amp; Liu, X. Mechanism of Quercetin Mediating PI3K/Akt/mTOR Pathway in Alleviating Cerebral Vascular Stenosis Caused by Vascular Endothelial Cell Injury. International Journal of Pharmacology, 21(3), 391-400.\u003c/li\u003e\n\u003cli\u003eLiu, Chaohong, Nicole M. Chapman, Peer WF Karmaus, Hu Zeng, and Hongbo Chi. \"mTOR and metabolic regulation of conventional and regulatory T cells.\"\u0026nbsp;\u003cem\u003eJournal of Leucocyte Biology\u003c/em\u003e97, no. 5 (2015): 837-847.\u003c/li\u003e\n\u003cli\u003eGuazelli, Carla FS, Larissa Staurengo-Ferrari, Ana C. Zarpelon, Felipe A. Pinho-Ribeiro, Kenji W. Ruiz-Miyazawa, Fabiana TMC Vicentin, et al. \"Quercetin attenuates zymosan-induced arthritis in mice.\" Biomedicine \u0026amp; pharmacotherapy 102 (2018): 175-184\u003c/li\u003e\n\u003cli\u003eKim, Kyung-Woon, Yong-Seung Shin, Kap-Sung Kim, Young-Chae Chang, Kwan-Kyu Park, Jae-Bok Park, et al. \"Suppressive effects of bee venom on the immune responses in collagen-induced arthritis in rats.\" Phytomedicine15, no. 12 (2008): 1099-1107.\u003c/li\u003e\n\u003cli\u003eBush, K. A., B. W. Kirkham, and J. S. Walker. \"The \u0026kappa;‐opioid agonist, asimadoline, alters cytokine gene expression in adjuvant arthritis.\" Rheumatology 40, no. 9 (2001): 1013-1021.\u003c/li\u003e\n\u003cli\u003eLivak, Kenneth J., and Thomas D. Schmittgen. \"Analysis of relative gene expression data using real-time quantitative PCR and the 2\u0026minus; \u0026Delta;\u0026Delta;CT method.\" methods 25, no. 4 (2001): 402-408.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Rheumatoid arthritis, Quercetin, rapamycin, Freund Adjuvant, mammalian target of rapamycin","lastPublishedDoi":"10.21203/rs.3.rs-8540432/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8540432/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Rheumatoid arthritis (RA) is one of the most prevalent chronic autoimmune disorders that primarily affects the articular tissue and is associated with significant systemic comorbidities. While numerous disease modifying anti-rheumatic drugs (DMARDs) are available for therapy, they are still not enough for most of patients to relieve pain. In addition to having several adverse effects, patients continue to have functional decline despite the use of these drugs. Quercetin, a natural bioflavonoid known for its potent anti-inflammatory and antioxidant properties, presents a promising alternative in the treatment of RA. Thus, our study estimated the effect of quercetin in a Freund’s Adjuvant-induced rat model of RA to test the effectiveness of quercetin through suppression of the PI3K/AKT/mTOR signalling pathways. Furthermore, we compared Quercetin's effects with those of Rapamycin (an established mTOR inhibitor) to validate the pathway's involvement in RA pathogenesis. Twenty-four rats Sprague Dawley of male sex were classified into four groups: negative control, arthritic group, rapamycin treated group, quercetin treated group. At the end of the study, before scarification, assessments of all the following were done, ankle diameter, arthritic score, and gaiting score. Then, animals were scarified, and the following markers were estimated: serum rheumatoid factor (RF) and CRP, and serum IL-1β and TNF-α. mTOR was estimated by western blotting and real-time PCR. p-AKT was evaluated by western blotting. The joint tissues were stained for H\u0026E to detect the main histopathological alterations. Quercetin and rapamycin improved ankle diameter, arthritic score, gaiting score, and decreased joint inflammation markers, as well as decreased mTOR and p-AKT expression. Histopathological examination confirmed the effects of quercetin and rapamycin as detected by light microscopy. Quercetin can modulate pathological and biochemical alternations in Freund adjuvant induced arthritis and can be considered a new possible disease modifying antirheumatic option for rheumatoid arthritis through its effect on PI3K/AKT/mTOR pathway.","manuscriptTitle":"Anti-inflammatory effect of Quercetin and rapamycin in rat rheumatoid arthritis model by targeting PI3K/AKT/mTOR pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-25 06:34:02","doi":"10.21203/rs.3.rs-8540432/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-21T09:13:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-15T11:13:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-08T16:14:23+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-31T03:37:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"140939147008974138897653078806180630297","date":"2026-03-26T09:35:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"252220119706394834941030447733272777289","date":"2026-03-25T12:37:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"55543046830055727352377337129146990524","date":"2026-03-25T11:52:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-23T04:01:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-13T03:18:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-02-11T19:05:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-31T09:54:26+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-01-31T09:39:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"060ee8c0-20e1-45a6-a220-02a3780c484f","owner":[],"postedDate":"March 25th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":64937724,"name":"Health sciences/Diseases"},{"id":64937725,"name":"Biological sciences/Drug discovery"},{"id":64937726,"name":"Biological sciences/Immunology"},{"id":64937727,"name":"Health sciences/Medical research"},{"id":64937728,"name":"Health sciences/Rheumatology"}],"tags":[],"updatedAt":"2026-05-04T19:38:10+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-25 06:34:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8540432","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8540432","identity":"rs-8540432","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0