Forensic Identification of Wild Ungulate Species via Mitochondrial Cytochrome C oxidase Gene Analysis

Forensic Identification of Wild Ungulate Species via Mitochondrial Cytochrome C oxidase Gene Analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Forensic Identification of Wild Ungulate Species via Mitochondrial Cytochrome C oxidase Gene Analysis Jagdish Swami, Girish Patil, M. Shashi Kumar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6366101/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The identification of wild animal species is crucial for the conservation of biodiversity and the prevention of illegal wildlife trade and poaching. Wild ungulates are highly susceptible to poaching, making it essential to develop reliable and authentic methods for identifying species from biological samples. By using mitochondrial DNA barcoding techniques, particularly targeting the Cytochrome c Oxidase gene , it offers an effective method for the accurate identification of species involved in poaching and illegal wildlife trade. The application of this technique in India and potentially in other countries can greatly assist in strengthening wildlife conservation efforts , combatting illegal wildlife trade , and providing robust evidence for legal authorities. Furthermore, it contributes to global efforts to document and preserve the genetic diversity of wild ungulates and other species. DNA FINS Mitochondria PCR DNA barcoding speciation Figures Figure 1 Figure 2 Figure 3 Introduction Reducing forest cover, increasing urbanization, continued wildlife poaching and man-animal conflicts have tremendously impacted the survival of wildlife. The demographic changes such as Corona Virus Infections Disease (COVID) − 2019 lockdowns have significantly increased poaching of wild ungulates at their habitats (Badola, 2020 ). Ungulates are polyphyletic hoofed quadruped mammals that play important role in forest ecosystems. In the Indian context, wild herbivores such as barking deer ( Muntiacus muntjak) , black buck ( Antilope cervicapra) , mouse deer ( Moschiola indica) , nilgai ( Boselaphus tragocamelus) and spotted deer ( Axis axis) are protected under Wildlife Protection Act, 1972. India is a treasure of 35 species of ungulates; of which, 25 are protected under Wildlife Protection Act of 1972 (Daniel 1991 ). Many factors are contributing to declining numbers of the wild ungulates; expanding human population, increasing man-animal conflicts, declining quantity and quality of land, water scarcity during critical times, decreasing forest cover, etc. Of all these, illegal poaching is a major contributing factor. Since wild ungulates play balancing role in the nature in terms of their crucial function in food chains of forest ecosystems, their decreasing number is a serious concern requiring conservation activities so as to preserve the biodiversity. Herbivores act as a food source to carnivores and human induced population disturbance in herbivores directly contributes to the vulnerability of carnivores (Proffitt et al, 2013 ; Xiao et al. 2018 ). Spotted deer ( Axis axis ) population is drastically declining at an estimated extinction rate of 45% over the last 50 years in the Indian sub-continent (Karanth et al. 2010 ). However, at some places it acts as an invasive species and outweigh in number especially in protected areas (Mohanty et al. 2016 ). India’s 123 protected areas and forest tracts nurture spotted deer (Sankar and Acharya, 2004 ). Nevertheless, spotted deer are killed illegally by humans for flesh, skin and antlers. Black buck ( Antilope cervicapra ) is widespread across Indian sub-continent; it mostly occurs in the Tarai region (Bashistha et al., 2012 ). Although this ecological indicator once inhabited the entire Indian subcontinent, but now its number is decreasing due to habitat destruction and poaching (Roberts, 1992). Barking deer ( Muntiacus muntjak ) or the Indian muntjak is one of the smallest deer belonging to Cervidae family. Even though muntjaks are listed under least concern category by the International Union for Conservation of Nature and Natural Resources (IUCN); their depleting number is of concern that occurs due to habitat destruction and poaching (Timmins et al. 2016 ). The small size in particular makes them highly vulnerable to hunting or poaching for meat and skin. Mouse deer ( Moschiola indica ) is a small nocturnal solitary artiodactyl that inhabit densely covered forests. Mouse deer is also known as Indian chevrotain and it lacks antlers (evolutionarily primitive). It is distributed across the India mostly in the Deccan peninsula including eastern and Western Ghats, Central India, Gangetic plains (except West Bengal) and the Tarai region bordering Nepal. Encroachment of forest due to anthropogenic activities and poaching has adversely affected this species (Duckworth and Timmins, 2015 ). Nilgai ( Boselaphus tragocamelus) is also known as blue bull; this largest Antelope is widely distributed in India. Nilgai is perceived as an agricultural pest in India since it depredates crops (Goyal and Rajpurohit 1999 ; IUCN, 2006 ). As per Indian Hindu doctrine, Nilgai is perceived sacred and treated on par with the cow; its hunting or harassing refrained (Prater, 1980 ). However, instances of its hunting for flesh arise as it has resemblance with that of beef. Authentic species identification of poached species helps in the wildlife protection and conservation initiatives. Use of different molecular markers has evolved as a powerful tool in species identification. Previously, techniques such as liquid chromatography (Dratch et al. 1996 ), immuno assay (Ubelaker et al. 2004 ), electrophoresis (Abraham et al . 2001), etc were for species identification of biological samples. Nevertheless, in the recent years, DNA based techniques are increasingly been used due to their higher specificity and stability. Mitochondrial DNA targets have been conclusively proven for species identification (Irwin et al. 1991 , Hayashi et al. 1985 , Gupta et al., 2015 ); this offers exploitation of variations in the mitochondrial DNA for the purpose of discrimination of closely related species that offers inter-species sequence variations. Mitochondrial DNA has been used extensively due to high copy number of mitochondria in the cell. Mitochondria follow clonal inheritance, only dam contributes mitochondria, genome does not undergo recombination and hence its genetic material is transferred to the next generation unchanged (Galtier et al. 2009 ). Further, mitochondrial genome accumulates high percentage of neutral mutations that aid in animal species identification. Each mitochondrion contains 2–6 circular DNA molecules, has 16,500 bp size and codes several genes (Gardner and Snustad, 1984 ). Several DNA based techniques have been developed for species identification of ungulates: species specific PCR (Paul et al., 2019 ), Polymerase Chain Reaction – Restriction Fragment Length Polymorphism (PCR–RFLP) (Rajput et al., 2013 ; Siddappa et al., 2013 ; Gupta et al ., 2008) and real time PCR (Davitkov et al. 2017 ). In the present study, conserved region of mitochondrial Cytochrome c Oxidase I (COI) sequences were amplified using specially designed universal primers and the amplicon were sequenced and analyzed to identify the biological samples derived from wild ungulates. Materials and Methods Collection of samples In the present study, blood as well as meat samples from black buck, barking deer, mouse deer, nilgai and spotted deer were collected for standardization of DNA based molecular techniques for species identification. Permission to collect the samples was obtained from the Principal Chief Secretary, Department of forest, Telangana state, India as well as the Director and Curator of Nehru Zoological Park, Hyderabad, India. Samples were collected individually into sterile containers and transported under chilled condition then stored at -20 °C until further analysis. Three samples were collected for each species of ungulates. Oligonucleotide Primers The primers for Cytochrome c oxidase I (COI) gene were designed by downloading the sequence and by using the primer select program of National Centre for Biotechnology Information (NCBI) database for this study. The primers were got synthesized from IRA Biotech, Hyderabad. Table 1: Details of primers used in the study Primers used Sequence of primers Cyt C oxidase gene F – 5’ TGGAACAGGCTGAACTGTAT 3’ R – 5’ ACTTTTACTCCTGTTGGGAT 3’ Isolation of DNA Isolation of DNA from tissue/ meat samples DNA extraction from tissue samples was undertaken using commercial kit (GCC Biotech, Kolkata, West Bengal, India) following the manufacturer’s instructions supplied along with the kit. Briefly, 20-100 mg of tissue was cut into very small pieces using a pair of scissors and placed in a 1.5 ml micro centrifuge tube. A master mix (275 µl) consisting of 200 µl of nuclei lysis solution, 50 µl of 0.5 M EDTA (pH 8), 20 µl of proteinase K (20 mg/ml) and 5 µl of RNase A solution (4 mg/ml) was added to each tube. The tubes were then incubated for 16-18 hrs at 55°C. After incubation, 250 µl of lysis buffer was added to the tubes and then vertexed. The contents were loaded onto mini column assembly and centrifuged @ 10,000 rpm for 3 minutes. The mini columns were then washed with 650 µl of wash solution 4-6 times, dried by centrifugation for 2 min and then transferred to fresh 1.5 ml tubes. A volume of 250 µl of Nuclease Free Water (NFW) was added and incubated for 2 min at room temperature and centrifuged for 2 minutes at the same speed for 1 min. An additional 250 µl of NFW was added to the tubes and incubated for 2 min after incubation, the tubes were centrifuged for 2 min and the pooled elutes were collected and stored at -20°C for further use. Isolation of DNA from the blood samples The DNA from blood samples was isolated by using phenol: chloroform method (Sambrook and Russel, 2001) with slight modifications. Fresh blood (20 ml) samples were collected in 3.5 ml ACD or EDTA and centrifuged (2,500 rpm for 15 min). The supernatant was discarded and buffy coat was collected. To this about 15 ml lysis buffer was added and the tubes were incubated at 37°C for 1 hr. Then, proteinase-K solution (20 mg/ml) was added @ 200 µg/ml and again incubated at 50°C for not less than 3 h or overnight. During incubation, regular swirling of the tubes was undertaken gently from time to time. Equal volume of tris-saturated phenol (equilibrated with 0.1 M Tris-Cl, pH 8.0) was added and the contents of the tubes were subjected to mixing end to end for 10 min. and the contents were then centrifuged at 6,500 RPM for 15 min. The upper aqueous phase was collected into a fresh tube and equal volume of Phenol: Chloroform: Isoamyl alcohol (25:24:1) mixture was added and centrifuged. The upper layer was collected and again equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added and centrifuged. Finally, the upper aqueous phase was collected in a fresh tube and equal volume of chloroform was added and then centrifuged. The upper phase was again collected in to a fresh tube containing 0.2 volumes of 10 M ammonium acetate and 2 volumes of absolute ethanol and was mixed well for precipitation of DNA. The mixture containing visible DNA threads were centrifuged at (10,000 RPM for 10 min). The DNA pellet was washed twice with 70% alcohol by centrifugation (10,000 RPM for 5 min each), dried over a dry bath at 60°C and then dissolved in 1X TE (Tris-EDTA) buffer (50- 100 µl) or nuclease free water either. These DNA samples were used for PCR or stored at -20°C until further use. Qualitative and quantitative analysis of extracted DNA The concentration of DNA was assessed with the help of Nano spectrophotometer at 260 nm and analyzed for purity by determining the optical density at 260/280 (Make: Denovix, Model:DS-11FX). (The recommended optimum values for purity lies between 1.7 to 2. The DNA which exhibited the ratio within the limit were taken for further study. All the extracted samples were kept at – 20 °C for further use. The concentration of DNA was estimated by using following formula (1 OD value at 260 nm is equivalent to 50 ng dsDNA / µl) Standardization of Polymerase Chain Reaction mitochondrial Cytochrome c Oxidase (DNA barcode) gene PCR was performed in a 50 µl reaction volume; consisting of 5 µl of 10X Assay buffer [100 mM Tris- HCl, pH 9.0, 15 mM MgCl2, 500 mMKCl and 0.1% gelatin],0.25mM of dNTP mix, 20pm each of forward and reverse primer, 1 U Taq DNA polymerase, 50ng of purified DNA and autoclaved NFW to make the final volume. The PCR was carried out in thermal cycler (Make: Applied Bio systems, USA) with the thermal cycling conditions: Initial denaturation at 94 °C for 5 min; followed by 30 cycles of denaturation (95 °C, 30 s), annealing (55, 60, 60, 50 and 55°C for mouse deer, barking deer, black buck, nilgai and spotted deer, respectively for 1 min and extension (72 °C for 1 min) with the final extension at 72 °C for 5 min. The PCR products were electrophoresed over 1 % agarose gel and visualized through gel documentation system and stored at -20 0 C for further use. Sequencing of PCR products The PCR product of each species was custom sequenced (IRA Biotech, Hyderabad) and analyzed through Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST hit showing the highest identity was deduced as the closest species. Further, multiple sequence alignment of sequences was carried out using Clustal W algorithm (DNA STAR software, Lasergene). The nucleotide sequences of Cytochrome c Oxidase I (COI) gene of different deer species submitted to NCBI (National Centre for Biotechnology Information) nucleotide database and their Gene bank acession numbers are given in Table 2. 4, 5 and 6. The Cytochrome c Oxidase I (COI) gene sequences of spotted deer, mouse deer, nilgai, barking deer and black buck were sequenced in this study and that of other species used for sequence comparison were retrieved from gen bank nucleotide sequence database (www.ncbi.nlm.nih.gov/centrez). Results and Discussion Standardization of PCR amplification of mitochondrial Cytochrome c Oxidase (COI) gene The PCR amplification using the primer designed targeting mitochondrial Cytochrome c Oxidase I (COI) gene was undertaken in the following species i.e. spotted deer, black buck, barking deer, nilgai and mouse deer. PCR amplification yielded amplicons of about 656 bp size in all the species (Fig: 1). Sequencing of mitochondrial Cytochrome c Oxidase (COI) gene PCR amplicons were sequenced with the help of commercial sequencing facility. Nucleotide sequence analysis of mitochondrial Cyt C oxidase gene sequences of spotted deer ( Axis axis ), black buck ( Antilope cervicapra ), barking deer ( Muntiacus muntjak ), mouse deer ( Moschiola indica ), and nilgai ( Boselaphus tragocamelus ) along with sheep ( Ovis aries) and goat ( Capra hircus ) downloaded from NCBI was undertaken using Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/entrez) which showed highest nucleotide homology with the respective species. Details of the nucleotide sequences used in this study and their accession numbers are given in Table 2. Sequence alignment was done using CLUSTAL W algorithm Megalign program (Laser Gene, DNA STAR Software) for determining similarity and divergence (Figure 2). Similarity index Cytochrome c Oxidase (COI) gene showed percent identity and divergence scores for different species adequate to identify species (Table 3). Sequence comparison showed 78.7- 89.9 % homology among deer species studied. Among deer species, barking deer showed divergence of 9.9 and 16.5 with closely related species viz ., spotted deer ( Axis axis ) and nilgai ( Boselaphus tragocamelus ) . Among wild ungulates, aligning of amplicon sequences using CLUSTAL W tool showed highest similarity (89.9%) between barking deer and spotted deer and lowest (78.7 %) between barking deer and black buck. Divergence score between different species enables the differentiation of the species of wild ungulates. Identification of species and determination of inter-species relationships is of paramount importance for the discourses in biology, ecology, evolution, systematics, wildlife management, conservation and forensic science (Tobe et al . 2010). Kumar et al. (2017) studied on the DNA barcoding of the Indian black buck and showed a strong ability of the COI barcoding gene to discriminate the black buck with their sympatric species.This study showed that, the intraspecific diversity among 4 genera of sub-family Antilopinae was observed with an average < 1% and specifically for the studied genus Antilope it was observed 0.3% and the inter specific diversity observed ranged 0.3% to 12.7%. Ranjana et al. (2020) studied a total 93 specimens representing 22 species of ungulates were analyzed from partial sequences of mtDNA COI and Cytb genes. All the species showed unique clades, and sequences divergence within species was between 0.01–3.9% in COI and 0.01–13.7 in Cytb, whereas divergence between species ranged from 2.2 to 29.5% in COI and 2.3 to 28.8% in Cytb. Highest intra specific divergence was observed within the Ovis aries in COI and Porculasalvania in Cytb. No barcode gap was observed between species in COI. This study demonstrates that even short fragments of COI and Cytb generated from fecal pellets can efficiently identify the Indian ungulates, thus demonstrating its high potential for use in wildlife conservation activities. Table 2. Details of wild ungulate species and the accession numbers of nucleotide sequences used in the present study Sl. No. Common name Species Accession number Reference 1 Black Buck Antilope cervicapra MZ734478 This work 2 Barking Deer Muntiacus muntjac MZ734482 This work 3 Sheep Ovis aries KP702285 Hongying, F.and Fuping, Z. 4 Nilgai Boselaphus tragocamelus MZ734479 This work 5 Mouse Deer Moschiola indica MZ734480 This work 6 Spotted deer Axis axis MZ734481 This work 7 Goat Capra hircus MN102712 Bhaskar et al. Table 3. Nucleotide similarity (upper triangle, %) and divergence (lower triangle, %) of mitochondrial CytC oxidase (COI) gene of different wild ungulate species. Species Name Spotted Deer Barking Deer Black Buck Goat Mouse Deer Nilgai Sheep Spotted deer - 89.9 80.1 41.3 82.1 85.2 80.7 Barking deer 9.9 - 78.7 41.2 79.9 85.4 79.8 Black buck 18.4 21.6 - 42.8 79.8 82.1 81.9 Goat 22.5 23.2 22.5 - 56.7 60.6 89.1 Mouse deer 20.9 23.9 22.8 28.1 - 81.4 77.7 Nilgai 16.7 16.5 18.6 18.3 19.9 - 59.3 Sheep 23.1 24.4 19.8 12.0 27.0 59.5 - Phylogenetic analysis using the sequence data Since the proposal of DNA barcoding in 2003, subunit I (658 bp) of the mitochondrial cytochrome C oxidase (COX) gene (namely COI) became the most universal marker for species identification in the animal kingdom (Hebert et al., 2003). Mitochondrial Cytochrome c oxidase (COI) gene sequence of different ungulate species was used to construct phylogenetic tree (Fig: 3) in this work. Phylogenetic analysis revealed divergent evolution of mouse deer as a separate group from other ungulate species. While, barking deer and spotted deer were found to be evolved from the same ancestor that also resulted in the evolution of black buck and sheep as well as goat (Nidhi et al. 2013& Kumar et al. 2017). However, nilgai was found to evolve from separate ancestor. Our results showed that Mouse deer is far related to Barking deer and Spotted deer which is in agreement with the phylogenetic analysis report of Siddappa et al . (2013). Phylogenetic relationship of different ungulates reported in this report is in agreement with the report of Kumar et al . (2014) who developed phylogenetic tree using the polymorphism in Cytochrome B and 12S rRNA gene. Hebert et al . (2003) developed a DNA based method for taxonomic classification of species popularly known as DNA bar coding. This technique is based on sequence analysis of cytochrome C oxidase I (COI) gene for taxonomic profiling of species including species identification of meat. Mouse deer probably evolved very early as primitive ruminant. From phylogenetic analysis it is evident that it evolved early as separate from other deer species family. Mitochondrial Cyt C oxidase (COI) gene was earlier used to identify the Indian black buck ( Antilope cervicapra ) and their correlation with other closely related species (Kumar et al. 2017), they have studied the phylogeny and revealed that the phylogenetic tree gave the same results as those obtained from measuring the intra and inter specific divergences with strong bootstrap values. The same species sequences were clade together with low divergence, and closely related species from the same sub-family and genus were clearly separated. Conclusion The present study provides significant contributions toward the taxonomic identity confirmation, phylogenetic studies that can be used for better planning of conservation and management of Indian ungulates. In India, very few data are present on many species of ungulates. This study will be helpful to strengthen the global database with barcode sequences of accurately identified other mammalian species. The technique involves extraction of DNA from the forensic sample, PCR amplification of mitochondrial Cytochrome c Oxidase gene using the universal primers, sequencing of the amplicon and sequence alignment using the NCBI database. Analysis will give the species to which the sequence matches thereby enables the unambiguous identification of species of meat. Sequence data can be an important evidence for the investigators in the legal process. Declarations The samples were collected from dead animals brought for postmortem in the Veterinary division of the zoo over a period of one year. Author Contribution Dr. Jagdish Swami conducted original research and wrote the main manuscript text and Girish patil & Dr. Shashi Kumar helped in the analysis of results and preparation of tables and figures. Funding – The Research work was funded by P.V. Narsimha Rao Telangana Veterinary University Animal Ethics: No approval of research ethics committees was required to accomplish the goals of this study References Abraham, J. 2001. Detection of species specific origin of meats of wild animals by isoelectric focusing. In: Proceedings of the1st Annual Convention of Association of Indian Zoo and Wildlife Veterinarians and Workshop an Basics of Captive Wild Animal Management, pp. 139–144, Indian Veterinary Research Institute, Izatnagar, India. Ahrestani, F. and Karanth, KU. 2014. Gaur Bos gaurus.In: Melletti, M. & Burton, J. (ed.), Ecology, Evolution and Behavior of Wild Cattle: Implications for Conservation, Cambridge University Press. Arif, IA. and Khan, HA. 2009. Molecular markers for biodiversity analysis of wildlife animals: A brief review. Animal Biodiversity Conservation. 32: 9-17. Badola, S. 2020. Indian wildlife amidst the COVID-19 crisis: An analysis of status of poaching and illegal wildlife trade. TRAFFIC. https://www.traffic.org/publications/reports/reported-wildlife-poaching-in-india-more-than-doubles-during-covid-19-lockdown/ (Accessed on 01 st July 2020) Barbar, ME., Hussain, T., Wajid, A., Nawaz, A., Nadeem, A., Sha, SA., Shahid, MA., Ahmad, N., Javed, K. and Abdullah, M. 2015. Mitochondrial cytochrome b and d-loop sequence based genetic diversity in Mareecha and Bareela camel breeds of Pakistan. Journal of Animal and Plant Sciences. 25: 591-594. Bashistha, M., Neupane, BK. and Khanal, SN. 2012. Antilope Cervicapra Blackbuck in Nepal: Population Status, Conservation and Translocation Issues of Blackbuck in the Blackbuck Conservation Area, Bardiya, Nepal. Saarbrücken: LAP Lambert Academic Publishing. Chikuni, K., Tabata, T., Saito, M. and Monma, M. 1994. Sequencing of mitochondrial cytochrome b genes for the identification of meat species. Animal Science and Technology. 65(6): 571–579. Choudhury, A. 2002. Distribution and conservation of the Gaur Bos gaurus in the Indian Subcontinent. Mammal Review. 32: 199-226. Choudhury, A. 2002. Distribution and conservation of the Gaur Bos gaurus in the Indian Subcontinent. Mammal Review. 32: 199-226. Davitkov, D., Glavinić, U., Nešić, K., Davitkov, D., Vučićević, M., Nešić, V. and Stanimirović, Z. 2017. Improved DNA-Based Identification of Cervidae Species in Forensic Investigations. Acta Veterinaria. 67: 449-458. doi: https://doi.org/10.1515/acve-2017-0037 Daniel JC. 1991. Ungulate conservation in India — Problems and prospects. Applied Animal Behaviour Science. 29: 349-359. Dratch, P., Shafer, J., Hoesch, R. and Espinoza, E. 1996. Comparison of electrophoretic and chromatographic methods for analysis of deer hemoglobin. The International Society of Animal Genetics. 27: 17–42. Duckworth, J.W. and Timmins, R. (2015). . The IUCN Red List of Threatened Species 2015: Moschiola indica e.T136585A61979067. http://dx.doi.org/10.2305/IUCN.UK.2015-2.RLTS.T136585A61979067 Galtier, N., Nabholz, B., Glemin, S. and Hurst, GDD. 2009. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Molecular Ecology. 18: 4541–4550. Gardner, EJ. and Snustad, DP. 1984. Principles of genetics (7thEd.). John Wiley and Sons: New York. Girish, PS., Anjaneyulu, ASR., Viswas KN., Anand M., Rajkumar N., Shivkumar BM., Patel M. and Sharma B. 2005. Meat species identification by Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene. Meat Science. 70: 107-112. Goyal, SK. and Rajpurohit, LS. 1999. Mass killing of mammalian crop pest — Nilgai (blue bull), Boselaphustagocamelus , in Village Parasala, Osian of Jodhpur, India. Advances in Ethology. 34: 224. Gupta, A., Bhardwaj, A., Supriya, Sharma, P., Pal, Y., Mamta. and Kumar, S. 2015. Mitochondrial DNA- A tool for phylogenetic and biodiversity search in equines. Journal of Biodiversity & Endangered Species. S1: 006. Hayashi, JI., Tagoshira, Y. and Yoshida, MC. 1985. Absence of extensive recombination between inter and intra species mt DNA in mammalian cells. Experimental Cell Research. 160: 387-395. Hebert PD, Ratnasingham S, deWaard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci 270: 96–99 IUCN. 2006. International Union for Conservation of Nature and Natural Resources. The IUCN Red list of threatened species. www.iucnredlist.org Irwin DM., Kocher TD. and Wilson AC. 1991. Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution. 32: 123-144. Irwin, DM., Kocher, TD. and Wilson AC. 1991. Evolution of the cytochrome b gene of mammals Journal of Molecular Evolution. 32: 123-144. Karanth, KK., Nichols, JD., Karanth, KU., Hines, JE. and Christensen, NL. 2010. The shrinking ark: Patterns of large mammal extinctions in India. Proceedings of the Royal Society of London. 277: 1971-1979. doi:10.1098/rspb.2010.0171 Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. and Wilson, A. C. 1989.Dynamics of mitochondrial DNA evolution in animals:amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. U.S.A. 86 :6196-6200. Kumar, VP., Kumar, D. and Goyal, SP. 2014. Wildlife DNA forensic in curbing illegal wildlife trade: Species identification from seizures. International Journal of Forensic Science and Pathology. 2: 38-42. doi: http://dx.doi.org/10.19070/2332-287X-1400012 Maroju PA, Yadav S, Kolipakam V, Singh S, Qureshi Q, Jhala Y. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer. BMC Genet. 2016 Feb 9;17:37. doi: 10.1186/s12863-016-0344-y. Erratum in: BMC Genet. 2017 Mar 24;18(1):28. PMID: 26860950; PMCID: PMC4748499. Mohanty, NP., Harikrishnan, S., Sivakumar, K. and Vasudevan, K. 2016. Impact of invasive spotted deer ( Axis axis ) on tropical island lizard communities in the Andaman archipelago. Biological invasions. 18: 9-15. Panday, R., Jha, DK., Thapa, N., Pokharel, BR. and Aryal, NK. 2014. Forensic wildlife parts and their product identification and individualization using DNA barcoding. The Open Forensic Science Journal. 7: 6-13. Pasha, MKS., Sankar, K., Qureshi, Q. and Areendran, G. 2004. Indian bison or gaur ( Bos gaurus Lambert, 1804). ENVIS Bulletin. 7: 91–102. Paul, S., Ghosh, T., Panday, B., Dhananjai, M., Habib, B., Parag Nigam and Mondol, S. 2019.Rapid molecular assays for species and sex identification of swamp deer andother coexisting cervids in human-dominated landscapes of the Terai regionand upper Gangetic plains, northern India: Implications in understandingspecies distribution and population parameters. Journal of Genetics. 98: 44. https://doi.org/10.1007/s12041-019-1094-1 Panicker, VP., Hridas, PS., Athira, N., Shynu, M. and Babu, BC. 2019.Mitochondrial 12S rRNA gene sequence analysis, a tool for species identification. Journal of Wildlife and Biodiversity. 3: 29-35. Prater, SH. 1980. The book of Indian animals. Bombay Natural History Society, Bombay, India Proffitt, KM., Gude, JA., Hamlin, KL. and Messer, MA. 2013. Effects of hunter access and habitat security on elk habitat selection in landscapes with a public and private land matrix. Journal of Wildlife Management. 77: 514–524. https://doi.org/10.1002/jwmg.491 Rajput, N., Shrivastav, AB., Parmar, SNS., Ranjan, R., Singh, S. and Joseph, E. 2013. Characterization of 12S rRNA gene for meat identification of common wild and domestic small herbivores as an aid to wildlife forensic. Veterinary World. 6: 254-259. Ranjana Bhaskar, Praveen Kanaparthiand Rengasamy Sakthivel. 2020. DNA barcode approaches to reveal interspecies genetic variation of Indian ungulates. Mitochondrial DNA Part B 5 :1, 938-944, DOI: 10.1080/23802359.2020.1719912. Ranjit sinh, MK. 1997. Beyond the tiger: Portraits of asian wildlife. Birajbasi Printers, New Delhi, India. Saccone, C., DeCarla, G., Gissi, C., Pesole, G. and Reynes, A. 1999. Evolutionary genomics in the Metazoa: The mitochondrial DNA as a model system. Gene. 238: 195–210. Sambrook, J. and Russel, DW. 2001. Molecular cloning: A laboratory manual. 3rd ed., Cold spring harbor laboratory press, New York, pp. 2000. Sanger, F., Nicklen, S. and Coulson, AR. 1977. DNA sequencing with chain-terminating inhibitors. Proceedings of National Academy of Sciences, USA. 74: 5463-5467. Sankar, K. and Acharya, B. 2004. Chital ( Axis axi s ) (Erxleben, 1777)). ENVIS Bulletin (Wildlife Institute of India, Dehra Dun) 7: 171–180. Sankar, K., Pabla, HS., Patil, CK., Nigam, P., Qureshi, Q., Navaneethan, B., Manjreakar, M., Virkar, PS. and Mondal, K. 2013. Home range, habitat use and food habits of re-introduced gaur ( Bos gaurus gaurus ) in Bandhavgarh Tiger Reserve, Central India. Tropical Conservation Science. 6: 50-69. Siddappa, CM., Mohini, S., Asit, D., Ramesh, D., Anil. K.S. and Praveen, KG. 2013. Sequence characterization of mitochondrial12S rRNA gene in mouse deer ( Moschiola indica ) for PCR - RFLP based species identification. Molecular Biology International. 1-6. http://dx.doi.org/10.1155/2013/783925 Timmins, RJ., Duckworth, JW. and Hedges, S. 2016. Muntiacusmuntjak . The IUCN Red List of Threatened Species 2016: e.T42190A56005589. https://dx.doi.org/10.2305/IUCN.UK.2016-1.RLTS.T42190A56005589.en. Downloaded on 28 June 2020. Tobe, SS., Kitchener, AC. and Linacre, AM. 2010.Reconstructing mammalian phylogenies: A detailed comparison of the cytochrome B and cytochrome oxidase subunit I mitochondrial genes. PLoS One. 5: e14156. Ubelaker, D. H., Lowenstein, J. M. and Hood, D.G. 2004. “Use of solidphase double-antibody radioimmunoassay to identify species fromsmall skeletal fragments,” Journal of Forensic Sciences , vol.49, no. 5, pp. 924–929. Xiao, W., Hebblewhite, M., Robinson, H., Feng L., Zhou, B., Mou, P., Wang, T. and Ge, J. 2018. Relationships between humans and ungulate prey shape Amur tiger occurrence in a core protected area along the Sino‐Russian border. Ecology and Evolution. 8: 11677-93. Yang, L., Tan, Z., Wang, D., Xue, L., Guan, M., Huang, T. and Li, R. 2014. Species identification through mitochondrial rRNA genetic analysis. Scientific Reports. 4: 4089. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6366101","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":442829513,"identity":"b0593fcc-dadf-4812-8052-6b0e93cb49ef","order_by":0,"name":"Jagdish Swami","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCElEQVRIiWNgGAWjYDCCAwwJDAxsEgwGYJ6BDZBgbDxAipY0kJYGQlqAgI0BqoXhMEIQF+C7feDhxy9lFvbm/GcMP90oOG+3tv0w0JYam2hcWiTPJSRLy5yTSNw5I8dYOsfgdvK2M4lALcfSchtwaDE4w5AgLdkmkWBwg3cDWIvZAaAWxobD+LQk/wZqsTc4f3bz7xyDc8lm5x8S1JIm+bFNgnHDgdxtQFsO2JndIGCLJFCLNQPQLxtu5H+zzjFITjC7AbQlAY9f+M7wJN/8UVYHdNix5Ns5f+zszc6nP3zwocYGpxYGBp4EZh4kbiJYZQJO5SDAfoDxBxLXHq/iUTAKRsEoGJEAANZgaDNz/CndAAAAAElFTkSuQmCC","orcid":"","institution":"P.V. Narsimha Rao Telangana Veterinary University","correspondingAuthor":true,"prefix":"","firstName":"Jagdish","middleName":"","lastName":"Swami","suffix":""},{"id":442829514,"identity":"fefd8d38-5ab6-49f8-81e9-6890388d2d5b","order_by":1,"name":"Girish Patil","email":"","orcid":"","institution":"National Research Centre on Mithun","correspondingAuthor":false,"prefix":"","firstName":"Girish","middleName":"","lastName":"Patil","suffix":""},{"id":442829515,"identity":"91283101-019e-4ac5-bcad-575d9ee9366f","order_by":2,"name":"M. Shashi Kumar","email":"","orcid":"","institution":"P.V. Narsimha Rao Telangana Veterinary University","correspondingAuthor":false,"prefix":"","firstName":"M.","middleName":"Shashi","lastName":"Kumar","suffix":""}],"badges":[],"createdAt":"2025-04-03 05:38:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6366101/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6366101/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":80694566,"identity":"45daf5fd-874c-410b-a72d-c3799a354ef2","added_by":"auto","created_at":"2025-04-16 06:30:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":113341,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePolymerase chain reaction amplification of mitochondrial CytC oxidase (COI) gene run on 1% agarose gel.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6366101/v1/70cf81629cee5a57ba42a58d.png"},{"id":80694567,"identity":"9eb8625b-cbaa-4af5-86dd-8dcfaa1b5530","added_by":"auto","created_at":"2025-04-16 06:30:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5179418,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNucleotide sequence alignment of mitochondrial Cyt c Oxidase (COI) gene of different wild animal species. A dot indicates identity with the majority at the given position.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6366101/v1/1f0ed5f83e19b69b66c7e6b8.png"},{"id":80695880,"identity":"cbeb0d16-7d1f-48f8-bd0f-7aeaf610b362","added_by":"auto","created_at":"2025-04-16 06:46:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":53290,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree constructed based on the mitochondrial Cytochrome C Oxidase (COI) gene sequences\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6366101/v1/94bd1778aa18c8c2004a2c17.png"},{"id":80696979,"identity":"8d38299a-e823-4841-add9-49bb730476e7","added_by":"auto","created_at":"2025-04-16 07:02:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5722826,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6366101/v1/17389a87-1fd0-4b81-8b24-879e8ab63108.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Forensic Identification of Wild Ungulate Species via Mitochondrial Cytochrome C oxidase Gene Analysis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eReducing forest cover, increasing urbanization, continued wildlife poaching and man-animal conflicts have tremendously impacted the survival of wildlife. The demographic changes such as Corona Virus Infections Disease (COVID) \u0026minus;\u0026thinsp;2019 lockdowns have significantly increased poaching of wild ungulates at their habitats (Badola, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Ungulates are polyphyletic hoofed quadruped mammals that play important role in forest ecosystems. In the Indian context, wild herbivores such as barking deer (\u003cem\u003eMuntiacus muntjak)\u003c/em\u003e, black buck (\u003cem\u003eAntilope cervicapra)\u003c/em\u003e, mouse deer (\u003cem\u003eMoschiola indica)\u003c/em\u003e, nilgai (\u003cem\u003eBoselaphus tragocamelus)\u003c/em\u003e and spotted deer (\u003cem\u003eAxis axis)\u003c/em\u003e are protected under Wildlife Protection Act, 1972. India is a treasure of 35 species of ungulates; of which, 25 are protected under Wildlife Protection Act of 1972 (Daniel \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). Many factors are contributing to declining numbers of the wild ungulates; expanding human population, increasing man-animal conflicts, declining quantity and quality of land, water scarcity during critical times, decreasing forest cover, etc. Of all these, illegal poaching is a major contributing factor. Since wild ungulates play balancing role in the nature in terms of their crucial function in food chains of forest ecosystems, their decreasing number is a serious concern requiring conservation activities so as to preserve the biodiversity. Herbivores act as a food source to carnivores and human induced population disturbance in herbivores directly contributes to the vulnerability of carnivores (Proffitt et al, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Xiao et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Spotted deer (\u003cem\u003eAxis axis\u003c/em\u003e) population is drastically declining at an estimated extinction rate of 45% over the last 50 years in the Indian sub-continent (Karanth et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). However, at some places it acts as an invasive species and outweigh in number especially in protected areas (Mohanty et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). India\u0026rsquo;s 123 protected areas and forest tracts nurture spotted deer (Sankar and Acharya, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Nevertheless, spotted deer are killed illegally by humans for flesh, skin and antlers. Black buck (\u003cem\u003eAntilope cervicapra\u003c/em\u003e) is widespread across Indian sub-continent; it mostly occurs in the Tarai region (Bashistha et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Although this ecological indicator once inhabited the entire Indian subcontinent, but now its number is decreasing due to habitat destruction and poaching (Roberts, 1992). Barking deer (\u003cem\u003eMuntiacus muntjak\u003c/em\u003e) or the Indian muntjak is one of the smallest deer belonging to Cervidae family. Even though muntjaks are listed under least concern category by the International Union for Conservation of Nature and Natural Resources (IUCN); their depleting number is of concern that occurs due to habitat destruction and poaching (Timmins et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The small size in particular makes them highly vulnerable to hunting or poaching for meat and skin.\u003c/p\u003e \u003cp\u003eMouse deer (\u003cem\u003eMoschiola indica\u003c/em\u003e) is a small nocturnal solitary artiodactyl that inhabit densely covered forests. Mouse deer is also known as Indian chevrotain and it lacks antlers (evolutionarily primitive). It is distributed across the India mostly in the Deccan peninsula including eastern and Western Ghats, Central India, Gangetic plains (except West Bengal) and the Tarai region bordering Nepal. Encroachment of forest due to anthropogenic activities and poaching has adversely affected this species (Duckworth and Timmins, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Nilgai (\u003cem\u003eBoselaphus tragocamelus)\u003c/em\u003e is also known as blue bull; this largest Antelope is widely distributed in India. Nilgai is perceived as an agricultural pest in India since it depredates crops (Goyal and Rajpurohit \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; IUCN, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). As per Indian Hindu doctrine, Nilgai is perceived sacred and treated on par with the cow; its hunting or harassing refrained (Prater, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). However, instances of its hunting for flesh arise as it has resemblance with that of beef.\u003c/p\u003e \u003cp\u003eAuthentic species identification of poached species helps in the wildlife protection and conservation initiatives. Use of different molecular markers has evolved as a powerful tool in species identification. Previously, techniques such as liquid chromatography (Dratch et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1996\u003c/span\u003e), immuno assay (Ubelaker et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), electrophoresis (Abraham \u003cem\u003eet al\u003c/em\u003e. 2001), etc were for species identification of biological samples. Nevertheless, in the recent years, DNA based techniques are increasingly been used due to their higher specificity and stability. Mitochondrial DNA targets have been conclusively proven for species identification (Irwin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1991\u003c/span\u003e, Hayashi et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1985\u003c/span\u003e, Gupta et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2015\u003c/span\u003e); this offers exploitation of variations in the mitochondrial DNA for the purpose of discrimination of closely related species that offers inter-species sequence variations. Mitochondrial DNA has been used extensively due to high copy number of mitochondria in the cell. Mitochondria follow clonal inheritance, only dam contributes mitochondria, genome does not undergo recombination and hence its genetic material is transferred to the next generation unchanged (Galtier et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Further, mitochondrial genome accumulates high percentage of neutral mutations that aid in animal species identification. Each mitochondrion contains 2\u0026ndash;6 circular DNA molecules, has 16,500 bp size and codes several genes (Gardner and Snustad, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1984\u003c/span\u003e). Several DNA based techniques have been developed for species identification of ungulates: species specific PCR (Paul et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), Polymerase Chain Reaction \u0026ndash; Restriction Fragment Length Polymorphism (PCR\u0026ndash;RFLP) (Rajput et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Siddappa et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Gupta \u003cem\u003eet al\u003c/em\u003e., 2008) and real time PCR (Davitkov et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In the present study, conserved region of mitochondrial Cytochrome c Oxidase I (COI) sequences were amplified using specially designed universal primers and the amplicon were sequenced and analyzed to identify the biological samples derived from wild ungulates.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003ch2\u003eCollection of samples\u003c/h2\u003e\n\u003cp\u003eIn the present study, blood as well as meat samples from black buck, barking deer, mouse deer, nilgai and spotted deer were collected for standardization of DNA based molecular techniques for species identification. Permission to collect the samples was obtained from the Principal Chief Secretary, Department of forest, Telangana state, India as well as the Director and Curator of Nehru Zoological Park, Hyderabad, India. Samples were collected individually into sterile containers and transported under chilled condition then stored at -20 \u0026deg;C until further analysis. Three samples were collected for each species of ungulates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOligonucleotide Primers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe primers for Cytochrome c oxidase I (COI) gene were designed by downloading the sequence and by using the primer select program of National Centre for Biotechnology Information (NCBI) database for this study. The primers were got synthesized from IRA Biotech, Hyderabad.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1: Details of primers used in the study\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"552\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.7101%;\"\u003e\n \u003cp\u003ePrimers used\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.2899%;\"\u003e\n \u003cp\u003eSequence of primers\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 29.7101%;\"\u003e\n \u003cp\u003eCyt C oxidase gene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 70.2899%;\"\u003e\n \u003cp\u003eF \u0026ndash; 5\u0026rsquo; TGGAACAGGCTGAACTGTAT 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR \u0026ndash; 5\u0026rsquo; ACTTTTACTCCTGTTGGGAT 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003e\u0026nbsp;Isolation of DNA \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Isolation of DNA from tissue/ meat samples\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDNA extraction from tissue samples was undertaken using commercial kit (GCC Biotech, Kolkata, West Bengal, India) following the manufacturer\u0026rsquo;s instructions supplied along with the kit. Briefly, 20-100 mg of tissue was cut into very small pieces using a pair of scissors and placed in a 1.5 ml micro centrifuge tube. A master mix (275 \u0026micro;l) consisting of 200 \u0026micro;l of nuclei lysis solution, 50 \u0026micro;l of 0.5 M EDTA (pH 8), 20 \u0026micro;l of proteinase K (20 mg/ml) and 5 \u0026micro;l of RNase A solution (4 mg/ml) was added to each tube. The tubes were then incubated for 16-18 hrs at 55\u0026deg;C. After incubation, 250 \u0026micro;l of lysis buffer was added to the tubes and then vertexed. The contents were loaded onto mini column assembly and centrifuged @ 10,000 rpm for 3 minutes. The mini columns were then washed with 650 \u0026micro;l of wash solution 4-6 times, dried by centrifugation for 2 min and then transferred to fresh 1.5 ml tubes. A volume of 250 \u0026micro;l of Nuclease Free Water (NFW) was added and incubated for 2 min at room temperature and centrifuged for 2 minutes at the same speed for 1 min. An additional 250 \u0026micro;l of NFW was added to the tubes and incubated for 2 min after incubation, the tubes were centrifuged for 2 min and the pooled elutes were collected and stored at -20\u0026deg;C for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of DNA from the blood samples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DNA from blood samples was isolated by using phenol: chloroform method (Sambrook and Russel, 2001) with slight modifications. Fresh blood (20 ml) samples were collected in 3.5 ml ACD or EDTA and centrifuged (2,500 rpm for 15 min). The supernatant was discarded and buffy coat was collected. To this about 15 ml lysis buffer was added and the tubes were incubated at 37\u0026deg;C for 1 hr. Then, proteinase-K solution (20 mg/ml) was added @ 200 \u0026micro;g/ml and again incubated at 50\u0026deg;C for not less than 3 h or overnight. During incubation, regular swirling of the tubes was undertaken gently from time to time. Equal volume of tris-saturated phenol (equilibrated with 0.1 M Tris-Cl, pH 8.0) was added and the contents of the tubes were subjected to mixing end to end for 10 min. and the contents were then centrifuged at 6,500 RPM for 15 min. The upper aqueous phase was collected into a fresh tube and equal volume of Phenol: Chloroform: Isoamyl alcohol (25:24:1) mixture was added and centrifuged. The upper layer was collected and again equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added and centrifuged. Finally, the upper aqueous phase was collected in a fresh tube and equal volume of chloroform was added and then centrifuged. The upper phase was again collected in to a fresh tube containing 0.2 volumes of 10 M ammonium acetate and 2 volumes of absolute ethanol and was mixed well for precipitation of DNA. The mixture containing visible DNA threads were centrifuged at (10,000 RPM for 10 min). The DNA pellet was washed twice with 70% alcohol by centrifugation (10,000 RPM for 5 min each), dried over a dry bath at 60\u0026deg;C and then dissolved in 1X TE (Tris-EDTA) buffer (50- 100 \u0026micro;l) or nuclease free water either. These DNA samples were used for PCR or stored at -20\u0026deg;C until further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQualitative and quantitative analysis of extracted DNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe concentration of DNA was assessed with the help of Nano spectrophotometer at 260 nm and analyzed for purity by determining the optical density at 260/280 (Make: Denovix, Model:DS-11FX). (The recommended optimum values for purity lies between 1.7 to 2. The DNA which exhibited the ratio within the limit were taken for further study. All the extracted samples were kept at \u0026ndash; 20 \u0026deg;C for further use.\u003c/p\u003e\n\u003cp\u003eThe concentration of DNA was estimated by using following formula\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAhQAAABMCAYAAAA1OC5WAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAABQDSURBVHhe7Z3fixfV/8fH772a5lUXIqkXkhCUmoQJCrkpEYaJmiFCUVkRBGL+QCLE0lICCU1R8EIzQTEk+6GgkCFlEkZBF7kiXni1KeofsN/34+w893P27Mzs7nve7123ng+Y98z5/Tq/X3PeM2fGdDfIjDHGGGNq8H/52RhjjDGmaaxQGGOMMaY2ViiMMcYYUxsrFMYYY4ypjRUKY4wxxtTGCoUxxhhjamOFwhhjjDG1sUJhjDHGmNpYoTDGGGNMbaxQGGOMMaY2ViiMGSG+/fbbbOLEidn169eD+Z9//sn279+fTZs2Lfvpp5+CXR22bNmSzZ49OzcZY0x7sUJhBs1XX30VJqgxY8aEg+tPPvkkd+0Bs9zTg4ly5cqVIZ4Hheeee66fnNiJ1D12E0Vx6KCM3nrrrUEpCIcOHco2bdqUdXZ25jYPPuSrKN/xkbaRB5FWtIOYtB+kit3vv//eGydnzOa/zb/iBoCPgxlTRVdXV/esWbO6p06d2n3mzJnctjtcY4cbfgTXqT1n/GNHs+vo6OgXZsWKFcGNg+urV6/mrv25ePFir3/iipFcuK1bt65POkXE/pEvhTgmTJjQfezYsdymP8iq9ERDMQhhCIvb5s2bc5dydu7cGfySv6FAHgg7UqguUpCplXIV1U+raEU7EIpHxxdffJG79LR14pGd2khZO1WbKDpIh7KPZaLtyD3ugzFpnGkfEvhDtmag/avMSANZiQ954n5iemB8aGf7Hg6sUJgBYbBhUGCASMEOt7QjEKZskGIwYYCJJ1jsNIlyJr6yQVaDFINTqnQQFjfFhd8yOWKUD+RiYhGKr0q5EYRFphTyQH7SuIvQQC/5Bwv5LEp7uJDcRbRKLuqoLI1W0Yp2wOROfZSBW1F/qQpDG2JCJpz6BGdkVNsijtiN+GRfBH4IW5UnKUYDtdsUyoBw8Y0B6Ul5wm00ktZbs1CeI9lf24UVClOJBoaqu2vc8BPfJTGIVQ1kGlQYwBmsixQD3OM7O9BgXDYIMgDGsiqtWLYylCb+kUthBzOJAGHLBgnFjXxVaGLG/2BRHY3kACW5Y6omyKGiyS9Nox3UbQfUMQf5J3wKcaV1RTvHvoqqPiXlIe2n2HGU1UVZfEC7wp3wKAaDReVXFoZyxH20QV22Sm7qYyT7a7uwQmEq0VJ21QSHtp0OIFWDH2gATBWGGNzjTodf7MoGdg1UqazINdgBUWkgOxPYYBQRkcqbors95GSSIi3sYnk1McuOa8kDGqw58Kuyjw/8MPgxuaSTFG6amHGjHpAFYpmIV+E5BrpDldyCuIgnBjvVO0eadyAelVOsOEpmHSoP4pScChPLSvykiX/qEn/ppFtEs+0grh8dcVhNSml5KlxZ2wZkUb5TKAeVQazE4F99uKhtlsUHuCGPwhcpR0UQbiD/1MlogvJVG6wL7aGsPkY7VihMJRoc0oE/RoNhPDhxHZtTNAGVdSo6MO7xAMuASZyalDDH4dVRCRuDH/wOFsU/1EGvKj8Ql6VkkllgH9upHOKy1KSktFT+cdqaBDgE/khTccvMQAmxTIQnHdIn7VQ5SJHc6RFDeRIPcXJwHcfLRI8sShe3uN5UfjFqD4pTdacJW/khLtoS7oNVLhUX56FC2So8h9qx6kp1IMrsY8hr3A5SlB7KkMA/5aLJMFWMyuJDXrlRlmm8Zahtqk0NBuSrUgqRGVloY1J48Re3dyCM8omfNK+xO2kpPDIrfa7Vd4gDMyicDuRRHXNNWoSXskpakpNDbUhlGR/EE8sQg1ssM/FQXsC52RuAdmGFwlRCZ1GjLwM3/GgAAq5jc4omoHRQEBpEhNKg09D54slDA53iTCmzL4P48E/HjBWagSBMWX4gLUvJFZdtkR3mtCzjtFQ2adpKTzAwaWATlDN+NPhWyVRF6of6YaCLYaCO04/DUKdcawAHDdIizY8G5zgMkG6cNn7I+1Bpth3ESEblW3UVly+U2ceQ/7QdxKg8OQv5pz7IB+5xXsriQ161CSBsWp9FKB9Vcqbgl/SQMe7XlB3xSW7qUOXDOICd6h6/+JO7lALlFXfCED+obsmj/HJQdvghXuKL2yty4kdILsqFdPBLXGrLGpfitEBlFNdTLINQ3pUnmdWWCS8ZlC6yI+dg6qod+LVRU8lDDz0Uzvfu3QvnKh599NH8amBu3LgRzpMnTw7nGPZj2L17d7Z3797cJssuXboUztu3bw/pPPzww8G90XGyTz/9NLi1Al7fO3XqVNYYgLI7d+5kr732Wu5Sn2vXroXzI488Es7DzZUrV7IpU6bkph6effbZcL5582Y4twrqpzHI5aYeeF2YOmP/DV4ffv/993OXLLt161Y4jx8/PpwBP7dv385N/fnzzz/DOW13pNsYXHNTD8gzFFrVDpYsWZI1JprevUbGjh0bzmUM5N4s5P/ChQtZYwLKFixYUPmaKrKePXs2lL8gD5RpK/ZHiaEt/PDDD9n69euDjHG/fvfdd7N58+Zlp0+fDn6XL18ezLB48eJwVrvBL+HkzuvX5FV88MEH2UcffZRNmjQpvKr75ptvBvvDhw+HdtmYhIN5w4YNQQba1Jw5c3rrrQi1TdJ5/PHHQ/rEdf/+/WCvvvXGG2+Ec1Ufi2UQ7733XqgD5YkzadCP8Y+sGzduDG7vvPNO77i4cOHCEXv13AqFqWTp0qXh/M0334RzEd999104P//88+E8ECgMdAig06Zs3bo1O3jw4KAUlHjyiCejlHhwKQO5mDjotEwEjTua0HlbsY8CAzFyMlAOJl/t4u7du/lVDwxA7QLlL4ZJjL1IaEtr1qzJGndYucv/OHfuXH41eKi3mKp2MBha3Q7mz5/fW+dMPLRFKcgCsyamZqlS0oG4jxw50qsgpeUmTpw4EdpqvI8GkzF8+eWX4VzGUBWioSiFVeB33Lhxuaknr0z4Kk/qr3GHz+1/n+P7778P7nVI+xBpEjfQZmjzzTCcNwCtwgqFqQQNedasWUEBKLqrYVDat29f0K4ZfAcDCgODGhNKOpDQARmA04FVg2R6x8DkIWVh7ty54ZzeRZ0/fz5btGhRbipn9erV2WeffdYrExMieedOWgpQM1BG3G0Ad0RDBRlaAcrM8ePH+0wkKs+ZM2eGczvhzpiJQhN1jCaidBMw7mDLyl5tggkwhom1Tpm1uh388ccf2csvv5ybevoUbTIGc7wiMFSo0yolXVDux44dC5MVG2oVKRUHDhzIurq6+k2+9HH6elEYQb+lnbHqUOUvJfXbjFJYddMDqRLXTtikijGHfLDa0yzDeQPQCqxQmAFBi2eQWLZsWRjgBddPPfVUcDt69Ghu2zM4sLzPWQMFZ/yzExyDEkuoLNnFMCAyScQDKxMMk54086LJQ/41mMUDB+levny5d6WlCMnFUqGWFwUrJbBq1aqwLXYZUrZ0lwjITZ6mT58eBnAG8jh+DRbx30lFdgwiKk/i1J3yjh07wsClOAmLHJpY4rKHPXv2hDs5FDrsOHbt2tVHGaySSfEU8dtvv4VzqvDFoETqrhM5NakqDMoGfp555plwVzxx4sSwlK26p34AOci3lF2Wt6WEcCb/KARQJXNKK9oBaauPkDZ+yVMc37Zt20KbVD3hBzPL/s1SpaSnUG70P9okRwwyMREWTVxr164N54FWkWhngExlUH/Ue6uUQm4qGFfiuiF+0gHGBRRC3NUmODO+tBrSYEXnl19+CX93DFQfZSDzSN4ANEVD8zRmQHjYh4eAGp289+EhrvXgkcCP3NOj0UHCg0t6yCimLBxhBH4aA0dveNLG3Jikghn04BIPSSEz6SFnGY3JtE96pCGIK3bTkZLGER+krQdJY9L8klaRHZAXygE78kO+yCP+FS/2uJMWpDIJHk5THRJH/KBaUfppPJJJFJURYYpQ/KRL3SELZsmMHFzjrnjiBwi5xo2ykL3qWGHIWywjdkqzobDktv1J84msoiiPHEXEZYgs5LEI5Fc9pPksgnySb8KovjjH9Uk5xNA2CCP/KZRHnA/ySTmVyUw8+MdP2g5S1B5JI61D3OI0kD+OU3LInLYTkJ3i0YOP8UHe0zjSQw9KqgzjssKOQ6hu8aN+gzlt7/JHXvFDGpixl7yYiQM/ZTJIZsoLOw6u4/SIAz+KF2SneIYTKxRmxFEHKDpwi6FTMtjgVjYQ00HTCdiY0UqspKQH7Zw2nk7wVQqSoF9owiR8lf/UvchPCmGktHDQb5E17bOaKNWvkUn5KZIrLQ/JgVKhfs85nmQhHhc4K1xaVhCbZYfcyEhYruWGXaysSpHDjbgxkyeFA/KLu8a3IhmAPEjRIB38azxLy4GySuNROQ4XY/hpJGyMMeY/BsvpD/r/8mb0YIXCGGOMMbXxQ5nGGGOMqY0VCmOMMcbUxgqFMcYYY2pjhcIYY4wxtbFCYYwxxpjaWKEwxhhjTG2sUBhjjDGmNrUVCjZG4SMz7YS98bXvfTMQFhn1DQT2Wtd++8YYY4ypTy2Fgg/88HEoPuDTTviKnD4QNFT4WBAfgOHrd+Kll14K38dvx4dhjDHGmP8iTSsUrEzw9cmTJ08O+rPVdWh2e1i+8nf69Onc1ANx8QXNX3/9tdbKhzHGGGN6aFqhOHToUPjMLZ+Mbif8NTF//vzc1DpQKvg0LKsU8edhjTHGGDN0mlIomIB37NgRvvXebur83TEQfKd+zpw5QTkyxhhjTPM0pVCcO3cuu3PnTuHqBA8/pg9pjhkzpveBSIFSwuoAbhMnTsy2bNmSu/SH1QT88zDltGnTwnMR+CcsZp7luH79ekhXdpgHw8KFC7MDBw6Ea4WvOtK8GWOMMaZJheLHH3/MOjo6clNzrF69OjzD0NXVlV25ciU7e/Zs76SNwgDx3x2sImzatCnr7OzMLl26lL366qshLPAsx4kTJ7KjR48G99u3b2e7du0KbgMxc+bMEAYFhOcq+Phq1YEfY4wxxvSlKYVisHf/VfDWxfLly8PqA389fPjhh9mECROCksCDlBD/3bFhw4Zs48aN4frpp58OYQj7+uuvB4UAd8XF3xiDlXHcuHHhfOvWrXA2xhhjzNBp+qHMVsPEzt8of/31V27TA0rCcDHcf3mk6SnuMvvYjkN/IxXZs8qT2mNXZk+Y1B7K7Nspe5n9aM7TgyZ7mX1sxzGa8hTbcYyk7P/GPD1IspfZj+Y8tVv24WDEFIrNmzeHZxdYSeD5iM8//zysUMyYMSO4t+vtjir8l4cxxhjTJI1JcsisW7eue9asWbmpLx0dHeGIIZmdO3fmph66urq6V6xY0T116tTgTpirV6/mrj1p4CeGOPB78eLF3OZ/djGpDPgvkgHk1tnZmdsYY4wxZqg0tULBygEPUpZx+fLlsPLAoSWhu3fv9nmT4+23387WrFmTXbt2rffOP31rJP27gzjg3r174Qw3btwI53gvCa5js/wrfAwPeDaUmvDshTHGGGOapEevGBqsHEyYMKHPSoFgZYDVC6LWKgMrEZiPHTuW++pZtSg6Nm/e3H3mzJk+fkErETpIm7RSu9hcZJeuUiAbaRpjjDGmecbw05hohwwrD6wO7N27N7fpYfbs2eF10IFgD4p9+/blpr5cvXq17TtwAisoDeUnrLZ4hcIYY4xpnqYfymQfiKJvYTA5x383FIH7lClTwl8d6bFz585s7Nixuc/2woOhH3/8sZUJY4wxpiZNKxQ833Dw4MGw0iClgh0rIX31M4XnJ86fPx9elYnhzY7Jkye3fYJHoVm5cmXYoXM4tg83xhhj/u3Uem2UvyX+/vvv7Ouvvw5mVhZ49XOgFQZ2vERpeOGFF/q9K8tE327YVXPBggX9/q4xxhhjTHM0/QyFMcYYY4wYsY2tjDHGGPPvwQqFMcYYY2pjhcIYY4wxtbFCYYwxxpjaWKEwxhTC69W8Es6bV2VfLMQPr47zpta0adPCq98pvE6uLyBy1uvlMYQjPH6Ib6C9bIwxDx5WKIwxhfB69e7du7Pjx4/nNv1ZvXp1OHd1dWUnT57MXnnllT77y6AY8Ir2iy++GDauW7t2bTDHCgP+CXf48OHgBxSvMWb04NdGjTGVsGrQ0dHR79P9rF6sWrUqKBP6kB9b8h84cCB89A9YbWBH3Xg7flYp2IdG+8CwMrFixYps+/btwYyyMX369OA+HPvSGGNag1cojDFNwYZ2KBrxV4Exd3Z29v6tgdKxfPnycC1YrYh318X/4sWLgxmIb9GiRb0b5hljRgdWKIwxTcF3e5588snc1IM+6vfzzz+Hj+/duXMnmzlzZrATjz32WLBHmdA2/TNmzAhn8cQTT2Rnz57NTcaY0YAVCmNMU7CyMH78+NzUl7t372a3bt0K1+PGjQvnlPv372c3b94M1/Eqh0DpMMaMHqxQGGOMMaY2ViiMMU3BhwDLYOVioI8E4l62wgFV8RtjHjysUBhjmoIHJ8+fP5+betAro3Pnzg3PU6AUXLp0KdgJzNjjjj+IXzUF4iV+Y8zowQqFMaYpli5dml2+fLnPnhIoC1OnTu19OJPXPlOlA7NeB8Uf/mOlg/iIl/iNMaMHKxTGmFKkLMRKg0ApmDNnTrZ169ZgZpVhx44d2Z49e4IZtm3bFpQDvSa6f//+YF6/fn0wAxtaEY63PkiH+FAyvAeFMaMLKxTGmELYpGrSpEnhmldE2eAq/Wvi6NGj2e3bt4Mbu2AeOXIkW7JkSe7a8/bGhQsXwo6b+Dl16lQws7GVmDdvXtjEatmyZb3ppZtoGWMefLxTpjHGGGNq4xUKY4wxxtTGCoUxxhhjamOFwhhjjDG1sUJhjDHGmNpYoTDGGGNMbaxQGGOMMaY2ViiMMcYYU5Ms+3+d0AHA41GzTwAAAABJRU5ErkJggg==\" height=\"76\" width=\"532\"\u003e\u003c/p\u003e\n\u003cp\u003e(1 OD value at 260 nm is equivalent to 50 ng dsDNA / \u0026micro;l)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStandardization of Polymerase Chain Reaction mitochondrial Cytochrome c Oxidase (DNA barcode) gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCR was performed in a 50 \u0026micro;l reaction volume; consisting of 5 \u0026micro;l of 10X Assay buffer [100 mM Tris- HCl, pH 9.0, 15 mM MgCl2, 500 mMKCl and 0.1% gelatin],0.25mM of dNTP mix, 20pm each of forward \u0026nbsp;and reverse primer, 1 U Taq DNA polymerase, 50ng of purified DNA and autoclaved NFW to make the final volume. The PCR was carried out in thermal cycler (Make: Applied Bio systems, USA) with the thermal cycling conditions: Initial denaturation at 94 \u0026deg;C for 5 min; followed by 30 cycles of denaturation (95 \u0026deg;C, 30 s), annealing (55, 60, 60, 50 and 55\u0026deg;C for mouse deer, barking deer, black buck, nilgai and spotted deer, respectively for 1 min and extension (72 \u0026deg;C for 1 min) with the final extension at 72 \u0026deg;C for 5 min. The PCR products were electrophoresed over 1 % agarose gel and visualized through gel documentation system and stored at -20\u003csup\u003e0\u003c/sup\u003e C for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Sequencing of PCR products\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PCR product of each species was custom sequenced (IRA Biotech, Hyderabad) and analyzed through Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The BLAST hit showing the highest identity was deduced as the closest species. Further, multiple sequence alignment of sequences was carried out using Clustal W algorithm (DNA STAR software, Lasergene). The nucleotide sequences of Cytochrome c Oxidase I (COI) gene of different deer species submitted to NCBI (National Centre for Biotechnology Information) nucleotide database and their Gene bank acession numbers are given in Table 2. 4, 5 and 6. The Cytochrome c Oxidase I (COI) gene sequences of spotted deer, mouse deer, nilgai, barking deer and black buck were sequenced in this study and that of other species used for sequence comparison were retrieved from gen bank nucleotide sequence database (www.ncbi.nlm.nih.gov/centrez).\u003c/p\u003e"},{"header":"Results and Discussion","content":"\u003cp\u003e\u003cstrong\u003eStandardization of PCR amplification of mitochondrial Cytochrome c Oxidase (COI) gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PCR amplification using the primer designed targeting mitochondrial Cytochrome c Oxidase I (COI) gene was undertaken in the following species i.e. spotted deer, black buck, barking deer, nilgai and mouse deer. PCR amplification yielded amplicons of about 656 bp size in all the species (Fig: 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSequencing of mitochondrial Cytochrome c Oxidase (COI) gene\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCR amplicons were sequenced with the help of commercial sequencing facility. Nucleotide sequence analysis of mitochondrial Cyt C oxidase gene sequences of spotted deer (\u003cem\u003eAxis axis\u003c/em\u003e), black buck (\u003cem\u003eAntilope cervicapra\u003c/em\u003e), barking deer (\u003cem\u003eMuntiacus muntjak\u003c/em\u003e), mouse deer (\u003cem\u003eMoschiola indica\u003c/em\u003e), and nilgai (\u003cem\u003eBoselaphus tragocamelus\u003c/em\u003e) along with sheep (\u003cem\u003eOvis aries)\u0026nbsp;\u003c/em\u003eand goat (\u003cem\u003eCapra hircus\u003c/em\u003e) downloaded from NCBI was undertaken using Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/entrez) which showed highest nucleotide homology with the respective species. Details of the nucleotide sequences used in this study and their accession numbers are given in Table 2. Sequence alignment was done using CLUSTAL W algorithm Megalign program (Laser Gene, DNA STAR Software) for determining similarity and divergence (Figure 2). Similarity index Cytochrome c Oxidase (COI) gene showed percent identity and divergence scores for different species adequate to identify species (Table 3). Sequence comparison showed 78.7- 89.9 % homology among deer species studied. Among deer species, barking deer showed divergence of 9.9 and 16.5 with closely related species \u003cem\u003eviz\u003c/em\u003e., spotted deer (\u003cem\u003eAxis axis\u003c/em\u003e) and nilgai (\u003cem\u003eBoselaphus tragocamelus\u003c/em\u003e)\u003cem\u003e.\u003c/em\u003e Among wild ungulates,\u0026nbsp;aligning of amplicon sequences using CLUSTAL W tool showed highest similarity (89.9%) between barking deer and spotted deer and lowest (78.7 %) between barking deer and black buck. Divergence score between different species enables the differentiation of the species of wild ungulates.\u0026nbsp;Identification of species and determination of inter-species relationships is of paramount importance for the discourses in biology, ecology, evolution, systematics, wildlife management, conservation and forensic science (Tobe \u003cem\u003eet al\u003c/em\u003e. 2010).\u003c/p\u003e\n\u003cp\u003eKumar \u003cem\u003eet al.\u003c/em\u003e (2017) studied on the DNA barcoding of the Indian black buck and showed a strong ability of the COI barcoding gene to discriminate the black buck with their sympatric species.This study showed that, the intraspecific diversity among 4 genera of sub-family \u003cem\u003eAntilopinae\u0026nbsp;\u003c/em\u003ewas observed with an average \u0026lt; 1% and specifically for the studied genus Antilope it was observed 0.3% and the inter specific diversity observed ranged 0.3% to 12.7%.\u003c/p\u003e\n\u003cp\u003eRanjana \u003cem\u003eet al.\u003c/em\u003e (2020) studied a total 93 specimens representing 22 species of ungulates were analyzed from partial sequences of mtDNA COI and Cytb genes. All the species showed unique clades, and sequences divergence within species was between 0.01\u0026ndash;3.9% in COI and 0.01\u0026ndash;13.7 in Cytb, whereas divergence between species ranged from 2.2 to 29.5% in COI and 2.3 to 28.8% in Cytb. Highest intra specific divergence was observed within the \u003cem\u003eOvis aries\u003c/em\u003e in COI and \u003cem\u003ePorculasalvania\u003c/em\u003e in Cytb. No barcode gap was observed between species in COI. This study demonstrates that even short fragments of COI and Cytb generated from fecal pellets can efficiently identify the Indian ungulates, thus demonstrating its high potential for use in wildlife conservation activities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Details of wild ungulate species and the accession numbers of nucleotide sequences used in the present study\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"566\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSl. No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCommon name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession number\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReference\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eBlack Buck\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eAntilope cervicapra\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003eMZ734478\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eThis work\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eBarking Deer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eMuntiacus muntjac\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003eMZ734482\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eThis work\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eSheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eOvis aries\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003eKP702285\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eHongying, F.and Fuping, Z.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eNilgai\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eBoselaphus\u0026nbsp;\u003c/em\u003e\u003cem\u003etragocamelus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003eMZ734479\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eThis work\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eMouse Deer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eMoschiola indica\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003e\u0026nbsp;MZ734480\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eThis work\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eSpotted deer\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eAxis axis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003e\u0026nbsp;MZ734481\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eThis work\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 6.70194%;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 14.9912%;\"\u003e\n \u003cp\u003eGoat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 30.3351%;\"\u003e\n \u003cp\u003e\u003cem\u003eCapra hircus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.873%;\"\u003e\n \u003cp\u003eMN102712\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 32.0988%;\"\u003e\n \u003cp\u003eBhaskar \u003cem\u003eet al.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3. Nucleotide similarity (upper triangle, %) and divergence (lower triangle, %) of mitochondrial CytC oxidase (COI) gene of different wild ungulate species.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"left\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecies Name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpotted Deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBarking Deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBlack Buck\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGoat\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse Deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNilgai\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSheep\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpotted deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e89.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e80.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e41.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e82.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e85.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e80.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBarking deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e9.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e78.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e41.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e79.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e85.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e79.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBlack buck\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e18.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e21.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e42.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e79.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e82.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e81.9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGoat\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e22.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e23.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e22.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e56.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e60.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e89.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMouse deer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e20.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e23.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e22.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e28.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e81.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e77.7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNilgai\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e16.7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e16.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e18.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e18.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e19.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e59.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 11.4379%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSheep\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e23.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e24.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e19.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.6013%;\"\u003e\n \u003cp\u003e12.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 9.80392%;\"\u003e\n \u003cp\u003e27.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 13.8889%;\"\u003e\n \u003cp\u003e59.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.4641%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic analysis using the sequence data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince the proposal of DNA barcoding in 2003, subunit I (658 bp) of the mitochondrial cytochrome C oxidase (COX) gene (namely COI) became the most universal marker for species identification in the animal kingdom (Hebert \u003cem\u003eet al.,\u003c/em\u003e 2003). Mitochondrial Cytochrome c oxidase (COI) gene sequence of different ungulate species was used to construct phylogenetic tree (Fig: 3) in this work.\u003c/p\u003e\n\u003cp\u003ePhylogenetic analysis revealed divergent evolution of mouse deer as a separate group from other ungulate species. While, barking deer and spotted deer were found to be evolved from the same ancestor that also resulted in the evolution of black buck and sheep as well as goat (Nidhi \u003cem\u003eet al.\u003c/em\u003e2013\u0026amp; Kumar \u003cem\u003eet al.\u003c/em\u003e2017). However, nilgai was found to evolve from separate ancestor. \u0026nbsp;Our results showed that Mouse deer is far related to Barking deer and Spotted deer which is in agreement with the phylogenetic analysis report of Siddappa \u003cem\u003eet al\u003c/em\u003e. (2013). Phylogenetic relationship of different ungulates reported in this report is in agreement with the report of Kumar \u003cem\u003eet al\u003c/em\u003e. (2014) who developed phylogenetic tree using the polymorphism in Cytochrome B and 12S rRNA gene. Hebert \u003cem\u003eet al\u003c/em\u003e. (2003) developed a DNA based method for taxonomic classification of species popularly known as DNA bar coding. This technique is based on sequence analysis of cytochrome C oxidase I (COI) gene for taxonomic profiling of species including species identification of meat.\u0026nbsp;Mouse deer probably evolved very early as primitive ruminant. From phylogenetic analysis it is evident that it evolved early as separate from other deer species family. Mitochondrial Cyt C oxidase (COI) gene was earlier used to identify the Indian black buck (\u003cem\u003eAntilope cervicapra\u003c/em\u003e) and their correlation with other closely related species (Kumar \u003cem\u003eet al.\u003c/em\u003e 2017), they have studied the phylogeny and revealed that the phylogenetic tree gave the same results as those obtained from measuring the intra and inter specific divergences with strong bootstrap values. The same species sequences were clade together with low divergence, and closely related species from the same sub-family and genus were clearly separated.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study provides significant contributions toward the taxonomic identity confirmation, phylogenetic studies that can be used for better planning of conservation and management of Indian ungulates. In India, very few data are present on many species of ungulates. This study will be helpful to strengthen the global database with barcode sequences of accurately identified other mammalian species. The technique involves extraction of DNA from the forensic sample, PCR amplification of mitochondrial Cytochrome c Oxidase gene using the universal primers, sequencing of the amplicon and sequence alignment using the NCBI database. Analysis will give the species to which the sequence matches thereby enables the unambiguous identification of species of meat. Sequence data can be an important evidence for the investigators in the legal process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cspan\u003eThe samples were collected from dead animals brought for postmortem in the Veterinary division of the zoo over a period of one year.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDr. Jagdish Swami conducted original research and wrote the main manuscript text and Girish patil \u0026amp; Dr. Shashi Kumar helped in the analysis of results and preparation of tables and figures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u0026ndash; The Research work was funded by P.V. Narsimha Rao Telangana Veterinary University\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal Ethics:\u0026nbsp;\u003c/strong\u003eNo approval of research ethics committees was required to accomplish the goals of this study\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbraham, J. 2001. Detection of species specific origin of meats of wild animals by isoelectric focusing. \u003cem\u003eIn:\u003c/em\u003e Proceedings of the1st Annual Convention of Association of Indian Zoo and Wildlife Veterinarians and Workshop an Basics of Captive Wild Animal Management, pp. 139\u0026ndash;144, Indian Veterinary Research Institute, Izatnagar, India.\u003c/li\u003e\n\u003cli\u003eAhrestani, F. and Karanth, KU. 2014. Gaur \u003cem\u003eBos gaurus.In:\u003c/em\u003eMelletti, M. \u0026amp; Burton, J. (ed.), Ecology, Evolution and Behavior of Wild Cattle: Implications for Conservation, Cambridge University Press.\u003c/li\u003e\n\u003cli\u003eArif, IA. and Khan, HA. 2009. Molecular markers for biodiversity analysis of wildlife animals: A brief review. Animal Biodiversity Conservation. 32: 9-17.\u003c/li\u003e\n\u003cli\u003eBadola, S. 2020. Indian wildlife amidst the COVID-19 crisis: An analysis of status of poaching and illegal wildlife trade. TRAFFIC. https://www.traffic.org/publications/reports/reported-wildlife-poaching-in-india-more-than-doubles-during-covid-19-lockdown/ (Accessed on 01\u003csup\u003est\u003c/sup\u003e July 2020)\u003c/li\u003e\n\u003cli\u003eBarbar, ME., Hussain, T., Wajid, A., Nawaz, A., Nadeem, A., Sha, SA., Shahid, MA., Ahmad, N., Javed, K. and Abdullah, M. 2015. Mitochondrial cytochrome b and d-loop sequence based genetic diversity in Mareecha and Bareela camel breeds of Pakistan. Journal of Animal and Plant Sciences. 25: 591-594.\u003c/li\u003e\n\u003cli\u003eBashistha, M., Neupane, BK. and Khanal, SN. 2012. Antilope Cervicapra Blackbuck in Nepal: Population Status, Conservation and Translocation Issues of Blackbuck in the Blackbuck Conservation Area, Bardiya, Nepal. Saarbr\u0026uuml;cken: LAP Lambert Academic Publishing.\u003c/li\u003e\n\u003cli\u003eChikuni, K., Tabata, T., Saito, M. and Monma, M. 1994. Sequencing of mitochondrial cytochrome b genes for the identification of meat species. Animal Science and Technology. 65(6): 571\u0026ndash;579.\u003c/li\u003e\n\u003cli\u003eChoudhury, A. 2002. Distribution and conservation of the Gaur \u003cem\u003eBos gaurus\u003c/em\u003e in the Indian Subcontinent. Mammal Review. 32: 199-226.\u003c/li\u003e\n\u003cli\u003eChoudhury, A. 2002. Distribution and conservation of the Gaur \u003cem\u003eBos gaurus\u003c/em\u003e in the Indian Subcontinent. Mammal Review. 32: 199-226.\u003c/li\u003e\n\u003cli\u003eDavitkov, D., Glavinić, U., Ne\u0026scaron;ić, K., Davitkov, D., Vučićević, M., Ne\u0026scaron;ić, V. and Stanimirović, Z. 2017. Improved DNA-Based Identification of Cervidae Species in Forensic Investigations. Acta Veterinaria. 67: 449-458. doi: https://doi.org/10.1515/acve-2017-0037\u003c/li\u003e\n\u003cli\u003eDaniel JC. 1991. Ungulate conservation in India \u0026mdash; Problems and prospects. Applied Animal Behaviour Science. 29: 349-359.\u003c/li\u003e\n\u003cli\u003eDratch, P., Shafer, J., Hoesch, R. and Espinoza, E. 1996. Comparison of electrophoretic and chromatographic methods for analysis of deer hemoglobin. The International Society of Animal Genetics. 27: 17\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eDuckworth, J.W. and Timmins, R. (2015). . The IUCN Red List of Threatened Species 2015: Moschiola indica e.T136585A61979067. http://dx.doi.org/10.2305/IUCN.UK.2015-2.RLTS.T136585A61979067\u003c/li\u003e\n\u003cli\u003eGaltier, N., Nabholz, B., Glemin, S. and Hurst, GDD. 2009. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Molecular Ecology. 18: 4541\u0026ndash;4550.\u003c/li\u003e\n\u003cli\u003eGardner, EJ. and Snustad, DP. 1984. Principles of genetics (7thEd.). John Wiley and Sons: New York.\u003c/li\u003e\n\u003cli\u003eGirish, PS., Anjaneyulu, ASR., Viswas KN., Anand M., Rajkumar N., Shivkumar BM., Patel M. and Sharma B. 2005. Meat species identification by Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene. Meat Science. 70: 107-112.\u003c/li\u003e\n\u003cli\u003eGoyal, SK. and Rajpurohit, LS. 1999. Mass killing of mammalian crop pest \u0026mdash; Nilgai (blue bull), \u003cem\u003eBoselaphustagocamelus\u003c/em\u003e, in Village Parasala, Osian of Jodhpur, India. Advances in Ethology. 34: 224.\u003c/li\u003e\n\u003cli\u003eGupta, A., Bhardwaj, A., Supriya, Sharma, P., Pal, Y., Mamta. and Kumar, S. 2015. Mitochondrial DNA- A tool for phylogenetic and biodiversity search in equines. Journal of Biodiversity \u0026amp; Endangered Species. S1: 006.\u003c/li\u003e\n\u003cli\u003eHayashi, JI., Tagoshira, Y. and Yoshida, MC. 1985. Absence of extensive recombination between inter and intra species mt DNA in mammalian cells. Experimental Cell Research. 160: 387-395.\u003c/li\u003e\n\u003cli\u003eHebert PD, Ratnasingham S, deWaard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci 270: 96\u0026ndash;99\u003c/li\u003e\n\u003cli\u003eIUCN. 2006. International Union for Conservation of Nature and Natural Resources. The IUCN Red list of threatened species. www.iucnredlist.org\u003c/li\u003e\n\u003cli\u003eIrwin DM., Kocher TD. and Wilson AC. 1991. Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution. 32: 123-144.\u003c/li\u003e\n\u003cli\u003eIrwin, DM., Kocher, TD. and Wilson AC. 1991. Evolution of the cytochrome b gene of mammals Journal of Molecular Evolution. 32: 123-144.\u003c/li\u003e\n\u003cli\u003eKaranth, KK., Nichols, JD., Karanth, KU., Hines, JE. and Christensen, NL. 2010. The shrinking ark: Patterns of large mammal extinctions in India. Proceedings of the Royal Society of London. 277: 1971-1979. doi:10.1098/rspb.2010.0171\u003c/li\u003e\n\u003cli\u003eKocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. and Wilson, A. C. 1989.Dynamics of mitochondrial DNA evolution in animals:amplification and sequencing with conserved primers. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A. \u003c/em\u003e\u003cstrong\u003e86\u003c/strong\u003e:6196-6200.\u003c/li\u003e\n\u003cli\u003eKumar, VP., Kumar, D. and Goyal, SP. 2014. Wildlife DNA forensic in curbing illegal wildlife trade: Species identification from seizures. International Journal of Forensic Science and Pathology. 2: 38-42. doi: http://dx.doi.org/10.19070/2332-287X-1400012\u003c/li\u003e\n\u003cli\u003eMaroju PA, Yadav S, Kolipakam V, Singh S, Qureshi Q, Jhala Y. Schrodinger\u0026apos;s scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer. BMC Genet. 2016 Feb 9;17:37. doi: 10.1186/s12863-016-0344-y. Erratum in: BMC Genet. 2017 Mar 24;18(1):28. PMID: 26860950; PMCID: PMC4748499.\u003c/li\u003e\n\u003cli\u003eMohanty, NP., Harikrishnan, S., Sivakumar, K. and Vasudevan, K. 2016. Impact of invasive spotted deer (\u003cem\u003eAxis axis\u003c/em\u003e) on tropical island lizard communities in the Andaman archipelago. Biological invasions. 18: 9-15.\u003c/li\u003e\n\u003cli\u003ePanday, R., Jha, DK., Thapa, N., Pokharel, BR. and Aryal, NK. 2014. Forensic wildlife parts and their product identification and individualization using DNA barcoding. The Open Forensic Science Journal. 7: 6-13.\u003c/li\u003e\n\u003cli\u003ePasha, MKS., Sankar, K., Qureshi, Q. and Areendran, G. 2004. Indian bison or gaur (\u003cem\u003eBos gaurus\u003c/em\u003e Lambert, 1804). ENVIS Bulletin. 7: 91\u0026ndash;102.\u003c/li\u003e\n\u003cli\u003ePaul, S., Ghosh, T., Panday, B., Dhananjai, M., Habib, B., Parag Nigam and Mondol, S. 2019.Rapid molecular assays for species and sex identification of swamp deer andother coexisting cervids in human-dominated landscapes of the Terai regionand upper Gangetic plains, northern India: Implications in understandingspecies distribution and population parameters. Journal of Genetics. 98: 44. https://doi.org/10.1007/s12041-019-1094-1\u003c/li\u003e\n\u003cli\u003ePanicker, VP., Hridas, PS., Athira, N., Shynu, M. and Babu, BC. 2019.Mitochondrial 12S rRNA gene sequence analysis, a tool for species identification. Journal of Wildlife and Biodiversity. 3: 29-35. \u003c/li\u003e\n\u003cli\u003ePrater, SH. 1980. The book of Indian animals. Bombay Natural History Society, Bombay, India\u003c/li\u003e\n\u003cli\u003eProffitt, KM., Gude, JA., Hamlin, KL. and Messer, MA. 2013. Effects of hunter access and habitat security on elk habitat selection in landscapes with a public and private land matrix. Journal of Wildlife Management. 77: 514\u0026ndash;524. https://doi.org/10.1002/jwmg.491\u003c/li\u003e\n\u003cli\u003eRajput, N., Shrivastav, AB., Parmar, SNS., Ranjan, R., Singh, S. and Joseph, E. 2013. Characterization of 12S rRNA gene for meat identification of common wild and domestic small herbivores as an aid to wildlife forensic. Veterinary World. 6: 254-259.\u003c/li\u003e\n\u003cli\u003eRanjana Bhaskar, Praveen Kanaparthiand Rengasamy Sakthivel. 2020. DNA barcode approaches to reveal interspecies genetic variation of Indian ungulates.\u003cem\u003eMitochondrial DNA Part B\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e:1, 938-944, DOI: 10.1080/23802359.2020.1719912.\u003c/li\u003e\n\u003cli\u003eRanjit sinh, MK. 1997. Beyond the tiger: Portraits of asian wildlife. Birajbasi Printers, New Delhi, India.\u003c/li\u003e\n\u003cli\u003eSaccone, C., DeCarla, G., Gissi, C., Pesole, G. and Reynes, A. 1999. Evolutionary genomics in the Metazoa: The mitochondrial DNA as a model system. Gene. 238: 195\u0026ndash;210.\u003c/li\u003e\n\u003cli\u003eSambrook, J. and Russel, DW. 2001. Molecular cloning: A laboratory manual. 3rd ed., Cold spring harbor laboratory press, New York, pp. 2000.\u003c/li\u003e\n\u003cli\u003eSanger, F., Nicklen, S. and Coulson, AR. 1977. DNA sequencing with chain-terminating inhibitors. Proceedings of National Academy of Sciences, USA. 74: 5463-5467.\u003c/li\u003e\n\u003cli\u003eSankar, K. and Acharya, B. 2004. Chital (\u003cem\u003eAxis axi\u003c/em\u003es\u003cem\u003e)\u003c/em\u003e (Erxleben, 1777)). ENVIS Bulletin (Wildlife Institute of India, Dehra Dun) 7: 171\u0026ndash;180.\u003c/li\u003e\n\u003cli\u003eSankar, K., Pabla, HS., Patil, CK., Nigam, P., Qureshi, Q., Navaneethan, B., Manjreakar, M., Virkar, PS. and Mondal, K. 2013. Home range, habitat use and food habits of re-introduced gaur (\u003cem\u003eBos gaurus gaurus\u003c/em\u003e) in Bandhavgarh Tiger Reserve, Central India. Tropical Conservation Science. 6: 50-69.\u003c/li\u003e\n\u003cli\u003eSiddappa, CM., Mohini, S., Asit, D., Ramesh, D., Anil. K.S. and Praveen, KG. 2013. Sequence characterization of mitochondrial12S rRNA gene in mouse deer (\u003cem\u003eMoschiola indica\u003c/em\u003e) for PCR - RFLP based species identification. Molecular Biology International. 1-6. http://dx.doi.org/10.1155/2013/783925\u003c/li\u003e\n\u003cli\u003eTimmins, RJ., Duckworth, JW. and Hedges, S. 2016. \u003cem\u003eMuntiacusmuntjak\u003c/em\u003e. The IUCN Red List of Threatened Species 2016: e.T42190A56005589. https://dx.doi.org/10.2305/IUCN.UK.2016-1.RLTS.T42190A56005589.en. Downloaded on 28 June 2020.\u003c/li\u003e\n\u003cli\u003eTobe, SS., Kitchener, AC. and Linacre, AM. 2010.Reconstructing mammalian phylogenies: A detailed comparison of the cytochrome B and cytochrome oxidase subunit I mitochondrial genes. PLoS One. 5: e14156.\u003c/li\u003e\n\u003cli\u003eUbelaker, D. H., Lowenstein, J. M. and Hood, D.G. 2004. \u0026ldquo;Use of solidphase double-antibody radioimmunoassay to identify species fromsmall skeletal fragments,\u0026rdquo; \u003cem\u003eJournal of Forensic Sciences\u003c/em\u003e, vol.49, no. 5, pp. 924\u0026ndash;929.\u003c/li\u003e\n\u003cli\u003eXiao, W., Hebblewhite, M., Robinson, H., Feng L., Zhou, B., Mou, P., Wang, T. and Ge, J. 2018. Relationships between humans and ungulate prey shape Amur tiger occurrence in a core protected area along the Sino‐Russian border. Ecology and Evolution. 8: 11677-93.\u003c/li\u003e\n\u003cli\u003eYang, L., Tan, Z., Wang, D., Xue, L., Guan, M., Huang, T. and Li, R. 2014. Species identification through mitochondrial rRNA genetic analysis. Scientific Reports. 4: 4089.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"DNA, FINS, Mitochondria, PCR, DNA barcoding, speciation","lastPublishedDoi":"10.21203/rs.3.rs-6366101/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6366101/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe identification of wild animal species is crucial for the conservation of biodiversity and the prevention of illegal wildlife trade and poaching. Wild ungulates are highly susceptible to poaching, making it essential to develop reliable and authentic methods for identifying species from biological samples. By using mitochondrial DNA barcoding techniques, particularly targeting the \u003cb\u003eCytochrome c Oxidase gene\u003c/b\u003e, it offers an effective method for the accurate identification of species involved in poaching and illegal wildlife trade. The application of this technique in India and potentially in other countries can greatly assist in \u003cb\u003estrengthening wildlife conservation efforts\u003c/b\u003e, \u003cb\u003ecombatting illegal wildlife trade\u003c/b\u003e, and providing \u003cb\u003erobust evidence\u003c/b\u003e for legal authorities. Furthermore, it contributes to global efforts to document and preserve the genetic diversity of wild ungulates and other species.\u003c/p\u003e","manuscriptTitle":"Forensic Identification of Wild Ungulate Species via Mitochondrial Cytochrome C oxidase Gene Analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-16 06:30:45","doi":"10.21203/rs.3.rs-6366101/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4f88195b-4ab9-4e23-b081-3b0e0b1f7a25","owner":[],"postedDate":"April 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-16T06:30:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-16 06:30:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6366101","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6366101","identity":"rs-6366101","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}