Compound heterozygosity of EXOSC2 ‘missense’ variants causes a bi-allelic decrease in protein expression through novel unexpected pathomechanisms

Compound heterozygosity of EXOSC2 ‘missense’ variants causes a bi-allelic decrease in protein expression through novel unexpected pathomechanisms | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Compound heterozygosity of EXOSC2 ‘missense’ variants causes a bi-allelic decrease in protein expression through novel unexpected pathomechanisms Shin Hayashi, Kenichiro Yamada, Takuma Mori, Yasuyo Suzuki, Yosuke Nishio, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9039053/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract EXOSC2 encodes one of the 11 components of the RNA exosome complex degrading various types of RNA. Pathogenic variants of some EXOSC genes cause genetic disorders with similar phenotypes, including intellectual disability (ID), microcephaly, and pontocerebellar hypoplasia. However, little is known regarding EXOSC2 . We report detailed analyses of compound heterozygosity of novel EXOSC2 variants, comprising paternally-inherited c.14T > G (p.M5R) and maternally-inherited c.317C > T (p.S106L), identified in a patient with ID, epilepsy, and microcephaly. Although the two variants appeared ‘missense,’ they respectively decreased protein EXOSC2 expression through novel pathomechanisms. c.14T > G may have decreased EXOSC2 expression by impaired efficiency during translational initiation. Interestingly, other synonymous codons didn’t decrease the expression, suggesting the decreased expression depended on the nucleotide change instead of residue change. The second variant, c.317C > T, caused unexpected exon 4 skipping, leading to decreased EXOSC2 expression, although the nucleotide 317C was in the middle of exon 4. Since the exon skipping didn’t occur due to other changes in nucleotides adjacent to c.317C, only c.317C > T critically reduced the function of the exon enhancer element. Altogether, we identified two novel pathomechanisms explaining the decrease in EXOSC2 expression. These findings suggest the possibility that we may overlook such kind of variants decreasing gene expression, which could cause disorders. Additionally, the etiology of the current case is a decline of one of the 11 components of the exosome, similar to previously-reported disorders by other genes in the EXOSC family, with overlapping clinical features. Thus, these disorders may be integrated into a new disease concept termed “ RNA exosomepathy .” Biological sciences/Genetics/Clinical genetics/Disease genetics Biological sciences/Genetics/Neurodevelopmental disorders Biological sciences/Genetics/Gene expression Biological sciences/Molecular biology Biological sciences/Biological techniques/Genomic analysis EXOSC2 RNA exosome splicing aberration Figures Figure 1 Figure 2 Figure 3 Introduction Interpretation of a missense variant can be challenging when determining the pathogenicity of a variant of uncertain significance (VUS) in genetic disorders, since missense variants can cause various genetic effects, including loss of function, gain of function, or no effect on function. According to the guidelines by the American College of Medical Genetics [Ref. 1], the estimation of missense variants depends on previous cases, functional analysis, genomic database, or in silico prediction. Although multiple in silico predictors are currently available [Ref. 2], their results are often controversial, and functional analysis for the VUS is still required to understand the actual pathomechanism. The EXOSC2 gene [MIM: *602238] encodes a component of the RNA exosome complex. Nine EXOSC family genes, EXOSC1 to EXOSC9 , encode components of the RNA exosome complex and are responsible for degrading various types of RNA. Some of them, EXOSC1 , EXOSC2 , EXOSC3 , EXOSC8 , and EXOSC9 , are known to cause genetic disorders with similar phenotypes, particularly intellectual disability (ID), microcephaly, and pontocerebellar hypoplasia (PCH) [Ref. 3]. However, few cases have been reported regarding EXOSC2 [Ref. 4]. Additionally, since most pathogenic variants of the EXOSC family genes are missense, it is difficult to determine the pathogenicity of a novel variant. In this study, we functionally analyzed two novel variants composing a compound heterozygosity of EXOSC2 , and clarified that each variant decreased EXOSC2 protein expression through different novel pathomechanisms, although both variants appeared ‘missense.’ Material and Methods The proband was a six-year-seven-month old boy with ID, developmental delay, epilepsy, and multiple congenital dysmorphologies (Table 1 ). His parents were not consanguineous, and there was no notable family history. He was conceived by in vitro fertilization as the second boy of two siblings and was born at 33 weeks. His birth weight was 1,688 g (-1.1 standard deviation [SD]), height was 42 cm (-0.6 SD), and occipitofrontal circumference (OFC) was 29.1 cm (-0.7 SD) at birth. He had hypocalcemia during the perinatal period and was diagnosed with hypoparathyroidism and given oral calcium lactate. He had an episode of absence seizure after six months, afebrile convulsion at 21 months, and recurrent multiple febrile convulsions; however, no electroencephalogram abnormalities were noted. He has been checked up at our hospital since he was one year old. His development has been markedly retarded: he has never held his head up yet, and he could roll over at two years old. His growth was remarkably retarded: at 6 years and 5 months, his weight was 9.6 kg (-4.2 SD), height was 91 cm (-5.7 SD), and OFC was 45 cm (-4.4 SD) (Fig. 1 A). Physical examination revealed sparse hair, small ala nasi , thin auricle, right retractile testis, and micropenis. Neurological findings showed hypertonia, athetosis of the upper limb, and a positive Babinski reflex. A computed tomography scan of the brain at three years and ten months showed a calcification in the white matter and basal ganglia (Fig. 1 B). Magnetic resonance imaging of the brain at three years and six months showed hypoplastic cerebellar hemisphere and vermis, while brainstem and corpus callosum were not hypoplastic (Fig. 1 C). His karyotype was 46,XY. DNA was extracted from peripheral blood by standard methods. A lymphoblastoid cell line (LCL) was also established for the patients and parents by infecting lymphocytes with an Epstein-Barr virus, as previously described [Ref. 5]. Table 1 The current and previous studies of the EXOSC family genes Gene Disor-der Genetic findings Clinical findings Brain CT or MRI findings Reference Variant Zygos-ity No. of families (individ-uals) Functional analysis DD Sei-zures Facial dys-morph-ism MIC Hypo- tonia BC CBH PH CEA CCH MA EXOSC1 PCH type 1F c.104C > T (p.S35L) Hom 1 (2) Mutant protein is significantly reduced (fibroblast) + - + + + + + + + - [ 23 ] c.547C > T (p.R183W) Hom 1 (1) Mutant protein is significantly reduced (yeast) + NA + + + + + + + - [ 26 ] EXOSC8 PCH type 1C c.815 G > C (p.S272T) Hom 2 (20) Mutant protein is significantly reduced (myoblast) + NA +* NA +* +* NA +* +* +* [ 20 ] c.5C > T (p.A2V) Hom 1 (2) Mutant protein is significantly reduced (fibroblast) + NA NA NA + + + - + - p.V80I Hom 1 (1) Exon5-skipping causing early termination + - + - + + + - + NA [ 24 ] EXOSC9 PCH type 1D c.41T > C (p.L14P) Hom 5 (5) Mutant protein is significantly reduced (fibroblast) ++ +* +* +* + + - +* - +* [ 21 , 22 ] c.41T > C (p.L14P)/ c.481C > T (p.R161*) CH 1 (1) NP ++ - NA - + + + + + + [ 21 ] c.239T > G (p.L80R)/ c.484dupA (p.R162Lfs*3) CH 1 (2) NP ++ - NA - + + - - - NA [ 32 ] c.151G > C (p.G51R) Hom 1 (1) NP ++ + NA - + + - - - NA EXOSC3 PCH type 1B c.395A > C (p.D132A) Hom 14 (22) NP + +* +* + +* + +* - - [ 33 , 34 , 35 , 36 , 37 , 38 , 39 ] c.92G > C (p.G31A) Hom 5 (6) Protein W238R is unstable and suppresses cell growth, but G31A and G191C do not (yeast) [ 29 ] + - NA +* + + + + - [ 36 ] c.92G > C (p.G31A)/ c.712T > C (p.W238R) CH 1 (2) + NA NA NA + + NA NA NA NA [ 33 , 35 ] c.571G > T (p.G191C) Hom 1 (4) +* +* NA - - + - - - - [ 40 ] EXOSC2 c.89G > T (p.G30V) Hom 1 (2) G198D decreases protein levels but G30V doesn't (LCL) +/- - + + NA +/- +/-* - [ 4 , 41 ] c.89G > T (p.G30V)/ c.593G > A (p.G198D) Hom 1 (1) +/- - + + NA + +/- +/- + c.14T > G (p.M5R)pat/ c.317C > T (p.S106L)mat CH 1 (1) Mutant protein is significantly reduced (LCL) ++ + + + Hyper-tonia + + - - - Present case Note: DD, developmental delay; MIC, microcephaly; BC, Brain calcification; CBH, cerebellar hypoplasia; PH, pontine hypoplasia; CEA, Cerebral atrophy; CCH, Corpus callosum hypoplasia; MA, Myelination abnormalities; CH, Compound heterozygosity; Hom, Homozigosity; *, present in some cases; ++, severe; +/-, mild; NA , not available; NP , not performed Whole exome sequencing For whole exome sequencing performed in the Initiative on Rare and Undiagnosed Diseases (IRUD) program, exonic regions were enriched and sequenced with 150 bp paired-end reads, achieving an average coverage of 100× across the targeted exome. Alignment and variant calling were performed using BWA-MEM and the Genome Analysis Toolkit (GATK v3.5) following GATK Best Practices, with the Human Reference Genome hs37d5. We included only rare variants with minor allele frequency (MAF) < 0.01, and the subsequent filtering processes were performed using an inhouse database. Reverse Transcription (RT)‑PCR and Real-time PCR Analysis RT-PCR was performed as described previously [Ref. 6]. Briefly, total RNA was extracted from LCLs derived from the patients and three controls using RNeasy Micro Kit (QIAGEN, Hilden, Germany). The RNA was reverse transcribed using ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). The synthesized cDNA was amplified by PCR with specific primer sets for EXOSC2 between exons 1 and 5 ( Table S1 ). PCR products were electrophoresed on an agarose gel. Real-time PCR was performed as described previously [Ref. 7]. Briefly, gene expression levels were quantified by real-time PCR using a THUNDERBIRD Next SYBR qPCR Mix (Toyobo). Relative RNA levels were normalized to the expression of TATA box binding protein ( TBP ), a stable housekeeping gene. The hypoxanthine phosphoribosyl-transferase I ( HPRT1 ) was used as an internal control [Ref. 8]. The primer sequences used for real-time PCR are listed in Table S1 . Western blotting Lymphoblastoid cells or transfected HEK293 cells were homogenized in extraction buffer containing 25 mM Tris/HCl (pH 7.5), 150 mM NaCl and 1:1000-diluted Protease Inhibitor Cocktail (Sigma-Aldrich). The homogenate was sonicated using SONIFIER 250 (BRANSON, Danbury, CT). Aliquots containing 10 µg of extracted protein were separated via 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The resolved proteins were transferred to Immobilon-P polyvinylidene fluoride membranes (Millipore, Billerica, MA) blocked with a mixture of 2% BSA, 10 mM Phosphate buffer (pH 7.5), and 100 mM NaCl at room temperature for 30 min and incubated with antibodies, EXOSC2 (1:10,000; Proteintech), α-tubulin (1:6000; Sigma-Aldrich), HA tag (1:10,000; HA-7, Abcam) overnight at 4°C. After incubation with a horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG secondary anti-body (1:10,000; Promega, Madison, WI, 1:10,000; Medical & Biological Laboratories, Nagoya, Japan), the signals were visualized using Western Lighting Chemiluminescence Reagent Plus (Perkin-Elmer, Boston, MA) and quantified using ImageQuant TL (Cytiva, Marlborough, MA). The efficiency of the transfection was verified by measuring β-galactosidase activity using o-nitrophenyl-β-D-galactopyranoside as the substrate [Ref. 9]. Minigene analysis A minigene splicing assay was performed to evaluate the effect of the variant on RNA splicing, as previously described [Refs. 4, 5]. Briefly, the genome fragments containing exons 3–5 of EXOSC2 (1,948 bp) were amplified using Tks Gflex DNA Polymerase (Takara Bio) with primers ( Fig. S1 , Table S1 ) from genomic DNA of healthy control and patient. The fragments were subcloned into pGEM-T easy vector, and sequences were confirmed. The fragments were subcloned into pCI-neo expression vector (Promega) at EcoRI site. The p.S106P (TCG > CCG) and p.S106S (TCG > TCA) variant minigenes were generated from WT minigene construct as a template using Tks Gflex DNA Polymerase with primer pairs ( Table S1 ). The PCR products were ligated to themselves at both ends and sequenced. The minigene constructs were transiently transfected into HEK293 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA). Forty-eight hours later, total RNA was extracted using the RNeasy Micro Kit (QIAGENE), and total RNA (3 µg) was reverse transcribed using First-Strand cDNA Synthesis Kit (Cytiva). PCR amplification was carried out with AmpliTaq-Gold (Applied Biosystems, Foster City, CA) with primer pair ( Table S1 ). Construction of EXOSC2-HA expression vectors EXOSC2 cDNA fragments were amplified from first-strand cDNA prepared from the lymphoblastoid cell of father by using a specific primer pair ( Table S1 ). Fragments were subcloned into pGEM-T easy vector, and sequences were confirmed. As a result, both wild-type and c.14T > G (p.M5R) clones were obtained. These fragments contained 69-bp upstream region from ATG start codon. These fragments were subcloned into the EcoRI/XbaI sites of the p3XFLAG (E4901; Sigma-Aldrich). Original HA tag fragment (GGATCCTACCCATACGATGTTCCAGATTACGCTTGATGCATTGGGCCCGGGATCC) was inserted into BamHI site of these clones. These expression vectors contained a termination codon (TGA) upstream of a 3×FLAG-tag sequence. The other nucleotide changes coding methionine to arginine (termed Var 5, ATG > CGC and Var 6, ATG > AGA) were generated from WT construct as a template using Tks Gflex DNA Polymerase with primer pairs ( Table S1 ). In silico structural modeling and evaluation of EXOSC2 variants A structural model of the nuclear exosome-MTR4, an RNA helicase complex from RCSB protein data bank [PDB: 6D6Q] [Ref. 10] was used to predict the effect of protein variants of Exosc2 in the complex. FoldX [ver. 5.0, SCR_008522] [Ref. 11] was used to estimate the change of stability of the protein upon mutation. FoldX repaired the protein structure to the most stable state, and the repaired file was used to evaluate the instability of the missense variants (M5R or S106L) of Exosc2. The repaired pdb files was imported into PyMOL [Ref. 12] and visualized. Results WES identified a compound heterozygosity consisting of two “missense” variants of EXOSC2 We extracted variants found only in the proband or variants consisting of compound heterozygosity, and identified two missense variants in EXOSC2 as candidate causative variants: paternally-inherited NM_001282708.1:c.14T > G (p.Met5Arg) at exon 1 and maternally-inherited NM_001282708.1:c.317C > T (p.Ser106Leu) at exon 4 (Figs. 2 A, 2 B). The variants were confirmed by Sanger sequencing ( Fig. S1 ). The amino acids surrounding the variants were well-conserved among species ( Fig. S2 ). The expression of EXOSC2 in the patient's LCL was significantly decreased To interpret the significance of the variants, performed western blotting analysis using the EXOSC2 antibody, demonstrating that the amount of EXOSC2 protein in the patient’s LCL was 27.6% lower compared to four healthy controls (Fig. 2 C). We also confirmed that EXOSC2 mRNA expression in the patient’s LCL was approximately 68% (p < 0.02) that of LCLs of three controls via quantitative polymerase chain reaction (PCR) (Fig. 2 D, Table S1 ). In silico predictions of the variants and estimation of protein structure change These findings suggested that both alleles of EXOSC2 were pathogenic; thus, we evaluated the effect of each missense variant. First, we estimated the pathogenicity of the variants using several in silico predictors, which revealed controversial results (Table 2 ). Some predictors, for example, PolyPhen-2 or Alphamissense, judged c.14T > G as ‘benign,’ while other predictors like PROVEAN and SIFT deemed it as ‘Pathogenic.’ Although c.317C > T was more likely to be judged as ‘Pathogenic,’ SpliceAI did not predict it to change the splicing ( Table S2 ). Next, we evaluated the effect of the missense variants on the three-dimensional structure. We obtained the whole structure of the human nuclear exosome-MTR4 RNA complex from the Protein Data Bank (ID: 6D6Q) [Ref. 13], and introduced one of the two missense variants to the exosome complex to investigate the impact of the variants on the RNA exosome complex. We first investigated the locations of the two substituted amino acids in the exosome complex ( Fig. S3A ) and observed that M5 was located adjacent to the EXOSC7 protein ( Fig. S3B ), and that S106 was facing the RNA ( Fig. S3C ). Next, we introduced the M5R variant and found that the substitution of arginine caused the slight instability of the EXOSC2 protein, although Alphamissense and Rosetta estimated that the M5R may not affect the stability of the protein (Table 2 ). The substitution also produced additional polar bonds between EXOSC2 and EXOSC7 in the complex ( Fig. S3D ). Meanwhile, the S106L variant did not cause a change in the protein stability calculated by FoldX (Table 2 ); however, Alphamissense classified the S106L as a pathogenic variant of EXOSC2 (Table 2 ). The substituted leucine lost a predicted polar bond between the beta sheets facing RNA ( Fig. S3E ). That is, these results were controversial and were not definitive conclusion for the determination of the pathigenicities of the variants. In total, our in silico simulation indicated that the protein variants might have caused the instability and structural change of the EXOSC2 protein in the RNA exosome complex, with discrepancies in the results. Table 2 Variants of EXOSC2 and in silico predictions Variant Assembly dbSNP MAF CADD REVEL PolyPhen-2 a) PROVEAN b) SIFT c) AlphaMissense Rosetta FoldX 5.1 NM_001282708.1:c.14T > G (p.Met5Arg) GRCh38/hg38 rs769145406 6.222 × 10 − 7 24.6 0.131 0.039 Benign -2.54 Deleterious 0.003 Damaging 0.336 likely benign 11.35 Stable 4.09 Slightly instable NM_001282708.1:c.317C > T (p.Ser106Leu) GRCh38/hg38 rs150081500 9.912 × 10 − 6 29.2 0.704 0.999 Probably damaging -5.04 Deleterious 0.001 Damaging 0.926 likely pathogenic 0.54 Stable -0.79 Stable Note: a) Only amino acid change is available b) Cutoff = -2.5 c) Cutoff = 0.05 The variant, c.317C > T (p.S106L), causes exon 4 skipping To compensate for these discrepancies, we proceeded with in vitro functional analysis of the variants. First, we performed reverse transcription (RT)-PCR on each LCL of the proband and the parents to amplify the all coding exons to investigate the significance of c.317C > T. We found that a shorter PCR product was strongly expressed in the mother and the patient (Fig. 3 A). Sequence analysis of the short PCR product exhibited a skipping of exon 4 including c.317C > T, comprising 90 nucleotides. Thus, the exon skipping probably occurred on an mRNA expressed from the maternal allele. Hence, the minigene assay producing exons 3 to 5 including introns 3 and 4 was performed to determine the effect of the c.317C > T variant on RNA transcription (Fig. 2 B). RT-PCR detected transcripts containing all the three exons from the cells transfected with the wild type (WT) allele, while the exon 4-skipping transcripts were strongly expressed in cells with the c.317C > T variant (Var.1 in Fig. 3 B). Although skipping of the exon 4 causes an in-frame deletion of 30 amino acids, the predicted shorter protein was not identified (Fig. 2 C), suggesting that the mutant protein is likely to be unstable. These findings prompted us to hypothesize that c.317C > T is not a mere missense mutation, but a functional nucleotide change, causing the exon splicing enhancer dysfunction. A few variants of S106 are registered in gnomAD, a genome database for healthy individuals: 16/1,614,142 alleles (MAF = 9.912 × 10 − 6 ) of the c.317C > T (p.S106L), 16/1,614,154 alleles (MAF = 9.912 × 10 − 6 ) of the c.316T > C (p.S106P), and 2,086/1,614,142 alleles (MAF = 1.292 × 10 − 3 ) of the c.318G > A (p.S106S). Therefore, we prepared minigenes replicating the variants, c.316T > C and c.318G > A, and performed RT-PCR in the same manner. Interestingly, c.317C > T certainly caused the exon 4-skipping, while the other variants caused slight skipping of the exon 4 (Fig. 3 B). These findings exhibited that the exon 4 skipping was tightly dependent on c.317C > T substitution, instead of the amino acid change. As a result, c.317C > T (p.S106L) variant of maternal allele caused decrease of EXOSC2 protein expression, and was thought to be pathogenic. The variant, c.14T > G (p.M5R), decreases protein expression in a nucleotide sequence-dependent manner. Next, we investigated the significance of the c.14T > G variant. RT-PCR using a primer set amplifying exon 1 containing c.14T > G (p.M5R) did not exhibit an aberrant transcript in the father (Fig. 3 A). Thus, we assessed the precise effect of the variant on EXOSC2 expression by transfecting the expression vector of the WT and c.14T > G variant changing the codon ATG to AGG (Var. 4) with HA tag into HEK293. RT-PCR revealed the decreased transcript (Var. 4 in Fig. 3 C, Table S1 ), which was concordant with the decreased EXOSC2 expression in the proband’s LCL (Fig. 2 D), and western blotting confirmed the decreased protein of EXOSC2 in Var. 4 (Fig. 3 D). Therefore, the c.14T > G (p.M5R) variant of the paternal allele was determined to be pathogenic. Additionally, we initially expected that the M3 and/or M5 may function as the first codon since the frst exon of EXOSC2 has the triple metionines, M1, M3, and M5, which appears to be a unique and unnatural structure (Fig. 2 B) [Ref. 14]. However, no shorter protein than WT was detected (Fig. 2 C), meaning the other methionines than the first one was not used as the start codon. Further analysis was performed to clarify the mechanism by which c.14T > G decreased EXOSC2 protein expression. Since the N-terminal amino acid sequence of EXOSC2 does not contain any functional domains, it is unlikely to affect the protein function or protein stability. Thus, we generated expression constructs of two more synonymous codons coding arginine, CGC and AGA (Var. 5 and 6). We transfected the constructs into HEK293 and performed RT-PCR and western blotting. However, these codons did not decrease mRNA and EXOSC2 protein expression (Var. 5 and 6 in Figs. 3 C and 3 D). There is little difference in codon usage of human among the synonymous codons, AGG, CGC, and AGA (12.0, 10.4, 12.2/1000 codons, respectively, NCBI-GenBank Flat File Release 160.0), suggesting that AGG does not have an inherent difficulty in being translated. These findings revealed that the impaired expression of EXOSC2 was tightly dependent on the c.14T > G substitution, instead of the amino acid change. Subsequently, to estimate whether there is a mechanism to degrade mRNA depending on the c.14T > G substitution, we transfected a vector expressing a 78-bp short RNA fragment containing the c.14T > G variant and adjacent sequences with the EXOSC2-pM5R-HA expression vectors and measured the protein expression. The expression of the p.M5R protein was not recovered with decoy RNA fragments (Lane 6 in Fig. S5 ), suggesting that the expression was decreased as a result of translational inhibition, probably because of the change in the secondary structure of the mRNA, instead of degradation by the non-coding RNAs. Discussion In the current study, we successfully clarified two unexpected and different mechanisms decreasing the expression of EXOSC2, although they appear to be missense variants. Thus, the two variants are considered to compound biallelic decreasing of EXOSC2 which causes the patient’s phenotypes. Initially, we expected the c.317C > T (p.S106L) was a missense variant which should affect the binding ability of EXOSC2 to RNA since the S106 was adjacent to V107 and L109, which were predicted as binding residues to RNA [Ref. 15]. However, the RT-PCR using LCL and the minigene assay clarified the c.317C > T led to the exon 4 skipping (Figs. 2 D and 3 A). Additionally, WT and other codon changes of S106, c.316T > C (p.S106P) and c.318G > A (p.S106S) variant registered in gnomAD as variants observed in healthy population, barely caused the exon 4-skipping (Fig. 3 B). Meanwhile, the faint products observed in WT and Var.3 (Fig. 3 B) may suggest the exon 4 is likely to be skipped. Thus, we predicted an exon splicing enhancer using ESEfinder 3.0 [Refs. 16, 17]. As a result, only c.317C > T lost the binding site of SF/ASF (IgM-BRCA1), which is required for the splicing ( Fig. S4 ). The estimation was concordant with the result of the in vitro analyses. These findings demonstrated that the exon skipping was highly dependent on the nucleotide substitution, c.317C > T, instead of the residual change. The region of the EXOSC2 protein encoded by exon4, V91 to L120, are partially overlapped with an Rrp4 S1-like RNA-binding domain in R75 to L166. Thus, the mRNA skipping exon 4 is predicted to lack a functional RNA-binding domain. Although the exon 4-skipping is an in-frame mutation, the protein may be unstable and likely to be degraded as WB did not detect a shorter protein (Fig. 2 C). Although most pathogenic exonic variants are presumed to affect protein coding, approximately one-third of them are also reported to affect a splicing [Ref. 18]. Thus, an effect on splicing should be considered in deciphering significance and pathomechanisms of VUS. Next, we interpreted the significance of the c.14T > G (p.M5R) variant. The variant decreased the expression of mRNA and protein depending on the nucleotide change instead of the amino acid change (Figs. 3 C and 3 D). The transfected decoy mimicking the short fragment including c.14T > G could not recover decrease of protein expression ( Fig. S5 ), suggesting that the expression was decreased as a result of translational inhibition probably because of the change of secondary structure of mRNA, instead of a degradation by the non-coding RNAs. The residue M5 is close to the translational initiation site; thus, its change may likely impact the secondary structure of mRNA, affecting the initiation of translation and the translational efficiency [Ref. 19]. Repeat expansion diseases, such as fragile X syndrome [#300624], myotonic dystrophy Type 1 [#160900], amyotrophic lateral sclerosis and/or frontotemporal dementia [#105550], or Huntington disease [#143100], are known to decrease protein synthesis by the change in secondary structure of mRNA induced by the repeat expansion [Refs 20, 21]. This means that the structural change in mRNA impairs ribosomal translation and decreases protein expression, which should be pathogenic. As an example, other than the repeat expansion, the deletion of three nucleotides (ΔF508) in the CFTR gene [*602421] reportedly reduces mRNA [Ref. 22]. Ribosomes stalling in translation are recognized as targets of endonucleolytic cleavage, referred to as ‘no-go decay,’ causing mRNA degradation [Ref. 23]. This mechanism may explain why the variant, c.14T > G, decreases not only protein expression but also mRNA (Fig. 3 D). Meanwhile, the mutant protein of p.M5R would be functional as with WT, since there is no functional domain around the M5 residue, although it is well conserved among the species ( Fig. S2 ). Thus, c.14T > G (p.M5R) is probably pathogenic because of decreased expression of the protein due to the impact on the efficiency of the translational initiation process, instead of a change in protein function or complete loss of EXOSC2 expression. Disorders caused by pathogenic variants of the EXOSC family genes exhibited notable similarity in phenotypes such as ID, seizure, hypotonia, microcephaly, and PCH, although they have not been understood as a unified disease concept (Table 1 ) [Ref. 3]. Most reported variants related to the disorders were missense, which prevented easy determination of the pathogenicity of the variant. Additionally, regarding EXOSC2 , the limited number of reported cases makes it difficult to understand it comprehensively with other EXOSC family genes [Ref. 4]. However, previous functional analyses demonstrated that most of the variants reduced the expression of each EXOSC gene, instead of gain-of-function or overexpression, although they looked like ‘missense’ variants. For example, RT-PCR and/or immunoblotting using the patient’s material, LCL or fibroblast, confirmed reduced expression of the mutated genes (Table 1 ) [Refs. 24, 25, 26, 27, 28]. Likewise, immunoblotting using yeast, to which the variant was introduced, showed reduced protein expression [Refs. 29, 30]. These findings suggest that expression of the EXOSC family, including EXOSC2 , is likely to be decreased even by the ‘missense’ variants, although not all of the variants were validated. Since the RNA exosome comprises 11 components, a decline in any component may decrease the activity of the RNA exosome and cause the overlapping phenotypes, depending on the remaining activity of the RNA exosome. Thus, the pathological condition should be defined as “ RNA exosomepathy,” characterized by overlapping features such as ID, microcephaly, and PCH. Meanwhile, the pathogenic variants do not necessarily result in a complete loss-of-function [Ref. 27]. Actually, knockouts of Exosc1 and Exosc2 in mice are embryonically lethal [Ref. 31]. That is, biallelic loss-of-function variants of the EXOSC family genes are lethal, which may explain the reason why it has never been reported. In conclusion, we successfully identified two unexpected mechanisms underlying the decrease in EXOSC2 protein expression that were difficult for the in silico predictors to estimate. The two variants are considered to compound the biallelic decrease in EXOSC2 expression, explaining the patient’s phenotypes. Declarations Acknowledgements The authors are grateful to the patients and their families for their agreement to participate in this study. We wish to acknowledge Emi Sato and Toshihiko Iwaki for dedicated analysis in the Tokai regional branch of the IRUD, and Noriko Nomura, Arisa Yamano and Yuko Furukawa for helpful assistance. We would also appreciate all members of the Bench-Bedside Collaborative Study (BBCS) for the presentation and enthusiastic discussion of the clinical cases. Author Contribution Statement K.Y.: Study design, genetic data acquisition and analysis, molecular analyses, and original draft preparation, writing, review, and editing. T.M.: 3D-model preparation and in silico prediction. Y.S.: Molecular analysis. Y.N. and T.O.: Genetic analysis and diagnosis. M.I.: Clinical diagnosis and follow-up of the patient. S.H.: Study design, genetic diagnosis, clinical data gathering and analysis, original draft preparation, writing, review, and editing. Funding This work was supported by JSPS KAKENHI Grant Numbers JP24K11014 and JP24K10523. The genetic diagnosis was a part of the Initiative on Rare and Undiagnosed Diseases (IRUD) program funded by the Japan Agency for Medical Research and Development (AMED), Grant Number 24ek0109760s0401. Ethical Approval Written informed consent was obtained from the parents of the proband. The experiments in this study were conducted after obtaining approval from the Research Ethics Committee of Aichi Developmental Disability Center (#RC6-01). Competing Interests The authors declare no competing interests. Web Resources Alphamissense: https://alphamissense.hegelab.org/ CADD: https://cadd.gs.washington.edu/ CentroidFold: http://rtools.cbrc.jp/centroidfold/ ESEfinder 3.0: https://esefinder.ahc.umn.edu/cgi-bin/tools/ESE3/esefinder.cgi The gnomAD database v4.1.0: https://gnomad.broadinstitute.org/ (v4.1.0, accessed Jan 2026) PolyPhen-2: http://genetics.bwh.harvard.edu/pph2/ PDB: https://www.rcsb.org/structure/ PROVEAN and SIFT: http://provean.jcvi.org/index.php REVEL: https://sites.google.com/site/revelgenomics/ Rosetta Online Server: https://rosie.graylab.jhu.edu/ SpliceAI: https://spliceailookup.broadinstitute.org Data and code availability This study did not generate datasets. References Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015, 17:405–24. doi: 10.1038/gim.2015.30 . Pejaver V, Byrne AB, Feng BJ, Pagel KA, Mooney SD, Karchin R, et al. Calibration of computational tools for missense variant pathogenicity classification and ClinGen recommendations for PP3/BP4 criteria. Am J Hum Genet. 2022, 109:2163–2177. doi: 10.1016/j.ajhg.2022.10.013 . Morton DJ, Kuiper EG, Jones SK, Leung SW, Corbett AH, Fasken MB. The RNA exosome and RNA exosome-linked disease. RNA. 2018, 24:127–142. doi: 10.1261/rna.064626.117 . Di Donato N, Neuhann T, Kahlert AK, Klink B, Hackmann K, Neuhann I, et al. Mutations in EXOSC2 are associated with a novel syndrome characterised by retinitis pigmentosa, progressive hearing loss, premature ageing, short stature, mild intellectual disability and distinctive gestalt. J Med Genet. 2016, 53:419–25. doi: 10.1136/jmedgenet-2015-103511 . Saito-Ohara F, Fukuda Y, Ito M, Agarwala KL, Hayashi M, Matsuo M, et al. The Xq22 inversion breakpoint interrupted a novel Ras-like GTPase gene in a patient with Duchenne muscular dystrophy and profound mental retardation. Am J Hum Genet. 2002, 71:637–45. doi: 10.1086/342208 . Suzuki Y, Nomura N, Yamada K, Yamada Y, Fukuda A, Hoshino K, Abe S, Kurosawa K, Inaba M, Mizuno S, Wakamatsu N, Hayashi S. Pathogenicity evaluation of variants of uncertain significance at exon-intron junction by splicing assay in patients with Mowat-Wilson syndrome. Eur J Med Genet. 2023, 66:104882. Doi: 10.1016/j.ejmg.2023.104882 Suzuki Y, Uehara DT, Enokido Y, Kawai T, Nomura N, Yamada K, Takanashi J, Miyahara H, Inazawa J, Hayashi S. Transcript imbalance from TENM4 exon skipping: effects on epilepsy and genetic pleiotropy. Mol Neurobiol. 2025, 63:324, 2025. DOI: 10.21203/rs.3.rs-7261185/v1 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3:RESEARCH0034. doi: 10.1186/gb-2002-3-7-research0034 . Gotoda Y, Wakamatsu N, Kawai H, Nishida Y, Matsumoto T. Missense and nonsense mutations in the lysosomal alpha-mannosidase gene (MANB) in severe and mild forms of alpha-mannosidosis. Am J Hum Genet. 1998, 63:1015–24. doi: 10.1086/302048 Burley SK, Bhatt R, Bhikadiya C, Bi C, Biester A, Biswas P, et al. Updated resources for exploring experimentally-determined PDB structures and Computed Structure Models at the RCSB Protein Data Bank. Nucleic Acids Res. 2025, 53:D564-D574. doi: 10.1093/nar/gkae1091 . Delgado J, Radusky LG, Cianferoni D, Serrano L. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics. 2019, 35:4168–4169. doi: 10.1093/bioinformatics/btz184 . Schrödinger L and DeLano W. PyMOL. 2020. http://www.pymol.org/pymol Weick EM, Puno MR, Januszyk K, Zinder JC, DiMattia MA, Lima CD. Helicase-Dependent RNA Decay Illuminated by a Cryo-EM Structure of a Human Nuclear RNA Exosome-MTR4 Complex. Cell. 2018, 173:1663–1677.e21. doi: 10.1016/j.cell.2018.05.041 . Zur H, Tuller T. New universal rules of eukaryotic translation initiation fidelity. PLoS Comput Biol. 2013, 9:e1003136. doi: 10.1371/journal.pcbi.1003136 . Meka H, Werner F, Cordell SC, Onesti S, Brick P. Crystal structure and RNA binding of the Rpb4/Rpb7 subunits of human RNA polymerase II. Nucleic Acids Res. 2005, 33:6435–44. doi: 10.1093/nar/gki945 . Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31:3568–71. doi: 10.1093/nar/gkg616 . Smith PJ, Zhang C, Wang J, Chew SL, Zhang MQ, Krainer AR. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet. 2006, 15:2490–508. doi: 10.1093/hmg/ddl171 . Lim KH, Ferraris L, Filloux ME, Raphael BJ, Fairbrother WG. Using positional distribution to identify splicing elements and predict pre-mRNA processing defects in human genes. Proc Natl Acad Sci U S A. 2011, 108:11093–8. doi: 10.1073/pnas.1101135108 . Liebhaber SA, Cash F, Eshleman SS. Translation inhibition by an mRNA coding region secondary structure is determined by its proximity to the AUG initiation codon. J Mol Biol. 1992, 226:609–21. doi: 10.1016/0022-2836(92)90619-u . Boczonadi V, Müller JS, Pyle A, Munkley J, Dor T, Quartararo J, et al. EXOSC8 mutations alter mRNA metabolism and cause hypomyelination with spinal muscular atrophy and cerebellar hypoplasia. Nat Commun. 2014, 5:4287. doi: 10.1038/ncomms5287 . Burns DT, Donkervoort S, Müller JS, Knierim E, Bharucha-Goebel D, Faqeih EA, et al. Variants in EXOSC9 Disrupt the RNA Exosome and Result in Cerebellar Atrophy with Spinal Motor Neuronopathy. Am J Hum Genet. 2018, 102:858–873. doi: 10.1016/j.ajhg.2018.03.011 . Bizzari S, Hamzeh AR, Mohamed M, Al-Ali MT, Bastaki F. Expanded PCH1D phenotype linked to EXOSC9 mutation. Eur J Med Genet. 2020, 63:103622. doi: 10.1016/j.ejmg.2019.01.012 . Somashekar PH, Kaur P, Stephen J, Guleria VS, Kadavigere R, Girisha KM, et al. Bi-allelic missense variant, p.Ser35Leu in EXOSC1 is associated with pontocerebellar hypoplasia. Clin Genet. 2021, 99:594–600. doi: 10.1111/cge.13928 . Zaki MS, Abdel-Ghafar SF, Abdel-Hamid MS. A missense variant in EXOSC8 causes exon skipping and expands the phenotypic spectrum of pontocerebellar hypoplasia type 1C. J Hum Genet. 2024, 69:79–84. doi: 10.1038/s10038-023-01207-4 . Fasken MB, Losh JS, Leung SW, Brutus S, Avin B, Vaught JC, et al. Insight into the RNA Exosome Complex Through Modeling Pontocerebellar Hypoplasia Type 1b Disease Mutations in Yeast. Genetics. 2017, 205:221–237. doi: 10.1534/genetics.116.195917 . Damseh NS, Obeidat AN, Ahammed KS, Al-Ashhab M, Awad MA, van Hoof A. Pontocerebellar hypoplasia associated with p.Arg183Trp homozygous variant in EXOSC1 gene: A case report. Am J Med Genet A. 2023, 191:1923–1928. doi: 10.1002/ajmg.a.63198 . Srinivasan S, He X, Mirza S, Mager J. Exosome complex components 1 and 2 are vital for early mammalian development. Gene Expr Patterns. 2024, 51:119346. doi: 10.1016/j.gep.2023.119346 . Chen JL, VanEtten DM, Fountain MA, Yildirim I, Disney MD. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington’s Disease and Myotonic Dystrophy Type 1. Biochemistry. 2017, 56:3463–3474. doi: 10.1021/acs.biochem.7b00252 . Broniarek I, Niewiadomska D, Sobczak K. Contribution of DNA/RNA Structures Formed by Expanded CGG/CCG Repeats Within the FMR1 Locus in the Pathogenesis of Fragile X-Associated Disorders. Wiley Interdiscip Rev RNA. 2024, 15:e1874. doi: 10.1002/wrna.1874 . Bartoszewski R, Rab A, Jurkuvenaite A, Mazur M, Wakefield J, Collawn JF, et al. Activation of the unfolded protein response by deltaF508 CFTR. Am J Respir Cell Mol Biol. 2008, 39:448–57. doi: 10.1165/rcmb.2008-0065OC . Doma MK, Parker R. Endonucleolytic cleavage of eukaryotic mRNAs with stalls in translation elongation. Nature. 2006, 440:561–4. doi: 10.1038/nature04530 . Sakamoto M, Iwama K, Sekiguchi F, Mashimo H, Kumada S, Ishigaki K, et al. Novel EXOSC9 variants cause pontocerebellar hypoplasia type 1D with spinal motor neuronopathy and cerebellar atrophy. J Hum Genet. 2021, 66:401–407. doi: 10.1038/s10038-020-00853-2 . Wan J, Yourshaw M, Mamsa H, Rudnik-Schöneborn S, Menezes MP, Hong JE, et al. Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration. Nat Genet. 2012, 44:704–8. doi: 10.1038/ng.2254 . Biancheri R, Cassandrini D, Pinto F, Trovato R, Di Rocco M, Mirabelli-Badenier M, et al. EXOSC3 mutations in isolated cerebellar hypoplasia and spinal anterior horn involvement. J Neurol. 2013, 260:1866–70. doi: 10.1007/s00415-013-6896-0 . Rudnik-Schöneborn S, Senderek J, Jen JC, Houge G, Seeman P, Puchmajerová A, et al. Pontocerebellar hypoplasia type 1: clinical spectrum and relevance of EXOSC3 mutations. Neurology. 2013, 80:438–46. doi: 10.1212/WNL.0b013e31827f0f66 . Eggens VR, Barth PG, Niermeijer JM, Berg JN, Darin N, Dixit A, et al. EXOSC3 mutations in pontocerebellar hypoplasia type 1: novel mutations and genotype-phenotype correlations. Orphanet J Rare Dis. 2014, 9:23. doi: 10.1186/1750-1172-9-23 . Schottmann G, Picker-Minh S, Schwarz JM, Gill E, Rodenburg RJT, Stenzel W, et al. Recessive mutation in EXOSC3 associates with mitochondrial dysfunction and pontocerebellar hypoplasia. Mitochondrion. 2017, 37:46–54. doi: 10.1016/j.mito.2017.06.007 . Nuovo S, Micalizzi A, Romaniello R, Arrigoni F, Ginevrino M, Casella A, et al. Refining the mutational spectrum and gene-phenotype correlates in pontocerebellar hypoplasia: results of a multicentric study. J Med Genet. 2022, 59:399–409. doi: 10.1136/jmedgenet-2020-107497 . Szeto CH, Rubin S, Sidlow R. Homozygous EXOSC3 c.395A > C Variants in Pontocerebellar Hypoplasia Type 1B: A Sibling Pair With Childhood Lethal Presentation and Literature Review. Cureus. 2023, 15:e39226. doi: 10.7759/cureus.39226 . Halevy A, Lerer I, Cohen R, Kornreich L, Shuper A, Gamliel M, et al. Novel EXOSC3 mutation causes complicated hereditary spastic paraplegia. J Neurol. 2014, 261:2165–9. doi: 10.1007/s00415-014-7457-x . Yang X, Bayat V, DiDonato N, Zhao Y, Zarnegar B, Siprashvili Z, et al. Genetic and genomic studies of pathogenic EXOSC2 mutations in the newly described disease SHRF implicate the autophagy pathway in disease pathogenesis. Hum Mol Genet. 2020, 29:541–553. doi: 10.1093/hmg/ddz251 . Additional Declarations There is no duality of interest Supplementary Files YamadaEXOSC2EJHGSupp.pdf Supplemental material Cite Share Download PDF Status: Under Review Version 1 posted Reviewer # 3 agreed at journal 14 Apr, 2026 Review # 1 received at journal 04 Apr, 2026 Review # 2 received at journal 25 Mar, 2026 Reviewer # 2 agreed at journal 13 Mar, 2026 Reviewer # 1 agreed at journal 10 Mar, 2026 Reviewers invited by journal 10 Mar, 2026 Submission checks completed at journal 06 Mar, 2026 Editor assigned by journal 05 Mar, 2026 First submitted to journal 05 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9039053","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":603855293,"identity":"d418da4f-53a6-4ce4-ab7e-7d1355e6ca2f","order_by":0,"name":"Shin Hayashi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCElEQVRIiWNgGAWjYDACCcYGBiACAh6GAx8MIAwgYCNOy8EZBiCKoBYghmlh5mGAa8EN5Gc3tz1g3GGX2N9/9uBhm4I79vYMvIc//GDgy8OlxeDOwXYDxjPJiTNu5CUczjF4ltjDwJcm2cPAVoxTi0Rim/TfNubEhhs8BkAthxN45N+YMQP9ktiAy2EzEtskGNvqE+efP2Nw2MLgsD3QL8af8WlhuAHWcjhxwwGgFQwGhxl7GHgMpPFpMYBoOW688UaOwcEeg8OJPQd4zCR7DHD7RX5G+jOglmrZeefPGH/48eewPXsDD5BRcQxniMGAI5ozDI4lENJijy5QQ1DLKBgFo2AUjBgAALcXVxYVcVHbAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-0644-5890","institution":"Institute for Developmental Research, Aichi Developmental Disability Center","correspondingAuthor":true,"prefix":"","firstName":"Shin","middleName":"","lastName":"Hayashi","suffix":""},{"id":603855294,"identity":"e3090e5d-29ad-4903-8881-a7d7123bb2a1","order_by":1,"name":"Kenichiro Yamada","email":"","orcid":"https://orcid.org/0000-0003-0486-284X","institution":"Institute for Developmental Research, Aichi Developmental Disability Center","correspondingAuthor":false,"prefix":"","firstName":"Kenichiro","middleName":"","lastName":"Yamada","suffix":""},{"id":603855295,"identity":"d51c0560-b5e0-48db-82a1-b0bfbd263278","order_by":2,"name":"Takuma Mori","email":"","orcid":"https://orcid.org/0000-0002-4195-2804","institution":"Institute for Developmental Research, Aichi Developmental Disability Center","correspondingAuthor":false,"prefix":"","firstName":"Takuma","middleName":"","lastName":"Mori","suffix":""},{"id":603855296,"identity":"684969e7-fd5d-48b6-a593-02e85a754838","order_by":3,"name":"Yasuyo Suzuki","email":"","orcid":"","institution":"Institute for Developmental Research, Aichi Developmental Disability Center","correspondingAuthor":false,"prefix":"","firstName":"Yasuyo","middleName":"","lastName":"Suzuki","suffix":""},{"id":603855297,"identity":"b071e17b-ae3f-49fa-bce1-64ad97069941","order_by":4,"name":"Yosuke Nishio","email":"","orcid":"https://orcid.org/0000-0003-3543-7491","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yosuke","middleName":"","lastName":"Nishio","suffix":""},{"id":603855298,"identity":"8bc707bf-63af-4c4c-915a-4d183b32908a","order_by":5,"name":"TOMOO OGI","email":"","orcid":"https://orcid.org/0000-0002-5492-9072","institution":"Nagoya University","correspondingAuthor":false,"prefix":"","firstName":"TOMOO","middleName":"","lastName":"OGI","suffix":""},{"id":603855299,"identity":"2cc3ff68-a6a7-4083-a139-99889f018cd5","order_by":6,"name":"Mie Inaba","email":"","orcid":"","institution":"Central Hospital, Aichi Developmental Disability Center","correspondingAuthor":false,"prefix":"","firstName":"Mie","middleName":"","lastName":"Inaba","suffix":""}],"badges":[],"createdAt":"2026-03-05 10:28:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9039053/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9039053/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104593727,"identity":"ae7705b5-35de-47ef-af0b-3c07bc20ff43","added_by":"auto","created_at":"2026-03-13 17:42:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":722268,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eClinical information of the patient. A.\u003c/strong\u003e Growth chart of the proband. \u003cstrong\u003eB.\u003c/strong\u003e Brain CT at three years and ten months old. Yellow arrowheads indicate the calcification of the white matter and basal ganglia. \u003cstrong\u003eC.\u003c/strong\u003e Brain MRI at three years and six months. The yellow arrow in the left panel indicates the hypoplastic cerebellum, and the yellow arrow in the right panel indicates the hypoplastic vermis. CT, computed tomography; MRI, magnetic resonance imaging\u003c/p\u003e","description":"","filename":"YamadaEXOSC2EJHGFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-9039053/v1/3409e23556d94b833307259e.png"},{"id":104593731,"identity":"efa4d574-8449-49f2-93a2-b1d6eecaa608","added_by":"auto","created_at":"2026-03-13 17:42:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1785949,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBoth of the ‘missence’ variants decreased EXOSC2 expression. A.\u003c/strong\u003e Two variants of \u003cem\u003eEXOSC2\u003c/em\u003e in the pedigree of the proband and parents. \u003cstrong\u003eB.\u003c/strong\u003e Scheme of the gene structure and \u003cem\u003eEXOSC2 \u003c/em\u003evariants. (Upper panel) Scheme of the construct for the minigene assay, the length of which is 1,948 bp. The boxes and lines indicate exons 3-5 and introns 3 and 4 of \u003cem\u003eEXOSC2\u003c/em\u003e, respectively. The green box in exon 4 indicates S106. The filled triangles denote the primer set used for the amplification of the minigene construction. (Lower panel) Scheme of the expression vector of EXOSC2, including 69 bp-upstream of the first methionine. The three yellow boxes indicate the first, third, and fifth methionines. The red box denotes the stop codon. \u003cstrong\u003eC.\u003c/strong\u003e Western blotting results comparing the expression of EXOSC2 in the LCL of four healthy controls (C1-C4) and the proband. α-tubulin served as a loading control. Representative blots from three independent experiments are shown. The bar chart shows the relative expression amount of EXOSC2. The results of the western blot analysis were statistically analyzed using an unpaired t-test. ***P \u0026lt; 0.001. \u003cstrong\u003eD. \u003c/strong\u003eQuantitative PCR results measuring the mRNA levels of EXOSC2 in LCL of the patient and the controls. The expression level of total EXOSC2 mRNA was measured using primers designed to amplify between exons 2 and 4 (\u003cstrong\u003eTable S1\u003c/strong\u003e). Gene expression was normalized using TATA-box binding protein (TBP). The HPRT1 gene was used as an internal control. Data are shown as the means ± standard error of the mean (SEM) (n = 3) and analyzed by an unpaired t-test. ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"YamadaEXOSC2EJHGFig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-9039053/v1/6c34db6b3f6d0798a4cba544.png"},{"id":104593730,"identity":"27fd26da-335d-4404-abfc-f1bc51fc11d7","added_by":"auto","created_at":"2026-03-13 17:42:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":279561,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDetailed functional analyses of the two variants. A. \u003c/strong\u003eRT-PCR on LCL of the proband and the parents using primer sets designed for EXOSC2 between exons 1 and 5 (\u003cstrong\u003eTable S1\u003c/strong\u003e). Direct sequencing revealed that the shorter product was found only in the mother, and the proband skipped exon 4. C: control; F: father; M: mother; P: proband; m: marker. \u003cstrong\u003eB.\u003c/strong\u003e RT-PCR after the transfection of the minigene constructs of the WT or variants at the S106 into HEK293 cells. Direct sequencing confirmed that the upper band indicates a 334-bp product including exons 3, 4, and 5, and the lower band indicates a 244-bp product skipping exon 4, which was strongly expressed only in the Var.1. Var. 1: c.317C\u0026gt;T (p.S106L); Var. 2: c.316T\u0026gt;C (p.S106P); Var. 3: c.318G\u0026gt;A (p.S106S);m: marker. \u003cstrong\u003eC, D.\u003c/strong\u003e Subcloned WT and each variant of EXOSC2 with an HA tag are expressed in HEK293 cells. EXOSC2 expression was detected using RT-PCR (\u003cstrong\u003eC, Table S1\u003c/strong\u003e) and Western blotting using anti-HA-tag antibodies (\u003cstrong\u003eD\u003c/strong\u003e). The expression of \u003cem\u003eEXOSC2\u003c/em\u003e of WT and those with each variant. Data was analyzed using one-way ANOVA. *P \u0026lt; 0.05. Statistical analyses were performed with the KyPlot 6.0 free program (KyensLab, Tokyo, Japan) and the GraphPad Prism 10.3.1 software (GraphPad Software Inc, CA). Var. 4: c.14T\u0026gt;G (ATG\u0026gt;AGG); Var. 5: c.13_15delinsCGC (ATG\u0026gt;CGC); Var. 6: c.14_15delinsGA (ATG\u0026gt;AGA); m: marker.\u003c/p\u003e","description":"","filename":"YamadaEXOSC2EJHGFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-9039053/v1/a9fd02d4cf71ab8321525c84.png"},{"id":104781563,"identity":"3ce99c19-d472-4450-9cd5-d93018302b11","added_by":"auto","created_at":"2026-03-17 07:55:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3847833,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9039053/v1/0a765d38-6be1-4a8f-8514-a105f2cbc5b8.pdf"},{"id":104593728,"identity":"4abf3858-dd7d-4be8-a73c-56ac4ca15c65","added_by":"auto","created_at":"2026-03-13 17:42:51","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1395040,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental material\u003c/p\u003e","description":"","filename":"YamadaEXOSC2EJHGSupp.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9039053/v1/cec90ac08f50086b95d5aeb0.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"Compound heterozygosity of \u003ci\u003eEXOSC2\u003c/i\u003e ‘missense’ variants causes a bi-allelic decrease in protein expression through novel unexpected pathomechanisms","fulltext":[{"header":"Introduction","content":"\u003cp\u003eInterpretation of a missense variant can be challenging when determining the pathogenicity of a variant of uncertain significance (VUS) in genetic disorders, since missense variants can cause various genetic effects, including loss of function, gain of function, or no effect on function. According to the guidelines by the American College of Medical Genetics [Ref. 1], the estimation of missense variants depends on previous cases, functional analysis, genomic database, or \u003cem\u003ein silico\u003c/em\u003e prediction. Although multiple \u003cem\u003ein silico\u003c/em\u003e predictors are currently available [Ref. 2], their results are often controversial, and functional analysis for the VUS is still required to understand the actual pathomechanism.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eEXOSC2\u003c/em\u003e gene [MIM: *602238] encodes a component of the RNA exosome complex. Nine EXOSC family genes, \u003cem\u003eEXOSC1\u003c/em\u003e to \u003cem\u003eEXOSC9\u003c/em\u003e, encode components of the RNA exosome complex and are responsible for degrading various types of RNA. Some of them, \u003cem\u003eEXOSC1\u003c/em\u003e, \u003cem\u003eEXOSC2\u003c/em\u003e, \u003cem\u003eEXOSC3\u003c/em\u003e, \u003cem\u003eEXOSC8\u003c/em\u003e, and \u003cem\u003eEXOSC9\u003c/em\u003e, are known to cause genetic disorders with similar phenotypes, particularly intellectual disability (ID), microcephaly, and pontocerebellar hypoplasia (PCH) [Ref. 3]. However, few cases have been reported regarding \u003cem\u003eEXOSC2\u003c/em\u003e [Ref. 4]. Additionally, since most pathogenic variants of the EXOSC family genes are missense, it is difficult to determine the pathogenicity of a novel variant. In this study, we functionally analyzed two novel variants composing a compound heterozygosity of \u003cem\u003eEXOSC2\u003c/em\u003e, and clarified that each variant decreased EXOSC2 protein expression through different novel pathomechanisms, although both variants appeared \u0026lsquo;missense.\u0026rsquo;\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003eThe proband was a six-year-seven-month old boy with ID, developmental delay, epilepsy, and multiple congenital dysmorphologies (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). His parents were not consanguineous, and there was no notable family history. He was conceived by \u003cem\u003ein vitro\u003c/em\u003e fertilization as the second boy of two siblings and was born at 33 weeks. His birth weight was 1,688 g (-1.1 standard deviation [SD]), height was 42 cm (-0.6 SD), and occipitofrontal circumference (OFC) was 29.1 cm (-0.7 SD) at birth. He had hypocalcemia during the perinatal period and was diagnosed with hypoparathyroidism and given oral calcium lactate. He had an episode of absence seizure after six months, afebrile convulsion at 21 months, and recurrent multiple febrile convulsions; however, no electroencephalogram abnormalities were noted. He has been checked up at our hospital since he was one year old. His development has been markedly retarded: he has never held his head up yet, and he could roll over at two years old. His growth was remarkably retarded: at 6 years and 5 months, his weight was 9.6 kg (-4.2 SD), height was 91 cm (-5.7 SD), and OFC was 45 cm (-4.4 SD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Physical examination revealed sparse hair, small \u003cem\u003eala nasi\u003c/em\u003e, thin auricle, right retractile testis, and micropenis. Neurological findings showed hypertonia, athetosis of the upper limb, and a positive Babinski reflex. A computed tomography scan of the brain at three years and ten months showed a calcification in the white matter and basal ganglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Magnetic resonance imaging of the brain at three years and six months showed hypoplastic cerebellar hemisphere and vermis, while brainstem and corpus callosum were not hypoplastic (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). His karyotype was 46,XY. DNA was extracted from peripheral blood by standard methods. A lymphoblastoid cell line (LCL) was also established for the patients and parents by infecting lymphocytes with an Epstein-Barr virus, as previously described [Ref. 5].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe current and previous studies of the EXOSC family genes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"18\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDisor-der\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c6\" namest=\"c3\"\u003e \u003cp\u003eGenetic findings\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c11\" namest=\"c7\"\u003e \u003cp\u003eClinical findings\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"6\" nameend=\"c17\" namest=\"c12\"\u003e \u003cp\u003eBrain CT or MRI findings\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVariant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eZygos-ity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNo. of families\u003c/p\u003e \u003cp\u003e(individ-uals)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFunctional analysis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eSei-zures\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eFacial \u003c/p\u003e \u003cp\u003edys-morph-ism\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eMIC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eHypo-\u003c/p\u003e \u003cp\u003etonia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003eCBH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003ePH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003eCEA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003eCCH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003eMA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eEXOSC1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCH type 1F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.104C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.S35L)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (fibroblast)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.547C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.R183W)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (yeast)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cb\u003eEXOSC8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003ePCH type 1C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.815 G\u0026thinsp;\u0026gt;\u0026thinsp;C (p.S272T)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2 (20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (myoblast)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eNA\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.5C\u0026thinsp;\u0026gt;\u0026thinsp;T \u003c/p\u003e \u003cp\u003e(p.A2V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (fibroblast)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003eNA\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ep.V80I\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eExon5-skipping causing early termination\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eEXOSC9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ePCH type 1D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.41T\u0026thinsp;\u0026gt;\u0026thinsp;C \u003c/p\u003e \u003cp\u003e(p.L14P)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (fibroblast)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.41T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.L14P)/\u003c/p\u003e \u003cp\u003ec.481C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.R161*)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eNP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.239T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.L80R)/\u003c/p\u003e \u003cp\u003ec.484dupA (p.R162Lfs*3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eNP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.151G\u0026thinsp;\u0026gt;\u0026thinsp;C (p.G51R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eNP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eEXOSC3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003ePCH type 1B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.395A\u0026thinsp;\u0026gt;\u0026thinsp;C (p.D132A)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14 (22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eNP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.92G\u0026thinsp;\u0026gt;\u0026thinsp;C (p.G31A)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5 (6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eProtein W238R is unstable and suppresses cell growth, but G31A and G191C do not (yeast) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.92G\u0026thinsp;\u0026gt;\u0026thinsp;C (p.G31A)/\u003c/p\u003e \u003cp\u003ec.712T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.W238R)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.571G\u0026thinsp;\u0026gt;\u0026thinsp;T (p.G191C)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cb\u003eEXOSC2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.89G\u0026thinsp;\u0026gt;\u0026thinsp;T (p.G30V)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eG198D decreases protein levels but G30V doesn't (LCL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+/-*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.89G\u0026thinsp;\u0026gt;\u0026thinsp;T (p.G30V)/\u003c/p\u003e \u003cp\u003ec.593G\u0026thinsp;\u0026gt;\u0026thinsp;A \u003c/p\u003e \u003cp\u003e(p.G198D)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHom\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e\u003cem\u003eNA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e+/-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ec.14T\u0026thinsp;\u0026gt;\u0026thinsp;G \u003c/p\u003e \u003cp\u003e(p.M5R)pat/\u003c/p\u003e \u003cp\u003ec.317C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003cp\u003e(p.S106L)mat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1 (1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMutant protein is significantly reduced (LCL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eHyper-tonia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003ePresent case\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e\u003cstrong\u003eNote:\u0026nbsp;\u003c/strong\u003eDD, developmental delay; MIC, microcephaly; BC, Brain calcification; CBH, cerebellar hypoplasia; PH, pontine hypoplasia; CEA, Cerebral atrophy; CCH, Corpus callosum hypoplasia; MA, Myelination abnormalities; CH, Compound heterozygosity; Hom, Homozigosity; *, present in some cases; ++, severe; +/-, mild; \u003cem\u003eNA\u003c/em\u003e, not available; \u003cem\u003eNP\u003c/em\u003e, not performed\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eWhole exome sequencing\u003c/h2\u003e \u003cp\u003eFor whole exome sequencing performed in the Initiative on Rare and Undiagnosed Diseases (IRUD) program, exonic regions were enriched and sequenced with 150 bp paired-end reads, achieving an average coverage of 100\u0026times; across the targeted exome. Alignment and variant calling were performed using BWA-MEM and the Genome Analysis Toolkit (GATK v3.5) following GATK Best Practices, with the Human Reference Genome hs37d5. We included only rare variants with minor allele frequency (MAF)\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and the subsequent filtering processes were performed using an inhouse database.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReverse Transcription (RT)‑PCR and Real-time PCR Analysis\u003c/h3\u003e\n\u003cp\u003eRT-PCR was performed as described previously [Ref. 6]. Briefly, total RNA was extracted from LCLs derived from the patients and three controls using RNeasy Micro Kit (QIAGEN, Hilden, Germany). The RNA was reverse transcribed using ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). The synthesized cDNA was amplified by PCR with specific primer sets for \u003cem\u003eEXOSC2\u003c/em\u003e between exons 1 and 5 (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). PCR products were electrophoresed on an agarose gel.\u003c/p\u003e \u003cp\u003eReal-time PCR was performed as described previously [Ref. 7]. Briefly, gene expression levels were quantified by real-time PCR using a THUNDERBIRD Next SYBR qPCR Mix (Toyobo). Relative RNA levels were normalized to the expression of TATA box binding protein (\u003cem\u003eTBP\u003c/em\u003e), a stable housekeeping gene. The hypoxanthine phosphoribosyl-transferase I (\u003cem\u003eHPRT1\u003c/em\u003e) was used as an internal control [Ref. 8]. The primer sequences used for real-time PCR are listed in \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e.\u003c/p\u003e\n\u003ch3\u003eWestern blotting\u003c/h3\u003e\n\u003cp\u003eLymphoblastoid cells or transfected HEK293 cells were homogenized in extraction buffer containing 25 mM Tris/HCl (pH 7.5), 150 mM NaCl and 1:1000-diluted Protease Inhibitor Cocktail (Sigma-Aldrich). The homogenate was sonicated using SONIFIER 250 (BRANSON, Danbury, CT). Aliquots containing 10 \u0026micro;g of extracted protein were separated via 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The resolved proteins were transferred to Immobilon-P polyvinylidene fluoride membranes (Millipore, Billerica, MA) blocked with a mixture of 2% BSA, 10 mM Phosphate buffer (pH 7.5), and 100 mM NaCl at room temperature for 30 min and incubated with antibodies, EXOSC2 (1:10,000; Proteintech), α-tubulin (1:6000; Sigma-Aldrich), HA tag (1:10,000; HA-7, Abcam) overnight at 4\u0026deg;C. After incubation with a horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG secondary anti-body (1:10,000; Promega, Madison, WI, 1:10,000; Medical \u0026amp; Biological Laboratories, Nagoya, Japan), the signals were visualized using Western Lighting Chemiluminescence Reagent Plus (Perkin-Elmer, Boston, MA) and quantified using ImageQuant TL (Cytiva, Marlborough, MA). The efficiency of the transfection was verified by measuring β-galactosidase activity using o-nitrophenyl-β-D-galactopyranoside as the substrate [Ref. 9].\u003c/p\u003e\n\u003ch3\u003eMinigene analysis\u003c/h3\u003e\n\u003cp\u003eA minigene splicing assay was performed to evaluate the effect of the variant on RNA splicing, as previously described [Refs. 4, 5]. Briefly, the genome fragments containing exons 3\u0026ndash;5 of \u003cem\u003eEXOSC2\u003c/em\u003e (1,948 bp) were amplified using Tks Gflex DNA Polymerase (Takara Bio) with primers (\u003cb\u003eFig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e, \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e) from genomic DNA of healthy control and patient. The fragments were subcloned into pGEM-T easy vector, and sequences were confirmed. The fragments were subcloned into pCI-neo expression vector (Promega) at EcoRI site. The p.S106P (TCG\u0026thinsp;\u0026gt;\u0026thinsp;CCG) and p.S106S (TCG\u0026thinsp;\u0026gt;\u0026thinsp;TCA) variant minigenes were generated from WT minigene construct as a template using Tks Gflex DNA Polymerase with primer pairs (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). The PCR products were ligated to themselves at both ends and sequenced. The minigene constructs were transiently transfected into HEK293 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA). Forty-eight hours later, total RNA was extracted using the RNeasy Micro Kit (QIAGENE), and total RNA (3 \u0026micro;g) was reverse transcribed using First-Strand cDNA Synthesis Kit (Cytiva). PCR amplification was carried out with AmpliTaq-Gold (Applied Biosystems, Foster City, CA) with primer pair (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e).\u003c/p\u003e\n\u003ch3\u003eConstruction of EXOSC2-HA expression vectors\u003c/h3\u003e\n\u003cp\u003eEXOSC2 cDNA fragments were amplified from first-strand cDNA prepared from the lymphoblastoid cell of father by using a specific primer pair (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). Fragments were subcloned into pGEM-T easy vector, and sequences were confirmed. As a result, both wild-type and c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) clones were obtained. These fragments contained 69-bp upstream region from ATG start codon. These fragments were subcloned into the EcoRI/XbaI sites of the p3XFLAG (E4901; Sigma-Aldrich). Original HA tag fragment (GGATCCTACCCATACGATGTTCCAGATTACGCTTGATGCATTGGGCCCGGGATCC) was inserted into BamHI site of these clones. These expression vectors contained a termination codon (TGA) upstream of a 3\u0026times;FLAG-tag sequence. The other nucleotide changes coding methionine to arginine (termed Var 5, ATG\u0026thinsp;\u0026gt;\u0026thinsp;CGC and Var 6, ATG\u0026thinsp;\u0026gt;\u0026thinsp;AGA) were generated from WT construct as a template using Tks Gflex DNA Polymerase with primer pairs (\u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn silico\u003c/b\u003e \u003cb\u003estructural modeling and evaluation of\u003c/b\u003e \u003cb\u003eEXOSC2\u003c/b\u003e \u003cb\u003evariants\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA structural model of the nuclear exosome-MTR4, an RNA helicase complex from RCSB protein data bank [PDB: 6D6Q] [Ref. 10] was used to predict the effect of protein variants of Exosc2 in the complex. FoldX [ver. 5.0, SCR_008522] [Ref. 11] was used to estimate the change of stability of the protein upon mutation. FoldX repaired the protein structure to the most stable state, and the repaired file was used to evaluate the instability of the missense variants (M5R or S106L) of Exosc2. The repaired pdb files was imported into PyMOL [Ref. 12] and visualized.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eWES identified a compound heterozygosity consisting of two \u0026ldquo;missense\u0026rdquo; variants of\u003c/b\u003e \u003cb\u003eEXOSC2\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe extracted variants found only in the proband or variants consisting of compound heterozygosity, and identified two missense variants in \u003cem\u003eEXOSC2\u003c/em\u003e as candidate causative variants: paternally-inherited NM_001282708.1:c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.Met5Arg) at exon 1 and maternally-inherited NM_001282708.1:c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Ser106Leu) at exon 4 (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The variants were confirmed by Sanger sequencing (\u003cb\u003eFig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). The amino acids surrounding the variants were well-conserved among species (\u003cb\u003eFig. S2\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eThe expression of EXOSC2 in the patient's LCL was significantly decreased\u003c/h3\u003e\n\u003cp\u003eTo interpret the significance of the variants, performed western blotting analysis using the EXOSC2 antibody, demonstrating that the amount of EXOSC2 protein in the patient\u0026rsquo;s LCL was 27.6% lower compared to four healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). We also confirmed that \u003cem\u003eEXOSC2\u003c/em\u003e mRNA expression in the patient\u0026rsquo;s LCL was approximately 68% (p\u0026thinsp;\u0026lt;\u0026thinsp;0.02) that of LCLs of three controls via quantitative polymerase chain reaction (PCR) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn silico\u003c/b\u003e \u003cb\u003epredictions of the variants and estimation of protein structure change\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThese findings suggested that both alleles of \u003cem\u003eEXOSC2\u003c/em\u003e were pathogenic; thus, we evaluated the effect of each missense variant. First, we estimated the pathogenicity of the variants using several \u003cem\u003ein silico\u003c/em\u003e predictors, which revealed controversial results (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Some predictors, for example, PolyPhen-2 or Alphamissense, judged c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G as \u0026lsquo;benign,\u0026rsquo; while other predictors like PROVEAN and SIFT deemed it as \u0026lsquo;Pathogenic.\u0026rsquo; Although c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T was more likely to be judged as \u0026lsquo;Pathogenic,\u0026rsquo; SpliceAI did not predict it to change the splicing (\u003cb\u003eTable S2\u003c/b\u003e). Next, we evaluated the effect of the missense variants on the three-dimensional structure. We obtained the whole structure of the human nuclear exosome-MTR4 RNA complex from the Protein Data Bank (ID: 6D6Q) [Ref. 13], and introduced one of the two missense variants to the exosome complex to investigate the impact of the variants on the RNA exosome complex. We first investigated the locations of the two substituted amino acids in the exosome complex (\u003cb\u003eFig. S3A\u003c/b\u003e) and observed that M5 was located adjacent to the EXOSC7 protein (\u003cb\u003eFig. S3B\u003c/b\u003e), and that S106 was facing the RNA (\u003cb\u003eFig. S3C\u003c/b\u003e). Next, we introduced the M5R variant and found that the substitution of arginine caused the slight instability of the EXOSC2 protein, although Alphamissense and Rosetta estimated that the M5R may not affect the stability of the protein (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The substitution also produced additional polar bonds between \u003cem\u003eEXOSC2\u003c/em\u003e and \u003cem\u003eEXOSC7\u003c/em\u003e in the complex (\u003cb\u003eFig. S3D\u003c/b\u003e). Meanwhile, the S106L variant did not cause a change in the protein stability calculated by FoldX (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e); however, Alphamissense classified the S106L as a pathogenic variant of \u003cem\u003eEXOSC2\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The substituted leucine lost a predicted polar bond between the beta sheets facing RNA (\u003cb\u003eFig. S3E\u003c/b\u003e). That is, these results were controversial and were not definitive conclusion for the determination of the pathigenicities of the variants. In total, our \u003cem\u003ein silico\u003c/em\u003e simulation indicated that the protein variants might have caused the instability and structural change of the EXOSC2 protein in the RNA exosome complex, with discrepancies in the results.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eVariants of EXOSC2 and \u003cem\u003ein silico\u003c/em\u003e predictions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"18\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026times;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVariant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAssembly\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003edbSNP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMAF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCADD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eREVEL\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c8\" namest=\"c7\"\u003e \u003cp\u003ePolyPhen-2\u003csup\u003ea)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003ePROVEAN\u003csup\u003eb)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c12\" namest=\"c11\"\u003e \u003cp\u003eSIFT\u003csup\u003ec)\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c14\" namest=\"c13\"\u003e \u003cp\u003eAlphaMissense\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c16\" namest=\"c15\"\u003e \u003cp\u003eRosetta\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c18\" namest=\"c17\"\u003e \u003cp\u003eFoldX 5.1\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNM_001282708.1:c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G \u003c/p\u003e \u003cp\u003e(p.Met5Arg)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGRCh38/hg38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ers769145406\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e6.222 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e24.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.131\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.039\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eBenign\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-2.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eDeleterious\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eDamaging\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c13\"\u003e \u003cp\u003e0.336\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003elikely benign\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c15\"\u003e \u003cp\u003e11.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003eStable\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c17\"\u003e \u003cp\u003e4.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003eSlightly instable\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNM_001282708.1:c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T \u003c/p\u003e \u003cp\u003e(p.Ser106Leu)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGRCh38/hg38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ers150081500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026times;\" colname=\"c4\"\u003e \u003cp\u003e9.912 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e29.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.704\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.999\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eProbably damaging\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e-5.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003eDeleterious\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c11\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003eDamaging\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c13\"\u003e \u003cp\u003e0.926\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003elikely pathogenic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c15\"\u003e \u003cp\u003e0.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003eStable\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c17\"\u003e \u003cp\u003e-0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003eStable\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eNote:\u0026nbsp;\u003c/strong\u003ea) Only amino acid change is available \u0026nbsp; b) Cutoff = -2.5 \u0026nbsp;c) Cutoff = 0.05\u003c/p\u003e\n\u003ch3\u003eThe variant, c.317C \u003e T (p.S106L), causes exon 4 skipping\u003c/h3\u003e\n\u003cp\u003eTo compensate for these discrepancies, we proceeded with \u003cem\u003ein vitro\u003c/em\u003e functional analysis of the variants. First, we performed reverse transcription (RT)-PCR on each LCL of the proband and the parents to amplify the all coding exons to investigate the significance of c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T. We found that a shorter PCR product was strongly expressed in the mother and the patient (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Sequence analysis of the short PCR product exhibited a skipping of exon 4 including c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T, comprising 90 nucleotides. Thus, the exon skipping probably occurred on an mRNA expressed from the maternal allele. Hence, the minigene assay producing exons 3 to 5 including introns 3 and 4 was performed to determine the effect of the c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T variant on RNA transcription (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). RT-PCR detected transcripts containing all the three exons from the cells transfected with the wild type (WT) allele, while the exon 4-skipping transcripts were strongly expressed in cells with the c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T variant (Var.1 in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Although skipping of the exon 4 causes an in-frame deletion of 30 amino acids, the predicted shorter protein was not identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), suggesting that the mutant protein is likely to be unstable.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese findings prompted us to hypothesize that c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T is not a mere missense mutation, but a functional nucleotide change, causing the exon splicing enhancer dysfunction. A few variants of S106 are registered in gnomAD, a genome database for healthy individuals: 16/1,614,142 alleles (MAF\u0026thinsp;=\u0026thinsp;9.912 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e) of the c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.S106L), 16/1,614,154 alleles (MAF\u0026thinsp;=\u0026thinsp;9.912 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e) of the c.316T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.S106P), and 2,086/1,614,142 alleles (MAF\u0026thinsp;=\u0026thinsp;1.292 \u0026times; 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e) of the c.318G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.S106S). Therefore, we prepared minigenes replicating the variants, c.316T\u0026thinsp;\u0026gt;\u0026thinsp;C and c.318G\u0026thinsp;\u0026gt;\u0026thinsp;A, and performed RT-PCR in the same manner. Interestingly, c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T certainly caused the exon 4-skipping, while the other variants caused slight skipping of the exon 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These findings exhibited that the exon 4 skipping was tightly dependent on c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T substitution, instead of the amino acid change. As a result, c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.S106L) variant of maternal allele caused decrease of EXOSC2 protein expression, and was thought to be pathogenic.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe variant, c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R), decreases protein expression in a nucleotide sequence-dependent manner.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eNext, we investigated the significance of the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G variant. RT-PCR using a primer set amplifying exon 1 containing c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) did not exhibit an aberrant transcript in the father (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Thus, we assessed the precise effect of the variant on \u003cem\u003eEXOSC2\u003c/em\u003e expression by transfecting the expression vector of the WT and c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G variant changing the codon ATG to AGG (Var. 4) with HA tag into HEK293. RT-PCR revealed the decreased transcript (Var. 4 in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, \u003cb\u003eTable \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e), which was concordant with the decreased \u003cem\u003eEXOSC2\u003c/em\u003e expression in the proband\u0026rsquo;s LCL (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), and western blotting confirmed the decreased protein of EXOSC2 in Var. 4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Therefore, the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) variant of the paternal allele was determined to be pathogenic. Additionally, we initially expected that the M3 and/or M5 may function as the first codon since the frst exon of \u003cem\u003eEXOSC2\u003c/em\u003e has the triple metionines, M1, M3, and M5, which appears to be a unique and unnatural structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) [Ref. 14]. However, no shorter protein than WT was detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), meaning the other methionines than the first one was not used as the start codon.\u003c/p\u003e \u003cp\u003eFurther analysis was performed to clarify the mechanism by which c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G decreased EXOSC2 protein expression. Since the N-terminal amino acid sequence of EXOSC2 does not contain any functional domains, it is unlikely to affect the protein function or protein stability. Thus, we generated expression constructs of two more synonymous codons coding arginine, CGC and AGA (Var. 5 and 6). We transfected the constructs into HEK293 and performed RT-PCR and western blotting. However, these codons did not decrease mRNA and EXOSC2 protein expression (Var. 5 and 6 in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). There is little difference in codon usage of human among the synonymous codons, AGG, CGC, and AGA (12.0, 10.4, 12.2/1000 codons, respectively, NCBI-GenBank Flat File Release 160.0), suggesting that AGG does not have an inherent difficulty in being translated. These findings revealed that the impaired expression of \u003cem\u003eEXOSC2\u003c/em\u003e was tightly dependent on the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G substitution, instead of the amino acid change. Subsequently, to estimate whether there is a mechanism to degrade mRNA depending on the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G substitution, we transfected a vector expressing a 78-bp short RNA fragment containing the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G variant and adjacent sequences with the EXOSC2-pM5R-HA expression vectors and measured the protein expression. The expression of the p.M5R protein was not recovered with decoy RNA fragments (Lane 6 in \u003cb\u003eFig. S5\u003c/b\u003e), suggesting that the expression was decreased as a result of translational inhibition, probably because of the change in the secondary structure of the mRNA, instead of degradation by the non-coding RNAs.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the current study, we successfully clarified two unexpected and different mechanisms decreasing the expression of EXOSC2, although they appear to be missense variants. Thus, the two variants are considered to compound biallelic decreasing of EXOSC2 which causes the patient\u0026rsquo;s phenotypes.\u003c/p\u003e \u003cp\u003eInitially, we expected the c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.S106L) was a missense variant which should affect the binding ability of EXOSC2 to RNA since the S106 was adjacent to V107 and L109, which were predicted as binding residues to RNA [Ref. 15]. However, the RT-PCR using LCL and the minigene assay clarified the c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T led to the exon 4 skipping (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Additionally, WT and other codon changes of S106, c.316T\u0026thinsp;\u0026gt;\u0026thinsp;C (p.S106P) and c.318G\u0026thinsp;\u0026gt;\u0026thinsp;A (p.S106S) variant registered in gnomAD as variants observed in healthy population, barely caused the exon 4-skipping (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Meanwhile, the faint products observed in WT and Var.3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) may suggest the exon 4 is likely to be skipped. Thus, we predicted an exon splicing enhancer using ESEfinder 3.0 [Refs. 16, 17]. As a result, only c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T lost the binding site of SF/ASF (IgM-BRCA1), which is required for the splicing (\u003cb\u003eFig. S4\u003c/b\u003e). The estimation was concordant with the result of the \u003cem\u003ein vitro\u003c/em\u003e analyses. These findings demonstrated that the exon skipping was highly dependent on the nucleotide substitution, c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T, instead of the residual change. The region of the EXOSC2 protein encoded by exon4, V91 to L120, are partially overlapped with an Rrp4 S1-like RNA-binding domain in R75 to L166. Thus, the mRNA skipping exon 4 is predicted to lack a functional RNA-binding domain. Although the exon 4-skipping is an in-frame mutation, the protein may be unstable and likely to be degraded as WB did not detect a shorter protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Although most pathogenic exonic variants are presumed to affect protein coding, approximately one-third of them are also reported to affect a splicing [Ref. 18]. Thus, an effect on splicing should be considered in deciphering significance and pathomechanisms of VUS.\u003c/p\u003e \u003cp\u003eNext, we interpreted the significance of the c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) variant. The variant decreased the expression of mRNA and protein depending on the nucleotide change instead of the amino acid change (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The transfected decoy mimicking the short fragment including c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G could not recover decrease of protein expression (\u003cb\u003eFig. S5\u003c/b\u003e), suggesting that the expression was decreased as a result of translational inhibition probably because of the change of secondary structure of mRNA, instead of a degradation by the non-coding RNAs. The residue M5 is close to the translational initiation site; thus, its change may likely impact the secondary structure of mRNA, affecting the initiation of translation and the translational efficiency [Ref. 19]. Repeat expansion diseases, such as fragile X syndrome [#300624], myotonic dystrophy Type 1 [#160900], amyotrophic lateral sclerosis and/or frontotemporal dementia [#105550], or Huntington disease [#143100], are known to decrease protein synthesis by the change in secondary structure of mRNA induced by the repeat expansion [Refs 20, 21]. This means that the structural change in mRNA impairs ribosomal translation and decreases protein expression, which should be pathogenic. As an example, other than the repeat expansion, the deletion of three nucleotides (ΔF508) in the CFTR gene [*602421] reportedly reduces mRNA [Ref. 22]. Ribosomes stalling in translation are recognized as targets of endonucleolytic cleavage, referred to as \u0026lsquo;no-go decay,\u0026rsquo; causing mRNA degradation [Ref. 23]. This mechanism may explain why the variant, c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G, decreases not only protein expression but also mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Meanwhile, the mutant protein of p.M5R would be functional as with WT, since there is no functional domain around the M5 residue, although it is well conserved among the species (\u003cb\u003eFig. S2\u003c/b\u003e). Thus, c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) is probably pathogenic because of decreased expression of the protein due to the impact on the efficiency of the translational initiation process, instead of a change in protein function or complete loss of \u003cem\u003eEXOSC2\u003c/em\u003e expression.\u003c/p\u003e \u003cp\u003eDisorders caused by pathogenic variants of the \u003cem\u003eEXOSC\u003c/em\u003e family genes exhibited notable similarity in phenotypes such as ID, seizure, hypotonia, microcephaly, and PCH, although they have not been understood as a unified disease concept (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [Ref. 3]. Most reported variants related to the disorders were missense, which prevented easy determination of the pathogenicity of the variant. Additionally, regarding \u003cem\u003eEXOSC2\u003c/em\u003e, the limited number of reported cases makes it difficult to understand it comprehensively with other \u003cem\u003eEXOSC\u003c/em\u003e family genes [Ref. 4]. However, previous functional analyses demonstrated that most of the variants reduced the expression of each EXOSC gene, instead of gain-of-function or overexpression, although they looked like \u0026lsquo;missense\u0026rsquo; variants. For example, RT-PCR and/or immunoblotting using the patient\u0026rsquo;s material, LCL or fibroblast, confirmed reduced expression of the mutated genes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [Refs. 24, 25, 26, 27, 28]. Likewise, immunoblotting using yeast, to which the variant was introduced, showed reduced protein expression [Refs. 29, 30]. These findings suggest that expression of the \u003cem\u003eEXOSC\u003c/em\u003e family, including \u003cem\u003eEXOSC2\u003c/em\u003e, is likely to be decreased even by the \u0026lsquo;missense\u0026rsquo; variants, although not all of the variants were validated. Since the RNA exosome comprises 11 components, a decline in any component may decrease the activity of the RNA exosome and cause the overlapping phenotypes, depending on the remaining activity of the RNA exosome. Thus, the pathological condition should be defined as \u0026ldquo;\u003cem\u003eRNA exosomepathy,\u0026rdquo;\u003c/em\u003e characterized by overlapping features such as ID, microcephaly, and PCH. Meanwhile, the pathogenic variants do not necessarily result in a complete loss-of-function [Ref. 27]. Actually, knockouts of \u003cem\u003eExosc1\u003c/em\u003e and \u003cem\u003eExosc2\u003c/em\u003e in mice are embryonically lethal [Ref. 31]. That is, biallelic loss-of-function variants of the EXOSC family genes are lethal, which may explain the reason why it has never been reported.\u003c/p\u003e \u003cp\u003eIn conclusion, we successfully identified two unexpected mechanisms underlying the decrease in EXOSC2 protein expression that were difficult for the \u003cem\u003ein silico\u003c/em\u003e predictors to estimate. The two variants are considered to compound the biallelic decrease in \u003cem\u003eEXOSC2\u003c/em\u003e expression, explaining the patient\u0026rsquo;s phenotypes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful to the patients and their families for their agreement to participate in this study. We wish to acknowledge Emi Sato and Toshihiko Iwaki for dedicated analysis in the Tokai regional branch of the IRUD, and Noriko Nomura, Arisa Yamano and Yuko Furukawa for helpful assistance. We would also appreciate all members of the Bench-Bedside Collaborative Study (BBCS) for the presentation and enthusiastic discussion of the clinical cases.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eK.Y.: Study design, genetic data acquisition and analysis, molecular analyses, and original draft preparation, writing, review, and editing. T.M.: 3D-model preparation and \u003cem\u003ein silico\u003c/em\u003e prediction. Y.S.: Molecular analysis. Y.N. and T.O.: Genetic analysis and diagnosis. M.I.: Clinical diagnosis and follow-up of the patient. S.H.: Study design, genetic diagnosis, clinical data gathering and analysis, original draft preparation, writing, review, and editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI Grant Numbers JP24K11014 and JP24K10523. The genetic diagnosis was a part of the Initiative on Rare and Undiagnosed Diseases (IRUD) program funded by the Japan Agency for Medical Research and Development (AMED), Grant Number 24ek0109760s0401.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWritten informed consent was obtained from the parents of the proband. The experiments in this study were conducted after obtaining approval from the Research Ethics Committee of Aichi Developmental Disability Center (#RC6-01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWeb Resources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAlphamissense:\u0026nbsp;https://alphamissense.hegelab.org/\u003c/p\u003e\n\u003cp\u003eCADD:\u0026nbsp;https://cadd.gs.washington.edu/\u003c/p\u003e\n\u003cp\u003eCentroidFold:\u0026nbsp;http://rtools.cbrc.jp/centroidfold/\u003c/p\u003e\n\u003cp\u003eESEfinder 3.0:\u0026nbsp;https://esefinder.ahc.umn.edu/cgi-bin/tools/ESE3/esefinder.cgi\u003c/p\u003e\n\u003cp\u003eThe gnomAD database v4.1.0:\u0026nbsp;https://gnomad.broadinstitute.org/ (v4.1.0, accessed Jan 2026)\u003c/p\u003e\n\u003cp\u003ePolyPhen-2:\u0026nbsp;http://genetics.bwh.harvard.edu/pph2/\u003c/p\u003e\n\u003cp\u003ePDB:\u0026nbsp;https://www.rcsb.org/structure/\u003c/p\u003e\n\u003cp\u003ePROVEAN and SIFT:\u0026nbsp;http://provean.jcvi.org/index.php\u003c/p\u003e\n\u003cp\u003eREVEL:\u0026nbsp;https://sites.google.com/site/revelgenomics/\u003c/p\u003e\n\u003cp\u003eRosetta Online Server:\u0026nbsp;https://rosie.graylab.jhu.edu/\u003c/p\u003e\n\u003cp\u003eSpliceAI:\u0026nbsp;https://spliceailookup.broadinstitute.org\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData and code availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study did not generate datasets.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRichards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, \u003cem\u003eet al.\u003c/em\u003e Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015, 17:405\u0026ndash;24. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/gim.2015.30\u003c/span\u003e\u003cspan address=\"10.1038/gim.2015.30\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePejaver V, Byrne AB, Feng BJ, Pagel KA, Mooney SD, Karchin R, \u003cem\u003eet al.\u003c/em\u003e Calibration of computational tools for missense variant pathogenicity classification and ClinGen recommendations for PP3/BP4 criteria. Am J Hum Genet. 2022, 109:2163\u0026ndash;2177. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ajhg.2022.10.013\u003c/span\u003e\u003cspan address=\"10.1016/j.ajhg.2022.10.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorton DJ, Kuiper EG, Jones SK, Leung SW, Corbett AH, Fasken MB. The RNA exosome and RNA exosome-linked disease. RNA. 2018, 24:127\u0026ndash;142. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1261/rna.064626.117\u003c/span\u003e\u003cspan address=\"10.1261/rna.064626.117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Donato N, Neuhann T, Kahlert AK, Klink B, Hackmann K, Neuhann I, \u003cem\u003eet al.\u003c/em\u003e Mutations in EXOSC2 are associated with a novel syndrome characterised by retinitis pigmentosa, progressive hearing loss, premature ageing, short stature, mild intellectual disability and distinctive gestalt. J Med Genet. 2016, 53:419\u0026ndash;25. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/jmedgenet-2015-103511\u003c/span\u003e\u003cspan address=\"10.1136/jmedgenet-2015-103511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaito-Ohara F, Fukuda Y, Ito M, Agarwala KL, Hayashi M, Matsuo M, \u003cem\u003eet al.\u003c/em\u003e The Xq22 inversion breakpoint interrupted a novel Ras-like GTPase gene in a patient with Duchenne muscular dystrophy and profound mental retardation. Am J Hum Genet. 2002, 71:637\u0026ndash;45. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1086/342208\u003c/span\u003e\u003cspan address=\"10.1086/342208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki Y, Nomura N, Yamada K, Yamada Y, Fukuda A, Hoshino K, Abe S, Kurosawa K, Inaba M, Mizuno S, Wakamatsu N, Hayashi S. Pathogenicity evaluation of variants of uncertain significance at exon-intron junction by splicing assay in patients with Mowat-Wilson syndrome. Eur J Med Genet. 2023, 66:104882. Doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejmg.2023.104882\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmg.2023.104882\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki Y, Uehara DT, Enokido Y, Kawai T, Nomura N, Yamada K, Takanashi J, Miyahara H, Inazawa J, Hayashi S. Transcript imbalance from TENM4 exon skipping: effects on epilepsy and genetic pleiotropy. Mol Neurobiol. 2025, 63:324, 2025. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.21203/rs.3.rs-7261185/v1\u003c/span\u003e\u003cspan address=\"10.21203/rs.3.rs-7261185/v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3:RESEARCH0034. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2002-3-7-research0034\u003c/span\u003e\u003cspan address=\"10.1186/gb-2002-3-7-research0034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGotoda Y, Wakamatsu N, Kawai H, Nishida Y, Matsumoto T. Missense and nonsense mutations in the lysosomal alpha-mannosidase gene (MANB) in severe and mild forms of alpha-mannosidosis. Am J Hum Genet. 1998, 63:1015\u0026ndash;24. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1086/302048\u003c/span\u003e\u003cspan address=\"10.1086/302048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurley SK, Bhatt R, Bhikadiya C, Bi C, Biester A, Biswas P, \u003cem\u003eet al.\u003c/em\u003e Updated resources for exploring experimentally-determined PDB structures and Computed Structure Models at the RCSB Protein Data Bank. Nucleic Acids Res. 2025, 53:D564-D574. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkae1091\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkae1091\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDelgado J, Radusky LG, Cianferoni D, Serrano L. FoldX 5.0: working with RNA, small molecules and a new graphical interface. Bioinformatics. 2019, 35:4168\u0026ndash;4169. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btz184\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btz184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchr\u0026ouml;dinger L and DeLano W. PyMOL. 2020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.pymol.org/pymol\u003c/span\u003e\u003cspan address=\"http://www.pymol.org/pymol\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeick EM, Puno MR, Januszyk K, Zinder JC, DiMattia MA, Lima CD. Helicase-Dependent RNA Decay Illuminated by a Cryo-EM Structure of a Human Nuclear RNA Exosome-MTR4 Complex. Cell. 2018, 173:1663\u0026ndash;1677.e21. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2018.05.041\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2018.05.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZur H, Tuller T. New universal rules of eukaryotic translation initiation fidelity. PLoS Comput Biol. 2013, 9:e1003136. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pcbi.1003136\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1003136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeka H, Werner F, Cordell SC, Onesti S, Brick P. Crystal structure and RNA binding of the Rpb4/Rpb7 subunits of human RNA polymerase II. Nucleic Acids Res. 2005, 33:6435\u0026ndash;44. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gki945\u003c/span\u003e\u003cspan address=\"10.1093/nar/gki945\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31:3568\u0026ndash;71. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkg616\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkg616\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith PJ, Zhang C, Wang J, Chew SL, Zhang MQ, Krainer AR. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum Mol Genet. 2006, 15:2490\u0026ndash;508. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddl171\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddl171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim KH, Ferraris L, Filloux ME, Raphael BJ, Fairbrother WG. Using positional distribution to identify splicing elements and predict pre-mRNA processing defects in human genes. Proc Natl Acad Sci U S A. 2011, 108:11093\u0026ndash;8. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1101135108\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1101135108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiebhaber SA, Cash F, Eshleman SS. Translation inhibition by an mRNA coding region secondary structure is determined by its proximity to the AUG initiation codon. J Mol Biol. 1992, 226:609\u0026ndash;21. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0022-2836(92)90619-u\u003c/span\u003e\u003cspan address=\"10.1016/0022-2836(92)90619-u\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoczonadi V, M\u0026uuml;ller JS, Pyle A, Munkley J, Dor T, Quartararo J, \u003cem\u003eet al.\u003c/em\u003e EXOSC8 mutations alter mRNA metabolism and cause hypomyelination with spinal muscular atrophy and cerebellar hypoplasia. Nat Commun. 2014, 5:4287. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms5287\u003c/span\u003e\u003cspan address=\"10.1038/ncomms5287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurns DT, Donkervoort S, M\u0026uuml;ller JS, Knierim E, Bharucha-Goebel D, Faqeih EA, \u003cem\u003eet al.\u003c/em\u003e Variants in EXOSC9 Disrupt the RNA Exosome and Result in Cerebellar Atrophy with Spinal Motor Neuronopathy. Am J Hum Genet. 2018, 102:858\u0026ndash;873. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ajhg.2018.03.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ajhg.2018.03.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBizzari S, Hamzeh AR, Mohamed M, Al-Ali MT, Bastaki F. Expanded PCH1D phenotype linked to EXOSC9 mutation. Eur J Med Genet. 2020, 63:103622. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejmg.2019.01.012\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmg.2019.01.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSomashekar PH, Kaur P, Stephen J, Guleria VS, Kadavigere R, Girisha KM, \u003cem\u003eet al.\u003c/em\u003e Bi-allelic missense variant, p.Ser35Leu in EXOSC1 is associated with pontocerebellar hypoplasia. Clin Genet. 2021, 99:594\u0026ndash;600. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cge.13928\u003c/span\u003e\u003cspan address=\"10.1111/cge.13928\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZaki MS, Abdel-Ghafar SF, Abdel-Hamid MS. A missense variant in EXOSC8 causes exon skipping and expands the phenotypic spectrum of pontocerebellar hypoplasia type 1C. J Hum Genet. 2024, 69:79\u0026ndash;84. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s10038-023-01207-4\u003c/span\u003e\u003cspan address=\"10.1038/s10038-023-01207-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFasken MB, Losh JS, Leung SW, Brutus S, Avin B, Vaught JC, \u003cem\u003eet al.\u003c/em\u003e Insight into the RNA Exosome Complex Through Modeling Pontocerebellar Hypoplasia Type 1b Disease Mutations in Yeast. Genetics. 2017, 205:221\u0026ndash;237. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1534/genetics.116.195917\u003c/span\u003e\u003cspan address=\"10.1534/genetics.116.195917\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDamseh NS, Obeidat AN, Ahammed KS, Al-Ashhab M, Awad MA, van Hoof A. Pontocerebellar hypoplasia associated with p.Arg183Trp homozygous variant in EXOSC1 gene: A case report. Am J Med Genet A. 2023, 191:1923\u0026ndash;1928. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ajmg.a.63198\u003c/span\u003e\u003cspan address=\"10.1002/ajmg.a.63198\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivasan S, He X, Mirza S, Mager J. Exosome complex components 1 and 2 are vital for early mammalian development. Gene Expr Patterns. 2024, 51:119346. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gep.2023.119346\u003c/span\u003e\u003cspan address=\"10.1016/j.gep.2023.119346\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen JL, VanEtten DM, Fountain MA, Yildirim I, Disney MD. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington\u0026rsquo;s Disease and Myotonic Dystrophy Type 1. Biochemistry. 2017, 56:3463\u0026ndash;3474. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.biochem.7b00252\u003c/span\u003e\u003cspan address=\"10.1021/acs.biochem.7b00252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroniarek I, Niewiadomska D, Sobczak K. Contribution of DNA/RNA Structures Formed by Expanded CGG/CCG Repeats Within the FMR1 Locus in the Pathogenesis of Fragile X-Associated Disorders. Wiley Interdiscip Rev RNA. 2024, 15:e1874. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/wrna.1874\u003c/span\u003e\u003cspan address=\"10.1002/wrna.1874\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartoszewski R, Rab A, Jurkuvenaite A, Mazur M, Wakefield J, Collawn JF, \u003cem\u003eet al.\u003c/em\u003e Activation of the unfolded protein response by deltaF508 CFTR. Am J Respir Cell Mol Biol. 2008, 39:448\u0026ndash;57. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1165/rcmb.2008-0065OC\u003c/span\u003e\u003cspan address=\"10.1165/rcmb.2008-0065OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoma MK, Parker R. Endonucleolytic cleavage of eukaryotic mRNAs with stalls in translation elongation. Nature. 2006, 440:561\u0026ndash;4. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature04530\u003c/span\u003e\u003cspan address=\"10.1038/nature04530\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakamoto M, Iwama K, Sekiguchi F, Mashimo H, Kumada S, Ishigaki K, \u003cem\u003eet al.\u003c/em\u003e Novel EXOSC9 variants cause pontocerebellar hypoplasia type 1D with spinal motor neuronopathy and cerebellar atrophy. J Hum Genet. 2021, 66:401\u0026ndash;407. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s10038-020-00853-2\u003c/span\u003e\u003cspan address=\"10.1038/s10038-020-00853-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan J, Yourshaw M, Mamsa H, Rudnik-Sch\u0026ouml;neborn S, Menezes MP, Hong JE, \u003cem\u003eet al.\u003c/em\u003e Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration. Nat Genet. 2012, 44:704\u0026ndash;8. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ng.2254\u003c/span\u003e\u003cspan address=\"10.1038/ng.2254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiancheri R, Cassandrini D, Pinto F, Trovato R, Di Rocco M, Mirabelli-Badenier M, \u003cem\u003eet al.\u003c/em\u003e EXOSC3 mutations in isolated cerebellar hypoplasia and spinal anterior horn involvement. J Neurol. 2013, 260:1866\u0026ndash;70. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00415-013-6896-0\u003c/span\u003e\u003cspan address=\"10.1007/s00415-013-6896-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRudnik-Sch\u0026ouml;neborn S, Senderek J, Jen JC, Houge G, Seeman P, Puchmajerov\u0026aacute; A, \u003cem\u003eet al.\u003c/em\u003e Pontocerebellar hypoplasia type 1: clinical spectrum and relevance of EXOSC3 mutations. Neurology. 2013, 80:438\u0026ndash;46. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1212/WNL.0b013e31827f0f66\u003c/span\u003e\u003cspan address=\"10.1212/WNL.0b013e31827f0f66\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEggens VR, Barth PG, Niermeijer JM, Berg JN, Darin N, Dixit A, \u003cem\u003eet al.\u003c/em\u003e EXOSC3 mutations in pontocerebellar hypoplasia type 1: novel mutations and genotype-phenotype correlations. Orphanet J Rare Dis. 2014, 9:23. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1750-1172-9-23\u003c/span\u003e\u003cspan address=\"10.1186/1750-1172-9-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchottmann G, Picker-Minh S, Schwarz JM, Gill E, Rodenburg RJT, Stenzel W, \u003cem\u003eet al.\u003c/em\u003e Recessive mutation in EXOSC3 associates with mitochondrial dysfunction and pontocerebellar hypoplasia. Mitochondrion. 2017, 37:46\u0026ndash;54. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mito.2017.06.007\u003c/span\u003e\u003cspan address=\"10.1016/j.mito.2017.06.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNuovo S, Micalizzi A, Romaniello R, Arrigoni F, Ginevrino M, Casella A, \u003cem\u003eet al.\u003c/em\u003e Refining the mutational spectrum and gene-phenotype correlates in pontocerebellar hypoplasia: results of a multicentric study. J Med Genet. 2022, 59:399\u0026ndash;409. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1136/jmedgenet-2020-107497\u003c/span\u003e\u003cspan address=\"10.1136/jmedgenet-2020-107497\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzeto CH, Rubin S, Sidlow R. Homozygous EXOSC3 c.395A\u0026thinsp;\u0026gt;\u0026thinsp;C Variants in Pontocerebellar Hypoplasia Type 1B: A Sibling Pair With Childhood Lethal Presentation and Literature Review. Cureus. 2023, 15:e39226. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7759/cureus.39226\u003c/span\u003e\u003cspan address=\"10.7759/cureus.39226\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHalevy A, Lerer I, Cohen R, Kornreich L, Shuper A, Gamliel M, \u003cem\u003eet al.\u003c/em\u003e Novel EXOSC3 mutation causes complicated hereditary spastic paraplegia. J Neurol. 2014, 261:2165\u0026ndash;9. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00415-014-7457-x\u003c/span\u003e\u003cspan address=\"10.1007/s00415-014-7457-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Bayat V, DiDonato N, Zhao Y, Zarnegar B, Siprashvili Z, \u003cem\u003eet al.\u003c/em\u003e Genetic and genomic studies of pathogenic EXOSC2 mutations in the newly described disease SHRF implicate the autophagy pathway in disease pathogenesis. Hum Mol Genet. 2020, 29:541\u0026ndash;553. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddz251\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddz251\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"EXOSC2, RNA exosome, splicing aberration","lastPublishedDoi":"10.21203/rs.3.rs-9039053/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9039053/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eEXOSC2\u003c/em\u003e encodes one of the 11 components of the RNA exosome complex degrading various types of RNA. Pathogenic variants of some EXOSC genes cause genetic disorders with similar phenotypes, including intellectual disability (ID), microcephaly, and pontocerebellar hypoplasia. However, little is known regarding \u003cem\u003eEXOSC2\u003c/em\u003e. We report detailed analyses of compound heterozygosity of novel \u003cem\u003eEXOSC2\u003c/em\u003e variants, comprising paternally-inherited c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G (p.M5R) and maternally-inherited c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.S106L), identified in a patient with ID, epilepsy, and microcephaly. Although the two variants appeared \u0026lsquo;missense,\u0026rsquo; they respectively decreased protein EXOSC2 expression through novel pathomechanisms. c.14T\u0026thinsp;\u0026gt;\u0026thinsp;G may have decreased EXOSC2 expression by impaired efficiency during translational initiation. Interestingly, other synonymous codons didn\u0026rsquo;t decrease the expression, suggesting the decreased expression depended on the nucleotide change instead of residue change. The second variant, c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T, caused unexpected exon 4 skipping, leading to decreased EXOSC2 expression, although the nucleotide 317C was in the middle of exon 4. Since the exon skipping didn\u0026rsquo;t occur due to other changes in nucleotides adjacent to c.317C, only c.317C\u0026thinsp;\u0026gt;\u0026thinsp;T critically reduced the function of the exon enhancer element. Altogether, we identified two novel pathomechanisms explaining the decrease in EXOSC2 expression. These findings suggest the possibility that we may overlook such kind of variants decreasing gene expression, which could cause disorders. Additionally, the etiology of the current case is a decline of one of the 11 components of the exosome, similar to previously-reported disorders by other genes in the EXOSC family, with overlapping clinical features. Thus, these disorders may be integrated into a new disease concept termed \u0026ldquo;\u003cem\u003eRNA exosomepathy\u003c/em\u003e.\u0026rdquo;\u003c/p\u003e","manuscriptTitle":"Compound heterozygosity of EXOSC2 ‘missense’ variants causes a bi-allelic decrease in protein expression through novel unexpected pathomechanisms","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-13 17:42:45","doi":"10.21203/rs.3.rs-9039053/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-04-14T08:35:51+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-04-04T12:02:50+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-25T16:21:29+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-03-13T12:23:37+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-03-10T14:58:46+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-03-10T13:46:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-06T16:41:52+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-05T10:19:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Human Genetics","date":"2026-03-05T10:19:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-human-genetics","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"ejhg","sideBox":"Learn more about [European Journal of Human Genetics](http://www.nature.com/ejhg/)","snPcode":"41431","submissionUrl":"https://mts-ejhg.nature.com/cgi-bin/main.plex","title":"European Journal of Human Genetics","twitterHandle":"@ejhg_journal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6990956d-f89e-4938-89b6-88cea7041057","owner":[],"postedDate":"March 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":64256782,"name":"Biological sciences/Genetics/Clinical genetics/Disease genetics"},{"id":64256783,"name":"Biological sciences/Genetics/Neurodevelopmental disorders"},{"id":64256784,"name":"Biological sciences/Genetics/Gene expression"},{"id":64256785,"name":"Biological sciences/Molecular biology"},{"id":64256786,"name":"Biological sciences/Biological techniques/Genomic analysis"}],"tags":[],"updatedAt":"2026-03-13T17:42:46+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-13 17:42:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9039053","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9039053","identity":"rs-9039053","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}