Fine Mapping and Identification of Causal Alleles at the Ur-11 Locus Controlling Rust Resistance in Common Bean (Phaseolus vulgaris L.)

Fine Mapping and Identification of Causal Alleles at the Ur-11 Locus Controlling Rust Resistance in Common Bean (Phaseolus vulgaris L.) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fine Mapping and Identification of Causal Alleles at the Ur-11 Locus Controlling Rust Resistance in Common Bean (Phaseolus vulgaris L.) Mohammad Erfatpour, Kristin Simons, Jayanta Roy, Jose Figueroa-Cerna, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5220084/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Feb, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted 4 You are reading this latest preprint version Abstract The Middle American rust resistance gene Ur-11 present in common bean ( Phaseolus vulgaris L.) confers resistance to all but one known race of the pathogen Uromyces appendiculatus (Pers.) Unger. Even though progress has been made in understanding the host-pathogen interactions between common bean and U. appendiculatus , the causal alleles of the majority of rust resistance loci, including Ur-11 , remain unknown. A genome-wide association study (GWAS) was conducted to identify genomic regions associated with resistance to the U. appendiculatus race 31 − 22, which is avirulent to Ur-11 but virulent to other Middle American rust resistance genes. GWAS using genotypic data consisting of approximately 71k SNP markers and phenotypic data based on the median reaction type (1 to 9 scale) of a panel of 350 Middle American breeding lines and cultivars, plus 12 germplasm lines with the Ur-11 locus derived from PI 181996, located Ur-11 on chromosome Pv11. Twenty-seven SNP markers clustered in the 55.16–55.56 Mb region of the P. vulgaris UI111 reference. Multiple DNA sequence alignments detected a missense mutation [c.1,328A > G] in the PvUI111.11G202400 gene model that encodes a leucine-rich repeat-containing protein in response to race 31 − 20. A PCR allele competitive extension marker (PACE) was developed and tested across a panel of ~ 650 Middle American dry bean genotypes. No recombination event was observed for the marker among the tested genotypes; suggesting that the polymorphism on which it is based is very close to or in the Ur-11 gene. This SNP marker will be a useful and reliable marker for marker-assisted selection. Figures Figure 1 Figure 2 Figure 3 Introduction Rust, caused by Uromyces appendiculatus (Pers.:Pers.) Unger, is among the most damaging diseases of common bean ( Phaseolus vulgaris L.) in humid tropical and subtropical production regions and is capable of causing periodic epidemics in temperate moist areas (Zaumeyer and Thomas 1957 ; Ballantyne 1974 ; Vargas 1980 ; Stavely and Pastor-Corrales 1989 ; Souza et al. 2013 ). The bean rust pathogen has a high virulence diversity with more than 90 races identified worldwide (Hurtado-Gonzales et al. 2017 ). Host plant resistance is an effective and environmentally friendly control measure despite high variability in U. appendiculatus . It is believed that the P. vulgaris - U. appendiculatus pathosystem fits the gene-for-gene theory and involves dominant genes in the bean plant that confer monogenic resistance against various races of the rust pathogen (Stavely and Pastor-Corrales 1989 ; Montejo Domínguez et al. 2022 ). However, new findings suggest an oligogenic control of rust resistance in some common bean accessions (Leitão et al. 2023 ). At least 11 rust resistance loci have been identified and mapped to different linkage groups in the bean genome, and more resistance loci (named and unnamed) are yet to be mapped (Miklas et al. 2002 , 2006 ; Steadman et al. 2002 ; Kelly et al. 2003 ; de Souza et al. 2011 , 2013 ; Hurtado-Gonzales et al. 2017 ). Among mapped resistance loci, Ur-3 , Ur-3 + , Ur-5 , Ur-7 , Ur-11 , and Ur-14 belong to the Middle American gene pool and Ur-4, Ur-6, Ur-9, Ur-12 , and Ur-13 are from the Andean gene pool (Steadman et al. 2002 ). In 2008, a new U. appendiculatus race, 20 − 3, was identified in North Dakota, resulting in susceptibility of at least 27 of the most grown cultivars in North Dakota (Markell et al. 2009 ). Race 20 − 3 were virulent on the Middle American differential cultivars, Aurora ( Ur-3 ) and GN1140 ( Ur-7 ) and the Andean differential cultivars, Golden Gate Wax ( Ur-6 ) and Montcalm (unknown gene). However, it is avirulant on the Middle American Ur-11 gene. This indicates the importance of incorporating effective genes and pyramiding of those genes for long-term rust management in common bean. The Ur-11 gene provides broad-spectrum resistance against most U. appendiculatus races and is susceptible only to Honduran U. appendiculatus race 22–52 (formerly known as 108) (Pastor-Corrales et al. 2007 ; Wasonga et al. 2010 ; Hurtado-Gonzales et al. 2017 ). Therefore, the Ur-11 gene in combination with other rust-resistance genes can be used as the most cost-effective strategy for controlling the highly variable rust pathogen in common bean (Pastor-Corrales et al. 2007 ). The Guatemalan black beans PI 181996 and PI 190078 are known sources of the Ur-11 gene in the Middle American gene pool (Pastor-Corrales et al. 2007 ). However, the PI 181996 resistance source was the one predominantly introgressed into common bean germplasm (Pastor-Corrales 2003 ). ‘ND-Falcon’ was the first pinto bean cultivar with the Ur-11 derived from PI 181996 released by the NDSU dry bean breeding program in 2019 (Osorno et al. 2020 ). Using BC 4 F 2 individuals derived from backcrosses between NX-040*4 and PI 181996, the Ur-11 locus was mapped to chromosome Pv11 and linked to two random amplified polymorphic DNA (RAPD) markers, OAC20 490 co-segregating in coupling phase, and OAE19 890 linked in repulsion phase at a distance of 6.2 ± 2.8 cM (Johnson et al. 1995 ). NX-040 is a sister line of 'Norstar' navy bean (Grafton et al. 1993 ). The RAPD marker OAE19 890 was later located 1.0 cM from the Ur-11 in a F 2 population derived from Ruda´ × BelMiDak-RR-3 cross (Alzate-Marin et al. 2004 ). Ruda´ is a carioca-type cultivar (Aragão and Rech 1997 ) and BelMiDak-RR-3 is a navy bean germplasm line possessing the Ur-11 gene from PI 181996 (Stavely et al. 1994 ; Pastor-Corrales 2003 ). Later, Queiroz et al. ( 2004 ) converted OAE19 890 into a sequence characterized amplified region (SCAR) marker sAE19 890 . It is worth noting that Blast searches in Phytozome ( http://phytozome.jgi.doe.gov ) reveal the reverse primer of sAE19 890 (5’-CAGTCCCTAAAGTAGTTTGTCCCTA-3’) is conserved across genetic backgrounds including Middle American ( P. vulgaris UI111 reference genome assembly v1.1, Pv11: 55335635..55335659) and Andean ( P. vulgaris G19833 genome assembly v2.1, Pv11: 51387148..51387172). Still, the forward primer of sAE19 890 (5’-CAGTCCCTGACAACATAACACC-3’) is likely specific for the Carioca background. Genome-wide association study (GWAS) is a powerful approach to detect genome-phenotype associations and validate loci identified by other methods. Recently, a GWAS on a Middle American diversity panel mapped the Ur-11 of PI 181996 to a genomic interval from 50.5Mb to 52.2Mb on Pv11 of P. vulgaris G19833 (Monclova-Santana 2019 ). This region contains multiple disease-resistance genes such as leucine-rich repeats containing (LRR) genes and corresponds to a genomic region from 54 to 56 Mb on Pv11 of P. vulgaris UI111 v1.1. Even though great progress has been made in mapping and identification of candidate genes for rust resistance at the Ur-11 locus, causal variants and their contributions to the development of resistance to rust pathogen remain unknown. This study aimed to i) validate genomic regions associated with the Ur-11 locus conferring resistance to U. appendiculatus in Middle American beans, ii) determine a variant or set of variants in candidate genes that might identify it as the Ur-11 gene, and iii) develop a gene-based marker that can be utilized in marker-assisted selection in early stages of a breeding program for rust resistance. Materials and methods Plant material A panel of 390 genotypes consisting of preliminary (PYT) and advanced yield trial (AYT) lines from the North Dakota State University dry bean program, germplasm lines and cultivars known to possess the Ur-11 locus derived from PI 181996 and cultivars from the Middle American gene pool was evaluated for this study. The panel was composed of 132 pinto, 100 black, 57 pink and small red, 51 great northern, and 50 navy bean genotypes. The germplasm lines included the great northern beans BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, and BelMiNeb-RMR-5; the navy beans BelMiDak-RR-1 and BelMiDak-RR-2; as well as the pinto bean BelDakMi-RR-5, all developed by the United States Department of Agriculture, Agricultural Research Station at Beltsville, Maryland (Pastor-Corrales 2003 ). The cultivars with the Ur-11 locus were great northern Beryl R (PVP# 200600224), pink bean Pink Floyd (PVP# 200500211, pinto bean NE2-09-3 developed by Dr. Carlos Urrea (University of Nebraska, Scottsbluff), and PI 181996. Inoculum preparation and plant inoculation Rust inoculum preparation and plant inoculation followed a protocol by Jochua et al. ( 2008 ) with a small modification. Briefly, 25 mg of urediniospores of U. appendiculatus race 31 − 22 (previously known as race 67) was suspended in 300 ml of Tween 20 solution (40 µl of Tween 20 per 1,000 ml of distillate water) and used to inoculate the unifoliate leaves of 8-day-old plants using a Paasche VL Series airbrush ( www.paascheairbrush.com ). Following drying, inoculated plants were incubated in humidity chambers overnight in darkness with misting for 20 sec every 30 min at 21 ± 1°C to increase humidity and aid infection. Plants were then transferred to a greenhouse (14 h days at 24 ± 2°C; 10 h night at 21 ± 2°C) for disease development. The experiment consisted of an alpha-lattice design with 3 replicates (rep) and 43 incomplete blocks [(plastic trays of 50 cells (10×5)] within each rep. In each incomplete block, the susceptible check ‘Othello’ was included. Each experimental unit consisted of 5 plants. Disease reaction evaluation The rust reaction was scored 14 days post-inoculation using the 1–9 scale as described by Van Schoonhoven and Pastor-Corrales ( 1987 ). According to this rating system, plants with no visible rust pustules were considered immune or hypersensitive (HR) and scored 1. Plants showing tiny pustules on less than 2% of their unifoliate area received a score of 3 and fell into the resistant category. Small and intermediate pustules covering approximately 5% of the unifoliate area resulted in a score of 5 for intermediate resistance. Plants were scored susceptible (7) and highly susceptible (9) for having large pustules covering approximately 10% and more than 25% of their unifoliate leaves, respectively. Proc univariate in SAS 9.4 (SAS Institute, Cary, NC, United States) was used to calculate descriptive statistics, including the median of the rust reaction values. DNA extraction and sequencing library preparation DNA extraction and sequencing library preparation Genomic DNA was isolated from approximately 50 mg of young trifoliate leaf tissue using Mag-Bind® Plant DNA Plus Kit (Omega Bio-Tek, Norcross, GA, United States) following the product manual ( https://omegabiotek.com/product/mag-bind-plant-dna-plus-96-kit ). DNA was quantified using a nanodrop and diluted to 50 ng/µl. Sequencing libraries were prepared following a Phaseolus -specific protocol developed by Schröder et al. (2016). In brief, DNA from each genotype was double digested with two restriction enzymes, MseI and Taqα1, and uniquely barcoded. Each library was sequenced in paired-end runs (2 x 150 bp) at HudsonAlpha Institute for Biotechnology (Huntsville, AL, United States) using Illumina HiSeq 2500 Sequencing System in rapid-run mode. Single nucleotide polymorphism dataset The raw sequencing reads were processed to trim low-quality reads with less than 80 bp in length and a default quality threshold score of 20 using SICKLE (Joshi and Fass 2011 ). The ‘BWA-MEM’ algorithm (Li 2013 ) was used to align the quality sequence reads against the UI111 v1.1 reference genome. The aligned reads were sorted and indexed with SAMtools (Danecek et al. 2021 ). Read group information for each genotype, including library, platform, and platform unit were added using Picard tools ( http://broadinstitute.github.io/picard ). SNP calling was implemented using the MultisampleVariantsDetector module embedded in the NGSEPcore_4.2.0 software with the -maxAlnsPerStartPos 100 parameter (Tello et al., 2023 ). Multiallelic SNPs were discarded and SNPs with a minimum read depth ≥ 3, were selected. Additionally, markers with less than 70% missing sites and 5% heterozygotes sites were imputed using Beagle 5.4 (Browning et al. 2018 ). Finally, a total of 71,098 high-quality SNPs were retained after applying 5% minor allele frequency (MAF), were used for GWAS. Genome-wide association study GWAS analysis was performed using phenotype and genotype data with Genome-wide Efficient Mixed Model Analysis (GEMMA) (Zhou and Stephens 2012 ) software implementing linear mixed model. Principal component analysis (PCA) was performed to estimate population structure. Population relatedness (kinship matrix) was generated using the GEMMA algorithm for centered relatedness. The linear mixed model was implemented including the first three PCA for population structure and kinship matrix for genetic relatedness. Manhattan and quantile-quantile plots were generated using the R package qqman (Turner 2018 ). The marker-trait association was determined statistically significant based on the p -value (-log10( p )) detection threshold using the Bonferroni correction to control the genome-wide false positive rate (α = 0.05). The proportion of phenotypic variation explained by the significant SNPs (R 2 ) was calculated in TASSEL. Identification of candidate genes and sequence alignment The flanking sequences from the significant SNP markers associated with the Ur-11 locus were extracted with Integrative Genomics Viewer ( https://igv.org/doc/desktop ) and used in a BLAST search against the P. vulgaris UI111 v1.1 in Phytozome 13 ( https://phytozome-next.jgi.doe.gov ). Candidate genes were identified within 100 kb upstream and downstream of the peak SNPs' physical location (bp). Multiple DNA sequence alignments and variant reviews were performed with IGV. Translation of DNA sequence to protein sequence was carried out with Expasy ( https://web.expasy.org/translate ). Multiple protein sequence alignments were performed with Clustal Omega ( https://www.ebi.ac.uk/jdispatcher/msa/clustalo ). PACE genotyping assay PCR Allele Competitive Extension (PACE) genotyping assays (allele-specific forward and common reverse primers) designed by Integrated DNA Technologies, Inc. investigated target SNP sites in exons and upstream regulatory regions of candidate genes. PACE SNP genotyping was performed with 20ng of high-quality genomic DNA samples from the genotypes using the PACE 2.0 Genotyping Master Mix (Standard ROX − 150 nM, 3CR Bioscience) in the presence of two competitive allele-specific forward primers and a common, reverse primer in a final volume of 8µL (Table S1 ). The PCR amplification condition was 15 min at 94°C for the hot start activation, 10 cycles of 20s at 94°C, 65°C for 60s (dropping 0.8°C per cycle), then 38 cycles of 20s at 94°C and 60s at 57°C followed by a final point read of the fluorescence for 2 min at 22°C on a CFX Opus 96 real-time PCR system and using the CFX Maestro Software (BIO-RAD). Results Phenotypic reactions of breeding lines and cultivars to U. appendiculatus race 31 − 22 were consistent across replicates under greenhouse conditions. Median genotype scores ranged from highly resistant (1) to highly susceptible (9). Approximately 8% of genotypes showed an immune reaction, 3% were resistant, 7% exhibited an intermediate reaction, 27% were susceptible, and 55% were highly susceptible. The germplasm lines and cultivars with the rust resistance Ur-11 locus including great northern beans BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, BelMiNeb-RMR-5, and Beryl R; navy beans BelMiDak-RR-1 and BelMiDak-RR-2; pinto bean BelDakMi-RR-5 and NE2-09-3; pink bean Pink Floyd; and black bean PI 181996 were among the 29 genotypes that expressed an immune reaction to race 31 − 22. Fourteen slow-darkening pinto, one black, one navy, and one pink bean breeding lines also showed an immune response. Seven black, one navy, and one slow-darkening pinto bean breeding lines were resistant. GWAS was conducted using genotypic data consisting of approximately 71k SNP markers and phenotypic data based on the median reaction type (1 to 9 scale) of 362 middle American-type bean genotypes. GWAS revealed 27 SNP markers within a distinct peak on chromosome Pv11 in the 55.16–55.56 Mb region of the P. vulgaris UI111 reference genome assembly v1.1 (Fig. 1 ; Table 1 ). Two SNP markers S11_55458849 and S11_55167465 showed the strongest association with the trait explaining 29% of the phenotypic variation. The peak SNPs in this cluster are bordered upstream and downstream by gene models that encode proteins in response to abiotic and biotic stimuli, including NBS-LRR proteins (Tables 1 , S2). Of the 27 peak SNPs, four SNP markers (S11_55167465, S11_55167606, S11_55167642, and S11_55167692) were found at approximately 14.2 to 22.8 kb upstream of the gene models PvUI111.11G202300 and PvUI111.11G202400 that encode NBS-LRR proteins. Five SNP markers (S11_55220618, S11_55220638, S11_55220675, S11_55221024, and S11_55221035) were found near the NBS-LRR protein ecoding genes PvUI111.11G202600 , PvUI111.11G202700, PvUI111.11G202800, PvUI111.11G203000, PvUI111.11G203100 , and PvUI111.11G203200 and a receptor protein kinase encoding gene PvUI111.11G203300 . The gene models PvUI111.11G203600, PvUI111.11G205100, PvUI111.11G205700, PvUI111.11G206000, and PvUI111.11G206100 were other NBS-LRR genes around the peak SNPs within the genomic region (Tables 1 , S2). DNA sequence alignments of the candidate genes associated with the Ur-11 in 13 genotypes that expressed an immune reaction to race 31 − 22, including BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, BelMiNeb-RMR-5, BelMiDak-RR-1, BelMiDak-RR-2, BelDakMi-RR-5, Beryl R, Pink Floyd, NE2-09-3, PI 181996, and Topaz R with 26 susceptible genotypes, including pinto beans AC Island, Buster, CDC Camino, Chase, Croissant, Frontier, Lariat, Kimberly, La Paz, Maverick, Monterrey, Montrose, Nodak, SDIP-1, Sedona, Stampede, UI-114, USPT-WM-1, Windbreaker, great northern bean BelNeb-RR-1, small red beans AC Redbod, AC Scarlet, Merlot, Rosetta, and black beans Mexico 235 and Mexico 309 revealed single and multiple nucleotide polymorphisms distributed within exons of these genes. In total, 12 PACE genotyping assays were designed for gene variants linked to the Ur-11 locus (Table 2 ). The efficiency of the PACE markers in revealing the disease phenotype was evaluated through their cross-validation in a set of 650 bean genotypes composed of cultivars and breeding lines and ~ 300 Middle American Diversity Panel (Moghaddam et al. 2016 ) from different genetic backgrounds and populations. The results showed no consistent association between the gene variants and disease phenotype for most of the detected polymorphisms in the candidate genes across the genotypes. However, the PACE marker S11_55191718 which represents a single nucleotide substitution in the exon [c.1,328A > G] of the candidate gene PvUI111.11G202400 (Table 2 ) did precisely distinguish the resistant and susceptible genotypes across different populations including two biparental navy bean populations derived from crosses between Puerto Rican bean lines 2104-1-1 × PR0806-81 and 2104-1-2 × PR0806-81 (made by Dr. James Beaver at the University of Puerto Rico and advanced to homozygosity at NDSU). The parental lines 2104-1-1 and 2104-1-2 are navy bean genotypes with the rust resistance Ur-5 gene (personal communication with Dr. Beaver). The parental line PR0806-81 (Reg. No. GP-297, PI 672995) is a navy bean germplasm line possessing the Ur-11 gene from PI 181996 (Beaver et al. 2015 ). Figure 2 demonstrates the outputs of four PACE assays for 67 navy bean breeding lines with an immune reaction to rust race 31 − 22. The PACE marker S11_55191718 cosegregated with the Ur-11 resistance phenotype compared to markers S11_55182817, S11_55458849, and S11_55482888. A blastp analysis found PvUI111.11G202400 exhibited about 70% sequence identity with coiled-coil nucleotide-binding site-leucine-rich repeat (CC-NBS-LRR) type disease resistance proteins such as At3g14460, RGAs, RPG1-B, and RPP13-like proteins in legume crops Vigna angularis (Wild.) (adzuki bean), V. radiata var. radiata (mung bean), V. umbellata (Thunb.) Ohwi & H.Ohashi (ricebean), V. unguiculata (L.) Walp. (cowpea), Glycine max (L.) Merr., and G. soja Siebold & Zucc. across its entire query length. Multiple sequence alignment of CC-NBS-LRR proteins and putative NBS-LRR proteins encoded by the gene homologs of PvUI111.11G202400 in UI111 and PI 181996 (McClean et al. 2022 ) revealed characteristic motifs of a typical CC-NBS-LRR for the PvUI111.11G202400 protein. Figures 3 and S1 show that the PvUI111.11G202400 protein comprises motifs with identical or similar residues to its putative homologs in different species. In order from the N-terminus, the protein has a conserved EDLLD motif in the CC domain; P-loop (also called kinase 1 or Walker A site, GGVGKT), RNBS-A (KAWVCVSD), kinase-2 (also called Walker B site, LVLDDV), RNBS-B (also called kinase-3a, NGCKVLFTTRSEEVC), GLPL (GLPLAL), RNBS-D (CFLYCALF), and MHDV (MHDV) in the NBS domain (also called the NB or NB-ARC); and LKKLQILKLNDCRR motifs in the LRR domain (Hammond-Kosack and Jones 1997 ; Meyers et al. 1999 ; Meyers et al. 2003 ; López et al. 2003 ; McHale et al. 2006 ; Rairdan and Moffett 2006 ; Rairdan et al. 2008 ; Wang et al. 2015 ; Wu et al. 2017 ; Liu et al. 2019 ; Goyal et al. 2020 ). The PvUI111.11G202400 c.1,328A > G polymorphism results in a substitution of tyrosine (Y) with a cysteine (C) at position 443 (Y443C) for the rust-resistant genotype PI 181996 (Fig. 3 ). Therefore, the protein encoded by PvUI111.11G202400 in the rust-susceptible genotype UI111 would be expected to have identical CC and LRR domains to its counterpart in PI 181996. Still, the RNBS-D motif in the NBS domain shows enrichment for cysteine in the resistant PvUI111.11G202400 protein and a slight increase in the protein sequence identity with its homologs in other species due to the amino acid substitution (Figure S1 ). PACE marker S11_55191718 was developed to differentiate the resistance allele from the susceptible one in the PvUI111.11G202400 . The primer sequences were designed to bind a site that ends with the G at c.1,328 that is A in the susceptible genotypes (Table 2 ). The marker was tested across a panel of ~ 650 Middle American dry bean genotypes. No recombination event was observed for the marker among this population indicating that the polymorphism on which it is based is very close to or in the Ur-11 gene. Discussion Introgression of Ur-11 , the most effective gene against the highly variable common bean rust pathogen, into dry beans has gained increased attention recently. The lack of reliable molecular markers has hindered the effective selection of lines possessing the Ur-11 gene in bean breeding programs. Here it is shown that Ur-11 is physically located close to gene model PvUI111.11G202400 which encodes an NBS-LRR protein located on chromosome Pv11. This model is near the reverse primer of SCAR marker sAE19890 which was previously found to be linked to the Ur-11 locus (Queiroz et al. 2004) and in the same genomic interval associated with an immune response to three U. appendiculatus races that attack Ur-11 alleles (Monclova-Santana 2019. In agreement with Monclova-Santana (2019), we found that most candidate genes tagged by the Ur-11 haplotype response to race 31 − 22 encode NBS-LRR proteins that constitute the largest protein family encoded by plant disease-resistance (R) genes in response to bacterial, fungal, and viral pathogens (Wu et al. 2017). A common NBS-LRR consists of a diverse N-terminal domain, a central NBS domain, and a C-terminal LRR domain. Plant NBS-LRR proteins can be divided into two subfamilies based on the presence of Toll/interleukin-1 receptor (TIR) or CC (or non-TIR) domains in the N-terminal domain (Bentham et al. 2018). The N-terminal TIR and CC, NBS, and LRR domains have different roles during host-pathogen recognition. Both TIR and CC domains are thought to be the receptor modules required for downstream signal transduction post-NBS-LRR activation (Takken and Goverse 2012); however, CC domains from a variety of different NBS-LRRs have also been implicated in guardee or effector perception (Khan et al. 2016). The highly conserved NBS domain typically consisting of ~ 300 amino acids is a functional ATPase domain, and its nucleotide-binding state is proposed to regulate the activity of the R protein (van Ooijen et al. 2008). Six conserved motifs have been identified in the NBS domain of CC-NBS-LRR proteins, including P-loop, kinase-2, RNBS-B, GLPL, RNBS-A, and RNBS-D (He et al. 2022). The functions of these conserved motifs are not well known, but it is believed that they may play roles in binding ATP for the regulation of protein activity (Takken et al., 2006). Mutations in the CC-NBS-LRR gene Pm21 which confers effective resistance to wheat ( Triticum aestivum L.) powdery mildew (caused by Blumeria graminis f. sp. Tritici ) (He et al. 2018) resulted in amino acid substitutions in or near the RNSB-D (L414F, P415L, L418F, R419H, P420S, and C421Y), leading to loss-of-function (He et al. 2022). In Arabidopsis thaliana , RMP1 encodes a CC-NBS-LRR protein in cell plasma membranes in response to the phytopathogenic bacterium Pseudomonas syringae (Boyes et al. 1998). Two amino acid substitutions in or next to the RNSB-D motif (S439F and P442L) of RPM1 impaired the protein function (Tornero et al. 2002). Substitutions of two amino acids (L456P/Y458H) in or next to the RNBS-D resulted in an extended resistance spectrum to wheat powdery mildew conditioned by of the CC-NBS-LRR gene Pm3f (Stirnweis et al. 2014). Amino acid changes in or near RNBS-D motifs were suggested to impair the ATP/ADP binding state of the CC-NBS-LRR protein encoded by Zea mays Rp1-D21 , which confers resistance against Puccinia sorghi , the causal agent of maize common rust (Wang et al. 2015). In potatoes ( Solanum tuberosum L.), similar observations were reported for the NBS-LRR proteins encoded by Rx1 , which confers resistance to potato virus X, and the Gpa2 gene that confers resistance to the potato cyst nematode Globodera pallida (Bendahmane et al. 2002; Slootweg et al. 2013). Our results suggest that a missense mutation [c.1,328G > A] in the UI111 allele of PvUI111.11G202400 likely causes an amino acid substitution (C443Y) in or next to the RNBS-D motif that disrupts the protein function in a similar way to the effect of amino acid substitution (C421Y) in the wheat CC-NBS-LRR gene Pm21 . This similarity may indicate the importance of the cysteine (C) residues in CC-NBS-LRRs (He et al. 2022). We speculate that the wild-type allele of the PvUI111.11G202400 gene is associated with rust resistance conditioned by the Ur-11 locus. In the present study, the use of rust pathogen race 31 − 22 which is avirulent to the Ur-11 locus but is virulent to many other Middle American Ur loci including the Ur -3 locus, which is closely linked to Ur-11 (Hurtado-Gonzales et al. 2017), plus the phenotypic data obtained from the responses of the Middle American genotypes to race 31 − 22, eliminated the confounding effects of other Ur loci for GWAS analysis, suggesting more accurate and reliable results than previous studies. The gene-based PACE marker S11_55182817 was more efficient in differentiating the Ur-11 resistant and susceptible genotypes within different Middle American market classes and populations as compared to the PACE marker snpPv00158 (McClean, Miklas, and Pastor-Corrales, unpublished) currently in use. This new marker would enable bean breeders to select for bean genotypes carrying the dominant allele from those possessing recessive alleles at the Ur-11 locus in early generations of population development, thus preventing the need for plant inoculation. Future work to validate the role of CC-NBS-LRR gene PvUI111.11G202400 in rust resistance might include targeted mutation of the amino acid 443 in the NBS domain of the protein, followed by Agrobacterium -mediated transient expression in bean cotyledons following procedures described by Williams et al. (2011) for flax rust resistance genes. Declarations Funding This research was supported by the U.S. Department of Agriculture’s (USDA) Agricultural Marketing Service (AMS) through the Specialty Crop Block Grant Program in collaboration with the ND Department of Agriculture (grant NOGA-21-303). Its contents are solely the authors' responsibility and do not necessarily represent the official views of the USDA. Support for the development of the breeding populations was provided by the Northarvest Bean Growers Association and USDA-National Institute of Food and Agriculture (NIFA) Hatch projects ND1508 and ND1517 (W-4150 multistate project). Author Contributions ME and JO designed the research plans. ME and JF performed the phenotyping experiments. KS and RL generated the SNP data sets. JR performed SNP calling. JF and ME performed TASSEL and GEMMA analysis. JB made crosses between Puerto Rican navy bean lines and provided F 1 seeds. PM provided additional genomic sequence data for multiple sequence alignments. ME conducted genotyping and cross-validation experiments. ME performed ‘in silico’ analysis. ME wrote the manuscript and the authors made edits. All the authors read and approved the final manuscript. Conflict of Interest The authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest. ORCID Mohammad Erfatpour https://orcid.org/0000-0002-7221-6973 Juan M. Osorno https://orcid.org/0000-0003-0905-3523 Kristin J. Simons https://orcid.org/0000-0002-1476-6707 References Alzate-Marin AL, de Souza TLPO, Ragagnin VA, Moreira MA, de Barros EG (2004) Allelism tests between the rust resistance gene present in common bean cultivar Ouro Negro and genes Ur-5 and Ur-11 . J. Phytopathology 152:60-64. https://doi.org/10.1046/j.1439-0434.2003.00802.x Aragão FJL, Rech EL (1997) Morphological factors influencing recovery of transgenic bean plants ( Phaseolus vulgaris L.) of a carioca cultivar. Int J Plant Sci 158:157-163 Ballantyne BJ (1974) Resistance to rust ( Uromyces appendiculatus ) in beans ( Phaseolus vulgaris ). Proc Linn Soc NSW 98:107-121 Beaver JS, Rosas JC, Porch TG, Pastor-Corrales MA, Godoy-Lutz G, Prophete EH (2015) Registration of PR0806-80 and PR0806-81 white bean germplasm lines with resistance to BGYMV, BCMV, BCMNV, and rust. J Plant Regis 9:208-211. http://doi.org/10.3198/jpr2014.09.0061crg Bendahmane A, Farnham G, Moffett P, Baulcombe DC (2002) Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. Plant J 32:195-204. https://doi.org/10.1046/j.1365-313X.2002.01413.x Bentham AR, Zdrzalek R, De la Concepcion JC, Banfield MJ (2018) Uncoiling CNLs: Structure/function approaches to understanding CC domain function in plant NLRs. Plant Cell Physiol 59:2398-2408. http://doi.org/10.1093/pcp/pcy185 Boyes DC, Nam J, Dangl JL (1998) The Arabidopsis thaliana RPM1 disease resistance gene product is a peripheral plasma membrane protein that is degraded coincident with the hypersensitive response. Proc Natl Acad Sci U S A. 95:15849-15854. http://doi.org/ 10.1073/pnas.95.26.15849 Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES (2007) TASSEL: software for association mapping of complex traits in diverse samples. Bioinform 23:2633-2635. https://doi.org/10.1093/bioinformatics/btm308 Browning BL, Zhou Y, Browning SR (2018) A one-penny imputed genome from next generation reference panels. Am J Hum Genet 103:338-348. http://doi.org/10.1016/j.ajhg.2018.07.015 Cao Y, Mo W, Li Y, Xiong Y, Wang H, Zhang Y, Lin M, Zhang L, Li X (2024) Functional characterization of NBS-LRR genes reveals an NBS-LRR gene that mediates resistance against Fusarium wilt. BMC Biol 22:45. https://doi.org/10.1186/s12915-024-01836-x Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H (2021) Twelve years of SAMtools and BCFtools. Gigascience 10:giab008. http://doi.org/10.1093/gigascience/giab008 de Souza TLPO, Dessaune SN, Sanglard DA, Moreira MA, de Barros EG (2011) Characterization of the rust resistance gene present in the common bean cultivar Ouro Negro, the main rust resistance source used in Brazil. Plant Pathol 60:839-845. https://doi.org/10.1111/j.1365-3059.2011.02456.x Elmore JM, Lin ZJ, Coaker G (2011) Plant NB-LRR signaling: upstreams and downstreams. Curr Opin Plant Biol 14:365-371. http://doi.org/10.1016/j.pbi.2011.03.011 Goyal N, Bhatia G, Sharma S, Garewal N, Upadhyay A, Upadhyay SK, Singh K (2020) Genome-wide characterization revealed role of NBS-LRR genes during powdery mildew infection in Vitis vinifera. Genomics 112:312-322. https://doi.org/10.1016/j.ygeno.2019.02.011 Grafton KF, Chang KC, Venette JR, Vander Wal AJ (1993) Registration of ‘Norstar’ navy bean. Crop Sci 33:1405-1406 Hammond-Kosack KE, Jones JD (1997) Plant disease resistance genes. Annu Rev Plant Physiol Plant Mol Biol 48:575-607. http://doi.org/10.1146/annurev.arplant.48.1.575 He H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) Pm21 , Encoding a Typical CC-NBS-LRR Protein, Confers Broad-Spectrum Resistance to Wheat Powdery Mildew Disease. Mol Plant 11:879-882. http://doi.org/10.1016/j.molp.2018.03.004 He H, Guo R, Gao A, Chen Z, Liu R, Liu T, Kang X, Zhu S (2022) Large-scale mutational analysis of wheat powdery mildew resistance gene Pm21 . Front Plant Sci 13:988641. http://doi.org/ 10.3389/fpls.2022.988641 Hurtado-Gonzales OP, Valentini G, Gilio TA, Martins AM, Song Q, Pastor-Corrales MA (2017) Fine mapping of Ur-3 , a historically important rust resistance locus in common bean. G3 Genes Genomes Genet 7:557-569. https://doi.org/10.1534/g3.116.036061 Jochua C, Amane MIV, Steadman JR, Xue X, Eskidge KM (2008) Virulence diversity of the common bean rust pathogen within and among individual bean fields and development of sampling strategies. Papers in Plant Pathology Plant Dis 92:401-408. https://doi.org/10.1094/ PDIS-92-3-0401 Johnson E, Miklas PN, Stavely JR, Martinez-Cruzado JC (1995) Coupling- and repulsion-phase RAPDs for marker-assisted selection of PI 181996 rust resistance in common bean. Theor Appl Genet 90:659-664. https://doi.org/10.1007/BF00222130 Joshi NA, Fass JN (2011) Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files (Version 1.33) [Software]. Available at https://github.com/najoshi/sickle. Kelly JD, Geots P, Miklas PM, Coyne DP (2003) Tagging and mapping of genes and QTL and molecular marker-assisted selection for traits of economic importance in bean and cowpea. Field Crops Res 82:135-154. https://doi.org/10.1016/S0378-4290(03)00034-0 Khan M, Subramaniam R, Desveaux D (2016) Of guards, decoys, baits and traps: Pathogen perception in plants by type III effector sensors. Curr Opin Microbiol 29:49-55. https://doi.org/10.1002/jsfa.7120 Lee HA, Yeom SI (2015) Plant NB-LRR proteins: tightly regulated sensors in a complex manner. Brief Funct Genomics 14:233-42. http://doi: 10.1093/bfgp/elv012 Leitão ST, Rubiales D, Vaz Patto MC (2023) Identification of novel sources of partial and incomplete hypersensitive resistance to rust and associated genomic regions in common bean. BMC Plant Biol 23:610. https://doi.org/10.1186/s12870-023-04619-8 Li H (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv: Genomics. https://doi.org/10.6084/m9.figshare.963153.v1 Liu Z, Xie J, Wang H, Zhong X, Li H, Yu J, Kang J (2019) Identification and expression profiling analysis of NBS-LRR genes involved in Fusarium oxysporum f.sp. conglutinans resistance in cabbage. 3 Biotech. 9:202. http://doi.org/10.1007/s13205-019-1714-8 López CE, Zuluaga AP, Cooke R, Delseny M, Tohme J, Verdier V (2003) Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava. Mol Genet Genomics 269:658-671. http://doi.org/10.1007/s00438-003-0868-5 Markell SM, Pastor-Corrales MA, Jordahl JG, Lampa RS, Mathew FB, Osorno JM, Goswami RS (2009) Virulence of Uromyces appendiculatus to the resistance gene Ur-3 identified in North Dakota in 2008. Annu Rep Bean Improv Coop, 52:82-83. Marone D, Russo MA, Laidò G, De Leonardis AM, Mastrangelo AM (2013). Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: active guardians in host defense responses. Int J Mol Sci 14:7302-26. http://doi.org/10.3390/ijms14047302 McClean PE, Lee R, Howe K, Osborne C, Grimwood J, Levy S, Haugrud AP, Plott C, Robinson M, Skiba RM, Tanha T, Zamani M, Thannhauser TW, Glahn RP, Schmutz J, Osorno JM, Miklas PN (2022) The common bean V gene encodes flavonoid 3′5′ hydroxylase: a major mutational target for flavonoid diversity in angiosperms. Front Plant Sci 13:869582. http://doi.org/10.3389/fpls.2022.869582 McHale L, Tan X, Koehl P, Michelmore RW (2006). Plant NBS-LRR proteins: adaptable guards. Genome Biol 7:212. https://doi.org/10.1186/gb-2006-7-4-212 Miklas PN, Pastor-Corrales MA, Jung G, Coyne DP, Kelly JD, McClean PE, Gepts P (2002) Comprehensive linkage map of bean rust resistance genes. Ann Rep Bean Improv Coop 45:125-129 Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND (1999) Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J 20:317-332. http:// doi.org/10.1046/j.1365-313x.2002.01404.x Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW (2003) Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15:809-834. http://doi.org/10.1105/tpc. 009308 Miklas PN, Kelly JD, Beebe SE, Blair MW (2006) Common bean breeding for resistance against biotic and abiotic stresses: from classical to MAS breeding. Euphytica 147:105-161. https://doi.org/10.1007/s10681-006-4600-5 Moffett P, Farnham G, Peart J, Baulcombe DC (2002) Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J 21:4511-4519. http://doi.org/10.1093/emboj/cdf453 Moghaddam SM, Mamidi S, Osorno JM, Lee R, Brick M, Kelly J, Miklas P, Urrea C, Song Q, Cregan P, Grimwood J, Schmutz J, McClean PE (2016) Genome-wide association study identifies candidate loci underlying agronomic traits in a middle american diversity panel of common bean. Plant Genome 9:1-21. http://doi.org/10.3835/plantgenome2016.02.0012 Monclova-Santana C (2019) Population structure of Uromyces appendiculatus in North Dakota. PhD Thesis. North Dakota State University: Fargo, ND. Montejo Domínguez LdMA, McClean PE, Steadman J, McCoy S, Markell S, Osorno JM (2022) Bean rust resistance in the Guatemalan climbing bean germplasm collection. Legum Sci 4:e149. https://doi.org/10.1002/leg3.149 Osorno JM, Vander Wal AJ, Posch J, Simons K, Grafton KF, Pasche JS, Nelson BD, Jain S, Pastor-Corrales M (2020) ‘ND Falcon’, a new pinto bean with combined resistance to rust and soybean cyst nematode. J Plant Regist 14:117-125. https://doi.org/10.1002/plr2.20025 Pastor-Corrales MA (2003) Sources, genes for resistance, and pedigrees of 52 rust and mosaic resistant dry bean germplasm lines released by the USDA Beltsville bean project in collaboration with the Michigan, Nebraska and North Dakota agricultural experiment station. Annu Rep Bean Improv Coop 46:235-241 Pastor-Corrales MA, Kelly JD, Steadman JR, Lindgren DT, Stavely JR, Coyne DP (2007) Registration of six great northern bean germplasm lines with enhanced resistance to rust and bean common mosaic and necrosis potyviruses. J Plant Regis 1:77-79. https://doi.org/10.3198/jpr2005.12.0517crg Queiroz VT, Sousa CS, Souza TLPO, Costa MR, Sanglard DA, Ragagnin VA, Barros EG, Moreira MA (2004) SCAR marker linked to the common bean rust resistance gene Ur-11 . Annu Rep Bean Improv Coop 47:271-272 Rairdan GJ, Moffett P (2006) Distinct domains in the ARC region of the potato resistance protein Rx mediate LRR binding and inhibition of activation. Plant Cell 18:2082-2093. http://doi.org/10.1105/tpc.106.042747 Rairdan GJ, Collier SM, Sacco MA, Baldwin TT, Boettrich T, Moffett P (2008) The coiled-coil and nucleotide binding domains of the Potato Rx disease resistance protein function in pathogen recognition and signaling. Plant Cell 20:739-751. http://doi.org/10.1105/tpc.107.056036 Schmutz J, McClean PE, Mamidi S, Wu GA, Cannon SB, Grimwood J et al (2014) A reference genome for common bean and genome-wide analysis of dual domestications. Nat Genet 46:707-713. https://doi.org/10.1038/ng.3008 Slootweg EJ, Spiridon LN, Roosien J, Butterbach P, Pomp R, Westerhof L, Wilbers R, Bakker E, Bakker J, Petrescu AJ, Smant G, Goverse A (2013) Structural determinants at the interface of the ARC2 and leucine-rich repeat domains control the activation of the plant immune receptors Rx1 and Gpa2. Plant Physiol 162:1510-1528. http://doi.org/10.1104/pp.113.218842 Souza TLPO, Faleiro FG, Dessaune SN, Paula-Junior TJ, Moreira MA, Barros EG (2013) Breeding for common bean ( Phaseolus vulgaris L.) rust resistance in Brazil. Trop Plant Pathol 38:361-374. https://doi.org/10.1590/S1982-56762013005000027 Stirnweis D, Milani SD, Jordan T, Keller B, Brunner S (2014) Substitutions of two amino acids in the nucleotide-binding site domain of a resistance protein enhance the hypersensitive response and enlarge the PM3F resistance spectrum in wheat. Mol Plant Microbe Interact 27:265-276. http://doi.org/10.1094/MPMI-10-13-0297-FI Stavely JR, Pastor-Corrales MA (1989) Rust. In: Schwartz HF, Pastor-Corrales MA (eds) Bean production problems in the tropics, 2nd edn. CIAT, Cali, pp 159-194 Stavely JR, Kelly JD, Grafton KF (1994) BelMiDak-Rust-Resistant navy dry beans germplasm lines. HortScience 29:709-711 Steadman JR, Pastor-Corrales MA, Beaver JS (2002) An overview of the 3 rd bean rust and 2 nd bean common bacterial blight international workshop. Annu Rep Bean Improv Coop 45:120-124 Takken FL, Albrecht M, Tameling WIL (2006) Resistance proteins: molecular switches of plant defence. Curr Opin Plant Biol 9:383-390. http://doi.org/10.1016/j.pbi.2006.05.009 Takken FL, Goverse A (2012). How to build a pathogen detector: structural basis of NB-LRR function. Curr Opin Plant Biol 15:375-384. http://doi.org/10.1016/j.pbi.2012.05.001 Tello D, Gonzalez-Garcia LN, Gomez J, Zuluaga-Monares JC, Garcia R, Angel R, Mahecha D, Duarte E, Leon MDR, Reyes F, Escobar-Velásquez C, Linares-Vásquez M, Cardozo N, Duitama J (2023) NGSEP 4: Efficient and accurate identification of orthogroups and whole-genome alignment. Mol Ecol Resour 23:712-724. https://doi.org/10.1111/1755-0998.13737 Tornero P, Chao RA, Luthin WN, Goff SA, Dangl JL (2002) Large-scale structure-function analysis of the Arabidopsis RPM1 disease resistance protein. Plant Cell 14:435-450. http://doi.org/ 10.1105/tpc.010393 Turner SD (2018) qqman: an R package for visualizing GWAS results using Q-Q and manhattan plots. J Open Source Softw 3:731. https://doi.org/10.21105/joss.00731 van der Biezen EA, Jones JDG (1998) The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. Current Biology, 8:R226-R228. https://doi.org/10.1016/S0960-9822(98)70145-9 van Ooijen G, Mayr G, Kasiem MMA, Albrecht M, Cornelissen BJC, Takken FLW (2008). Structure-function analysis of theNB-ARC domain of plant disease resistance proteins. J Exp Bot 59:1383-1397. https://doi.org/10.1093/jxb/ern045 Van Schoonhoven A, Pastor-Corrales MA (1987) Standard system for the evaluation of bean germplasm. Cali 24-27 Vargas E (1980) Rust. In: Schwartz HF, Gálvez GE, Guillermo E (eds) Bean production problems: disease, insect, soil and climatic constraints of Phaseolus vulgaris. CIAT, Cali, pp 17-36 Wang GF, Ji J, El-Kasmi F, Dangl JL, Johal G, Balint-Kurti PJ (2015) Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity. PLoS Pathog 11:e1004674. http://doi.org/10.1371/journal.ppat.1004674 Wasonga CJ, Pastor-Corrales MA, Porch TG, Griffiths PD (2010) Targeting gene combinations for broad-spectrum rust resistance in heat-tolerant snap beans developed for tropical environments. J Amer Soc Hort Sci 135:521-532. https://doi.org/10.21273/JASHS.135.6.521 Williams SJ, Sornaraj P, deCourcy-Ireland E, Menz RI, Kobe B, Ellis JG, Dodds PN, Anderson PA (2011) An autoactive mutant of the M flax rust resistance protein has a preference for binding ATP, whereas wild-type M protein binds ADP. Mol Plant Microbe Interact. 24:897-906. http://doi.org/10.1094/MPMI-03-11-0052 Wu J, Zhu J, Wang L, Wang S (2017) Genome-wide association study identifies NBS–LRR-encoding genes related with anthracnose and common bacterial blight in the common bean. Front Plant Sci 8:1398. https://doi.org/10.3389/fpls.2017.01398 Zaumeyer WJ, Thomas HR (1957) A monographic study of bean diseases and methods of their control. United States Department of Agriculture, Economic Research Service. Technical Bulletin 868:84-88. https://doi.org/10.22004/ag.econ.169625 Zhou X, Stephens M (2012) Genome-wide efficient mixed-model analysis for association studies. Nat Genet 44:821-824. http://doi.org/10.1038/ng.2310 Tables Table 1. Significant single nucleotide polymorphism (SNP) markers on chromosome Pv11 from a genome-wide association study (GWAS) of preliminary and advanced breeding lines and cultivars from the North Dakota State University dry bean breeding program, plus germplasm lines from the United States Department of Agriculture, Agricultural Research Station at Beltsville, Maryland in association with Uromyces appendiculatus races 31-22. SNP marker positions are relative to the P. vulgaris UI111 reference genome assembly v1.1. Reference SNP Position (bp) -log 10 ( p ) Variation explained (%) S11_55458849 55,458,849 50.40 28.82 S11_55167465 55,167,465 51.41 28.48 S11_55167606 55,167,606 51.41 28.48 S11_55397512 55,397,512 51.41 28.48 S11_55397514 55,397,514 51.41 28.48 S11_55397572 55,397,572 51.41 28.48 S11_55397575 55,397,575 51.41 28.48 S11_55401744 55,401,744 51.41 28.48 S11_55401745 55,401,745 51.41 28.48 S11_55401746 55,401,746 51.41 28.48 S11_55401884 55,401,884 51.41 28.48 S11_55401904 55,401,904 51.41 28.48 S11_55403439 55,403,439 51.41 28.48 S11_55403490 55,403,490 51.41 28.48 S11_55466915 55,466,915 51.41 28.48 S11_55167642 55,167,642 49.70 27.83 S11_55167692 55,167,692 48.36 27.53 S11_55220638 55,220,638 47.29 27.41 S11_55220618 55,220,618 48.55 26.87 S11_55564761 55,564,761 45.48 26.69 S11_55220675 55,220,675 40.31 23.96 S11_55221024 55,221,024 40.31 23.96 S11_55221035 55,221,035 40.31 23.96 S11_55374026 55,374,026 25.41 21.47 S11_55564702 55,564,702 38.62 21.09 S11_55565283 55,565,283 39.72 19.76 S11_55565595 55,565,595 28.99 14.81 Table 2 List of PCR Competitive Extension (PACE) genotyping assays designed for genetic variants in the exons of candidate genes linked to the Ur-11 locus on chromosome Pv11 of the UI111 reference genome that consistently differentiate genotypes with immune or hypersensitive reactions to rust race 31-22 from the susceptible genotypes based on the results of DNA sequence alignments. Gene SNP physical position (bp) UI111 Genome Reference allele Alternate allele Marker ID Primer type Primer sequence PvUI111.11G202300 55,182,814 C G S11_55182814 Alternate 1 FAM-GCCTTGAAAACAATGGGAAGTCTAC Reference 2 HEX-GCCTTGAAAACAATGGGAAGTCTAG Common TGCTTTCCCATTCCCAAAAGGATGATTTA PvUI111.11G202300 55,182,817 C A S11_55182817 Alternate FAM-CCATTCCCAAAAGGATGATTTACTGTT Reference HEX-CCATTCCCAAAAGGATGATTTACTGTG Common TAGCCTTGAAAACAATGGGAAGTCTASTA PvUI111.11G202300 55,182,818 A G S11_55182818 Alternate FAM-CCATTCCCAAAAGGATGATTTACTGC Reference HEX-CCATTCCCAAAAGGATGATTTACTGT Common CTTTAGCCTTGAAAACAATGGGAAGTCTAGTA PvUI111.11G202400 55,191,672 G T S11_55191672 Alternate FAM-CCTTCCTTCTTATCTGAAGAAATGCTTTT Reference HEX-CCTTCCTTCTTATCTGAAGAAATGCTTTG Common CACATAACCTTTGGGAAATAAGGCACAAA PvUI111.11G202400 55,191,718 A G S11_55191718 Alternate FAM- AAAGGTTATGTGTTTGACAAGGAGTG Reference HEX- AAAGGTTATGTGTTTGACAAGGAGTA Common CACATAACCTTTGGGAAATAAGGCACAAA PvUI111.11G202400 55,192,034 G T S11_55192034 Alternate FAM-CAGTCAGTTGGCATAAATGTATGCAAA Reference HEX- CAGTCAGTTGGCATAAATGTATGCAAC Common GGGTTTGGAAGTTTGGTTGATACTCAAAA PvUI111.11G202400 55,192,298 C T S11_55192298 Alternate FAM-AAGCTCCTTCAATCTTCGACAATCA Reference HEX-AAGCTCCTTCAATCTTCGACAATCG Common AAACTACCTGACTCCATAAGTTTACTCAAA PvUI111.11G204900 55,458,849 G A S11_55458849 Alternate FAM-CAGTGTCTGTGGCTGTTGGTA Reference HEX-CAGTGTCTGTGGCTGTTGGTG Common GGATCTGCCATCTCATTGGGAAGAA Table 2 . (continued). Gene SNP physical position (bp) UI111 Genome Reference allele Alternate allele Marker ID Primer type Primer sequence PvUI111.11G204900 55,459,336 G A S11_55459336 Alternate FAM-GGTATTTGCCGGTTGAAGTGAA Reference HEX- GGTATTTGCCGGTTGAAGTGAG Common CAACCAAAACACTTCGCATGCCCAT PvUI111.11G205100 55,482,888 G A S11_55482888 Alternate FAM-CTCCAACGCCTACCAGAGGAGA Reference HEX-CTCCAACGCCTACCAGAGGAGG Common GCAAAGGACACTGCTTTATTGTAAGACTT PvUI111.11G205100 55,483,738 C G S11_55483738 Alternate FAM-GTCCAACTGCAGCTTTCCACAC Reference HEX-GTCCAACTGCAGCTTTCCACAG Common CACTCTCAGAGCTCTTGATTTAGAACTA PvUI111.11G205100 55,484,893 C A S11_55484893 Alternate FAM-GAGTTGATGAACCAAAAGGTATACCA Reference HEX-GAGTTGATGAACCAAAAGGTATACCC Common GGTTGTAGATGACAAATGACGGATTGTTT 1 Resistant allele 2 Susceptible allele Supplementary Files Supplementarytablesandfigure.docx Cite Share Download PDF Status: Published Journal Publication published 24 Feb, 2025 Read the published version in Theoretical and Applied Genetics → Version 1 posted Reviewers agreed at journal 11 Oct, 2024 Reviewers invited by journal 11 Oct, 2024 Editor assigned by journal 09 Oct, 2024 First submitted to journal 07 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5220084","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":364910964,"identity":"0eafb575-d19c-43d1-95be-195c562da734","order_by":0,"name":"Mohammad Erfatpour","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Erfatpour","suffix":""},{"id":364910965,"identity":"61be0aba-f93b-46c6-a732-297de693628f","order_by":1,"name":"Kristin Simons","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Kristin","middleName":"","lastName":"Simons","suffix":""},{"id":364910966,"identity":"0f7450d6-b665-4854-9280-f7797f028929","order_by":2,"name":"Jayanta Roy","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Jayanta","middleName":"","lastName":"Roy","suffix":""},{"id":364910967,"identity":"e681613f-8482-443a-a903-d88fc427e6e6","order_by":3,"name":"Jose Figueroa-Cerna","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Jose","middleName":"","lastName":"Figueroa-Cerna","suffix":""},{"id":364910968,"identity":"28dea401-1195-4c82-a09e-e7d4b06f857e","order_by":4,"name":"Rian Lee","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Rian","middleName":"","lastName":"Lee","suffix":""},{"id":364910969,"identity":"9d36938f-3e87-46cc-90a2-817219521550","order_by":5,"name":"James Beaver","email":"","orcid":"","institution":"UPR Mayaguez: Recinto Universitario de Mayaguez Universidad de Puerto Rico","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"","lastName":"Beaver","suffix":""},{"id":364910970,"identity":"0b54da29-80b5-46e6-b735-c8fb415b5955","order_by":6,"name":"Phillip McClean","email":"","orcid":"","institution":"NDSU: North Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Phillip","middleName":"","lastName":"McClean","suffix":""},{"id":364910971,"identity":"a91c6bfa-bef3-4c22-9e19-740f8232fb3e","order_by":7,"name":"Juan M. Osorno","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYBAC9gYQWQFmMz5gYAMzDPBqYQRrOQNmMxsQr4WxDcxmkyBOy4zkZw8Y2+rkzGc3H6suKKtLbGBv3iaBX0uauQFj22FjmTvH0m7POHc4sYHnWBkBLQlmEoxtBxJnSOSY3eYFMhqADAJa0r8BtdSBtRTzAhkN8m/waxGckQOyhRmshZkXyGiQ4MGvRZrnTZlEwpnDxhISacnSPOcOG7fxpBVb4NPCx56+TeJDRZ2chETywc88ZXWy/eyHN97ApwUMEpA5bASVj4JRMApGwSggCAAHrkIDmEqMvQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0905-3523","institution":"NDSU: North Dakota State University","correspondingAuthor":true,"prefix":"","firstName":"Juan","middleName":"M.","lastName":"Osorno","suffix":""}],"badges":[],"createdAt":"2024-10-07 18:08:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5220084/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5220084/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00122-025-04836-9","type":"published","date":"2025-02-24T15:57:30+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66583875,"identity":"eda4e03d-0551-4277-940e-1605844ba19f","added_by":"auto","created_at":"2024-10-14 13:59:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":108480,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Manhattan plot highlighting SNPs associated with the \u003cem\u003eUr-11\u003c/em\u003elocus in the 55.16-56.33 Mb region of Pv11 of the \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference genome assembly v1.1, with (B) Q-Q plot showing substantial deviation from the diagonal for highly trait-associated SNPs. \u003cem\u003eP. vulgaris\u003c/em\u003e chromosomes (1-11) are represented on the x-axis, and a -log 10 (p) values are shown on the y-axis. The red line indicates the threshold at a significance value of -log10(\u003cem\u003ep\u003c/em\u003e)=4.7.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5220084/v1/1b3f6395ff87f6ec71d698d5.png"},{"id":66583878,"identity":"aea4146e-1ebb-48ff-a828-87e177f7741c","added_by":"auto","created_at":"2024-10-14 13:59:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":185802,"visible":true,"origin":"","legend":"\u003cp\u003eBio-Rad CFX Maestro images of four different PCR Allele Competitive Extension (PACE) genotyping assays linked to the rust resistance \u003cem\u003eUr-11\u003c/em\u003e locus and comparison of their efficiency to differentiate the respective phenotypes in 67 navy bean genotypes with an immune reaction to rust race 31-22. Orange circles have a FAM-type allele and represent resistant genotypes homozygous for allele 1; Blue squares have a HEX-type allele and represent susceptible genotypes homozygous for the reference allele 2; Green triangles represent heterozygotes; and black diamonds represent no-template controls.\u003cstrong\u003e \u003c/strong\u003eFAM and HEX signals are reported in relative fluorescence units (RFUs). Fluorescence intensities were normalized using a passive reference dye (ROX).\u003cstrong\u003eA \u003c/strong\u003ePACE\u003cstrong\u003e \u003c/strong\u003emarker S11_55182817 represents a single nucleotide substitution in the exon [c.1,155C/T] of \u003cem\u003ePvUI111.11G202300\u003c/em\u003e.\u003cstrong\u003e B\u003c/strong\u003e PACE marker S11_55191718 represents a single nucleotide substitution in the exon [c.1,328A\u0026gt;G] of \u003cem\u003ePvUI111.11G202400\u003c/em\u003e.\u003cstrong\u003eC\u003c/strong\u003e. PACE marker S11_55458849 represents a single nucleotide substitution in the exon [c.610G\u0026gt;A] of \u003cem\u003ePvUI111.11G204900\u003c/em\u003e.\u003cstrong\u003e D \u003c/strong\u003ePACE marker S11_55482888 represents a single nucleotide substitution in the exon [c.3,565G\u0026gt;A] of \u003cem\u003ePvUI111.11G205100\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5220084/v1/67bde73445ea233ae144c4d4.png"},{"id":66583874,"identity":"2c46e5bf-3568-4e5b-a4f1-81d2139d66b6","added_by":"auto","created_at":"2024-10-14 13:59:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":62975,"visible":true,"origin":"","legend":"\u003cp\u003eSequence alignment of NBS-LRR protein encoded by \u003cem\u003ePvUI111.11G202400\u003c/em\u003ein \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference genome (rust susceptible genotype) and the putative translation of the homolog of \u003cem\u003ePvUI111.11G202400\u003c/em\u003e in PI 181996 (possessing the rust resistance \u003cem\u003eUr-11\u003c/em\u003e gene). A substitution of cysteine (C) for tyrosine (Y) at position 443 (bordered by red lines) was detected in the protein sequence of the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e in PI 181996 (rust susceptible genotype). Characteristic motifs of CC-NBS-LRR are identified, including EDLLD motif (teal residues) in the CC domain, P-loop (red residues), RNBS-A (blue residues), kinase-2 (purple residues), RNBS-B (green residues), GLPLAL (megneta residues), RNBS-D (orange residues), and MHDL (pink residues) in the NBS domain, plus the LKKLQILKLNDCRR motifs (brown residues) in the NBS-LRR domain. A substitution of cysteine (C) for tyrosine (Y) at position 443 (bordered by red lines) was detected in the protein sequence of the \u003cem\u003ePvUI111.11G202400\u003c/em\u003ein PI 181996.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5220084/v1/3f98e63fa45cbf11976bc500.png"},{"id":77622855,"identity":"c92481a4-d645-47a2-9a0a-77216e4fb375","added_by":"auto","created_at":"2025-03-03 16:10:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1199879,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5220084/v1/a0aeeaea-8a64-4ad1-9786-233f13e69fb4.pdf"},{"id":66583876,"identity":"9b423323-d649-4394-a7ca-cff1117c0245","added_by":"auto","created_at":"2024-10-14 13:59:56","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":29378,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarytablesandfigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-5220084/v1/0e3a17a5fe178561e6726be7.docx"}],"financialInterests":"","formattedTitle":"Fine Mapping and Identification of Causal Alleles at the Ur-11 Locus Controlling Rust Resistance in Common Bean (Phaseolus vulgaris L.)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRust, caused by \u003cem\u003eUromyces appendiculatus\u003c/em\u003e (Pers.:Pers.) Unger, is among the most damaging diseases of common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) in humid tropical and subtropical production regions and is capable of causing periodic epidemics in temperate moist areas (Zaumeyer and Thomas \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e1957\u003c/span\u003e; Ballantyne \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1974\u003c/span\u003e; Vargas \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e1980\u003c/span\u003e; Stavely and Pastor-Corrales \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Souza et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The bean rust pathogen has a high virulence diversity with more than 90 races identified worldwide (Hurtado-Gonzales et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Host plant resistance is an effective and environmentally friendly control measure despite high variability in \u003cem\u003eU. appendiculatus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIt is believed that the \u003cem\u003eP. vulgaris\u003c/em\u003e-\u003cem\u003eU. appendiculatus\u003c/em\u003e pathosystem fits the gene-for-gene theory and involves dominant genes in the bean plant that confer monogenic resistance against various races of the rust pathogen (Stavely and Pastor-Corrales \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Montejo Dom\u0026iacute;nguez et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, new findings suggest an oligogenic control of rust resistance in some common bean accessions (Leit\u0026atilde;o et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). At least 11 rust resistance loci have been identified and mapped to different linkage groups in the bean genome, and more resistance loci (named and unnamed) are yet to be mapped (Miklas et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2002\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Steadman et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Kelly et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; de Souza et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Hurtado-Gonzales et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Among mapped resistance loci, \u003cem\u003eUr-3\u003c/em\u003e, \u003cem\u003eUr-3\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eUr-5\u003c/em\u003e, \u003cem\u003eUr-7\u003c/em\u003e, \u003cem\u003eUr-11\u003c/em\u003e, and \u003cem\u003eUr-14\u003c/em\u003e belong to the Middle American gene pool and \u003cem\u003eUr-4, Ur-6, Ur-9, Ur-12\u003c/em\u003e, and \u003cem\u003eUr-13\u003c/em\u003e are from the Andean gene pool (Steadman et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2002\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn 2008, a new \u003cem\u003eU. appendiculatus\u003c/em\u003e race, 20\u0026thinsp;\u0026minus;\u0026thinsp;3, was identified in North Dakota, resulting in susceptibility of at least 27 of the most grown cultivars in North Dakota (Markell et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Race 20\u0026thinsp;\u0026minus;\u0026thinsp;3 were virulent on the Middle American differential cultivars, Aurora (\u003cem\u003eUr-3\u003c/em\u003e) and GN1140 (\u003cem\u003eUr-7\u003c/em\u003e) and the Andean differential cultivars, Golden Gate Wax (\u003cem\u003eUr-6\u003c/em\u003e) and Montcalm (unknown gene). However, it is avirulant on the Middle American \u003cem\u003eUr-11\u003c/em\u003e gene. This indicates the importance of incorporating effective genes and pyramiding of those genes for long-term rust management in common bean.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eUr-11\u003c/em\u003e gene provides broad-spectrum resistance against most \u003cem\u003eU. appendiculatus\u003c/em\u003e races and is susceptible only to Honduran \u003cem\u003eU. appendiculatus\u003c/em\u003e race 22\u0026ndash;52 (formerly known as 108) (Pastor-Corrales et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Wasonga et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Hurtado-Gonzales et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, the \u003cem\u003eUr-11\u003c/em\u003e gene in combination with other rust-resistance genes can be used as the most cost-effective strategy for controlling the highly variable rust pathogen in common bean (Pastor-Corrales et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The Guatemalan black beans PI 181996 and PI 190078 are known sources of the \u003cem\u003eUr-11\u003c/em\u003e gene in the Middle American gene pool (Pastor-Corrales et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). However, the PI 181996 resistance source was the one predominantly introgressed into common bean germplasm (Pastor-Corrales \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). \u0026lsquo;ND-Falcon\u0026rsquo; was the first pinto bean cultivar with the \u003cem\u003eUr-11\u003c/em\u003e derived from PI 181996 released by the NDSU dry bean breeding program in 2019 (Osorno et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUsing BC\u003csub\u003e4\u003c/sub\u003eF\u003csub\u003e2\u003c/sub\u003e individuals derived from backcrosses between NX-040*4 and PI 181996, the \u003cem\u003eUr-11\u003c/em\u003e locus was mapped to chromosome Pv11 and linked to two random amplified polymorphic DNA (RAPD) markers, OAC20\u003csub\u003e490\u003c/sub\u003e co-segregating in coupling phase, and OAE19\u003csub\u003e890\u003c/sub\u003e linked in repulsion phase at a distance of 6.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8 cM (Johnson et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). NX-040 is a sister line of 'Norstar' navy bean (Grafton et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). The RAPD marker OAE19\u003csub\u003e890\u003c/sub\u003e was later located 1.0 cM from the \u003cem\u003eUr-11\u003c/em\u003e in a F\u003csub\u003e2\u003c/sub\u003e population derived from Ruda\u0026acute; \u0026times; BelMiDak-RR-3 cross (Alzate-Marin et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Ruda\u0026acute; is a carioca-type cultivar (Arag\u0026atilde;o and Rech \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) and BelMiDak-RR-3 is a navy bean germplasm line possessing the \u003cem\u003eUr-11\u003c/em\u003e gene from PI 181996 (Stavely et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Pastor-Corrales \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Later, Queiroz et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) converted OAE19\u003csub\u003e890\u003c/sub\u003e into a sequence characterized amplified region (SCAR) marker sAE19\u003csub\u003e890\u003c/sub\u003e. It is worth noting that Blast searches in Phytozome (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://phytozome.jgi.doe.gov\u003c/span\u003e\u003cspan address=\"http://phytozome.jgi.doe.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) reveal the reverse primer of sAE19\u003csub\u003e890\u003c/sub\u003e (5\u0026rsquo;-CAGTCCCTAAAGTAGTTTGTCCCTA-3\u0026rsquo;) is conserved across genetic backgrounds including Middle American (\u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference genome assembly v1.1, Pv11: 55335635..55335659) and Andean (\u003cem\u003eP. vulgaris\u003c/em\u003e G19833 genome assembly v2.1, Pv11: 51387148..51387172). Still, the forward primer of sAE19\u003csub\u003e890\u003c/sub\u003e (5\u0026rsquo;-CAGTCCCTGACAACATAACACC-3\u0026rsquo;) is likely specific for the Carioca background.\u003c/p\u003e \u003cp\u003eGenome-wide association study (GWAS) is a powerful approach to detect genome-phenotype associations and validate loci identified by other methods. Recently, a GWAS on a Middle American diversity panel mapped the \u003cem\u003eUr-11\u003c/em\u003e of PI 181996 to a genomic interval from 50.5Mb to 52.2Mb on Pv11 of \u003cem\u003eP. vulgaris\u003c/em\u003e G19833 (Monclova-Santana \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). This region contains multiple disease-resistance genes such as leucine-rich repeats containing (LRR) genes and corresponds to a genomic region from 54 to 56 Mb on Pv11 of \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 v1.1.\u003c/p\u003e \u003cp\u003eEven though great progress has been made in mapping and identification of candidate genes for rust resistance at the \u003cem\u003eUr-11\u003c/em\u003e locus, causal variants and their contributions to the development of resistance to rust pathogen remain unknown. This study aimed to i) validate genomic regions associated with the \u003cem\u003eUr-11\u003c/em\u003e locus conferring resistance to \u003cem\u003eU. appendiculatus\u003c/em\u003e in Middle American beans, ii) determine a variant or set of variants in candidate genes that might identify it as the \u003cem\u003eUr-11\u003c/em\u003e gene, and iii) develop a gene-based marker that can be utilized in marker-assisted selection in early stages of a breeding program for rust resistance.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003ePlant material\u003c/h2\u003e\n \u003cp\u003eA panel of 390 genotypes consisting of preliminary (PYT) and advanced yield trial (AYT) lines from the North Dakota State University dry bean program, germplasm lines and cultivars known to possess the \u003cem\u003eUr-11\u003c/em\u003e locus derived from PI 181996 and cultivars from the Middle American gene pool was evaluated for this study. The panel was composed of 132 pinto, 100 black, 57 pink and small red, 51 great northern, and 50 navy bean genotypes. The germplasm lines included the great northern beans BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, and BelMiNeb-RMR-5; the navy beans BelMiDak-RR-1 and BelMiDak-RR-2; as well as the pinto bean BelDakMi-RR-5, all developed by the United States Department of Agriculture, Agricultural Research Station at Beltsville, Maryland (Pastor-Corrales \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). The cultivars with the \u003cem\u003eUr-11\u003c/em\u003e locus were great northern Beryl R (PVP# 200600224), pink bean Pink Floyd (PVP# 200500211, pinto bean NE2-09-3 developed by Dr. Carlos Urrea (University of Nebraska, Scottsbluff), and PI 181996.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eInoculum preparation and plant inoculation\u003c/h3\u003e\n\u003cp\u003eRust inoculum preparation and plant inoculation followed a protocol by Jochua et al. (\u003cspan class=\"CitationRef\"\u003e2008\u003c/span\u003e) with a small modification. Briefly, 25 mg of urediniospores of \u003cem\u003eU. appendiculatus\u003c/em\u003e race 31\u0026thinsp;\u0026minus;\u0026thinsp;22 (previously known as race 67) was suspended in 300 ml of Tween 20 solution (40 \u0026micro;l of Tween 20 per 1,000 ml of distillate water) and used to inoculate the unifoliate leaves of 8-day-old plants using a Paasche VL Series airbrush (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.paascheairbrush.com\u003c/span\u003e\u003c/span\u003e). Following drying, inoculated plants were incubated in humidity chambers overnight in darkness with misting for 20 sec every 30 min at 21\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C to increase humidity and aid infection. Plants were then transferred to a greenhouse (14 h days at 24\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C; 10 h night at 21\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C) for disease development. The experiment consisted of an alpha-lattice design with 3 replicates (rep) and 43 incomplete blocks [(plastic trays of 50 cells (10\u0026times;5)] within each rep. In each incomplete block, the susceptible check \u0026lsquo;Othello\u0026rsquo; was included. Each experimental unit consisted of 5 plants.\u003c/p\u003e\n\u003ch3\u003eDisease reaction evaluation\u003c/h3\u003e\n\u003cp\u003eThe rust reaction was scored 14 days post-inoculation using the 1\u0026ndash;9 scale as described by Van Schoonhoven and Pastor-Corrales (\u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e). According to this rating system, plants with no visible rust pustules were considered immune or hypersensitive (HR) and scored 1. Plants showing tiny pustules on less than 2% of their unifoliate area received a score of 3 and fell into the resistant category. Small and intermediate pustules covering approximately 5% of the unifoliate area resulted in a score of 5 for intermediate resistance. Plants were scored susceptible (7) and highly susceptible (9) for having large pustules covering approximately 10% and more than 25% of their unifoliate leaves, respectively. Proc univariate in SAS 9.4 (SAS Institute, Cary, NC, United States) was used to calculate descriptive statistics, including the median of the rust reaction values.\u003c/p\u003e\n\u003ch3\u003eDNA extraction and sequencing library preparation\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eDNA extraction and sequencing library preparation\u003c/div\u003e\n\u003cp\u003eGenomic DNA was isolated from approximately 50 mg of young trifoliate leaf tissue using Mag-Bind\u0026reg; Plant DNA Plus Kit (Omega Bio-Tek, Norcross, GA, United States) following the product manual (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://omegabiotek.com/product/mag-bind-plant-dna-plus-96-kit\u003c/span\u003e\u003c/span\u003e). DNA was quantified using a nanodrop and diluted to 50 ng/\u0026micro;l. Sequencing libraries were prepared following a \u003cem\u003ePhaseolus\u003c/em\u003e-specific protocol developed by Schr\u0026ouml;der et al. (2016). In brief, DNA from each genotype was double digested with two restriction enzymes, MseI and Taq\u0026alpha;1, and uniquely barcoded. Each library was sequenced in paired-end runs (2 x 150 bp) at HudsonAlpha Institute for Biotechnology (Huntsville, AL, United States) using Illumina HiSeq 2500 Sequencing System in rapid-run mode.\u003c/p\u003e\n\u003ch3\u003eSingle nucleotide polymorphism dataset\u003c/h3\u003e\n\u003cp\u003eThe raw sequencing reads were processed to trim low-quality reads with less than 80 bp in length and a default quality threshold score of 20 using SICKLE (Joshi and Fass \u003cspan class=\"CitationRef\"\u003e2011\u003c/span\u003e). The \u0026lsquo;BWA-MEM\u0026rsquo; algorithm (Li \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e) was used to align the quality sequence reads against the UI111 v1.1 reference genome. The aligned reads were sorted and indexed with SAMtools (Danecek et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Read group information for each genotype, including library, platform, and platform unit were added using Picard tools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://broadinstitute.github.io/picard\u003c/span\u003e\u003c/span\u003e). SNP calling was implemented using the MultisampleVariantsDetector module embedded in the NGSEPcore_4.2.0 software with the -maxAlnsPerStartPos 100 parameter (Tello et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). Multiallelic SNPs were discarded and SNPs with a minimum read depth\u0026thinsp;\u0026ge;\u0026thinsp;3, were selected. Additionally, markers with less than 70% missing sites and 5% heterozygotes sites were imputed using Beagle 5.4 (Browning et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Finally, a total of 71,098 high-quality SNPs were retained after applying 5% minor allele frequency (MAF), were used for GWAS.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eGenome-wide association study\u003c/h2\u003e\n \u003cp\u003eGWAS analysis was performed using phenotype and genotype data with Genome-wide Efficient Mixed Model Analysis (GEMMA) (Zhou and Stephens \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e) software implementing linear mixed model. Principal component analysis (PCA) was performed to estimate population structure. Population relatedness (kinship matrix) was generated using the GEMMA algorithm for centered relatedness. The linear mixed model was implemented including the first three PCA for population structure and kinship matrix for genetic relatedness. Manhattan and quantile-quantile plots were generated using the R package qqman (Turner \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). The marker-trait association was determined statistically significant based on the \u003cem\u003ep\u003c/em\u003e-value (-log10(\u003cem\u003ep\u003c/em\u003e)) detection threshold using the Bonferroni correction to control the genome-wide false positive rate (\u0026alpha;\u0026thinsp;=\u0026thinsp;0.05). The proportion of phenotypic variation explained by the significant SNPs (R\u003csup\u003e2\u003c/sup\u003e) was calculated in TASSEL.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eIdentification of candidate genes and sequence alignment\u003c/h3\u003e\n\u003cp\u003eThe flanking sequences from the significant SNP markers associated with the \u003cem\u003eUr-11\u003c/em\u003e locus were extracted with Integrative Genomics Viewer (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://igv.org/doc/desktop\u003c/span\u003e\u003c/span\u003e) and used in a BLAST search against the \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 v1.1 in Phytozome 13 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://phytozome-next.jgi.doe.gov\u003c/span\u003e\u003c/span\u003e). Candidate genes were identified within 100 kb upstream and downstream of the peak SNPs\u0026apos; physical location (bp). Multiple DNA sequence alignments and variant reviews were performed with IGV. Translation of DNA sequence to protein sequence was carried out with Expasy (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/translate\u003c/span\u003e\u003c/span\u003e). Multiple protein sequence alignments were performed with Clustal Omega (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/jdispatcher/msa/clustalo\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003ePACE genotyping assay\u003c/h3\u003e\n\u003cp\u003ePCR Allele Competitive Extension (PACE) genotyping assays (allele-specific forward and common reverse primers) designed by Integrated DNA Technologies, Inc. investigated target SNP sites in exons and upstream regulatory regions of candidate genes. PACE SNP genotyping was performed with 20ng of high-quality genomic DNA samples from the genotypes using the PACE 2.0 Genotyping Master Mix (Standard ROX \u0026minus;\u0026thinsp;150 nM, 3CR Bioscience) in the presence of two competitive allele-specific forward primers and a common, reverse primer in a final volume of 8\u0026micro;L (Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e). The PCR amplification condition was 15 min at 94\u0026deg;C for the hot start activation, 10 cycles of 20s at 94\u0026deg;C, 65\u0026deg;C for 60s (dropping 0.8\u0026deg;C per cycle), then 38 cycles of 20s at 94\u0026deg;C and 60s at 57\u0026deg;C followed by a final point read of the fluorescence for 2 min at 22\u0026deg;C on a CFX Opus 96 real-time PCR system and using the CFX Maestro Software (BIO-RAD).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003ePhenotypic reactions of breeding lines and cultivars to \u003cem\u003eU. appendiculatus\u003c/em\u003e race 31\u0026thinsp;\u0026minus;\u0026thinsp;22 were consistent across replicates under greenhouse conditions. Median genotype scores ranged from highly resistant (1) to highly susceptible (9). Approximately 8% of genotypes showed an immune reaction, 3% were resistant, 7% exhibited an intermediate reaction, 27% were susceptible, and 55% were highly susceptible. The germplasm lines and cultivars with the rust resistance \u003cem\u003eUr-11\u003c/em\u003e locus including great northern beans BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, BelMiNeb-RMR-5, and Beryl R; navy beans BelMiDak-RR-1 and BelMiDak-RR-2; pinto bean BelDakMi-RR-5 and NE2-09-3; pink bean Pink Floyd; and black bean PI 181996 were among the 29 genotypes that expressed an immune reaction to race 31\u0026thinsp;\u0026minus;\u0026thinsp;22. Fourteen slow-darkening pinto, one black, one navy, and one pink bean breeding lines also showed an immune response. Seven black, one navy, and one slow-darkening pinto bean breeding lines were resistant.\u003c/p\u003e \u003cp\u003eGWAS was conducted using genotypic data consisting of approximately 71k SNP markers and phenotypic data based on the median reaction type (1 to 9 scale) of 362 middle American-type bean genotypes. GWAS revealed 27 SNP markers within a distinct peak on chromosome Pv11 in the 55.16\u0026ndash;55.56 Mb region of the \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference genome assembly v1.1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Two SNP markers S11_55458849 and S11_55167465 showed the strongest association with the trait explaining 29% of the phenotypic variation. The peak SNPs in this cluster are bordered upstream and downstream by gene models that encode proteins in response to abiotic and biotic stimuli, including NBS-LRR proteins (Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, S2).\u003c/p\u003e \u003cp\u003eOf the 27 peak SNPs, four SNP markers (S11_55167465, S11_55167606, S11_55167642, and S11_55167692) were found at approximately 14.2 to 22.8 kb upstream of the gene models \u003cem\u003ePvUI111.11G202300\u003c/em\u003e and \u003cem\u003ePvUI111.11G202400\u003c/em\u003e that encode NBS-LRR proteins. Five SNP markers (S11_55220618, S11_55220638, S11_55220675, S11_55221024, and S11_55221035) were found near the NBS-LRR protein ecoding genes \u003cem\u003ePvUI111.11G202600\u003c/em\u003e, \u003cem\u003ePvUI111.11G202700, PvUI111.11G202800, PvUI111.11G203000, PvUI111.11G203100\u003c/em\u003e, and \u003cem\u003ePvUI111.11G203200\u003c/em\u003e and a receptor protein kinase encoding gene \u003cem\u003ePvUI111.11G203300\u003c/em\u003e. The gene models \u003cem\u003ePvUI111.11G203600, PvUI111.11G205100, PvUI111.11G205700, PvUI111.11G206000, and PvUI111.11G206100\u003c/em\u003e were other NBS-LRR genes around the peak SNPs within the genomic region (Tables\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, S2).\u003c/p\u003e \u003cp\u003eDNA sequence alignments of the candidate genes associated with the \u003cem\u003eUr-11\u003c/em\u003e in 13 genotypes that expressed an immune reaction to race 31\u0026thinsp;\u0026minus;\u0026thinsp;22, including BelMiNeb-RR-1, BelMiNeb-RR-2, BelMiNeb-RMR-3, BelMiNeb-RMR-4, BelMiNeb-RMR-5, BelMiDak-RR-1, BelMiDak-RR-2, BelDakMi-RR-5, Beryl R, Pink Floyd, NE2-09-3, PI 181996, and Topaz R with 26 susceptible genotypes, including pinto beans AC Island, Buster, CDC Camino, Chase, Croissant, Frontier, Lariat, Kimberly, La Paz, Maverick, Monterrey, Montrose, Nodak, SDIP-1, Sedona, Stampede, UI-114, USPT-WM-1, Windbreaker, great northern bean BelNeb-RR-1, small red beans AC Redbod, AC Scarlet, Merlot, Rosetta, and black beans Mexico 235 and Mexico 309 revealed single and multiple nucleotide polymorphisms distributed within exons of these genes. In total, 12 PACE genotyping assays were designed for gene variants linked to the \u003cem\u003eUr-11\u003c/em\u003e locus (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The efficiency of the PACE markers in revealing the disease phenotype was evaluated through their cross-validation in a set of 650 bean genotypes composed of cultivars and breeding lines and ~\u0026thinsp;300 Middle American Diversity Panel (Moghaddam et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) from different genetic backgrounds and populations. The results showed no consistent association between the gene variants and disease phenotype for most of the detected polymorphisms in the candidate genes across the genotypes. However, the PACE marker S11_55191718 which represents a single nucleotide substitution in the exon [c.1,328A\u0026thinsp;\u0026gt;\u0026thinsp;G] of the candidate gene \u003cem\u003ePvUI111.11G202400\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e) did precisely distinguish the resistant and susceptible genotypes across different populations including two biparental navy bean populations derived from crosses between Puerto Rican bean lines 2104-1-1 \u0026times; PR0806-81 and 2104-1-2 \u0026times; PR0806-81 (made by Dr. James Beaver at the University of Puerto Rico and advanced to homozygosity at NDSU). The parental lines 2104-1-1 and 2104-1-2 are navy bean genotypes with the rust resistance \u003cem\u003eUr-5\u003c/em\u003e gene (personal communication with Dr. Beaver). The parental line PR0806-81 (Reg. No. GP-297, PI 672995) is a navy bean germplasm line possessing the \u003cem\u003eUr-11\u003c/em\u003e gene from PI 181996 (Beaver et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e demonstrates the outputs of four PACE assays for 67 navy bean breeding lines with an immune reaction to rust race 31\u0026thinsp;\u0026minus;\u0026thinsp;22. The PACE marker S11_55191718 cosegregated with the \u003cem\u003eUr-11\u003c/em\u003e resistance phenotype compared to markers S11_55182817, S11_55458849, and S11_55482888.\u003c/p\u003e \u003cp\u003eA blastp analysis found \u003cem\u003ePvUI111.11G202400\u003c/em\u003e exhibited about 70% sequence identity with coiled-coil nucleotide-binding site-leucine-rich repeat (CC-NBS-LRR) type disease resistance proteins such as At3g14460, RGAs, RPG1-B, and RPP13-like proteins in legume crops \u003cem\u003eVigna angularis\u003c/em\u003e (Wild.) (adzuki bean), \u003cem\u003eV. radiata\u003c/em\u003e var. radiata (mung bean), \u003cem\u003eV. umbellata\u003c/em\u003e (Thunb.) Ohwi \u0026amp; H.Ohashi (ricebean), \u003cem\u003eV. unguiculata\u003c/em\u003e (L.) Walp. (cowpea), \u003cem\u003eGlycine max\u003c/em\u003e (L.) Merr., and \u003cem\u003eG. soja\u003c/em\u003e Siebold \u0026amp; Zucc. across its entire query length. Multiple sequence alignment of CC-NBS-LRR proteins and putative NBS-LRR proteins encoded by the gene homologs of \u003cem\u003ePvUI111.11G202400\u003c/em\u003e in UI111 and PI 181996 (McClean et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) revealed characteristic motifs of a typical CC-NBS-LRR for the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e protein. Figures\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and S1 show that the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e protein comprises motifs with identical or similar residues to its putative homologs in different species. In order from the N-terminus, the protein has a conserved EDLLD motif in the CC domain; P-loop (also called kinase 1 or Walker A site, GGVGKT), RNBS-A (KAWVCVSD), kinase-2 (also called Walker B site, LVLDDV), RNBS-B (also called kinase-3a, NGCKVLFTTRSEEVC), GLPL (GLPLAL), RNBS-D (CFLYCALF), and MHDV (MHDV) in the NBS domain (also called the NB or NB-ARC); and LKKLQILKLNDCRR motifs in the LRR domain (Hammond-Kosack and Jones \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Meyers et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Meyers et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; L\u0026oacute;pez et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; McHale et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Rairdan and Moffett \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Rairdan et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Goyal et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ePvUI111.11G202400\u003c/em\u003e c.1,328A\u0026thinsp;\u0026gt;\u0026thinsp;G polymorphism results in a substitution of tyrosine (Y) with a cysteine (C) at position 443 (Y443C) for the rust-resistant genotype PI 181996 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Therefore, the protein encoded by \u003cem\u003ePvUI111.11G202400\u003c/em\u003e in the rust-susceptible genotype UI111 would be expected to have identical CC and LRR domains to its counterpart in PI 181996. Still, the RNBS-D motif in the NBS domain shows enrichment for cysteine in the resistant \u003cem\u003ePvUI111.11G202400\u003c/em\u003e protein and a slight increase in the protein sequence identity with its homologs in other species due to the amino acid substitution (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). PACE marker S11_55191718 was developed to differentiate the resistance allele from the susceptible one in the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e. The primer sequences were designed to bind a site that ends with the G at c.1,328 that is A in the susceptible genotypes (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The marker was tested across a panel of ~\u0026thinsp;650 Middle American dry bean genotypes. No recombination event was observed for the marker among this population indicating that the polymorphism on which it is based is very close to or in the \u003cem\u003eUr-11\u003c/em\u003e gene.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIntrogression of \u003cem\u003eUr-11\u003c/em\u003e, the most effective gene against the highly variable common bean rust pathogen, into dry beans has gained increased attention recently. The lack of reliable molecular markers has hindered the effective selection of lines possessing the \u003cem\u003eUr-11\u003c/em\u003e gene in bean breeding programs. Here it is shown that \u003cem\u003eUr-11\u003c/em\u003e is physically located close to gene model \u003cem\u003ePvUI111.11G202400\u003c/em\u003e which encodes an NBS-LRR protein located on chromosome Pv11. This model is near the reverse primer of SCAR marker sAE19890 which was previously found to be linked to the \u003cem\u003eUr-11\u003c/em\u003e locus (Queiroz et al. 2004) and in the same genomic interval associated with an immune response to three \u003cem\u003eU. appendiculatus\u003c/em\u003e races that attack \u003cem\u003eUr-11\u003c/em\u003e alleles (Monclova-Santana 2019. In agreement with Monclova-Santana (2019), we found that most candidate genes tagged by the \u003cem\u003eUr-11\u003c/em\u003e haplotype response to race 31 − 22 encode NBS-LRR proteins that constitute the largest protein family encoded by plant disease-resistance (R) genes in response to bacterial, fungal, and viral pathogens (Wu et al. 2017).\u003c/p\u003e\n\u003cp\u003eA common NBS-LRR consists of a diverse N-terminal domain, a central NBS domain, and a C-terminal LRR domain. Plant NBS-LRR proteins can be divided into two subfamilies based on the presence of Toll/interleukin-1 receptor (TIR) or CC (or non-TIR) domains in the N-terminal domain (Bentham et al. 2018). The N-terminal TIR and CC, NBS, and LRR domains have different roles during host-pathogen recognition. Both TIR and CC domains are thought to be the receptor modules required for downstream signal transduction post-NBS-LRR activation (Takken and Goverse 2012); however, CC domains from a variety of different NBS-LRRs have also been implicated in guardee or effector perception (Khan et al. 2016). The highly conserved NBS domain typically consisting of ~ 300 amino acids is a functional ATPase domain, and its nucleotide-binding state is proposed to regulate the activity of the R protein (van Ooijen et al. 2008).\u003c/p\u003e\n\u003cp\u003eSix conserved motifs have been identified in the NBS domain of CC-NBS-LRR proteins, including P-loop, kinase-2, RNBS-B, GLPL, RNBS-A, and RNBS-D (He et al. 2022). The functions of these conserved motifs are not well known, but it is believed that they may play roles in binding ATP for the regulation of protein activity (Takken et al., 2006). Mutations in the CC-NBS-LRR gene \u003cem\u003ePm21\u003c/em\u003e which confers effective resistance to wheat (\u003cem\u003eTriticum aestivum\u003c/em\u003e L.) powdery mildew (caused by \u003cem\u003eBlumeria graminis\u003c/em\u003e f. sp. \u003cem\u003eTritici\u003c/em\u003e) (He et al. 2018) resulted in amino acid substitutions in or near the RNSB-D (L414F, P415L, L418F, R419H, P420S, and C421Y), leading to loss-of-function (He et al. 2022). In \u003cem\u003eArabidopsis thaliana\u003c/em\u003e, \u003cem\u003eRMP1\u003c/em\u003e encodes a CC-NBS-LRR protein in cell plasma membranes in response to the phytopathogenic bacterium \u003cem\u003ePseudomonas syringae\u003c/em\u003e (Boyes et al. 1998). Two amino acid substitutions in or next to the RNSB-D motif (S439F and P442L) of RPM1 impaired the protein function (Tornero et al. 2002). Substitutions of two amino acids (L456P/Y458H) in or next to the RNBS-D resulted in an extended resistance spectrum to wheat powdery mildew conditioned by of the CC-NBS-LRR gene \u003cem\u003ePm3f\u003c/em\u003e (Stirnweis et al. 2014). Amino acid changes in or near RNBS-D motifs were suggested to impair the ATP/ADP binding state of the CC-NBS-LRR protein encoded by \u003cem\u003eZea mays Rp1-D21\u003c/em\u003e, which confers resistance against \u003cem\u003ePuccinia sorghi\u003c/em\u003e, the causal agent of maize common rust (Wang et al. 2015). In potatoes (\u003cem\u003eSolanum tuberosum\u003c/em\u003e L.), similar observations were reported for the NBS-LRR proteins encoded by \u003cem\u003eRx1\u003c/em\u003e, which confers resistance to potato virus X, and the \u003cem\u003eGpa2\u003c/em\u003e gene that confers resistance to the potato cyst nematode \u003cem\u003eGlobodera pallida\u003c/em\u003e (Bendahmane et al. 2002; Slootweg et al. 2013).\u003c/p\u003e\n\u003cp\u003eOur results suggest that a missense mutation [c.1,328G \u0026gt; A] in the UI111 allele of \u003cem\u003ePvUI111.11G202400\u003c/em\u003e likely causes an amino acid substitution (C443Y) in or next to the RNBS-D motif that disrupts the protein function in a similar way to the effect of amino acid substitution (C421Y) in the wheat CC-NBS-LRR gene \u003cem\u003ePm21\u003c/em\u003e. This similarity may indicate the importance of the cysteine (C) residues in CC-NBS-LRRs (He et al. 2022). We speculate that the wild-type allele of the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e gene is associated with rust resistance conditioned by the \u003cem\u003eUr-11\u003c/em\u003e locus.\u003c/p\u003e\n\u003cp\u003eIn the present study, the use of rust pathogen race 31 − 22 which is avirulent to the \u003cem\u003eUr-11\u003c/em\u003e locus but is virulent to many other Middle American \u003cem\u003eUr\u003c/em\u003e loci including the \u003cem\u003eUr\u003c/em\u003e-3 locus, which is closely linked to \u003cem\u003eUr-11\u003c/em\u003e (Hurtado-Gonzales et al. 2017), plus the phenotypic data obtained from the responses of the Middle American genotypes to race 31 − 22, eliminated the confounding effects of other \u003cem\u003eUr\u003c/em\u003e loci for GWAS analysis, suggesting more accurate and reliable results than previous studies. The gene-based PACE marker S11_55182817 was more efficient in differentiating the \u003cem\u003eUr-11\u003c/em\u003e resistant and susceptible genotypes within different Middle American market classes and populations as compared to the PACE marker snpPv00158 (McClean, Miklas, and Pastor-Corrales, unpublished) currently in use. This new marker would enable bean breeders to select for bean genotypes carrying the dominant allele from those possessing recessive alleles at the \u003cem\u003eUr-11\u003c/em\u003e locus in early generations of population development, thus preventing the need for plant inoculation.\u003c/p\u003e\n\u003cp\u003eFuture work to validate the role of CC-NBS-LRR gene \u003cem\u003ePvUI111.11G202400\u003c/em\u003e in rust resistance might include targeted mutation of the amino acid 443 in the NBS domain of the protein, followed by \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transient expression in bean cotyledons following procedures described by Williams et al. (2011) for flax rust resistance genes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the U.S. Department of Agriculture\u0026rsquo;s (USDA) Agricultural Marketing Service (AMS) through the Specialty Crop Block Grant Program in collaboration with the ND Department of Agriculture (grant NOGA-21-303). Its contents are solely the authors\u0026apos; responsibility and do not necessarily represent the official views of the USDA. Support for the development of the breeding populations was provided by the Northarvest Bean Growers Association and USDA-National Institute of Food and Agriculture (NIFA) Hatch projects ND1508 and ND1517 (W-4150 multistate project).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eME and JO designed the research plans. ME and JF performed the phenotyping experiments. KS and RL generated the SNP data sets. JR performed SNP calling. JF and ME performed TASSEL and GEMMA analysis. JB made crosses between Puerto Rican navy bean lines and provided F\u003csub\u003e1\u003c/sub\u003e seeds. PM provided additional genomic sequence data for multiple sequence alignments. ME conducted genotyping and cross-validation experiments. ME performed \u003cem\u003e\u0026lsquo;in silico\u0026rsquo;\u003c/em\u003e analysis. ME wrote the manuscript and the authors made edits. All the authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted without any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eORCID\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMohammad Erfatpour\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ehttps://orcid.org/0000-0002-7221-6973\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eJuan M. Osorno\u003c/em\u003e https://orcid.org/0000-0003-0905-3523\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eKristin J. Simons\u003c/em\u003e https://orcid.org/0000-0002-1476-6707\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlzate-Marin AL, de Souza TLPO, Ragagnin VA, Moreira MA, de Barros EG (2004) Allelism tests between the rust resistance gene present in common bean cultivar Ouro Negro and genes \u003cem\u003eUr-5\u003c/em\u003e and \u003cem\u003eUr-11\u003c/em\u003e. J. Phytopathology 152:60-64. https://doi.org/10.1046/j.1439-0434.2003.00802.x\u003c/li\u003e\n\u003cli\u003eArag\u0026atilde;o FJL, Rech EL (1997) Morphological factors influencing recovery of transgenic bean plants (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) of a carioca cultivar. Int J Plant Sci 158:157-163\u003c/li\u003e\n\u003cli\u003eBallantyne BJ (1974) Resistance to rust (\u003cem\u003eUromyces appendiculatus\u003c/em\u003e) in beans (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e). Proc Linn Soc NSW 98:107-121\u003c/li\u003e\n\u003cli\u003eBeaver JS, Rosas JC, Porch TG, Pastor-Corrales MA, Godoy-Lutz G, Prophete EH (2015) Registration of PR0806-80 and PR0806-81 white bean germplasm lines with resistance to BGYMV, BCMV, BCMNV, and rust. J Plant Regis 9:208-211. http://doi.org/10.3198/jpr2014.09.0061crg\u003c/li\u003e\n\u003cli\u003eBendahmane A, Farnham G, Moffett P, Baulcombe DC (2002) Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the \u003cem\u003eRx\u003c/em\u003e locus of potato. Plant J 32:195-204. https://doi.org/10.1046/j.1365-313X.2002.01413.x\u003c/li\u003e\n\u003cli\u003eBentham AR, Zdrzalek R, De la Concepcion JC, Banfield MJ (2018) Uncoiling CNLs: Structure/function approaches to understanding CC domain function in plant NLRs. Plant Cell Physiol 59:2398-2408. http://doi.org/10.1093/pcp/pcy185\u003c/li\u003e\n\u003cli\u003eBoyes DC, Nam J, Dangl JL (1998) The \u003cem\u003eArabidopsis thaliana RPM1\u003c/em\u003e disease resistance gene product is a peripheral plasma membrane protein that is degraded coincident with the hypersensitive response. Proc Natl Acad Sci U S A. 95:15849-15854. http://doi.org/ 10.1073/pnas.95.26.15849\u003c/li\u003e\n\u003cli\u003eBradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES (2007) TASSEL: software for association mapping of complex traits in diverse samples. Bioinform 23:2633-2635. https://doi.org/10.1093/bioinformatics/btm308\u003c/li\u003e\n\u003cli\u003eBrowning BL, Zhou Y, Browning SR (2018) A one-penny imputed genome from next generation reference panels. Am J Hum Genet 103:338-348. http://doi.org/10.1016/j.ajhg.2018.07.015\u003c/li\u003e\n\u003cli\u003eCao Y, Mo W, Li Y, Xiong Y, Wang H, Zhang Y, Lin M, Zhang L, Li X (2024) Functional characterization of NBS-LRR genes reveals an NBS-LRR gene that mediates resistance against Fusarium wilt. BMC Biol 22:45. https://doi.org/10.1186/s12915-024-01836-x\u003c/li\u003e\n\u003cli\u003eDanecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H (2021) Twelve years of SAMtools and BCFtools. Gigascience 10:giab008. http://doi.org/10.1093/gigascience/giab008\u003c/li\u003e\n\u003cli\u003ede Souza TLPO, Dessaune SN, Sanglard DA, Moreira MA, de Barros EG (2011) Characterization of the rust resistance gene present in the common bean cultivar Ouro Negro, the main rust resistance source used in Brazil. Plant Pathol 60:839-845. https://doi.org/10.1111/j.1365-3059.2011.02456.x\u003c/li\u003e\n\u003cli\u003eElmore JM, Lin ZJ, Coaker G (2011) Plant NB-LRR signaling: upstreams and downstreams. Curr Opin Plant Biol 14:365-371. http://doi.org/10.1016/j.pbi.2011.03.011\u003c/li\u003e\n\u003cli\u003eGoyal N, Bhatia G, Sharma S, Garewal N, Upadhyay A, Upadhyay SK, Singh K (2020) Genome-wide characterization revealed role of NBS-LRR genes during powdery mildew infection in Vitis vinifera. Genomics 112:312-322. https://doi.org/10.1016/j.ygeno.2019.02.011\u003c/li\u003e\n\u003cli\u003eGrafton KF, Chang KC, Venette JR, Vander Wal AJ (1993) Registration of \u0026lsquo;Norstar\u0026rsquo; navy bean. Crop Sci 33:1405-1406\u003c/li\u003e\n\u003cli\u003eHammond-Kosack KE, Jones JD (1997) Plant disease resistance genes. Annu Rev Plant Physiol Plant Mol Biol 48:575-607. http://doi.org/10.1146/annurev.arplant.48.1.575\u003c/li\u003e\n\u003cli\u003eHe H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) \u003cem\u003ePm21\u003c/em\u003e, Encoding a Typical CC-NBS-LRR Protein, Confers Broad-Spectrum Resistance to Wheat Powdery Mildew Disease. Mol Plant 11:879-882. http://doi.org/10.1016/j.molp.2018.03.004\u003c/li\u003e\n\u003cli\u003eHe H, Guo R, Gao A, Chen Z, Liu R, Liu T, Kang X, Zhu S (2022) Large-scale mutational analysis of wheat powdery mildew resistance gene \u003cem\u003ePm21\u003c/em\u003e. Front Plant Sci 13:988641. http://doi.org/ 10.3389/fpls.2022.988641\u003c/li\u003e\n\u003cli\u003eHurtado-Gonzales OP, Valentini G, Gilio TA, Martins AM, Song Q, Pastor-Corrales MA (2017) Fine mapping of \u003cem\u003eUr-3\u003c/em\u003e, a historically important rust resistance locus in common bean. G3 Genes Genomes Genet 7:557-569. https://doi.org/10.1534/g3.116.036061\u003c/li\u003e\n\u003cli\u003eJochua C, Amane MIV, Steadman JR, Xue X, Eskidge KM (2008) Virulence diversity of the common bean rust pathogen within and among individual bean fields and development of sampling strategies. Papers in Plant Pathology Plant Dis 92:401-408. https://doi.org/10.1094/ PDIS-92-3-0401\u003c/li\u003e\n\u003cli\u003eJohnson E, Miklas PN, Stavely JR, Martinez-Cruzado JC (1995) Coupling- and repulsion-phase RAPDs for marker-assisted selection of PI 181996 rust resistance in common bean. Theor Appl Genet 90:659-664. https://doi.org/10.1007/BF00222130\u003c/li\u003e\n\u003cli\u003eJoshi NA, Fass JN (2011) Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files (Version 1.33) [Software]. Available at https://github.com/najoshi/sickle.\u003c/li\u003e\n\u003cli\u003eKelly JD, Geots P, Miklas PM, Coyne DP (2003) Tagging and mapping of genes and QTL and molecular marker-assisted selection for traits of economic importance in bean and cowpea. Field Crops Res 82:135-154. https://doi.org/10.1016/S0378-4290(03)00034-0\u003c/li\u003e\n\u003cli\u003eKhan M, Subramaniam R, Desveaux D (2016) Of guards, decoys, baits and traps: Pathogen perception in plants by type III effector sensors. Curr Opin Microbiol 29:49-55. https://doi.org/10.1002/jsfa.7120\u003c/li\u003e\n\u003cli\u003eLee HA, Yeom SI (2015) Plant NB-LRR proteins: tightly regulated sensors in a complex manner. Brief Funct Genomics 14:233-42. http://doi: 10.1093/bfgp/elv012\u003c/li\u003e\n\u003cli\u003eLeit\u0026atilde;o ST, Rubiales D, Vaz Patto MC (2023) Identification of novel sources of partial and incomplete hypersensitive resistance to rust and associated genomic regions in common bean. BMC Plant Biol 23:610. https://doi.org/10.1186/s12870-023-04619-8\u003c/li\u003e\n\u003cli\u003eLi H (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv: Genomics. https://doi.org/10.6084/m9.figshare.963153.v1\u003c/li\u003e\n\u003cli\u003eLiu Z, Xie J, Wang H, Zhong X, Li H, Yu J, Kang J (2019) Identification and expression profiling analysis of NBS-LRR genes involved in \u003cem\u003eFusarium oxysporum\u003c/em\u003e f.sp. \u003cem\u003econglutinans\u003c/em\u003e resistance in cabbage. 3 Biotech. 9:202. http://doi.org/10.1007/s13205-019-1714-8\u003c/li\u003e\n\u003cli\u003eL\u0026oacute;pez CE, Zuluaga AP, Cooke R, Delseny M, Tohme J, Verdier V (2003) Isolation of Resistance Gene Candidates (RGCs) and characterization of an RGC cluster in cassava. Mol Genet Genomics 269:658-671. http://doi.org/10.1007/s00438-003-0868-5\u003c/li\u003e\n\u003cli\u003eMarkell SM, Pastor-Corrales MA, Jordahl JG, Lampa RS, Mathew FB, Osorno JM, Goswami RS (2009) Virulence of \u003cem\u003eUromyces appendiculatus\u003c/em\u003e to the resistance gene \u003cem\u003eUr-3\u003c/em\u003e identified in North Dakota in 2008. Annu Rep Bean Improv Coop, 52:82-83.\u003c/li\u003e\n\u003cli\u003eMarone D, Russo MA, Laid\u0026ograve; G, De Leonardis AM, Mastrangelo AM (2013). Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: active guardians in host defense responses. Int J Mol Sci 14:7302-26. http://doi.org/10.3390/ijms14047302\u003c/li\u003e\n\u003cli\u003eMcClean PE, Lee R, Howe K, Osborne C, Grimwood J, Levy S, Haugrud AP, Plott C, Robinson M, Skiba RM, Tanha T, Zamani M, Thannhauser TW, Glahn RP, Schmutz J, Osorno JM, Miklas PN (2022) The common bean \u003cem\u003eV\u003c/em\u003e gene encodes flavonoid 3\u0026prime;5\u0026prime; hydroxylase: a major mutational target for flavonoid diversity in angiosperms. Front Plant Sci 13:869582. http://doi.org/10.3389/fpls.2022.869582\u003c/li\u003e\n\u003cli\u003eMcHale L, Tan X, Koehl P, Michelmore RW (2006). Plant NBS-LRR proteins: adaptable guards. Genome Biol 7:212. https://doi.org/10.1186/gb-2006-7-4-212\u003c/li\u003e\n\u003cli\u003eMiklas PN, Pastor-Corrales MA, Jung G, Coyne DP, Kelly JD, McClean PE, Gepts P (2002) Comprehensive linkage map of bean rust resistance genes. Ann Rep Bean Improv Coop 45:125-129\u003c/li\u003e\n\u003cli\u003eMeyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND (1999) Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J 20:317-332. http:// doi.org/10.1046/j.1365-313x.2002.01404.x\u003c/li\u003e\n\u003cli\u003eMeyers BC, Kozik A, Griego A, Kuang H, Michelmore RW (2003) Genome-wide analysis of NBS-LRR-encoding genes in Arabidopsis. Plant Cell 15:809-834. http://doi.org/10.1105/tpc. 009308\u003c/li\u003e\n\u003cli\u003eMiklas PN, Kelly JD, Beebe SE, Blair MW (2006) Common bean breeding for resistance against biotic and abiotic stresses: from classical to MAS breeding. Euphytica 147:105-161. https://doi.org/10.1007/s10681-006-4600-5\u003c/li\u003e\n\u003cli\u003eMoffett P, Farnham G, Peart J, Baulcombe DC (2002) Interaction between domains of a plant NBS-LRR protein in disease resistance-related cell death. EMBO J 21:4511-4519. http://doi.org/10.1093/emboj/cdf453\u003c/li\u003e\n\u003cli\u003eMoghaddam SM, Mamidi S, Osorno JM, Lee R, Brick M, Kelly J, Miklas P, Urrea C, Song Q, Cregan P, Grimwood J, Schmutz J, McClean PE (2016) Genome-wide association study identifies candidate loci underlying agronomic traits in a middle american diversity panel of common bean. Plant Genome 9:1-21. http://doi.org/10.3835/plantgenome2016.02.0012\u003c/li\u003e\n\u003cli\u003eMonclova-Santana C (2019) Population structure of \u003cem\u003eUromyces appendiculatus\u003c/em\u003e in North Dakota. PhD Thesis. North Dakota State University: Fargo, ND.\u003c/li\u003e\n\u003cli\u003eMontejo Dom\u0026iacute;nguez LdMA, McClean PE, Steadman J, McCoy S, Markell S, Osorno JM (2022) Bean rust resistance in the Guatemalan climbing bean germplasm collection. Legum Sci 4:e149. https://doi.org/10.1002/leg3.149\u003c/li\u003e\n\u003cli\u003eOsorno JM, Vander Wal AJ, Posch J, Simons K, Grafton KF, Pasche JS, Nelson BD, Jain S, Pastor-Corrales M (2020) \u0026lsquo;ND Falcon\u0026rsquo;, a new pinto bean with combined resistance to rust and soybean cyst nematode. J Plant Regist 14:117-125. https://doi.org/10.1002/plr2.20025\u003c/li\u003e\n\u003cli\u003ePastor-Corrales MA (2003) Sources, genes for resistance, and pedigrees of 52 rust and mosaic resistant dry bean germplasm lines released by the USDA Beltsville bean project in collaboration with the Michigan, Nebraska and North Dakota agricultural experiment station. Annu Rep Bean Improv Coop 46:235-241\u003c/li\u003e\n\u003cli\u003ePastor-Corrales MA, Kelly JD, Steadman JR, Lindgren DT, Stavely JR, Coyne DP (2007) Registration of six great northern bean germplasm lines with enhanced resistance to rust and bean common mosaic and necrosis potyviruses. J Plant Regis 1:77-79. https://doi.org/10.3198/jpr2005.12.0517crg\u003c/li\u003e\n\u003cli\u003eQueiroz VT, Sousa CS, Souza TLPO, Costa MR, Sanglard DA, Ragagnin VA, Barros EG, Moreira MA (2004) SCAR marker linked to the common bean rust resistance gene \u003cem\u003eUr-11\u003c/em\u003e. Annu Rep Bean Improv Coop 47:271-272\u003c/li\u003e\n\u003cli\u003eRairdan GJ, Moffett P (2006) Distinct domains in the ARC region of the potato resistance protein Rx mediate LRR binding and inhibition of activation. Plant Cell 18:2082-2093. http://doi.org/10.1105/tpc.106.042747\u003c/li\u003e\n\u003cli\u003eRairdan GJ, Collier SM, Sacco MA, Baldwin TT, Boettrich T, Moffett P (2008) The coiled-coil and nucleotide binding domains of the Potato Rx disease resistance protein function in pathogen recognition and signaling. Plant Cell 20:739-751. http://doi.org/10.1105/tpc.107.056036\u003c/li\u003e\n\u003cli\u003eSchmutz J, McClean PE, Mamidi S, Wu GA, Cannon SB, Grimwood J et al (2014) A reference genome for common bean and genome-wide analysis of dual domestications. Nat Genet 46:707-713. https://doi.org/10.1038/ng.3008\u003c/li\u003e\n\u003cli\u003eSlootweg EJ, Spiridon LN, Roosien J, Butterbach P, Pomp R, Westerhof L, Wilbers R, Bakker E, Bakker J, Petrescu AJ, Smant G, Goverse A (2013) Structural determinants at the interface of the ARC2 and leucine-rich repeat domains control the activation of the plant immune receptors Rx1 and Gpa2. Plant Physiol 162:1510-1528. http://doi.org/10.1104/pp.113.218842\u003c/li\u003e\n\u003cli\u003eSouza TLPO, Faleiro FG, Dessaune SN, Paula-Junior TJ, Moreira MA, Barros EG (2013) Breeding for common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) rust resistance in Brazil. Trop Plant Pathol 38:361-374. https://doi.org/10.1590/S1982-56762013005000027\u003c/li\u003e\n\u003cli\u003eStirnweis D, Milani SD, Jordan T, Keller B, Brunner S (2014) Substitutions of two amino acids in the nucleotide-binding site domain of a resistance protein enhance the hypersensitive response and enlarge the PM3F resistance spectrum in wheat. Mol Plant Microbe Interact 27:265-276. http://doi.org/10.1094/MPMI-10-13-0297-FI\u003c/li\u003e\n\u003cli\u003eStavely JR, Pastor-Corrales MA (1989) Rust. In: Schwartz HF, Pastor-Corrales MA (eds) Bean production problems in the tropics, 2nd edn. CIAT, Cali, pp 159-194\u003c/li\u003e\n\u003cli\u003eStavely JR, Kelly JD, Grafton KF (1994) BelMiDak-Rust-Resistant navy dry beans germplasm lines. HortScience 29:709-711\u003c/li\u003e\n\u003cli\u003eSteadman JR, Pastor-Corrales MA, Beaver JS (2002) An overview of the 3\u003csup\u003erd\u003c/sup\u003e bean rust and 2\u003csup\u003end\u003c/sup\u003e bean common bacterial blight international workshop. Annu Rep Bean Improv Coop\u003cem\u003e \u003c/em\u003e45:120-124\u003c/li\u003e\n\u003cli\u003eTakken FL, Albrecht M, Tameling WIL (2006) Resistance proteins: molecular switches of plant defence. Curr Opin Plant Biol 9:383-390. http://doi.org/10.1016/j.pbi.2006.05.009\u003c/li\u003e\n\u003cli\u003eTakken FL, Goverse A (2012). How to build a pathogen detector: structural basis of NB-LRR function. Curr Opin Plant Biol 15:375-384. http://doi.org/10.1016/j.pbi.2012.05.001\u003c/li\u003e\n\u003cli\u003eTello D, Gonzalez-Garcia LN, Gomez J, Zuluaga-Monares JC, Garcia R, Angel R, Mahecha D, Duarte E, Leon MDR, Reyes F, Escobar-Vel\u0026aacute;squez C, Linares-V\u0026aacute;squez M, Cardozo N, Duitama J (2023) NGSEP 4: Efficient and accurate identification of orthogroups and whole-genome alignment. Mol Ecol Resour 23:712-724. https://doi.org/10.1111/1755-0998.13737\u003c/li\u003e\n\u003cli\u003eTornero P, Chao RA, Luthin WN, Goff SA, Dangl JL (2002) Large-scale structure-function analysis of the Arabidopsis RPM1 disease resistance protein. Plant Cell 14:435-450. http://doi.org/ 10.1105/tpc.010393\u003c/li\u003e\n\u003cli\u003eTurner SD (2018) qqman: an R package for visualizing GWAS results using Q-Q and manhattan plots. J Open Source Softw 3:731. https://doi.org/10.21105/joss.00731\u003c/li\u003e\n\u003cli\u003evan der Biezen EA, Jones JDG (1998) The NB-ARC domain: a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. Current Biology, 8:R226-R228. https://doi.org/10.1016/S0960-9822(98)70145-9\u003c/li\u003e\n\u003cli\u003evan Ooijen G, Mayr G, Kasiem MMA, Albrecht M, Cornelissen BJC, Takken FLW (2008). Structure-function analysis of theNB-ARC domain of plant disease resistance proteins. J Exp Bot 59:1383-1397. https://doi.org/10.1093/jxb/ern045\u003c/li\u003e\n\u003cli\u003eVan Schoonhoven A, Pastor-Corrales MA (1987) Standard system for the evaluation of bean germplasm. Cali 24-27\u003c/li\u003e\n\u003cli\u003eVargas E (1980) Rust. In: Schwartz HF, G\u0026aacute;lvez GE, Guillermo E (eds) Bean production problems: disease, insect, soil and climatic constraints of\u003cem\u003e Phaseolus vulgaris. \u003c/em\u003eCIAT, Cali, pp 17-36\u003c/li\u003e\n\u003cli\u003eWang GF, Ji J, El-Kasmi F, Dangl JL, Johal G, Balint-Kurti PJ (2015) Molecular and functional analyses of a maize autoactive NB-LRR protein identify precise structural requirements for activity. PLoS Pathog 11:e1004674. http://doi.org/10.1371/journal.ppat.1004674\u003c/li\u003e\n\u003cli\u003eWasonga CJ, Pastor-Corrales MA, Porch TG, Griffiths PD (2010) Targeting gene combinations for broad-spectrum rust resistance in heat-tolerant snap beans developed for tropical environments. J Amer Soc Hort Sci 135:521-532. https://doi.org/10.21273/JASHS.135.6.521\u003c/li\u003e\n\u003cli\u003eWilliams SJ, Sornaraj P, deCourcy-Ireland E, Menz RI, Kobe B, Ellis JG, Dodds PN, Anderson PA (2011) An autoactive mutant of the M flax rust resistance protein has a preference for binding ATP, whereas wild-type M protein binds ADP. Mol Plant Microbe Interact. 24:897-906. http://doi.org/10.1094/MPMI-03-11-0052\u003c/li\u003e\n\u003cli\u003eWu J, Zhu J, Wang L, Wang S (2017) Genome-wide association study identifies NBS\u0026ndash;LRR-encoding genes related with anthracnose and common bacterial blight in the common bean. Front Plant Sci 8:1398. https://doi.org/10.3389/fpls.2017.01398\u003c/li\u003e\n\u003cli\u003eZaumeyer WJ, Thomas HR (1957) A monographic study of bean diseases and methods of their control. United States Department of Agriculture, Economic Research Service. Technical Bulletin 868:84-88. https://doi.org/10.22004/ag.econ.169625\u003c/li\u003e\n\u003cli\u003eZhou X, Stephens M (2012) Genome-wide efficient mixed-model analysis for association studies. Nat Genet 44:821-824. http://doi.org/10.1038/ng.2310\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Significant single nucleotide polymorphism (SNP) markers on chromosome Pv11 from a genome-wide association study (GWAS) of preliminary and advanced breeding lines and cultivars from the North Dakota State University dry bean breeding program, plus germplasm lines from the United States Department of Agriculture, Agricultural Research Station at Beltsville, Maryland in association with \u003cem\u003eUromyces appendiculatus\u003c/em\u003e races 31-22. SNP marker positions are relative to the \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference genome assembly v1.1.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eReference SNP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePosition (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003e-log\u003csub\u003e10\u003c/sub\u003e(\u003cem\u003ep\u003c/em\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eVariation explained (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55458849\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,458,849\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e50.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.82\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55167465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,167,465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55167606\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,167,606\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55397512\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,397,512\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55397514\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,397,514\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55397572\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,397,572\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55397575\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,397,575\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55401744\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,401,744\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55401745\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,401,745\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55401746\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,401,746\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55401884\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,401,884\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55401904\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,401,904\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55403439\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,403,439\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55403490\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,403,490\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55466915\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,466,915\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e51.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55167642\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,167,642\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e49.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27.83\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55167692\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,167,692\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e48.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27.53\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55220638\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,220,638\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e47.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e27.41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55220618\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,220,618\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e48.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e26.87\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55564761\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,564,761\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e45.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e26.69\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55220675\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,220,675\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e40.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55221024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,221,024\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e40.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55221035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,221,035\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e40.31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e23.96\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55374026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,374,026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e25.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21.47\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55564702\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,564,702\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e38.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e21.09\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55565283\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,565,283\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e39.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19.76\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eS11_55565595\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e55,565,595\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e28.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14.81\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003eList of PCR Competitive Extension (PACE) genotyping assays designed for genetic variants in the exons of candidate genes linked to the \u003cem\u003eUr-11\u003c/em\u003e locus on chromosome Pv11 of the UI111 reference genome that consistently differentiate genotypes with immune or hypersensitive reactions to rust race 31-22 from the susceptible genotypes based on the results of DNA sequence alignments.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"876\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eSNP physical position (bp)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eUI111 Genome\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eReference allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAlternate allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eMarker ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,182,814\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55182814\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-GCCTTGAAAACAATGGGAAGTCTAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-GCCTTGAAAACAATGGGAAGTCTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTGCTTTCCCATTCCCAAAAGGATGATTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,182,817\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55182817\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CCATTCCCAAAAGGATGATTTACTGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-CCATTCCCAAAAGGATGATTTACTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eTAGCCTTGAAAACAATGGGAAGTCTASTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,182,818\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55182818\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CCATTCCCAAAAGGATGATTTACTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-CCATTCCCAAAAGGATGATTTACTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCTTTAGCCTTGAAAACAATGGGAAGTCTAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,191,672\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55191672\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CCTTCCTTCTTATCTGAAGAAATGCTTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-CCTTCCTTCTTATCTGAAGAAATGCTTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCACATAACCTTTGGGAAATAAGGCACAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,191,718\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55191718\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-\u0026nbsp;AAAGGTTATGTGTTTGACAAGGAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-\u0026nbsp;AAAGGTTATGTGTTTGACAAGGAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCACATAACCTTTGGGAAATAAGGCACAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,192,034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55192034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CAGTCAGTTGGCATAAATGTATGCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-\u0026nbsp;CAGTCAGTTGGCATAAATGTATGCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGGGTTTGGAAGTTTGGTTGATACTCAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G202400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,192,298\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55192298\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-AAGCTCCTTCAATCTTCGACAATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-AAGCTCCTTCAATCTTCGACAATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAAACTACCTGACTCCATAAGTTTACTCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G204900\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,458,849\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55458849\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CAGTGTCTGTGGCTGTTGGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-CAGTGTCTGTGGCTGTTGGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGGATCTGCCATCTCATTGGGAAGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e. (continued).\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eSNP physical position (bp)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eUI111 Genome\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eReference allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAlternate allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eMarker ID\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G204900\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,459,336\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55459336\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-GGTATTTGCCGGTTGAAGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-\u0026nbsp;GGTATTTGCCGGTTGAAGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCAACCAAAACACTTCGCATGCCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G205100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,482,888\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55482888\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-CTCCAACGCCTACCAGAGGAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-CTCCAACGCCTACCAGAGGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGCAAAGGACACTGCTTTATTGTAAGACTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G205100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,483,738\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55483738\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-GTCCAACTGCAGCTTTCCACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-GTCCAACTGCAGCTTTCCACAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCACTCTCAGAGCTCTTGATTTAGAACTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePvUI111.11G205100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e55,484,893\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eS11_55484893\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eAlternate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFAM-GAGTTGATGAACCAAAAGGTATACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eHEX-GAGTTGATGAACCAAAAGGTATACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eCommon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eGGTTGTAGATGACAAATGACGGATTGTTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Resistant allele\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u0026nbsp;\u003c/sup\u003eSusceptible allele\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5220084/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5220084/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Middle American rust resistance gene \u003cem\u003eUr-11\u003c/em\u003e present in common bean (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.) confers resistance to all but one known race of the pathogen \u003cem\u003eUromyces appendiculatus\u003c/em\u003e (Pers.) Unger. Even though progress has been made in understanding the host-pathogen interactions between common bean and \u003cem\u003eU. appendiculatus\u003c/em\u003e, the causal alleles of the majority of rust resistance loci, including \u003cem\u003eUr-11\u003c/em\u003e, remain unknown. A genome-wide association study (GWAS) was conducted to identify genomic regions associated with resistance to the \u003cem\u003eU. appendiculatus\u003c/em\u003e race 31\u0026thinsp;\u0026minus;\u0026thinsp;22, which is avirulent to \u003cem\u003eUr-11\u003c/em\u003e but virulent to other Middle American rust resistance genes. GWAS using genotypic data consisting of approximately 71k SNP markers and phenotypic data based on the median reaction type (1 to 9 scale) of a panel of 350 Middle American breeding lines and cultivars, plus 12 germplasm lines with the \u003cem\u003eUr-11\u003c/em\u003e locus derived from PI 181996, located \u003cem\u003eUr-11\u003c/em\u003e on chromosome Pv11. Twenty-seven SNP markers clustered in the 55.16\u0026ndash;55.56 Mb region of the \u003cem\u003eP. vulgaris\u003c/em\u003e UI111 reference. Multiple DNA sequence alignments detected a missense mutation [c.1,328A\u0026thinsp;\u0026gt;\u0026thinsp;G] in the \u003cem\u003ePvUI111.11G202400\u003c/em\u003e gene model that encodes a leucine-rich repeat-containing protein in response to race 31\u0026thinsp;\u0026minus;\u0026thinsp;20. A PCR allele competitive extension marker (PACE) was developed and tested across a panel of ~\u0026thinsp;650 Middle American dry bean genotypes. No recombination event was observed for the marker among the tested genotypes; suggesting that the polymorphism on which it is based is very close to or in the \u003cem\u003eUr-11\u003c/em\u003e gene. This SNP marker will be a useful and reliable marker for marker-assisted selection.\u003c/p\u003e","manuscriptTitle":"Fine Mapping and Identification of Causal Alleles at the Ur-11 Locus Controlling Rust Resistance in Common Bean (Phaseolus vulgaris L.)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-14 13:59:52","doi":"10.21203/rs.3.rs-5220084/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-10-11T11:38:32+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-11T10:13:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-09T15:14:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2024-10-07T14:08:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"c0f2cf29-b915-43f1-b5b0-c2f691d2f8d6","owner":[],"postedDate":"October 14th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-03T16:07:20+00:00","versionOfRecord":{"articleIdentity":"rs-5220084","link":"https://doi.org/10.1007/s00122-025-04836-9","journal":{"identity":"theoretical-and-applied-genetics","isVorOnly":false,"title":"Theoretical and Applied Genetics"},"publishedOn":"2025-02-24 15:57:30","publishedOnDateReadable":"February 24th, 2025"},"versionCreatedAt":"2024-10-14 13:59:52","video":"","vorDoi":"10.1007/s00122-025-04836-9","vorDoiUrl":"https://doi.org/10.1007/s00122-025-04836-9","workflowStages":[]},"version":"v1","identity":"rs-5220084","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5220084","identity":"rs-5220084","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}