Estrogen Administration Enhances the Adverse Effects of Cigarette Smoking on the Heart in Cycling Female Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Estrogen Administration Enhances the Adverse Effects of Cigarette Smoking on the Heart in Cycling Female Mice Emna Abidi, Reine Diab, Rana Zahreddine, Abdullah Kaplan, George W. Booz, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4619755/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Dec, 2024 Read the published version in Biology of Sex Differences → Version 1 posted 10 You are reading this latest preprint version Abstract Smoking, particularly chronic smoking (CS), is a threat to global health, contributing to increased mortality and morbidity associated with cardiovascular disease (CVDs). CS induces oxidative stress and endothelial dysfunction, which has a profound impact on cardiac structure and function. While the protective effects of estrogen, particularly 17β-estradiol (E2), on cardiovascular health are well-documented in premenopausal women, the interaction between estrogen and CS remains poorly understood. The aim of this study is to investigate the impact of chronic cigarette smoking on cardiac health in relation to ethinylestradiol (EE) oral contraceptive (OC) usage in premenopausal females. Female mice were exposed to chronic cigarette smoke and co-administered EE. Cardiac structural and functional parameters were assessed alongside inflammatory markers, oxidative stress indicators, and histological changes. Results revealed that the combination of EE and CS led to adverse cardiac remodeling characterized by increased left ventricular end-diastolic volume, decreased fractional shortening, and elevated left ventricular mass. Comparisons to both ovariectomized females and male mice indicate a singular influence of EE on cardiac contractility with CS. In addition, an inflammatory state was evident, marked by increased expression of IL-4, IL-1β, IL-13, IL-10, and PARP-1, as well as increased interstitial collagen deposition. These findings suggest a progression towards adverse cardiac remodeling resembling dilated cardiomyopathy. Furthermore, our observations highlight the complexity of the inflammatory response triggered by smoking, potentially exacerbated by estrogen supplementation. The main finding of this study is that the combination of CS and EE enhanced adverse cardiac remodeling, which was shown structurally, histologically, and biochemically. Cardiac remodeling tobacco use oxidative stress oral contraceptives inflammation cytokines Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Tobacco use and chronic smoking (CS) constitute a global epidemic among all age groups, causing serious health problems and a dramatic rise in deaths [ 1 ]. Tobacco smoke contains more than 4720 harmful compounds, such as polycyclic aromatic hydrocarbons, free radicals, and oxidative gases, which cause cells that line blood vessels to become swollen and inflamed. Indeed, CS is strongly associated with elevated oxidative stress status as evidenced by an increase in reactive oxygen species (ROS) production, LDL oxidation, attenuated levels of the cardioprotective HDL, higher levels of triglycerides, and subsequent endothelial dysfunction [ 2 ]. Moreover, CS has been demonstrated to be an independent risk factor accounting for 10% of cardiovascular diseases (CVDs), such as myocardial infarction, stroke, hypertension, coronary heart disease (CHD), atherosclerosis, and aortic aneurysm [ 3 ]. In fact, CS increases the risk of coronary artery disease (CAD) by 2- to 4-fold with the CHD incidence rate in all age groups being highly attributable to smoking [ 4 , 5 ]. CS may damage the heart through a direct effect on the myocardium resulting in smoking cardiomyopathy and an indirect effect by inducing other cardiovascular complications that in time damage and remodel the heart [ 6 ]. A source of oxidative stress that fuels the inflammatory response with CS is cellular and metabolic impairment; an excess in oxidants induces irreversible damage to cellular components, leading to altered cellular function or apoptosis [ 7 ]. CS also stimulates the recruitment of inflammatory cells leading to the generation of ROS, which contribute to protein oxidation and endothelial dysfunction. ROS production also triggers inflammation by effects on innate and adaptive immune cells, which in turn increase the secretion of pro-inflammatory cytokines [ 8 ]. ROS overproduction is characterized by the imbalance between antioxidant protection and ROS production [ 6 , 9 ], leading to various alterations at the structural, molecular, cellular, and interstitial levels of the heart and clinically relevant changes in cardiac size, mass, geometry, and function [ 10 ]. Notably, cigarette compounds also diminish intracellular antioxidant mechanisms such as superoxide dismutase (SOD) and glutathione peroxidase (GSH) [ 11 ]. This oxidative protective impairment further contributes to increased inflammation and mitochondrial dysfunction. In this context, the risk of CVD in smoking pre-menopausal females is often underestimated, due to the assumption that females are more protected against CVD development than males [ 12 ]. This is emphasized by the fact that endogenous-estrogen, 17β-estradiol (E2), the most potent human estrogen, affects almost every tissue or organ system, including the heart and blood vessels where it is linked in premenopausal women to NO production, blood pressure lowering actions, and multiple cardiovascular protective effects [ 13 ]. The latter are characterized in general by preserved cardiac function, decreased ROS generation, decreased apoptosis, decreased fibrosis and collagen deposition, and decreased immune cell infiltration and inflammatory cytokine generation [ 13 ]. However, research has shown that CS may interfere with the body's ability to utilize endogenous and exogenous estrogen [ 14 ]. Seemingly, smoking and estrogen have opposing effects on many common targets in the body. To date, data on the effects of chronic cigarette smoking on the heart in relation to ethinylestradiol (EE) oral contraceptive (OC) usage in premenopausal women is scarce. Therefore, we sought to investigate, for the first time, the mechanism of smoke cardiomyopathy in females using EE OCs. Material and Methods Animals This study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB). Five-month old WT C57BL/J6 fertile female and male mice (25–30 g) were purchased from Charles River Laboratories (Wilmington, MA, USA) and housed under pathogen-free conditions with constant temperature and humidity control at the AUB animal care facility. Mice were provided sterile bedding and ad libitum access to water and rodent chow. Study timeline and experimental design The experimental design of this study is shown in Fig. 1 . Baseline echocardiography (echo) was performed. Mice were then enrolled into 8 weeks of smoking exposure in parallel with subcutaneous (SQ) injections of EE or vehicle (V), with echo recorded every other week. Mice were sacrificed at week 8 and the organs collected. Ovariectomy was performed as previously described [ 15 ], 4 weeks before being used in experiments. Echocardiography Echocardiography was performed using the VEVO 2100 (High-Resolution Imaging System) with a frequency of 15.0 MHz. For imaging, animals were anaesthetized with isoflurane 2 to 3% in an oxygen mix chamber and placed on an electrically heated platform in a supine position. Body temperatures (maintained at 37°C), heart rates and respiratory rates were continuously monitored throughout the procedure via an Indus Mouse-Monitor Heated Surgical Platform and the depth of anaesthesia was adjusted to maintain heart rate at 400–500 beats per minute. M-mode and B-mode echocardiography images of the left ventricle (LV) were obtained in the parasternal long axis- and short-axis views. Measurements at baseline and at 8 weeks right before sacrifice were acquired. For all animals, three to four beats were measured using the same transducer position and mean calculations were obtained from three consecutive cardiac cycles. Fractional shortening (FS), ejection fraction (EF), left ventricular end‐systolic diameter (LVESD), left ventricular end‐diastolic diameter (LVESD), left ventricular end‐systolic volume (LVESV) and left ventricular end‐diastolic volume (LVEDV) were recorded. Chronic smoking exposure Upon arrival to the smoking exposure room and following a short acclimatization period, female mice were exposed to cigarette smoke (CS) using an exposure apparatus (ONARES, CH Technologies, USA). This apparatus includes a smoke generator with a mixing/conditioning chamber and a “nose only” rodent exposure carousel. It allows for exposure to mainstream smoke from a cigarette in conscious, restrained rodents. This system has been extensively used to study smoking-related diseases. Mice in the smoking groups (V + CS and EE + CS) received CS twice daily (7 days/week) for 8 weeks. Cigarettes were placed into the cigarette puffer, and a peristaltic pump was used to generate puffs at a frequency of 1 puff/minute, duration of 2.5 seconds, and a volume of 5 ml per puff generated from 3R4F cigarettes (University of Kentucky, Lexington, KY, USA). 3R4F are scientifically prepared cigarettes concentrated with toxins and chemicals, making the study timeline suitable to observe the effects of smoking on mice. Animals received two 60 min CS sessions per day allowing a total particular matter (TPM) concentration of about 100g/cm 3 /mouse/session (100 mg TPM, 9.4 mg tar, and 0.726 mg nicotine per cigarette). Drug delivery Stock solutions of EE (Sigma-Aldrich, St. Louis, MO) for injections were dissolved in a vehicle (V) of 0.1% solution of polyoxyethylated 12-hydroxystearic acid (Sigma-Aldrich) and additional dilutions were made using normal saline. Mice were subcutaneously injected with 25 µg/kg/day EE, daily for 21 days (3 weeks) per cycle, for a total of 2 cycles in 8 weeks. Vehicle was given to control groups (100 µL/day). EE contraceptives are widely adapted in rodent research and are used in this study at a human-equivalent dose. The EE dosage was selected based on previous reports and also to be comparable to clinically relevant levels during oral contraceptive therapy daily regimen that an average 60–70 kg woman would be prescribed in an oral contraceptive [ 15 ]. Necropsy : At the end of the study, all mice were sacrificed. Mice were anesthetized with 3% isoflurane vapor (Forane®) diluted with O 2 . They were then injected with heparin for 5 min prior to sacrifice to facilitate blood collection. After that, plasma was separated and mixed with protease inhibitors and snap frozen in liquid nitrogen for further analysis. Hearts were isolated from all mice, the right ventricle was removed, and the rest divided into 2 sections: one section was immediately suspended in formalin-containing storage vials for histology analysis and the other snap frozen in liquid nitrogen and stored at -80°C for molecular analysis. Histology After formalin (10%) fixation for 2 days in a biopsy cassette and at room temperature, left ventricular transactional cuts were dehydrated and embedded in paraffin. Tissue sections from paraffin blocks (4 µm thickness) were mounted on glass slides for further different staining. Hematoxylin and Eosin (H & E) staining : Briefly, heart mid sections of 5 µm thickness were taken for each mouse, de-paraffinized, rehydrated, and stained with H & E stain for 10 min. The slides were then washed and examined under a light microscope. Cross sectional area of 100 cells of each of the 4 groups: V, V + CS, EE and EE + CS (n = 5 of each), were measured using Image J software ( https://imagej.nih.gov/ij/ ). Masson’s trichrome staining In order to detect collagen deposition, tissue slides were stained with Masson’s Trichrome. Briefly, after dewaxing and hydration according to manufacturer’s protocol (Connective Tissue Stain, Abcam, ab150686) tissues were soaked in Boudin solution for 1 h at 56ᵒC, washed in running tap water, and then rinsed in distilled water. A second washing step was necessary after 10 min of incubation in hematoxylin, and then slides were stained in Biebrich scarlet acid fuchsin for 10 min. Sections were rinsed in water and incubated in phosphomolybdic phosphotungstic acid solution for 10 min. After that they were transferred to aniline blue solution and stained for 5 min and finally mounted and observed using light microscopy. Collagen volume fractions and fibrosis were measured using Image J software. Western blotting : Snap frozen left ventricular sections of the heart were ground in liquid nitrogen with a mortar and pestle and then homogenized in lysis buffer containing protease and phosphates inhibitors. This step was followed by a centrifugation (12,000xg at 4ᵒC) for 10 min. Protein concentrations were quantified using a DCTM Protein Assay II kit (Bio-Rad, Hercules, CA, USA). Equal amounts of protein samples were loaded in wells of a 10 or 12% gel and run until the dye front reached the bottom of the gel. Separated proteins were transferred onto methanol-activated PVDF membranes at 4°C for 1.5 h at 90 volts. The membranes were blocked with 5% fat-free milk prepared in Tween PBS solution at room temperature for 1h and incubated with primary antibodies and glyceraldehyde 3-phosphate dehydrogenase (GAPDH); the latter was used to ensure equal loading of samples. Immunoblots were then probed with the appropriate secondary antibody. All antibodies are listed in Table 1 . The immunoreactive bands were visualized with ECL chemiluminescence detection kit (Thermo Fisher Scientific). Image J software ( https://imagej.nih.gov/ij/ ) was used to quantify the intensity of bands and to normalize GAPDH protein levels on each group to confirm any up or down-regulation of the targeted protein. Table 1 List of antibodies Antibody (dilution) Catalogue number Commercial Source Anti-IL13 (1/500-1/1000) ab106732 abcam Anti-IL4 (1/1000) ab9728 abcam Anti-IL1beta (1/500) ab9722 abcam Anti-IL13 (1/500-1/1000) ab106732 abcam Anti-IL10 (1/1000) ab9969 abcam Anti-PARP-1 (1/500-1/1000) ab227244 abcam Anti-GAPDH (1/500-1/1000) ab8245 abcam Secondary anti-mouse (1:10000–1:200000) 115-035-003 Jackson ImmunoResearch Secondary anti-rabbit (1:10000) ab8245 abcam Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) Snap frozen heart tissues were used for RNA extraction. Briefly, mid-sections from the left ventricle were grounded in liquid nitrogen by a mortar and pestle then total RNA was isolated using TRIzol according to manufacturer’s instructions (Thermo Fisher Scientific, Grand Island, NY, USA). NanoDrop® ND-1000 UV-Vis spectrophotometer was used for RNA quantification. The purity of extracted RNA was assessed using the absorbance ratio of 260 to 280 nm, where a value of 1.8–2.0 indicates good-quality of RNA. To remove contaminating DNA, RNAs were treated with deoxyribonuclease I (Thermo, USA). qPCR was used to quantify differences in mRNA expression. Gene expressions, were monitored using SYBR® Green PCR Master Mix (Bio-Rad, Hercules, CA, USA). GAPDH expression was used to normalize gene expressions between different samples. cDNA was synthesized from RNA using Revert Aid 1st Strand cDNA synthesis kit (Thermo, USA), followed by real-time PCR analysis in a CFX96 real-time PCR instrument (Bio-Rad, Germany). For the qPCR reaction, cDNA was loaded in duplicates of each of the forward and reverse primers of the gene of interest and mixed with SYBR Green. Negative control (RNAs free water) was used to check for nonspecific amplification. Fold expressions were normalized relative to the control and were calculated and plotted using Bio-Rad CFX Manager to compare differential gene expressions. The sequences of primers are listed in Table 2 . Table 2 List of primers Primers Sequences Forward Reverse IL-1-β 5′-TGG TGT GTG ACG TTC CCA TT-3′ 5′-TGT CGT TGC TTG GTT CTC CT-3′ IL-6 GAACAACGATGATGCACTTGC 5′-TCCAGGTAGCTATGGTACTCC-3′ IL-13 5′-TGTGTCTCTCCCTCTGACCC-3′ 5′-CAGGGCTACACAGAACCCG-3′ TNF-α 5′-AATGGGCTCCCTCTCATCAGTTC-3′ 5′-TCTGCTTGGTGGTTTGCTACGAC-3′ NOX-4 5′-ACCAAATGTTGGGCGATTGTG-3′ 5′-GGCTACATGCACACCTGAGA-3′ SOD-1 5′-TGTTGGAGACCTGGGCAATG-3′ 5′-ACGGCCAATGATGGAATGCT-3′ GAPDH 5′-GGGGCTCTCTGCTCCTCCCTG-3′ 5′-CGGCCAAATCCGTTCACACCG-3′ IL-1, interleukin 1; IL-6, interleukin 6; IL-13, interleukin 13; TNF-α, tumor necrosis factor alpha; SOD-1, superoxide dismutase 1; NOX-4, NADPH oxidase 4; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Statistical analysis : Data are shown as means ± SEM (SEM). Statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, San Diego, CA; https://www.graphpad.com ). A difference of P < 0.05 was considered significant. Prior to analysis, normality tests including the D'Agostino-Pearson omnibus, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov test were applied to ensure data distribution met assumptions for parametric testing. With all datasets passing at least one normality test, validation for the application of a 2-way ANOVA was achieved. In case of significant interaction or if one or both main effects was significant, a Tukey post-test was performed. When representative images are shown, the selected images were those that most accurately represented the average data obtained in all the samples. Results The EE + CS combination resulted in adverse structural and functional cardiac remodeling in premenopausal female mice. CS increased both LVESD and LVEDD, but no effect of EE was observed (Figs. 2 A & 2 B). A modest increase in LVESV with EE was in evidence in mice exposed to CS (Fig. 2 C); however, the combination of EE and CS markedly increased LVEDV (Fig. 2 D). The EE + CS group also experienced a significant decrease in LV fractional shortening compared to the non-smoking EE treated group and all other groups (Fig. 3 A). Nevertheless, the EE + CS combination did not affect cardiac ejection fraction compared to any of the other groups (Fig. 3 B). CS enhanced LV mass, with the EE + CS group showing a significant increase in LV mass compared to all other groups (Fig. 4 ). The role of sex in the echocardiography changes observed with EE was further assessed using ovariectomized (OVX) females and males. As seen in Fig. 5 A, CS together with a reduction in endogenous estrogen impaired cardiac contractility as evidenced by an increase in LVESV, although LVEDV was not affected (Fig. 5 B). Fractional shortening was reduced in the absence of estrogen, while this was reversed by CS (Fig. 5 C). None of the other parameters mentioned above were affected by ovariectomy or male sex. The EE + CS combination resulted in upregulated expression of inflammatory marker mRNAs, but not TNFα gene expression and serum levels. Unlike the V treated groups that showed comparable levels of IL-1β and IL-6 mRNA expressions in the absence and presence of CS, both IL-1β and Il-6 pro-inflammatory gene expression increased in the left ventricles of EE + CS exposed mice after 8 weeks, compared to EE and V only groups (Figs. 6 A & 6 B). Moreover, IL-6 gene expression was significantly increased in the EE + CS group compared to the V + CS group (Fig. 6 B). The EE + CS group also showed a significant increase in IL-13 gene expression compared to the EE or V only groups (Fig. 6 C). IL-4 gene expression showed a significant effect of the EE + CS combination compared to all other conditions (Fig. 6 D). On the other hand, EE administration or CS exposure did not affect TNFα gene expression (Fig. 6 E) or serum levels (Fig. 6 F) alone or in combination. The EE + CS combination resulted in a significant upregulations of inflammatory protein expression and cell-death markers. In agreement with the PCR results, we found a significant increase in the protein expression levels of IL-4, IL-1β, IL-13, IL-10 inflammatory markers in the EE + CS group compared to all other groups (Figs. 7 A-D). Likewise, the same group presented with a significant increase in PARP-1 protein expression, as a marker of increased cellular stress and cell programmed death, in comparison to the other groups (Figs. 7 E). The EE + CS combination promoted protein expression of cardiac oxidative stress markers. The EE + CS combination tended to increase the expression of Nox-4 gene compared to the EE alone group (Fig. 8 A), although this did not reach significance. Moreover, no change was observed in SOD-1 expression in either the smoking or the nonsmoking studied groups (Fig. 8 B). The EE + CS combination resulted in collagen deposition in the left ventricular cardiac tissue, nut no change in cardiomyocyte cross-sectional area. LV cardiac tissue from the EE + CS group showed significantly increased deposition of interstitial collagen compared to the V + CS group (Fig. 9 A). The administration of EE resulted in no change in the cross-sectional area in the presence or the absence of CS (Fig. 9 B) indicating that there was no sign of cardiac hypertrophy at the histological level. Discussion In this study, we assessed whether the effects of estrogen on the heart were influenced by cigarette smoking in female mice. We observed that in response to cigarette smoking exposure estrogen administration caused in increase in diastolic LV volume, a decrease in fractional shortening, and an increase in LV mass. In addition, increases were observed in cardiac IL-4, IL-1β, IL-13, IL-10, and PARP-1 expression, in agreement with both an inflammatory response and increased cardiac stress. Greater interstitial collagen was also seen in cigarette smoke-exposed mice treated with estrogen. These observations are consistent with early stages of adverse cardiac remodeling as seen for instance with dilated cardiomyopathy [ 16 ]. These findings have relevance to understanding the risk of CVD due to smoking in premenopausal females, especially in the context of oral contraceptive usage. Estrogen receptors are expressed by cardiomyocytes and orchestrate a myriad of genomic and non-genomic effects on the heart [ 17 ]. Cardiovascular function is enhanced by endogenous estrogen; however, research has shown that CS may interfere with the body's ability to utilize endogenous and exogenous estrogen [ 14 ]. Some studies suggest that cigarette smoking is more harmful in young (premenopausal) women than in men, which may be due to CS-induced changes in estrogen activity [ 18 ]. It has been demonstrated that CS has anti-estrogenic effects due to changes in estrogen metabolism [ 19 , 20 ], by increasing the 2-hydroxylation stage of estradiol metabolism and thereby reducing estrogen availability and activity [ 21 , 22 ]. Tobacco smoke components lead to the upregulation of a number of genes, including members of the cytochrome P450 (CYP) family, in particular CYP1B1 and CYP1A; the latter and CYP1A2 are the primary enzymes in humans for catalyzing the 2-hydroxylation of estradiol [ 23 ]. Another study found that when taking oral estrogen replacement therapy (ERT), CS reduced estrogen levels by 40–70%, but when estrogen was applied transdermally at a low dosage to bypass liver metabolism smoking only caused a small change in estrogen levels [ 24 ]. These findings can be attributed to CS increasing the hepatic metabolism of oral estrogens, thus preventing the body from using drug-derived estrogens by converting them to forms that are less active. In addition, the 2-hydroxylation of estradiol results in the production of metabolites that have been associated with endometriosis and pain [ 25 ]. Our findings indicate that the functional responses of the hearts of female mice to CS is influenced by levels of estrogen. CS impaired cardiac contractility in female mice as indicated by an increase in LVESV with both the reduction and enhancement of estrogen levels. In intact females, EE treatment with CS impaired myocardial contractility as seen by decreased fractional shortening. On the other hand, in OVX females, CS reversed a decrease in fractional shortening, which may be attributable to enhanced sympathetic activity and as evidenced by increased heart rate with CS: 381 ± 12 (6) vs 469 ± 11 (6) and 434 ± 7 (4) vs 454 ± 13 (8), P < 0.05 in intact and OVX females, respectively. Of note, cardiac performance was not affected by CS in male mice in the presence study. However, we and others have previously reported that cigarette smoking results in a relatively modest increase in male mice in both LVEDD and LVESD, suggesting that some other variables are involved [ 26 , 27 ]. We observed increases in cytokines associated with both a type 1 and 2 inflammatory response. Numerous studies have reported that cigarette smoking is strongly associated with development of a systemic inflammatory response and increased risk of atherosclerotic cardiovascular disease [ 28 ]. CS has direct adverse effects on the myocardium, resulting in what is referred to as smoking cardiomyopathy [ 29 ]. Our findings indicate that estrogen supplementation may exacerbate smoking cardiomyopathy and the risk of cardiovascular disease. IL-4 and IL-13 are associated with cardiac fibrosis and hypertrophy [ 30 – 32 ], while IL-1β mediates inflammation, endothelial dysfunction and myocardial injury [ 33 ]. IL-10, traditionally considered anti-inflammatory, can paradoxically exacerbate cardiac remodeling under certain conditions [ 30 ]. PARP-1, involved in DNA repair and inflammation, also contributes to the pathophysiology of CVDs [ 34 ]. The complex roles of these inflammatory markers in cardiac remodeling underscore the intricate interplay between chronic smoking, estrogen supplementation and cardiovascular health. Further mechanistic studies are needed to elucidate the specific pathways by which these cytokines contribute to adverse cardiac remodeling in the context of estrogen supplementation and smoking. Our study has a few limitations. For one thing, we did not measure 2-hydroxylation of estradiol or blood estrogen levels. Nor did we examine immune cell infiltration into the heart. In addition, we did not look at what effect estrogen treatment may have had on the detrimental effects of cigarette smoking on vascular histology and function. In addition, with regard to OCs, estrogen and progesterone combination are commonly used as progesterone helps to regulate some effects of estrogen. This combination may have different results from what we found and needs future study. We also did not look at the effects of EE on males, which is relevant to defining the cardiovascular risks of CS to transgender females. In conclusion, the findings of our study indicate that in combination with cigarette smoking estrogen had harmful effects on the hearts of fertile female mice that is consistent with adverse cardiac remodeling. Additional studies are warranted to decipher the molecular basis for those actions. Declarations Ethics approval and consent to participate No human subjects or tissues were involved. This study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB). Consent for publication Not applicable Availability of data and materials The datasets generated and/or analyzed during the current study are available from the corresponding authors on reasonable request. Competing interests The authors declare that they have no competing interests. Funding GWB was supported in part by the National Institute of General Medical Sciences of the National Institutes of Health under Award Number P20GM121334. FAZ was supported by grants from the American University of Beirut Faculty of Medicine [MPP – 320145; URB – 103949], The Centre National de la Recherche Scientifique (CNRS) [grants number 103507/103487/103941/103944/104230] and by the Agence nationale des recherches (ANR) et l’Agence française de développement (AFD) [ANICOV-HF]. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Authors’ Contributions EA and RD carried out the experiments, performed data analysis, and participated in writing and revising the first draft. RZ and AK carried out the blinded analysis of the data and participated in revising the first draft. GWB participated in the design of the study and helped perform the statistical analysis and data interpretation. FAZ conceived the study, acquired funding, and participated in its design and coordination and helped to draft and revise the manuscript. All authors read and approved the final manuscript. Acknowledgements GWB acknowledges the support of the Pharmacology Clinical Research Core of the University of Mississippi Medical Center. Authors' information Emna Abidi and Reine Diab share first authorship. References USPHSOotS G, Prevention, NCfCD. Smoking HPOo. Preventing tobacco use among youth and young adults: a report of the surgeon general US Government Printing Office. 2012. Yao H, Edirisinghe I, Yang S-R, Rajendrasozhan S, Kode A, Caito S, et al. Genetic ablation of NADPH oxidase enhances susceptibility to cigarette smoke-induced lung inflammation and emphysema in mice. Am J Pathol. 2008;172:5. Messner B, Bernhard D. Smoking and cardiovascular disease: mechanisms of endothelial dysfunction and early atherogenesis. Arteriosclerosis, thrombosis, and vascular biology. 2014;34:3509–15. Health UDo, Services H. The health consequences of smoking—50 years of progress: a report of the Surgeon General. Atlanta, GA: US Department of Health and Human Services, Centers for Disease …. Tolstrup JS, Hvidtfeldt UA, Flachs EM, Spiegelman D, Heitmann BL, Bälter K, et al. Smoking and risk of coronary heart disease in younger, middle-aged, and older adults. Am J Public Health. 2014;104(1):96–102. Kaplan A, Abidi E, Ghali R, Booz GW, Kobeissy F, Zouein FA. Functional, cellular, and molecular remodeling of the heart under influence of oxidative cigarette tobacco smoke. Oxidative medicine and cellular longevity. 2017;2017. Ballinger SW, Patterson C, Yan C-N, Doan R, Burow DL, Young CG, et al. Hydrogen peroxide–and peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circul Res. 2000;86:9. Churg A, Dai J, Tai H, Xie C, Wright JL. Tumor necrosis factor-α is central to acute cigarette smoke–induced inflammation and connective tissue breakdown. Am J Respir Crit Care Med. 2002;166:6849–54. VAZIRI N. Causal link between oxidative stress, inflammation, and hypertension. 2008. Amiri P, Mohammadzadeh-Naziri K, Abbasi B, Cheraghi L, Jalali-Farahani S, Momenan AA, et al. Smoking habits and incidence of cardiovascular diseases in men and women: findings of a 12 year follow up among an urban Eastern-Mediterranean population. BMC Public Health. 2019;19:1–10. Rafacho BP, Azevedo PS, Polegato BF, Fernandes AA, Bertoline MA, Fernandes DC, et al. Tobacco smoke induces ventricular remodeling associated with an increase in NADPH oxidase activity. Cell Physiol Biochem. 2011;27:3–4. Lopez AD, Collishaw NE, Piha T. A descriptive model of the cigarette epidemic in developed countries. Tob Control. 1994;3:3. Raza JA, Reinhart RA, Movahed A. Ischemic heart disease in women and the role of hormone therapy. Int J Cardiol. 2004;96:1. Prescott E, Hippe M, Schnohr P, Hein HO, Vestbo J. Smoking and risk of myocardial infarction in women and men: longitudinal population study. BMJ. 1998;316:7137. Habeichi NJ, Ghali R, Mroueh A, Kaplan A, Tannous C, Jurjus A, et al. Sexual dimorphism in acute myocardial infarction-induced acute kidney injury: cardiorenal deteriorating effects of ovariectomy in premenopausal female mice. Clin Sci (Lond). 2023;137(1):47–63. 10.1042/CS20220513 . Zhang J, Cheng L, Li Z, Li H, Liu Y, Zhan H, et al. Immune cells and related cytokines in dilated cardiomyopathy. Biomed Pharmacother. 2024;171:116159. 10.1016/j.biopha.2024.116159 . Luo T, Kim JK. The role of estrogen and estrogen receptors on cardiomyocytes: an overview. Can J Cardiol. 2016;32:8. Grundtvig M, Hagen TP, German M, Reikvam Å. Sex-based differences in premature first myocardial infarction caused by smoking: twice as many years lost by women as by men. Eur J Prev Cardiol. 2009;16:2. Tankó LB, Christiansen C. An update on the antiestrogenic effect of smoking: a literature review with implications for researchers and practitioners. Menopause. 2004;11:1. Sathish V, Freeman MR, Long E, Thompson MA, Pabelick CM, Prakash Y. Cigarette smoke and estrogen signaling in human airway smooth muscle. Cell Physiol Biochem. 2015;36:3. JJ M. Increased 2-hydroxylation of estradiol as a possible mechanism for the anti-estrogenic effect of cigarette smoking. N Engl J Med. 1986;315:1305–9. Marom-Haham L, Shulman A. Cigarette smoking and hormones. Curr Opin Obstet Gynecol. 2016;28:4. Marom-Haham L, Shulman A. Cigarette smoking and hormones. Curr Opin Obstet Gynecol. 2016;28:4:230–5. 10.1097/GCO.0000000000000283 . Mueck AO, Seeger H. Smoking, estradiol metabolism and hormone replacement therapy. Curr Med Chem Cardiovasc Hematol Agents. 2005;3:1:45–54. 10.2174/1568016052773270 . Emond JP, Caron P, Pusic M, Turcotte V, Simonyan D, Vogler A, et al. Circulating estradiol and its biologically active metabolites in endometriosis and in relation to pain symptoms. Front Endocrinol (Lausanne). 2022;13:1034614. 10.3389/fendo.2022.1034614 . Kaplan A, Abidi E, Habeichi NJ, Ghali R, Alawasi H, Fakih C, et al. Gender-biased kidney damage in mice following exposure to tobacco cigarette smoke: More protection in premenopausal females. Physiol Rep. 2020;8:2e14339. 10.14814/phy2.14339 . Zhou X, Li C, Xu W, Chen J. Trimetazidine protects against smoking-induced left ventricular remodeling via attenuating oxidative stress, apoptosis, and inflammation. PLoS ONE. 2012;7:7e40424. 10.1371/journal.pone.0040424 . Ishida M, Sakai C, Kobayashi Y, Ishida T. Cigarette Smoking and Atherosclerotic Cardiovascular Disease. J Atheroscler Thromb. 2024;31:3:189–200. 10.5551/jat.RV22015 . Kaplan A, Abidi E, Ghali R, Booz GW, Kobeissy F, Zouein FA. Functional, Cellular, and Molecular Remodeling of the Heart under Influence of Oxidative Cigarette Tobacco Smoke. Oxid Med Cell Longev. 2017;2017:3759186. 10.1155/2017/3759186 . Frangogiannis NG. Cardiac fibrosis. Cardiovasc Res. 2021;117:6:1450–88. 10.1093/cvr/cvaa324 . Rosello-Lleti E, Rivera M, Bertomeu V, Cortes R, Jordan A, Gonzalez-Molina A. [Interleukin-4 and cardiac fibrosis in patients with heart failure]. Rev Esp Cardiol. 2007;60:7777–80. https://www.ncbi.nlm.nih.gov/pubmed/17663863 . Hofmann U, Knorr S, Vogel B, Weirather J, Frey A, Ertl G, et al. Interleukin-13 deficiency aggravates healing and remodeling in male mice after experimental myocardial infarction. Circ Heart Fail. 2014;7:5822–30. 10.1161/CIRCHEARTFAILURE.113.001020 . Frangogiannis NG. Interleukin-1 in cardiac injury, repair, and remodeling: pathophysiologic and translational concepts. Discoveries (Craiova). 2015;3:1. 10.15190/d.2015.33 . Andrabi SA, Umanah GK, Chang C, Stevens DA, Karuppagounder SS, Gagne JP, et al. Poly(ADP-ribose) polymerase-dependent energy depletion occurs through inhibition of glycolysis. Proc Natl Acad Sci U S A. 2014;111:28. 10.1073/pnas.1405158111 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 04 Dec, 2024 Read the published version in Biology of Sex Differences → Version 1 posted Editorial decision: Revision requested 12 Aug, 2024 Reviews received at journal 24 Jul, 2024 Reviews received at journal 23 Jul, 2024 Reviewers agreed at journal 08 Jul, 2024 Reviewers agreed at journal 02 Jul, 2024 Reviewers agreed at journal 02 Jul, 2024 Reviewers invited by journal 02 Jul, 2024 Editor assigned by journal 28 Jun, 2024 Submission checks completed at journal 28 Jun, 2024 First submitted to journal 21 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4619755","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329817300,"identity":"7033f744-5fd9-4d36-a74b-1d0c1d315d93","order_by":0,"name":"Emna Abidi","email":"","orcid":"","institution":"American University of Beirut Medical Center, Riad El-Solh","correspondingAuthor":false,"prefix":"","firstName":"Emna","middleName":"","lastName":"Abidi","suffix":""},{"id":329817302,"identity":"14083f32-15b4-4d1b-9b5b-9558a36fb4e4","order_by":1,"name":"Reine Diab","email":"","orcid":"","institution":"American University of Beirut Medical Center, Riad El-Solh","correspondingAuthor":false,"prefix":"","firstName":"Reine","middleName":"","lastName":"Diab","suffix":""},{"id":329817303,"identity":"cf4f9017-9001-458b-be1d-9aea3eca4562","order_by":2,"name":"Rana Zahreddine","email":"","orcid":"","institution":"American University of Beirut Medical Center, Riad El-Solh","correspondingAuthor":false,"prefix":"","firstName":"Rana","middleName":"","lastName":"Zahreddine","suffix":""},{"id":329817304,"identity":"32c5a53f-660e-4010-ac66-b47ef38e705f","order_by":3,"name":"Abdullah Kaplan","email":"","orcid":"","institution":"American University of Beirut Medical Center, Riad El-Solh","correspondingAuthor":false,"prefix":"","firstName":"Abdullah","middleName":"","lastName":"Kaplan","suffix":""},{"id":329817305,"identity":"1d6a42d0-efc1-45cc-b9a1-0ece88d3a763","order_by":4,"name":"George W. Booz","email":"","orcid":"","institution":"University of Mississippi Medical Center","correspondingAuthor":false,"prefix":"","firstName":"George","middleName":"W.","lastName":"Booz","suffix":""},{"id":329817306,"identity":"42048014-3251-43d7-8f30-bbed33f6aa53","order_by":5,"name":"Fouad A. Zouein","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYBAC9gbG9g8fGBgSgGwDBoaCA4S18BxgbmOcAddiQJQW9jZmHtK08B9se2xTcziPgb15mwSDwR0itDAcbDfOOXa4mIHnWBlQyzPCWuwZGxukc9gOJzZI5JgBtRwmwhZmxgZpi39ALfJviNXCxtgmzdgGsoWHWC08jM2GvX3pxWw8acUWCcT4hYf/+MMHP75Z5/GzH95440MFESEGB2wgIoEEDaNgFIyCUTAK8AAApHA26s3CkCMAAAAASUVORK5CYII=","orcid":"","institution":"American University of Beirut Medical Center, Riad El-Solh","correspondingAuthor":true,"prefix":"","firstName":"Fouad","middleName":"A.","lastName":"Zouein","suffix":""}],"badges":[],"createdAt":"2024-06-22 02:53:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4619755/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4619755/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13293-024-00667-3","type":"published","date":"2024-12-04T15:57:01+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60833725,"identity":"f615b95b-bd99-4d29-b1d1-d7dac31ed7eb","added_by":"auto","created_at":"2024-07-22 15:26:59","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":53103,"visible":true,"origin":"","legend":"\u003cp\u003eStudy Timeline. EE, ethinylestradiol; V, vehicle; CS, chronic cigarette smoking; WT, wild type; SQ, subcutaneous; TPM, total particulate matter; Cig, cigarette; Echo, echocardiography.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/29920208f59c1bc62a8e5d4f.png"},{"id":60833039,"identity":"1d8db61c-ae80-44b2-8982-f8887f17f68c","added_by":"auto","created_at":"2024-07-22 15:18:59","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":43554,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EE+CS on left ventricular diameters and volumes. Following 8 weeks of EE administration and concomitant CS, the EE+CS group displayed LV dilatation represented by an increased (\u003cstrong\u003eA\u003c/strong\u003e) LVESD and (\u003cstrong\u003eB)\u003c/strong\u003e LVEDD when compared to the V only group. Left LVESV \u003cstrong\u003e(C)\u003c/strong\u003e and LVEDV \u003cstrong\u003e(D)\u003c/strong\u003e also showed the same significant increase in the EE+CS group when compared to all other groups. CS, chronic smoking; EE, ethynil estradiol; V, vehicle; LVESD, left ventricular end-systolic diameter; LVEDD, left ventricular end-diastolic diameter; LVESV, left ventricular end-systolic volume; LVEDV, left ventricular end-diastolic volume. Data were analysed for significance using two-way ANOVA. All bars represent mean ± SEM (*P ≤ 0.05; **P ≤ 0.01; \u003cem\u003en\u003c/em\u003e = 5–10).\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/796659e73abaa2dd2a7ccef0.png"},{"id":60832180,"identity":"3f3fced2-8e71-4d78-8660-55509361cb7c","added_by":"auto","created_at":"2024-07-22 15:02:59","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21510,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of EE+CS combination on cardiac function. Following 8 weeks of CS and EE simultaneous administration, left ventricular systolic function showed deteriorations represented by a decreased left ventricular fractional shortening in the EE+CS group when compared to all other groups \u003cstrong\u003e(A)\u003c/strong\u003ewhile EF \u003cstrong\u003e(B)\u003c/strong\u003e remained preserved in all groups. CS, chronic smoking; EE, ethynil estradiol; V, vehicle; LV, left ventricular. Data were analysed for significance using two-way ANOVA. All bars represent mean ± SEM (*P ≤ 0.05; **P ≤ 0.01; ***P≤ 0.001; \u003cem\u003en\u003c/em\u003e = 5–10).\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/ca96711b93ebc0c8cf9fee4e.png"},{"id":60832618,"identity":"49efc84f-8d9e-40a8-a0ab-47c9f62fea76","added_by":"auto","created_at":"2024-07-22 15:10:59","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":17012,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EE+CS on left ventricular cardiac mass. Following 8 weeks of CS and EE simultaneous administration, left ventricular mass showed a significant increase in the EE+CS group when compared to all other groups. CS, chronic smoking; EE, ethynil estradiol; V, vehicle; LV, left ventricular. Data were analysed for significance using two-way ANOVA. All bars represent mean ± SEM. (*P ≤ 0.05; ***P ≤ 0.001 and ****P ≤ 0.0001; n=6-10).\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/2ef0fef8757682c3e0f9ecab.png"},{"id":60832621,"identity":"4b2bd1ea-3783-4f4e-bafb-88d3035319e4","added_by":"auto","created_at":"2024-07-22 15:10:59","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":46961,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of CS on cardiac performance in ovariectomized females and male mice. \u003cstrong\u003e(A)\u003c/strong\u003eLeft ventricular end systolic volume (LVESV) and \u003cstrong\u003e(B)\u003c/strong\u003e left ventricular end diastolic volume was measured in n = 6-9 females or n = 6 males per group. \u0026nbsp;\u003cstrong\u003e(C)\u003c/strong\u003e Fractional shortening was measured in n = 5-9 females or 5 = 6 males per group. **P ≤ 0.01 and ***P ≤ 0.001.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/608cddc5fcc77b6260937eb2.png"},{"id":60832184,"identity":"addc9199-a76d-45f9-816b-c3657618edd7","added_by":"auto","created_at":"2024-07-22 15:02:59","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":46501,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EE+CS on gene expressions of proinflammatory markers at 8 weeks post CS concomitant exposure. Higher inflammatory marker mRNA expression in the EE+CS treated group. EE+CS combination resulted in a significantly greater IL-1 mRNA expression compared to CS naïve EE and V treated groups. The V injected group presented with no significant changes in IL-1 mRNA expression levels irrespective of CS exposure (\u003cstrong\u003eA\u003c/strong\u003e). Similarly, a significant increase in the IL-6 mRNA expression was shown only in the EE+CS group compared to all other groups (\u003cstrong\u003eB\u003c/strong\u003e). Moreover,\u003cstrong\u003e \u003c/strong\u003eEE+CS combination resulted in a significantly greater IL-13 (\u003cstrong\u003eC\u003c/strong\u003e) and IL-4 (\u003cstrong\u003eD\u003c/strong\u003e) mRNA expressions compared to CS naïve EE and V treated groups. The V injected group presented with no significant changes in both interleukins’ mRNA expression levels irrespective of CS exposure. EE+CS combination resulted in no significant change neither in TNF-α mRNA expression (\u003cstrong\u003eE\u003c/strong\u003e) nor TNF-α serum levels (\u003cstrong\u003eF\u003c/strong\u003e) compared to CS naïve treated EE and V groups. CS,chronic smoking; EE, ethynil estradiol; V, vehicle; LV, left ventricular; Data were analysed for significance using two-way ANOVA. All bars represent mean ± SEM (*P ≤ 0.05; **P ≤ 0.01; n=2-6).\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/4552d2a3c0da3cedee12ac91.png"},{"id":60832187,"identity":"7457ca0a-60de-4ffa-b837-f56264ceb1b4","added_by":"auto","created_at":"2024-07-22 15:02:59","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":160025,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EE+CS on protein expressions of proinflammatory markers at 8 weeks post CS concomitant exposure. Higher inflammatory markers’ protein expression in the EE+CS treated group. Protein expressions of IL-4 (\u003cstrong\u003eA\u003c/strong\u003e), IL-1 (\u003cstrong\u003eB\u003c/strong\u003e), IL-13 (\u003cstrong\u003eC\u003c/strong\u003e), IL-10 (\u003cstrong\u003eD\u003c/strong\u003e) significantly increased in the EE+CD treated mice when compared to all other groups. Similar pattern is observed with cleaved PARP-1 protein levels (\u003cstrong\u003eE\u003c/strong\u003e). Representative images of each blot are shown. Data were analysed for significance using two-way ANOVA. All bars represent fold change ± SEM after normalization to GAPDH (*P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001; n=2-10). CS, chronic smoking; EE, ethinylestradiol; V, vehicle; LV, left ventricular; IL, interleukin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase as housekeeping protein; TNF-α, tumor necrosis factor alpha; PARP-1, poly (ADP-ribose) polymerase 1.\u003c/p\u003e","description":"","filename":"Slide7.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/b63ff858087036024389c1dc.png"},{"id":60832186,"identity":"23a01ff6-41b5-489c-9aca-78757a44df0c","added_by":"auto","created_at":"2024-07-22 15:02:59","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":15383,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of EE+CS administration on gene expressions of oxidative stress markers at 8 weeks post CS concomitant exposure. Higher levels oxidative stress markers in the EE+CS group were demonstrated. Nox-4 mRNA expression significantly increased the EE+CS mice group when compared to the EE only treated group (\u003cstrong\u003eA\u003c/strong\u003e). On the other hand, SOD-1 mRNA expression didn’t show any significant change in all groups (\u003cstrong\u003eB\u003c/strong\u003e). Data were analysed for significance using two-way ANOVA. All bars represent fold change ± SEM (*P=0.05; n=2-3). CS, chronic smoking; EE, ethynil estradiol; V, vehicle; LV, left ventricular; NOX-4, NADPH oxidase 4; SOD, superoxide dismutase; GAPDH, glyceraldehyde 3-phosphate dehydrogenase as housekeeping protein.\u003c/p\u003e","description":"","filename":"Slide8.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/bce689ea31cf58602dcc4703.png"},{"id":60832188,"identity":"01571a29-777f-4ef4-9f0d-399f3e80fd08","added_by":"auto","created_at":"2024-07-22 15:02:59","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":402545,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of EE+CS on cardiac collagen and myocyte size.\u003c/strong\u003e Left ventricular fibrosis percentage significantly increased in the EE+CS mice group when compared to their counterparts in the V+CS group (\u003cstrong\u003eA\u003c/strong\u003e). Representative image of each Masson trichrome‐stained group is shown. Representative image of each H\u0026amp;E‐stained group is shown (B). No significant difference in left ventricular cross-sectional area between all different groups was shown Data were analysed for significance using two-way ANOVA. All bars represent fold change ± SEM (*P \u0026lt; 0.05; n =2-3). Scale bars = 100 µm. CS, chronic smoking; EE, ethinylestradiol; V, vehicle.\u003c/p\u003e","description":"","filename":"Slide9.png","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/a0608601511b3fdf2cc9ddc1.png"},{"id":70964823,"identity":"5fd3ab48-9bcb-407d-a5fe-a06d1d1100d9","added_by":"auto","created_at":"2024-12-09 16:16:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1424813,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4619755/v1/500d05a5-0bd0-4fa5-8e21-6c93ce589345.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Estrogen Administration Enhances the Adverse Effects of Cigarette Smoking on the Heart in Cycling Female Mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTobacco use and chronic smoking (CS) constitute a global epidemic among all age groups, causing serious health problems and a dramatic rise in deaths [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Tobacco smoke contains more than 4720 harmful compounds, such as polycyclic aromatic hydrocarbons, free radicals, and oxidative gases, which cause cells that line blood vessels to become swollen and inflamed. Indeed, CS is strongly associated with elevated oxidative stress status as evidenced by an increase in reactive oxygen species (ROS) production, LDL oxidation, attenuated levels of the cardioprotective HDL, higher levels of triglycerides, and subsequent endothelial dysfunction [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Moreover, CS has been demonstrated to be an independent risk factor accounting for 10% of cardiovascular diseases (CVDs), such as myocardial infarction, stroke, hypertension, coronary heart disease (CHD), atherosclerosis, and aortic aneurysm [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In fact, CS increases the risk of coronary artery disease (CAD) by 2- to 4-fold with the CHD incidence rate in all age groups being highly attributable to smoking [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCS may damage the heart through a direct effect on the myocardium resulting in smoking cardiomyopathy and an indirect effect by inducing other cardiovascular complications that in time damage and remodel the heart [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. A source of oxidative stress that fuels the inflammatory response with CS is cellular and metabolic impairment; an excess in oxidants induces irreversible damage to cellular components, leading to altered cellular function or apoptosis [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. CS also stimulates the recruitment of inflammatory cells leading to the generation of ROS, which contribute to protein oxidation and endothelial dysfunction. ROS production also triggers inflammation by effects on innate and adaptive immune cells, which in turn increase the secretion of pro-inflammatory cytokines [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. ROS overproduction is characterized by the imbalance between antioxidant protection and ROS production [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], leading to various alterations at the structural, molecular, cellular, and interstitial levels of the heart and clinically relevant changes in cardiac size, mass, geometry, and function [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Notably, cigarette compounds also diminish intracellular antioxidant mechanisms such as superoxide dismutase (SOD) and glutathione peroxidase (GSH) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. This oxidative protective impairment further contributes to increased inflammation and mitochondrial dysfunction.\u003c/p\u003e \u003cp\u003eIn this context, the risk of CVD in smoking pre-menopausal females is often underestimated, due to the assumption that females are more protected against CVD development than males [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. This is emphasized by the fact that endogenous-estrogen, 17β-estradiol (E2), the most potent human estrogen, affects almost every tissue or organ system, including the heart and blood vessels where it is linked in premenopausal women to NO production, blood pressure lowering actions, and multiple cardiovascular protective effects [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The latter are characterized in general by preserved cardiac function, decreased ROS generation, decreased apoptosis, decreased fibrosis and collagen deposition, and decreased immune cell infiltration and inflammatory cytokine generation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, research has shown that CS may interfere with the body's ability to utilize endogenous and exogenous estrogen [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Seemingly, smoking and estrogen have opposing effects on many common targets in the body. To date, data on the effects of chronic cigarette smoking on the heart in relation to ethinylestradiol (EE) oral contraceptive (OC) usage in premenopausal women is scarce. Therefore, we sought to investigate, for the first time, the mechanism of smoke cardiomyopathy in females using EE OCs.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e \u003cstrong\u003eAnimals\u003c/strong\u003e \u003cp\u003e This study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB). Five-month old WT C57BL/J6 fertile female and male mice (25\u0026ndash;30 g) were purchased from Charles River Laboratories (Wilmington, MA, USA) and housed under pathogen-free conditions with constant temperature and humidity control at the AUB animal care facility. Mice were provided sterile bedding and ad libitum access to water and rodent chow.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eStudy timeline and experimental design\u003c/strong\u003e \u003cp\u003eThe experimental design of this study is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Baseline echocardiography (echo) was performed. Mice were then enrolled into 8 weeks of smoking exposure in parallel with subcutaneous (SQ) injections of EE or vehicle (V), with echo recorded every other week. Mice were sacrificed at week 8 and the organs collected. Ovariectomy was performed as previously described [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], 4 weeks before being used in experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEchocardiography\u003c/strong\u003e \u003cp\u003eEchocardiography was performed using the VEVO 2100 (High-Resolution Imaging System) with a frequency of 15.0 MHz. For imaging, animals were anaesthetized with isoflurane 2 to 3% in an oxygen mix chamber and placed on an electrically heated platform in a supine position. Body temperatures (maintained at 37\u0026deg;C), heart rates and respiratory rates were continuously monitored throughout the procedure via an Indus Mouse-Monitor Heated Surgical Platform and the depth of anaesthesia was adjusted to maintain heart rate at 400\u0026ndash;500 beats per minute. M-mode and B-mode echocardiography images of the left ventricle (LV) were obtained in the parasternal long axis- and short-axis views. Measurements at baseline and at 8 weeks right before sacrifice were acquired. For all animals, three to four beats were measured using the same transducer position and mean calculations were obtained from three consecutive cardiac cycles. Fractional shortening (FS), ejection fraction (EF), left ventricular end‐systolic diameter (LVESD), left ventricular end‐diastolic diameter (LVESD), left ventricular end‐systolic volume (LVESV) and left ventricular end‐diastolic volume (LVEDV) were recorded.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eChronic smoking exposure\u003c/strong\u003e \u003cp\u003eUpon arrival to the smoking exposure room and following a short acclimatization period, female mice were exposed to cigarette smoke (CS) using an exposure apparatus (ONARES, CH Technologies, USA). This apparatus includes a smoke generator with a mixing/conditioning chamber and a \u0026ldquo;nose only\u0026rdquo; rodent exposure carousel. It allows for exposure to mainstream smoke from a cigarette in conscious, restrained rodents. This system has been extensively used to study smoking-related diseases. Mice in the smoking groups (V\u0026thinsp;+\u0026thinsp;CS and EE\u0026thinsp;+\u0026thinsp;CS) received CS twice daily (7 days/week) for 8 weeks. Cigarettes were placed into the cigarette puffer, and a peristaltic pump was used to generate puffs at a frequency of 1 puff/minute, duration of 2.5 seconds, and a volume of 5 ml per puff generated from 3R4F cigarettes (University of Kentucky, Lexington, KY, USA). 3R4F are scientifically prepared cigarettes concentrated with toxins and chemicals, making the study timeline suitable to observe the effects of smoking on mice. Animals received two 60 min CS sessions per day allowing a total particular matter (TPM) concentration of about 100g/cm\u003csup\u003e3\u003c/sup\u003e/mouse/session (100 mg TPM, 9.4 mg tar, and 0.726 mg nicotine per cigarette).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eDrug delivery\u003c/strong\u003e \u003cp\u003eStock solutions of EE (Sigma-Aldrich, St. Louis, MO) for injections were dissolved in a vehicle (V) of 0.1% solution of polyoxyethylated 12-hydroxystearic acid (Sigma-Aldrich) and additional dilutions were made using normal saline. Mice were subcutaneously injected with 25 \u0026micro;g/kg/day EE, daily for 21 days (3 weeks) per cycle, for a total of 2 cycles in 8 weeks. Vehicle was given to control groups (100 \u0026micro;L/day). EE contraceptives are widely adapted in rodent research and are used in this study at a human-equivalent dose. The EE dosage was selected based on previous reports and also to be comparable to clinically relevant levels during oral contraceptive therapy daily regimen that an average 60\u0026ndash;70 kg woman would be prescribed in an oral contraceptive [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eNecropsy\u003c/b\u003e: At the end of the study, all mice were sacrificed. Mice were anesthetized with 3% isoflurane vapor (Forane\u0026reg;) diluted with O\u003csub\u003e2\u003c/sub\u003e. They were then injected with heparin for 5 min prior to sacrifice to facilitate blood collection. After that, plasma was separated and mixed with protease inhibitors and snap frozen in liquid nitrogen for further analysis. Hearts were isolated from all mice, the right ventricle was removed, and the rest divided into 2 sections: one section was immediately suspended in formalin-containing storage vials for histology analysis and the other snap frozen in liquid nitrogen and stored at -80\u0026deg;C for molecular analysis.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eHistology\u003c/strong\u003e \u003cp\u003eAfter formalin (10%) fixation for 2 days in a biopsy cassette and at room temperature, left ventricular transactional cuts were dehydrated and embedded in paraffin. Tissue sections from paraffin blocks (4 \u0026micro;m thickness) were mounted on glass slides for further different staining.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHematoxylin and Eosin (H\u003c/b\u003e \u0026amp; \u003cb\u003eE) staining\u003c/b\u003e: Briefly, heart mid sections of 5 \u0026micro;m thickness were taken for each mouse, de-paraffinized, rehydrated, and stained with H \u0026amp; E stain for 10 min. The slides were then washed and examined under a light microscope. Cross sectional area of 100 cells of each of the 4 groups: V, V\u0026thinsp;+\u0026thinsp;CS, EE and EE\u0026thinsp;+\u0026thinsp;CS (n\u0026thinsp;=\u0026thinsp;5 of each), were measured using Image J software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://imagej.nih.gov/ij/\u003c/span\u003e\u003cspan address=\"https://imagej.nih.gov/ij/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMasson\u0026rsquo;s trichrome staining\u003c/strong\u003e \u003cp\u003eIn order to detect collagen deposition, tissue slides were stained with Masson\u0026rsquo;s Trichrome. Briefly, after dewaxing and hydration according to manufacturer\u0026rsquo;s protocol (Connective Tissue Stain, Abcam, ab150686) tissues were soaked in Boudin solution for 1 h at 56ᵒC, washed in running tap water, and then rinsed in distilled water. A second washing step was necessary after 10 min of incubation in hematoxylin, and then slides were stained in Biebrich scarlet acid fuchsin for 10 min. Sections were rinsed in water and incubated in phosphomolybdic phosphotungstic acid solution for 10 min. After that they were transferred to aniline blue solution and stained for 5 min and finally mounted and observed using light microscopy. Collagen volume fractions and fibrosis were measured using Image J software.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blotting\u003c/b\u003e: Snap frozen left ventricular sections of the heart were ground in liquid nitrogen with a mortar and pestle and then homogenized in lysis buffer containing protease and phosphates inhibitors. This step was followed by a centrifugation (12,000xg at 4ᵒC) for 10 min. Protein concentrations were quantified using a DCTM Protein Assay II kit (Bio-Rad, Hercules, CA, USA). Equal amounts of protein samples were loaded in wells of a 10 or 12% gel and run until the dye front reached the bottom of the gel. Separated proteins were transferred onto methanol-activated PVDF membranes at 4\u0026deg;C for 1.5 h at 90 volts. The membranes were blocked with 5% fat-free milk prepared in Tween PBS solution at room temperature for 1h and incubated with primary antibodies and glyceraldehyde 3-phosphate dehydrogenase (GAPDH); the latter was used to ensure equal loading of samples. Immunoblots were then probed with the appropriate secondary antibody. All antibodies are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The immunoreactive bands were visualized with ECL chemiluminescence detection kit (Thermo Fisher Scientific). Image J software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://imagej.nih.gov/ij/\u003c/span\u003e\u003cspan address=\"https://imagej.nih.gov/ij/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to quantify the intensity of bands and to normalize GAPDH protein levels on each group to confirm any up or down-regulation of the targeted protein.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of antibodies\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody (dilution)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCatalogue number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCommercial Source\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-IL13 (1/500-1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab106732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-IL4 (1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab9728\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-IL1beta (1/500)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab9722\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-IL13 (1/500-1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab106732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-IL10 (1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab9969\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-PARP-1 (1/500-1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab227244\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-GAPDH (1/500-1/1000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab8245\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSecondary anti-mouse (1:10000\u0026ndash;1:200000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e115-035-003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJackson\u003c/p\u003e \u003cp\u003eImmunoResearch\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSecondary anti-rabbit (1:10000)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eab8245\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eabcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eReverse transcription-quantitative polymerase chain reaction (RT-qPCR)\u003c/strong\u003e \u003cp\u003eSnap frozen heart tissues were used for RNA extraction. Briefly, mid-sections from the left ventricle were grounded in liquid nitrogen by a mortar and pestle then total RNA was isolated using TRIzol according to manufacturer\u0026rsquo;s instructions (Thermo Fisher Scientific, Grand Island, NY, USA). NanoDrop\u0026reg; ND-1000 UV-Vis spectrophotometer was used for RNA quantification. The purity of extracted RNA was assessed using the absorbance ratio of 260 to 280 nm, where a value of 1.8\u0026ndash;2.0 indicates good-quality of RNA. To remove contaminating DNA, RNAs were treated with deoxyribonuclease I (Thermo, USA). qPCR was used to quantify differences in mRNA expression. Gene expressions, were monitored using SYBR\u0026reg; Green PCR Master Mix (Bio-Rad, Hercules, CA, USA). GAPDH expression was used to normalize gene expressions between different samples. cDNA was synthesized from RNA using Revert Aid 1st Strand cDNA synthesis kit (Thermo, USA), followed by real-time PCR analysis in a CFX96 real-time PCR instrument (Bio-Rad, Germany). For the qPCR reaction, cDNA was loaded in duplicates of each of the forward and reverse primers of the gene of interest and mixed with SYBR Green. Negative control (RNAs free water) was used to check for nonspecific amplification. Fold expressions were normalized relative to the control and were calculated and plotted using Bio-Rad CFX Manager to compare differential gene expressions. The sequences of primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-TGG TGT GTG ACG TTC CCA TT-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-TGT CGT TGC TTG GTT CTC CT-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAACAACGATGATGCACTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-TCCAGGTAGCTATGGTACTCC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-TGTGTCTCTCCCTCTGACCC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CAGGGCTACACAGAACCCG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-AATGGGCTCCCTCTCATCAGTTC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-TCTGCTTGGTGGTTTGCTACGAC-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOX-4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-ACCAAATGTTGGGCGATTGTG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-GGCTACATGCACACCTGAGA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSOD-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-TGTTGGAGACCTGGGCAATG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-ACGGCCAATGATGGAATGCT-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026prime;-GGGGCTCTCTGCTCCTCCCTG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026prime;-CGGCCAAATCCGTTCACACCG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eIL-1, interleukin 1; IL-6, interleukin 6; IL-13, interleukin 13; TNF-α, tumor necrosis factor alpha; SOD-1, superoxide dismutase 1; NOX-4, NADPH oxidase 4; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical analysis\u003c/b\u003e: Data are shown as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (SEM). Statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, San Diego, CA; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.graphpad.com\u003c/span\u003e\u003cspan address=\"https://www.graphpad.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). A difference of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant. Prior to analysis, normality tests including the D'Agostino-Pearson omnibus, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov test were applied to ensure data distribution met assumptions for parametric testing. With all datasets passing at least one normality test, validation for the application of a 2-way ANOVA was achieved. In case of significant interaction or if one or both main effects was significant, a Tukey post-test was performed. When representative images are shown, the selected images were those that most accurately represented the average data obtained in all the samples.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination resulted in adverse structural and functional cardiac remodeling in premenopausal female mice.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCS increased both LVESD and LVEDD, but no effect of EE was observed (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). A modest increase in LVESV with EE was in evidence in mice exposed to CS (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC); however, the combination of EE and CS markedly increased LVEDV (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The EE\u0026thinsp;+\u0026thinsp;CS group also experienced a significant decrease in LV fractional shortening compared to the non-smoking EE treated group and all other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Nevertheless, the EE\u0026thinsp;+\u0026thinsp;CS combination did not affect cardiac ejection fraction compared to any of the other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). CS enhanced LV mass, with the EE\u0026thinsp;+\u0026thinsp;CS group showing a significant increase in LV mass compared to all other groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe role of sex in the echocardiography changes observed with EE was further assessed using ovariectomized (OVX) females and males. As seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, CS together with a reduction in endogenous estrogen impaired cardiac contractility as evidenced by an increase in LVESV, although LVEDV was not affected (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Fractional shortening was reduced in the absence of estrogen, while this was reversed by CS (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). None of the other parameters mentioned above were affected by ovariectomy or male sex.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination resulted in upregulated expression of inflammatory marker mRNAs, but not TNFα gene expression and serum levels.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUnlike the V treated groups that showed comparable levels of IL-1β and IL-6 mRNA expressions in the absence and presence of CS, both IL-1β and Il-6 pro-inflammatory gene expression increased in the left ventricles of EE\u0026thinsp;+\u0026thinsp;CS exposed mice after 8 weeks, compared to EE and V only groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Moreover, IL-6 gene expression was significantly increased in the EE\u0026thinsp;+\u0026thinsp;CS group compared to the V\u0026thinsp;+\u0026thinsp;CS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The EE\u0026thinsp;+\u0026thinsp;CS group also showed a significant increase in IL-13 gene expression compared to the EE or V only groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). IL-4 gene expression showed a significant effect of the EE\u0026thinsp;+\u0026thinsp;CS combination compared to all other conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). On the other hand, EE administration or CS exposure did not affect TNFα gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE) or serum levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF) alone or in combination.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination resulted in a significant upregulations of inflammatory protein expression and cell-death markers.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn agreement with the PCR results, we found a significant increase in the protein expression levels of IL-4, IL-1β, IL-13, IL-10 inflammatory markers in the EE\u0026thinsp;+\u0026thinsp;CS group compared to all other groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-D). Likewise, the same group presented with a significant increase in PARP-1 protein expression, as a marker of increased cellular stress and cell programmed death, in comparison to the other groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination promoted protein expression of cardiac oxidative stress markers.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination tended to increase the expression of Nox-4 gene compared to the EE alone group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), although this did not reach significance. Moreover, no change was observed in SOD-1 expression in either the smoking or the nonsmoking studied groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe EE\u0026thinsp;+\u0026thinsp;CS combination resulted in collagen deposition in the left ventricular cardiac tissue, nut no change in cardiomyocyte cross-sectional area.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eLV cardiac tissue from the EE\u0026thinsp;+\u0026thinsp;CS group showed significantly increased deposition of interstitial collagen compared to the V\u0026thinsp;+\u0026thinsp;CS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). The administration of EE resulted in no change in the cross-sectional area in the presence or the absence of CS (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB) indicating that there was no sign of cardiac hypertrophy at the histological level.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we assessed whether the effects of estrogen on the heart were influenced by cigarette smoking in female mice. We observed that in response to cigarette smoking exposure estrogen administration caused in increase in diastolic LV volume, a decrease in fractional shortening, and an increase in LV mass. In addition, increases were observed in cardiac IL-4, IL-1β, IL-13, IL-10, and PARP-1 expression, in agreement with both an inflammatory response and increased cardiac stress. Greater interstitial collagen was also seen in cigarette smoke-exposed mice treated with estrogen. These observations are consistent with early stages of adverse cardiac remodeling as seen for instance with dilated cardiomyopathy [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. These findings have relevance to understanding the risk of CVD due to smoking in premenopausal females, especially in the context of oral contraceptive usage.\u003c/p\u003e \u003cp\u003eEstrogen receptors are expressed by cardiomyocytes and orchestrate a myriad of genomic and non-genomic effects on the heart [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Cardiovascular function is enhanced by endogenous estrogen; however, research has shown that CS may interfere with the body's ability to utilize endogenous and exogenous estrogen [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Some studies suggest that cigarette smoking is more harmful in young (premenopausal) women than in men, which may be due to CS-induced changes in estrogen activity [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It has been demonstrated that CS has anti-estrogenic effects due to changes in estrogen metabolism [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], by increasing the 2-hydroxylation stage of estradiol metabolism and thereby reducing estrogen availability and activity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Tobacco smoke components lead to the upregulation of a number of genes, including members of the cytochrome P450 (CYP) family, in particular CYP1B1 and CYP1A; the latter and CYP1A2 are the primary enzymes in humans for catalyzing the 2-hydroxylation of estradiol [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Another study found that when taking oral estrogen replacement therapy (ERT), CS reduced estrogen levels by 40\u0026ndash;70%, but when estrogen was applied transdermally at a low dosage to bypass liver metabolism smoking only caused a small change in estrogen levels [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These findings can be attributed to CS increasing the hepatic metabolism of oral estrogens, thus preventing the body from using drug-derived estrogens by converting them to forms that are less active. In addition, the 2-hydroxylation of estradiol results in the production of metabolites that have been associated with endometriosis and pain [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur findings indicate that the functional responses of the hearts of female mice to CS is influenced by levels of estrogen. CS impaired cardiac contractility in female mice as indicated by an increase in LVESV with both the reduction and enhancement of estrogen levels. In intact females, EE treatment with CS impaired myocardial contractility as seen by decreased fractional shortening. On the other hand, in OVX females, CS reversed a decrease in fractional shortening, which may be attributable to enhanced sympathetic activity and as evidenced by increased heart rate with CS: 381\u0026thinsp;\u0026plusmn;\u0026thinsp;12 (6) vs 469\u0026thinsp;\u0026plusmn;\u0026thinsp;11 (6) and 434\u0026thinsp;\u0026plusmn;\u0026thinsp;7 (4) vs 454\u0026thinsp;\u0026plusmn;\u0026thinsp;13 (8), P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 in intact and OVX females, respectively. Of note, cardiac performance was not affected by CS in male mice in the presence study. However, we and others have previously reported that cigarette smoking results in a relatively modest increase in male mice in both LVEDD and LVESD, suggesting that some other variables are involved [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe observed increases in cytokines associated with both a type 1 and 2 inflammatory response. Numerous studies have reported that cigarette smoking is strongly associated with development of a systemic inflammatory response and increased risk of atherosclerotic cardiovascular disease [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. CS has direct adverse effects on the myocardium, resulting in what is referred to as smoking cardiomyopathy [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Our findings indicate that estrogen supplementation may exacerbate smoking cardiomyopathy and the risk of cardiovascular disease. IL-4 and IL-13 are associated with cardiac fibrosis and hypertrophy [\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], while IL-1β mediates inflammation, endothelial dysfunction and myocardial injury [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. IL-10, traditionally considered anti-inflammatory, can paradoxically exacerbate cardiac remodeling under certain conditions [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. PARP-1, involved in DNA repair and inflammation, also contributes to the pathophysiology of CVDs [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The complex roles of these inflammatory markers in cardiac remodeling underscore the intricate interplay between chronic smoking, estrogen supplementation and cardiovascular health. Further mechanistic studies are needed to elucidate the specific pathways by which these cytokines contribute to adverse cardiac remodeling in the context of estrogen supplementation and smoking.\u003c/p\u003e \u003cp\u003eOur study has a few limitations. For one thing, we did not measure 2-hydroxylation of estradiol or blood estrogen levels. Nor did we examine immune cell infiltration into the heart. In addition, we did not look at what effect estrogen treatment may have had on the detrimental effects of cigarette smoking on vascular histology and function. In addition, with regard to OCs, estrogen and progesterone combination are commonly used as progesterone helps to regulate some effects of estrogen. This combination may have different results from what we found and needs future study. We also did not look at the effects of EE on males, which is relevant to defining the cardiovascular risks of CS to transgender females. In conclusion, the findings of our study indicate that in combination with cigarette smoking estrogen had harmful effects on the hearts of fertile female mice that is consistent with adverse cardiac remodeling. Additional studies are warranted to decipher the molecular basis for those actions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo human subjects or tissues were involved.\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Institutional Animal Care and Use Committee (IACUC) of the American University of Beirut (AUB).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available from the corresponding authors on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGWB was supported in part by the National Institute of General Medical Sciences of the National Institutes of Health under Award Number P20GM121334. FAZ was supported by grants from the American University of Beirut Faculty of Medicine [MPP \u0026ndash; 320145; URB \u0026ndash; 103949], \u0026nbsp;The Centre National de la Recherche Scientifique (CNRS) [grants number 103507/103487/103941/103944/104230] and by the Agence nationale des recherches (ANR) et l\u0026rsquo;Agence fran\u0026ccedil;aise de d\u0026eacute;veloppement (AFD) [ANICOV-HF]. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEA and RD carried out the experiments, performed data analysis, and participated in writing and revising the first draft. RZ and AK carried out the blinded analysis of the data and participated in revising the first draft. GWB participated in the design of the study and helped perform the statistical analysis and data interpretation. FAZ conceived the study, acquired funding, and participated in its design and coordination and helped to draft and revise the manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGWB acknowledges the support of the Pharmacology Clinical Research Core of the University of Mississippi Medical Center. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEmna Abidi and Reine Diab share first authorship.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eUSPHSOotS G, Prevention, NCfCD. Smoking HPOo. Preventing tobacco use among youth and young adults: a report of the surgeon general US Government Printing Office. 2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao H, Edirisinghe I, Yang S-R, Rajendrasozhan S, Kode A, Caito S, et al. Genetic ablation of NADPH oxidase enhances susceptibility to cigarette smoke-induced lung inflammation and emphysema in mice. Am J Pathol. 2008;172:5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMessner B, Bernhard D. Smoking and cardiovascular disease: mechanisms of endothelial dysfunction and early atherogenesis. Arteriosclerosis, thrombosis, and vascular biology. 2014;34:3509\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHealth UDo, Services H. The health consequences of smoking\u0026mdash;50 years of progress: a report of the Surgeon General. Atlanta, GA: US Department of Health and Human Services, Centers for Disease \u0026amp;#8230.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTolstrup JS, Hvidtfeldt UA, Flachs EM, Spiegelman D, Heitmann BL, B\u0026auml;lter K, et al. Smoking and risk of coronary heart disease in younger, middle-aged, and older adults. Am J Public Health. 2014;104(1):96\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaplan A, Abidi E, Ghali R, Booz GW, Kobeissy F, Zouein FA. Functional, cellular, and molecular remodeling of the heart under influence of oxidative cigarette tobacco smoke. Oxidative medicine and cellular longevity. 2017;2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallinger SW, Patterson C, Yan C-N, Doan R, Burow DL, Young CG, et al. Hydrogen peroxide\u0026ndash;and peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circul Res. 2000;86:9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChurg A, Dai J, Tai H, Xie C, Wright JL. Tumor necrosis factor-α is central to acute cigarette smoke\u0026ndash;induced inflammation and connective tissue breakdown. Am J Respir Crit Care Med. 2002;166:6849\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVAZIRI N. Causal link between oxidative stress, inflammation, and hypertension. 2008.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmiri P, Mohammadzadeh-Naziri K, Abbasi B, Cheraghi L, Jalali-Farahani S, Momenan AA, et al. Smoking habits and incidence of cardiovascular diseases in men and women: findings of a 12 year follow up among an urban Eastern-Mediterranean population. BMC Public Health. 2019;19:1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRafacho BP, Azevedo PS, Polegato BF, Fernandes AA, Bertoline MA, Fernandes DC, et al. Tobacco smoke induces ventricular remodeling associated with an increase in NADPH oxidase activity. Cell Physiol Biochem. 2011;27:3\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez AD, Collishaw NE, Piha T. A descriptive model of the cigarette epidemic in developed countries. Tob Control. 1994;3:3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaza JA, Reinhart RA, Movahed A. Ischemic heart disease in women and the role of hormone therapy. Int J Cardiol. 2004;96:1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrescott E, Hippe M, Schnohr P, Hein HO, Vestbo J. Smoking and risk of myocardial infarction in women and men: longitudinal population study. BMJ. 1998;316:7137.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHabeichi NJ, Ghali R, Mroueh A, Kaplan A, Tannous C, Jurjus A, et al. Sexual dimorphism in acute myocardial infarction-induced acute kidney injury: cardiorenal deteriorating effects of ovariectomy in premenopausal female mice. Clin Sci (Lond). 2023;137(1):47\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/CS20220513\u003c/span\u003e\u003cspan address=\"10.1042/CS20220513\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang J, Cheng L, Li Z, Li H, Liu Y, Zhan H, et al. Immune cells and related cytokines in dilated cardiomyopathy. Biomed Pharmacother. 2024;171:116159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biopha.2024.116159\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2024.116159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo T, Kim JK. The role of estrogen and estrogen receptors on cardiomyocytes: an overview. Can J Cardiol. 2016;32:8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrundtvig M, Hagen TP, German M, Reikvam \u0026Aring;. Sex-based differences in premature first myocardial infarction caused by smoking: twice as many years lost by women as by men. Eur J Prev Cardiol. 2009;16:2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTank\u0026oacute; LB, Christiansen C. An update on the antiestrogenic effect of smoking: a literature review with implications for researchers and practitioners. Menopause. 2004;11:1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSathish V, Freeman MR, Long E, Thompson MA, Pabelick CM, Prakash Y. Cigarette smoke and estrogen signaling in human airway smooth muscle. Cell Physiol Biochem. 2015;36:3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJJ M. Increased 2-hydroxylation of estradiol as a possible mechanism for the anti-estrogenic effect of cigarette smoking. N Engl J Med. 1986;315:1305\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarom-Haham L, Shulman A. Cigarette smoking and hormones. Curr Opin Obstet Gynecol. 2016;28:4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarom-Haham L, Shulman A. Cigarette smoking and hormones. Curr Opin Obstet Gynecol. 2016;28:4:230\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/GCO.0000000000000283\u003c/span\u003e\u003cspan address=\"10.1097/GCO.0000000000000283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMueck AO, Seeger H. Smoking, estradiol metabolism and hormone replacement therapy. Curr Med Chem Cardiovasc Hematol Agents. 2005;3:1:45\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/1568016052773270\u003c/span\u003e\u003cspan address=\"10.2174/1568016052773270\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmond JP, Caron P, Pusic M, Turcotte V, Simonyan D, Vogler A, et al. Circulating estradiol and its biologically active metabolites in endometriosis and in relation to pain symptoms. Front Endocrinol (Lausanne). 2022;13:1034614. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fendo.2022.1034614\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2022.1034614\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaplan A, Abidi E, Habeichi NJ, Ghali R, Alawasi H, Fakih C, et al. Gender-biased kidney damage in mice following exposure to tobacco cigarette smoke: More protection in premenopausal females. Physiol Rep. 2020;8:2e14339. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.14814/phy2.14339\u003c/span\u003e\u003cspan address=\"10.14814/phy2.14339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Li C, Xu W, Chen J. Trimetazidine protects against smoking-induced left ventricular remodeling via attenuating oxidative stress, apoptosis, and inflammation. PLoS ONE. 2012;7:7e40424. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0040424\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0040424\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshida M, Sakai C, Kobayashi Y, Ishida T. Cigarette Smoking and Atherosclerotic Cardiovascular Disease. J Atheroscler Thromb. 2024;31:3:189\u0026ndash;200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5551/jat.RV22015\u003c/span\u003e\u003cspan address=\"10.5551/jat.RV22015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaplan A, Abidi E, Ghali R, Booz GW, Kobeissy F, Zouein FA. Functional, Cellular, and Molecular Remodeling of the Heart under Influence of Oxidative Cigarette Tobacco Smoke. Oxid Med Cell Longev. 2017;2017:3759186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2017/3759186\u003c/span\u003e\u003cspan address=\"10.1155/2017/3759186\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrangogiannis NG. Cardiac fibrosis. Cardiovasc Res. 2021;117:6:1450\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cvr/cvaa324\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvaa324\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosello-Lleti E, Rivera M, Bertomeu V, Cortes R, Jordan A, Gonzalez-Molina A. [Interleukin-4 and cardiac fibrosis in patients with heart failure]. Rev Esp Cardiol. 2007;60:7777\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/pubmed/17663863\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/pubmed/17663863\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHofmann U, Knorr S, Vogel B, Weirather J, Frey A, Ertl G, et al. Interleukin-13 deficiency aggravates healing and remodeling in male mice after experimental myocardial infarction. Circ Heart Fail. 2014;7:5822\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/CIRCHEARTFAILURE.113.001020\u003c/span\u003e\u003cspan address=\"10.1161/CIRCHEARTFAILURE.113.001020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrangogiannis NG. Interleukin-1 in cardiac injury, repair, and remodeling: pathophysiologic and translational concepts. Discoveries (Craiova). 2015;3:1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15190/d.2015.33\u003c/span\u003e\u003cspan address=\"10.15190/d.2015.33\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrabi SA, Umanah GK, Chang C, Stevens DA, Karuppagounder SS, Gagne JP, et al. Poly(ADP-ribose) polymerase-dependent energy depletion occurs through inhibition of glycolysis. Proc Natl Acad Sci U S A. 2014;111:28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1405158111\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1405158111\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"biology-of-sex-differences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bosd","sideBox":"Learn more about [Biology of Sex Differences](http://bsd.biomedcentral.com)","snPcode":"13293","submissionUrl":"https://submission.nature.com/new-submission/13293/3","title":"Biology of Sex Differences","twitterHandle":"@BiologySexDiff","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cardiac remodeling, tobacco use, oxidative stress, oral contraceptives, inflammation, cytokines","lastPublishedDoi":"10.21203/rs.3.rs-4619755/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4619755/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSmoking, particularly chronic smoking (CS), is a threat to global health, contributing to increased mortality and morbidity associated with cardiovascular disease (CVDs). CS induces oxidative stress and endothelial dysfunction, which has a profound impact on cardiac structure and function. While the protective effects of estrogen, particularly 17β-estradiol (E2), on cardiovascular health are well-documented in premenopausal women, the interaction between estrogen and CS remains poorly understood. The aim of this study is to investigate the impact of chronic cigarette smoking on cardiac health in relation to ethinylestradiol (EE) oral contraceptive (OC) usage in premenopausal females. Female mice were exposed to chronic cigarette smoke and co-administered EE. Cardiac structural and functional parameters were assessed alongside inflammatory markers, oxidative stress indicators, and histological changes. Results revealed that the combination of EE and CS led to adverse cardiac remodeling characterized by increased left ventricular end-diastolic volume, decreased fractional shortening, and elevated left ventricular mass. Comparisons to both ovariectomized females and male mice indicate a singular influence of EE on cardiac contractility with CS. In addition, an inflammatory state was evident, marked by increased expression of IL-4, IL-1β, IL-13, IL-10, and PARP-1, as well as increased interstitial collagen deposition. These findings suggest a progression towards adverse cardiac remodeling resembling dilated cardiomyopathy. Furthermore, our observations highlight the complexity of the inflammatory response triggered by smoking, potentially exacerbated by estrogen supplementation. The main finding of this study is that the combination of CS and EE enhanced adverse cardiac remodeling, which was shown structurally, histologically, and biochemically.\u003c/p\u003e","manuscriptTitle":"Estrogen Administration Enhances the Adverse Effects of Cigarette Smoking on the Heart in Cycling Female Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 15:02:54","doi":"10.21203/rs.3.rs-4619755/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-12T13:39:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-24T08:49:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-24T00:00:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"134799815784613646933534164616615073057","date":"2024-07-09T03:02:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"207639858892209571458126207892424759448","date":"2024-07-03T03:23:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"328655841934902174807738390667930967320","date":"2024-07-02T19:55:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-02T15:06:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-28T14:36:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-28T14:35:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biology of Sex Differences","date":"2024-06-22T02:49:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"biology-of-sex-differences","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bosd","sideBox":"Learn more about [Biology of Sex Differences](http://bsd.biomedcentral.com)","snPcode":"13293","submissionUrl":"https://submission.nature.com/new-submission/13293/3","title":"Biology of Sex Differences","twitterHandle":"@BiologySexDiff","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f48aae6a-97b9-483d-99d8-adfa7436e057","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T16:05:06+00:00","versionOfRecord":{"articleIdentity":"rs-4619755","link":"https://doi.org/10.1186/s13293-024-00667-3","journal":{"identity":"biology-of-sex-differences","isVorOnly":false,"title":"Biology of Sex Differences"},"publishedOn":"2024-12-04 15:57:01","publishedOnDateReadable":"December 4th, 2024"},"versionCreatedAt":"2024-07-22 15:02:54","video":"","vorDoi":"10.1186/s13293-024-00667-3","vorDoiUrl":"https://doi.org/10.1186/s13293-024-00667-3","workflowStages":[]},"version":"v1","identity":"rs-4619755","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4619755","identity":"rs-4619755","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.