Endurance exercise prevents genetic obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene in different tissues in Drosophila

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract The Adipokinetic hormone (Akh) is a key regulator of energy metabolism in Drosophila melanogaster, analogous to glucagon in mammals. Aerobic endurance exercise is considered to be an important means to prevent and reduce obesity and its related complications, but it is still unclear whether it can effectively combat obesity and obesity-related exercise impairment and heart dysfunction induced by Akh genetic knockdown. In this study, Akh- UAS-RNAi /Ppl-Gal4 and Akh- UAS-RNAi /Mef2-Gal4 systems were constructed in F1 generation Drosophila through hybridization, and the Akh gene was knocked down in adipose tissue and muscle tissue. Experimental flies underwent an endurance exercise intervention lasting 3 weeks starting at 1 week of age. The results showed that the knockdown of Akh in both adipose tissue and skeletal muscle tissue significantly increased body weight, triglyceride levels, the expression of Bmm gene and Mdy gene, and MDA level, and it also significantly decreased exercise endurance, cardiac fractional shortening, SOD level, and the expression of Srl gene. Moreover, the microscopic images of oil red O staining and the ultraimages of transmission electron microscopy indicated that Akh knockdown led to the increase of lipid dropper accumulation and the destruction of mitochondrial structure. Importantly, endurance exercise effectively prevented these changes induced by Akh knockdown in adipose tissue and muscle tissue by up regulating Akh gene. Therefore, our present findings demonstrated for the first time that endurance exercise could act as the upstream regulator of Akh gene in adipose tissue and muscle tissue, improve obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene via activating Akh/Bmm/Mdy pathway, Akh/srl pathway, and Akh/SOD/MDA pathway.
Full text 150,435 characters · extracted from preprint-html · click to expand
Endurance exercise prevents genetic obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene in different tissues in Drosophila | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Endurance exercise prevents genetic obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene in different tissues in Drosophila Ying Lin, Xing-feng Ma, Qing yao Sun, Han-yu Li, Zhao-qing Gao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6632687/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The Adipokinetic hormone (Akh) is a key regulator of energy metabolism in Drosophila melanogaster, analogous to glucagon in mammals. Aerobic endurance exercise is considered to be an important means to prevent and reduce obesity and its related complications, but it is still unclear whether it can effectively combat obesity and obesity-related exercise impairment and heart dysfunction induced by Akh genetic knockdown. In this study, Akh- UAS-RNAi /Ppl-Gal4 and Akh- UAS-RNAi /Mef2-Gal4 systems were constructed in F1 generation Drosophila through hybridization, and the Akh gene was knocked down in adipose tissue and muscle tissue. Experimental flies underwent an endurance exercise intervention lasting 3 weeks starting at 1 week of age. The results showed that the knockdown of Akh in both adipose tissue and skeletal muscle tissue significantly increased body weight, triglyceride levels, the expression of Bmm gene and Mdy gene, and MDA level, and it also significantly decreased exercise endurance, cardiac fractional shortening, SOD level, and the expression of Srl gene. Moreover, the microscopic images of oil red O staining and the ultraimages of transmission electron microscopy indicated that Akh knockdown led to the increase of lipid dropper accumulation and the destruction of mitochondrial structure. Importantly, endurance exercise effectively prevented these changes induced by Akh knockdown in adipose tissue and muscle tissue by up regulating Akh gene. Therefore, our present findings demonstrated for the first time that endurance exercise could act as the upstream regulator of Akh gene in adipose tissue and muscle tissue, improve obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene via activating Akh/Bmm/Mdy pathway, Akh/srl pathway, and Akh/SOD/MDA pathway. Biological sciences/Physiology/Metabolism/Metabolic diseases/Obesity Biological sciences/Physiology/Metabolism/Fat metabolism Exercise hereditary obesity skeletal muscle mitochondria Akh gene Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction Over the past few decades, the incidence of obesity has been rising rapidly worldwide, which poses a serious threat to human health, and obesity has also been recognized by the World Health Organization as a global health crisis 1 . Obesity is a chronic metabolic disorder closely related to chronic diseases such as coronary heart disease, hypertension, cancer and type 2 diabetes, and its causes include both genetic factors and environmental factors acquired later in life 2 . Studies have shown that environmental factors acquired later in life, such as sedentary lifestyle and long-term high-fat/high-sugar diet, are prone to induce obesity and can alter obesity-related genetic genes, thereby increasing the risk of obesity in offspring 3 . Furthermore, numerous studies have confirmed that aerobic endurance exercise is an effective and very economical means to combat secondary obesity and its related complications 4 , and the physiological mechanism lies in that aerobic endurance exercise can reduce fat accumulation by increasing energy consumption, and rebalance various metabolic and signaling pathways within the body by enhancing insulin sensitivity 5,6 . However, the molecular mechanism of endurance exercise in combating genetic obesity and its complications remains to be explored. Drosophila is a classic model organism for genetic studies. Constructing target gene mutations through Drosophila genetic hybridization is an important means to study genetic obesity and its complications. Akh is a peptide hormone that plays a key role in regulating energy metabolism and lipid mobilization in insects, including Drosophila 7 . Functionally, Akh is similar to mammalian glucagon and participates in stimulating lipid breakdown and energy release during periods of high metabolic demand 8 . Studies have shown that the Akh signal is crucial for maintaining lipid homeostasis, and dysfunction of the Akh gene can lead to excessive fat accumulation in Drosophila and induce obesity 9,10,11 . However, regarding whether the Akh gene in adipose tissue and skeletal muscle tissue has the function of regulating systemic lipid metabolism, exercise capacity, and cardiac function, as well as whether endurance exercise can effectively counteract genetic obesity induced by Akh gene knockout and concurrent exercise capacity and cardiac function disorders, there are still few research reports. This study first constructed the Akh UAS-RNAi /Ppl-Gal4 and Akh UAS-RNAi /Mef2-Gal4 systems in F1 generation Drosophila through genetic hybridization, respectively knocking out the Akh gene in adipose tissue and skeletal muscle tissue, to verify whether F1 can be induced to develop genetic obesity and concurrent skeletal muscle and cardiac dysfunction, and analyze its molecular mechanism; then, for F1 generation Drosophila with genetic obesity, a 3-week aerobic endurance exercise intervention was carried out, and the expression of the Akh gene in adipose tissue and skeletal muscle tissue, the levels of triglycerides (TG) in the body and skeletal muscle, the expression of lipid metabolism-related genes Bmm and Mdy, the expression of mitochondrial synthesis-related gene PGC-1α(srl) in skeletal muscle tissue, and the oxidative/antioxidant balance state were measured, aiming to reveal the molecular mechanism of aerobic endurance exercise in counteracting genetic obesity and concurrent skeletal muscle and cardiac dysfunction induced by the Akh gene knockout, and providing theoretical support for the prevention and treatment of genetic obesity and its complications through endurance exercise in humans. 2 Materials and methods 2.1 Drosophila strains and hybridization groups The w[1118]P{GD4582}v12345 flies (stock ID: V12345; FlyBase Genotype: w[1118] P{GD4582}v12345) were obtained from the Vienna Drosophila Resource Center. The Ppl-Gal4 flies (stock ID: BCF-673; FlyBase Genotype: w; P{ppl-GAL4.P}2) and Mef2-Gal4 flies (stock ID: 27390; FlyBase Genotype: w; P{Mef2-GAL4.247}) were obtained from the Bloomington Drosophila Stock Center. Male Akh UAS-RNAi flies were crossed to female Ppl-Gal4 and Mef2-Gal4 lines.“w[1118] P{GD4582}v12345>w[1118] P{GD4582}v12345”was represented as“Akh normal expression (Akh UAS-RNAi -C)”and “Akh normal expression exercise (Akh UAS-RNAi -E).“w[1118] P{GD4582}v12345>P{ppl-GAL4.P}2”was represented as“Akh adipose tissue knockdown (Akh×Ppl RNAi -C)”and“Akh adipose tissue knockdown exercise (Akh×Ppl RNAi -E)”.“w[1118] P{GD4582}v 12345>P{Mef2-GAL4.247}”was represented as “Akh skeletal muscle knockdown (Akh×Mef2 RNAi- C)” and “Akh skeletal muscle knockdown exercise (Akh×Mef2 RNAi -E)”. All flies were maintained in a controlled environment at 25°C, 50% constant humidity, and a 12-h light/dark cycle. 2.2 Exercise training The upward climbing endurance training was conducted on an exercise platform that leveraged the anti-gravity climbing behavior of Drosophila. The setup involved fixing the test tube vertically on a clamp, perpendicular to the ground. As the fruit flies climbed from the bottom to the top of the tube, the tube would automatically rotate 180°(at a speed of 60 rad/s with uniform motion), returning the flies to the bottom to climb again. This cycle was continuously repeated. The climbing load for the fruit flies was their own body weight, with 20 flies per tube. An 8 cm space was left between the medium at the bottom of the tube and the lower end of the cotton plug to provide an activity area for the flies. After being returned to the bottom of the tube, the flies had 10 seconds to initiate each climbing attempt. The exercise group started training from 1 day of age and continued until the end of week 3. The training protocol involved 15 minutes of exercise followed by 5 minutes of rest, repeated four times daily. (Table 1) 12 Table 1 Training protocols Day Exercise Rest Exercise Rest Exercise Rest Exercise Rest Monday 15min 5min 15min 5min 15min 5min 15min 5min Tuesday 20min 5min 15min 5min 15min 5min 15min 5min Wednesday Rest Thursday 15min 5min 15min 5min 15min 5min 15min 5min Friday 20min 5min 20min 5min 15min 5min 15min 5min Saturday Rest Sunday Rest 2.3 Preparation of Drosophila culture medium The preparation of the Drosophila culture medium was adapted from the standard diet used in previous studies. To configure 2 L of Drosophila culture medium, add 20 g of soybean flour, 84 g of cornmeal, 26 g of yeast powder, and 16 g of agar strips to a pot. Pour in 2 L of distilled water and mix thoroughly. Continuously stir the mixture while heating until the agar strips are completely dissolved and the solution reaches boiling. Once boiling is achieved, remove from heat and add 62 g of maltose and 62 g of sucrose while the mixture is cooling. After the sucrose and maltose are fully dissolved, incorporate 4000 µl of the preservative propionic acid and 2 g of sodium benzoate. Immediately dispense the medium into clean culture vials, filling each to a thickness of approximately 0.5 cm after thorough mixing 12 . 2.4 ELISA assay The levels and activities of triglyceride (TG), superoxide dismutase (SOD) in Drosophila skeletal muscle were measured using insect-specific ELISA kits for TG, SOD. The specific steps for the ELISA assay are as follows: (1) Standard addition: Prepare standard wells according to the kit instructions. (2) Sample addition: Set up blank control wells and sample wells to be tested. Add 40 µl of diluent to the sample wells, followed by 10 µl of the test sample. (3) Enzyme addition: Add 100 µl of enzyme-conjugated reagent to each well, excluding the blank wells. (4) Incubation: Cover the plate with a sealing film and incubate at 37°C for 60 minutes. (5) Washing buffer preparation: Dilute the 20x concentrated washing buffer with distilled water at a 1:20 ratio for use. (6) Washing: Remove the sealing film, discard the liquid in the wells, thoroughly wash the plate, and allow it to dry. (7) Color development: Add 50 µl of color-developing agent A to each well, followed by 50 µl of color-developing agent B. Gently mix and incubate at 37°C in the dark for 15 minutes. (8) Reaction termination: Add 50 µl of stop solution to each well to halt the reaction (the color will immediately change from blue to yellow). (9) Measurement: Determine the absorbance (OD value) of each well using a microplate reader at the appropriate wavelength. 2.5 Real-time quantitative PCR At the end of the third week, 50 samples of Drosophila skeletal muscle (thorax) and adipose tissue (abdomen) were collected from each group and immersed in 1000 µl of Trizol reagent for the detection of relevant pathway gene expression levels. (1) Total RNA Extraction: A homogenizer tube was pre-chilled on ice, and 1 ml of RNA extraction solution was added. Approximately 100 mg of tissue was placed into the tube and thoroughly homogenized until no visible tissue chunks remained. The mixture was then centrifuged at 12,000 rpm at 4°C for 10 minutes. The white precipitate at the bottom of the tube represented the RNA. The supernatant was discarded, and 1.5 ml of 75% ethanol was added to wash and precipitate the RNA. After centrifugation at 12,000 rpm at 4°C for 5 minutes, the liquid was removed, and the tube was left on a clean bench for 3 minutes. The RNA was dissolved in 15 µl of Nuclease-Free Water and incubated at 55°C for 5 minutes. RNA concentration and purity were measured using a Nanodrop 2000 spectrophotometer. After blank calibration, 2.5 µl of RNA solution was placed on the detection platform, and the sample arm was lowered. The software was used to measure absorbance. RNA samples with excessive concentration were diluted to achieve a final concentration of 100–500 ng/µl. (2) Reverse Transcription: The reverse transcription reaction mixture was prepared, gently mixed, and briefly centrifuged. The reverse transcription program was set according to the manufacturer's instructions. (3) Quantitative PCR: A 0.2 ml PCR tube was used to prepare the reaction mixture. Each cDNA sample was prepared in triplicate for PCR amplification.Results Analysis: Quantification was performed using the CT method. The primer sequences for Rp-49 were as follows: F: 5’- CTAAGCTGTCGCACAAATGG-3’, R: 5’-AACTTCTTGAATCCGGTGGG-3’. Primer sequences for Akh were as follows: F: 5’ -GGTCCTCAGCGAGATGCAATAA-3’, R: 5’- TAAGGTTCGATTGCAGAATTGTG T C-3’. Primer sequences for Bmm were as follows: 5’-CAGTCCCTCCTTCAACATCCAG-3’, R: 5’-GACCTC TTCCCGT GACTCAAACT-3’. Primer sequences for Srl were as follows: F: 5’-ACCTGGCGATTCTGATTATGACT-3’, R: 5’-C CTTTAC ATTGTCCACATAGCGT-3’. 2.6 Transmission electron microscopy of the skeletal muscle For electron microscopic examination, muscles were carefully dissected in an ice-cold fixative solution composed of 2.5% glutaraldehyde in 0.1 mol/L PIPES buffer (pH 7.4). Following a fixation period of 10 hours at 4 °C, the samples were rinsed with 0.1 mol/L PIPES buffer. Subsequently, post-fixation was conducted using 1% OsO4 for 30 minutes, and the samples were stained with 2% uranyl acetate for 1 hour. Dehydration was achieved through a graded ethanol series (50%, 70%, and 100%), and the samples were embedded in epoxy resin. Ultrathin sections were prepared and examined using an HT-7700 transmission electron microscope, with images captured for subsequent analysis 12 . 2.7 Oil red staining analysis of skeletal muscle Skeletal muscle samples were harvested and fixed in tissue fixative for 15 minutes, washed with water, and air-dried. An oil red O working solution was prepared by combining 6 parts of saturated oil red O dye solution with 4 parts of distilled water. This mixture was heated in a water bath at 60–70 °C for 30 minutes, allowed to cool naturally, and then filtered through qualitative filter paper. The sections were stained in the oil red O working solution for 8–10 minutes (covered to prevent light exposure). After removal, the sections were briefly air-dried for 3 seconds and then immersed sequentially in two containers of 60% isopropyl alcohol for differentiation (3 seconds and 5 seconds, respectively). The sections were rinsed in two containers of distilled water for 10 seconds each. Subsequently, the sections were air-dried for 3 seconds and stained with hematoxylin for 3–5 minutes. They were then rinsed in three containers of distilled water for 5 seconds, 10 seconds, and 30 seconds, respectively. Differentiation was performed using a differentiation solution for 2–8 seconds, followed by rinsing in two containers of distilled water for 10 seconds each. The sections were briefly washed in a bluing solution for 1 second. Finally, the sections were gently immersed in two containers of tap water for 5 seconds and 10 seconds, respectively, and the staining results were examined under a microscope. The sections were mounted with glycerol gelatin, and images were captured and analyzed using a microscope. Microscopy, image acquisition, and analysis were conducted using an upright light microscope. A 40× oil immersion objective with a numerical aperture (NA) of 1.3 was selected for high-resolution imaging. A high-resolution digital camera was used to capture clear images, allowing precise measurement and documentation of details at a scale of 5 μm. A 10× low magnification objective was used to quickly locate the target area during initial observation and to understand the overall distribution of the sample 12 . 2.8 Athletic ability testing One hundred fruit flies were randomly chosen from each group and divided into five tubes, with 20 flies per tube. Each tube was placed under a high-definition video camera for recording. Once the camera was activated, the fruit flies were gently shaken to the bottom of the tube every 15 seconds. After three consecutive shakes, the flies in the current tube were replaced with those from the next tube. The best performance out of three climbing attempts for each tube of fruit flies was selected for data analysis. Screenshots capturing the climbing height of the fruit flies 3 seconds after they were shaken from the bottom were taken using AVS Video Editor Software. These images clearly displayed the climbing height of the flies. The 3-second climbing heights were then processed and analyzed using HEYEAR software and Prism software. 2.9 Statistical methods To compare the Gαq gene expression among the normal Gαq expression group, the adipose tissue Gαq knockdown group, and the skeletal muscle tissue Gαq knockdown group, one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test was employed to assess differences between groups. For comparisons between the control and exercise groups, independent samples t-tests were conducted to determine between-group differences. Experimental data were presented as mean ± standard deviation (SD), with the significance level set at α = 0.05 (or 0.01). 3 Results 3.1 Adipose tissue Akh knockdown induced lipid accumulation, exercise endurance limitation, and cardiac dysfunction. It has been reports that the manipulation of the Akh gene expression influences multiple aspects of fly physiology 13 . Akh signaling in the fat body is crucial for calcium oscillations and triglyceride breakdown, and its impairment results in abnormal lipid storage and metabolic dysfunction 14 . However, it is still unclear whether Akh hereditary knockdown can induce hereditary obesity and associated skeletal and myocardial dysfunction. In this study, we first constructed the Akh-UAS-RNAi>Ppl-gal4 system in Drosophila F1 generation by genetic hybridization. The results showed that in fly adipose tissue(AT), the relative expression of Akh gene of Akh AT-RNAi -C group was significantly lower than that of Akh- UAS-RNAi -C group flies (P < 0.01) (Fig.1-A), suggesting that the Akh-UAS-RNAi/Ppl-gal4 system was successfully constructed in Drosophila F1 generation. Besides, the body weight, systemic TG levels, and muscular TG levels, and the expression of Bmm gene and Mdy gene of Akh AT-RNAi -C group flies were significantly higher than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.1- B, C, D, E, and F), and images of flies show that Akh AT-RNAi -C group fly was significantly fatter than Akh- UAS-RNAi -C group fly (Fig.1-G), suggesting that genetic Akh knockdown in AT disrupted the balance of lipid metabolism and led to hereditary obesity in flies. Moreover, at the end of 1, 2 and 3 weeks of age, the climbing endurance of Akh AT-RNAi -C group flies was significantly shorter than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.1-H, I, and J). What’s more, the heart rate of Akh AT-RNAi -C group flies was significantly faster than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.1-K), but the fraction shortening of Akh AT-RNAi -C group flies was significantly lower than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.1-L). These results indicated that genetic Akh knockdown in AT also impaired the flies' ability to exercise and their heart function. Finally, the SOD level of Akh AT-RNAi -C group flies was significantly lower than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.1-M), and the MDA of Akh AT-RNAi -C group flies was significantly higher than that of the Akh UAS-RNAi -C group flies (P < 0.05) (Fig.1-N), suggesting that genetic Akh knockdown in AT may exacerbate oxidative stress damage in the body. Taken together, these results suggested that genetic knockdown of Akh gene in adipose tissue could lead to hereditary obesity, accompanied by reduced exercise capacity and cardiac function, and the physiological mechanism may be related to the damage of cells in the body under high oxidative stress. 3.2 Muscle Akh knockdown also induced lipid accumulation, exercise endurance limitation, and cardiac dysfunction. Although a large number of studies have confirmed that Akh is related to intracellular calcium ion regulation and energy metabolism 15,16 , our results also verified that Akh gene in adipose tissue is involved in lipid metabolism, exercise ability, heart function and oxidative stress, but the function of Akh gene in muscle tissue is still unclear. In this study, we also constructed the Akh-UAS-RNAi>Mef2-gal4 system in Drosophila F1 generation by genetic hybridization. The results showed that compared with Akh- UAS-RNAi -C group flies, the relative expression in MT of Akh gene in Akh AT-RNAi -C group flies was significantly decreased (P < 0.01) (Fig.2-A), suggesting that the Akh-UAS-RNAi/ Mef2-gal4 system was successfully constructed in Drosophila F1 generation. Besides, the body weight, systemic TG levels, and muscular TG levels, and the expression of Bmm gene of Akh MT-RNAi -C group flies were also significantly higher than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.2-B) (Fig.3- B, C, D, and E), and images of flies show that Akh MT-RNAi -C group fly was significantly fatter than Akh- UAS-RNAi -C group fly (Fig.2-F), and skeletal muscle oil red O staining microscopic images showed that Akh knockdown in muscle tissue resulted in a significant increase in lipid droplets in skeletal muscle cells (Fig.2-G). These results suggested that genetic Akh knockdown in MT also disrupted the balance of lipid metabolism and led to hereditary obesity in flies. In addition, at the end of 1, 2 and 3 weeks of age, the climbing endurance of Akh MT-RNAi -C group flies was significantly shorter than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.3-A, B, and C). What’s more, the heart rate of Akh MT-RNAi -C group flies was significantly faster than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.2-D), but the fraction shortening of Akh MT-RNAi -C group flies was significantly lower than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.3-E). These results indicated that genetic Akh knockdown in MT also impaired the flies' ability to exercise and their heart function. What’s more, the SOD level of Akh MT-RNAi -C group flies was significantly lower than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.2-F), and the MDA of Akh MT-RNAi -C group flies was significantly higher than that of the Akh UAS-RNAi -C group flies (P < 0.05) (Fig.2-G), suggesting that genetic Akh knockdown in MT may exacerbate oxidative stress damage in the body. Finally, the expression of srl(PCG-1α) gene of Akh MT-RNAi -C group flies were also significantly higher than that of the Akh UAS-RNAi -C group flies (P < 0.01) (Fig.3-H), and projective electron microscopy images of skeletal muscle showed that knockdown of Akh gene resulted in decreased mitochondrial number and increased mitochondrial damage(Fig.3-I), suggesting that genetic Akh knockdown in AT may impair mitochondrial synthesis and function. Taken together, these results suggested that genetic knockdown of Akh gene in muscle tissue could also lead to hereditary obesity, accompanied by reduced exercise capacity and cardiac function, and the physiological mechanism may be related to the damage of cells in the body under high oxidative stress and the impairment of mitochondrial synthesis and function in muscle. 3.3 Endurance exercise prevented AT-Akh knockdown-induced hereditary obesity. A large number of studies have confirmed that aerobic endurance exercise can prevent and reduce obesity and obesity-related complications 17181920 , but it is still unclear whether exercise can effectively combat Akh knockdown induced hereditary obesity and its complications. In this study, we performed aerobic endurance exercise intervention on AT-Akh gene knockdown Drosophila for 3 weeks. The results showed that in both Akh- UAS-RNAi -C group flies and Akh AT-RNAi -C group flies, aerobic endurance exercise for 3 weeks significantly upregulates the expression of Akh gene in adipose tissue(P < 0.01) (Fig.4-A), suggesting that exercise may be the upstream regulator of Akh gene in adipose tissue. Besides, the body weight of Akh AT-RNAi -C group flies significantly decreased after exercise training(P < 0.01) (Fig.4-B), and exercise training significantly reduced the systemic TG levels, muscular TG levels, and the expression of Bmm gene and Mdy gene in Akh AT-RNAi -C group flies and Akh UAS-RNAi -C group flies(P < 0.05 or P < 0.01) (Fig.4-C, D, E, and F), and images of flies show that Akh AT-RNAi -C group fly was significantly fatter than Akh AT-RNAi -E group fly (Fig.4-G). These results suggested that aerobic endurance exercise for 3 weeks prevented lipid metabolism disorder and hereditary obesity induced by Akh gene knockdown in adipose tissue. In addition, at the end of 3 weeks of age, the climbing endurance of Akh UAS-RNAi -C group flies and Akh AT-RNAi -C group flies was significantly increased after exercise training(P 0.05) (Fig.4-H, I, and J). In both Akh UAS-RNAi -C group flies and Akh AT-RNAi -C group flies, exercise training significantly decreased the heart rate(P < 0.05) (Fig.4-K), and it significantly increased the fraction shortening of heart(P < 0.01) (Fig.4-L). These results suggested that aerobic endurance exercise genetic prevented AT-Akh knockdown induced the impairments of exercise ability and heart function in flies. What’s more, in both Akh UAS-RNAi -C group flies and Akh AT-RNAi -C group flies, exercise training significantly increased the SOD level(P < 0.05 or P < 0.01) (Fig.4-M), and it significantly decreased the MDA level(P < 0.01) (Fig.4-N), suggesting that aerobic endurance exercise genetic prevented AT-Akh knockdown induced oxidative stress damage in flies. Taken together, these results suggested that as an upstream regulator of Akh gene in adipose tissue, 3-week aerobic endurance exercise effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in adipose tissue, the mechanism of which was related to the reduction of oxidative stress by aerobic endurance exercise. 3.4 Endurance exercise also prevented MT-Akh knockdown-induced hereditary obesity. In this study, we also performed aerobic endurance exercise intervention on MT-Akh gene knockdown Drosophila for 3 weeks. The results showed that in Akh MT-RNAi -C group flies, aerobic endurance exercise for 3 weeks significantly upregulates the expression of Akh gene in muscle tissue(P < 0.01) (Fig.5-A), suggesting that exercise may be an upstream regulator of Akh gene in muscle tissue. Besides, the body weight of Akh MT-RNAi -C group flies significantly decreased after exercise training(P < 0.01), and exercise training significantly reduced the systemic TG levels, muscular TG levels, and the expression of Bmm gene in Akh MT-RNAi -C group flies(P < 0.01) (Fig.5-B, C, D, and E), and images of flies show that Akh AT-RNAi -C group fly was significantly fatter than Akh AT-RNAi -E group fly (Fig.5-F). Skeletal muscle oil red O staining microscopic images showed that exercise prevented the accumulation of lipid droplets induced by MT-Akh knockdown in skeletal muscle cells(Fig.5-G). These results suggested that aerobic endurance exercise for 3 weeks prevented lipid metabolism disorder and hereditary obesity induced by Akh gene knockdown in muscle tissue. In addition, at the end of 3 weeks of age, the climbing endurance of Akh UAS-RNAi -C group flies and Akh MT-RNAi -C group flies was significantly increased after exercise training(P < 0.01) (Fig.6-A, B, and C). In both Akh UAS-RNAi -C group flies and Akh MT-RNAi -C group flies, exercise training significantly decreased the heart rate(P < 0.05) (Fig.6-D), and it significantly increased the fraction shortening of heart(P < 0.01) (Fig.6-E). These results suggested that aerobic endurance exercise genetic prevented MT-Akh knockdown induced the impairments of exercise ability and heart function in flies. What’s more, in both Akh UAS-RNAi -C group flies and Akh AT-RNAi -C group flies, exercise training significantly increased the SOD level(P < 0.05 or P < 0.01) (Fig.6-F), and it significantly decreased the MDA level(P < 0.01) (Fig.6-G), suggesting that aerobic endurance exercise genetic prevented MT-Akh knockdown induced oxidative stress damage in flies. Finally, In both Akh UAS-RNAi -C group flies and Akh MT-RNAi -C group flies, exercise training significantly increased the expression of muscle srl(PCG-1α) gene(P < 0.05 or P < 0.01) (Fig.6-H), and projective electron microscopy images of skeletal muscle showed that exercise training prevented the decrease in mitochondrial number and mitochondrial damages induced by MT-Akh knockdown(Fig.6-I). Taken together, these results suggested that as an upstream regulator of Akh gene in muscle tissue, 3-week aerobic endurance exercise effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockdown in muscle tissue, the mechanism of which was related to the reduction of oxidative stress and enhancement of muscle mitochondrial function by aerobic endurance exercise. 4 Discussion 4.1 Effects of Akh knockdown in adipose tissue and muscle tissue on Drosophila. The adipokine hormone (Akh) plays a crucial role in regulating energy metabolism and stress responses. Studies have shown that knockdown of Akh can impair the lipid mobilization process, leading to increased fat storage and thereby disrupting energy balance and glucose homeostasis 21, 22, 23, 24 . In Drosophila, Akh is a homolog of glucagon and is essential for lipid mobilization from adipose tissue, especially during starvation 25 . When Akh is knocked out, the lipid breakdown function is impaired, resulting in increased accumulation of triglycerides due to the disruption of the Ca²⁺ signaling pathway and intercellular calcium waves 26 , and the Akh signal is crucial for maintaining energy homeostasis through Ca²⁺ influx and downstream effectors such as Gαq and PLC21C 27, 28 . Conversely, dietary amino acids can promote the release of Akh by adipokine cells, thereby stimulating lipolysis and accelerating lipid breakdown metabolism 29, 30. Therefore, these studies emphasize the importance of Akh in regulating lipid homeostasis, but it is currently unclear whether Akh in adipose tissue and muscle tissue has the function of regulating systemic lipid metabolism, regulating exercise capacity and cardiac function. The results of this study indicate that genetic knockdown of the Akh gene in adipose tissue can induce lipid accumulation and cause hereditary obesity in Drosophila, accompanied by obesity-related impairments in locomotor ability and cardiac function. The molecular mechanism is related to the activation of the Bmm/Mdy pathway by Akh and the inhibition of the SOD/MDA pathway by Akh. Moreover, genetic knockdown of the Akh gene in muscle tissue can also cause obesity in Drosophila, accompanied by weakened locomotor ability and cardiac function. The physiological mechanism is related to abnormal regulation of Akh/Bmm, Akh/PGC-1α, and Akh/SOD in muscle cells, which leads to abnormal lipid breakdown, mitochondrial function, and oxidative stress in skeletal muscle tissue. Lipid metabolism disorder and obesity in Drosophila are closely related to the abnormal changes of related molecular pathways. For instance, Brummer (Bmm) encodes a triglyceride lipase orthologous to mammalian Adipose Triglyceride Lipase, and bmm knockdown reveals a marked reduction in medium chain fatty acids, long chain saturated fatty acids and long chain monounsaturated and polyunsaturated fatty acids, and an increase in diacylglycerol levels 31, 32 . Global overexpression of Bmm strongly promoted numerous markers of physiological fitness, including increased mitochondrial biogenesis and oxidative metabolism, and it also upregulated the heat shock protein 70 (Hsp70) family of proteins, which equipped the flies with higher resistance to heat, cold, and ER stress via improved proteostasis 33 . High-fat-diet feeding lowers cardiac PGC-1α/srl expression by elevating TOR signaling and inhibiting expression of the Drosophila Bmm, both of which function as upstream modulators of PGC-1α/srl 34 . Additionally, Mdy (Midway), on the other hand, is involved in lipid droplet dynamics and regulation 35 . The midway gene encodes a protein similar to mammalian acyl coenzyme A: diacylglycerol acyltransferase, which converts diacylglycerol into triacylglycerol (TG) 36 . Genetic or physiological activation of fat body Toll signaling leads to a tissue-autonomous reduction in triglyceride storage, and this is paralleled by decreased transcript levels of the DGAT homolog Mdy, which carries out the final step of triglyceride synthesis 37 . These evidences indicate that Bmm gene and Mdy gene are key factors regulating lipid metabolism, and Akh gene in skeletal muscle and adipose tissue is the upstream regulator of both, and the genetic obesity caused by Akh gene knockdown may be related to the abnormal expression of Bmm gene and Mdy gene in skeletal muscle and adipose tissue. Obesity-related skeletal muscle dysfunction and cardiac dysfunction are associated with mitochondrial dysfunction and increased oxidative stress in cells. For example, obesity may trigger different myocellular mechanisms proposed to contribute to insulin resistance and aggravate skeletal muscle atrophy and dysfunction, and skeletal muscle atrophy and dysfunction can also impair whole-body metabolism and reduce physical exercise capacity, thus instigating a vicious cycle that further deteriorates the underlying conditions. These mechanisms mainly include the inactivation of insulin signaling components through sustained activation of stress-related pathways, mitochondrial dysfunction, a shift to glycolytic skeletal muscle fibers, and hyperglycemia 38 . PGC-1α is a transcriptional co-activator and master regulator of mitochondrial biogenesis, obesity can reduce the expression of PGC-1α in skeletal muscle and heart muscle cells, leading to their dysfunction 39, 40 . Moreover, the oxidation/antioxidant balance in the body is an important condition for maintaining cell function. Both the decrease of oxidase activity (such as SOD) and the increase of oxygen free radicals in vivo can lead to the increase of oxidative stress damage 41, 42 . Obesity is easy to cause insufficient lipid oxidation in the body, which combines with oxygen free radicals to form malondialdehyde, and malondialdehyde has strong cytotoxicity and can damage cell structures such as cell membranes, mitochondria, and even DNA 43, 44 . Therefore, these evidences suggest that Akh knockdown in adipose tissue can induce hereditary obesity, and the physiological mechanism is that the upstream of Akh in adipose tissue regulates the expression of fat metabolism-related genes Bmm and Mdy, leading to lipid accumulation. At the same time, obesity also reduces exercise capacity and heart function by enhancing oxidative stress in the body. In addition, muscle Akh gene also acts as an upstream regulator of PGC-1 in muscle cells, controlling the synthesis and function of mitochondria. Muscle Akh gene knockdown leads to mitochondrial dysfunction of skeletal muscle cells and cardiomyocytes, as well as intracellular lipid metabolism disorder and increased oxidative stress, thus exhibiting obesity, impaired exercise ability and cardiac dysfunction. 4.2 Effects of exercise on Drosophila with Akh knockdown in adipose tissue and muscular tissue A large number of studies have shown that endurance exercise is a classic means to prevent and reduce obesity and obesity-related complications. For instance, regular exercise may play a role in remodelling abdominal subcutaneous adipose tissue structure and proteomic profile in ways that may contribute to preserved cardiometabolic health 45 . In subjects with obesity, the implementation of long-term exercise intervention increases lean tissue mass and lowers adipose tissue mass 46 . In the obese, some endocrinological disturbances during acute endurance and resistance exercise have been identified: a blunted blood growth hormone, atrial natriuretic peptide and epinephrine release, and greater cortisol and insulin release. These hormonal disturbances might contribute to a suppressed lipolytic response, and/or suppressed skeletal muscle protein synthesis, as a result of acute endurance or resistance exercise, respectively 47, 48 . Moreover, obesity-linked insulin resistance is mainly due to fatty acid overload in non-adipose tissues, particularly skeletal muscle and liver, where it results in high production of reactive oxygen species and mitochondrial dysfunction. Accumulating evidence indicates that resistance and endurance training alone and in combination can counteract the harmful effects of obesity increasing insulin sensitivity, thus preventing diabetes 49 . 3-month endurance and endurance strength training have positive effects on anthropometric parameters, body composition, physical capacity, and circulatory system function in women with abdominal obesity 50 . Although these studies have shown that endurance exercise is beneficial for obesity and obesity-related exercise impairment and cardiac dysfunction, few studies have reported whether endurance exercise is effective against Akh knockdown in dipose tissue or muscular tissue induced hereditary obesity and its concomitant exercise function and cardiac dysfunction. In this study, our results suggest that as an upstream regulator of Akh gene in adipose tissue, 3-week aerobic endurance exercise can effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in adipose tissue and skeletal muscle, the mechanism of which is related to positively regulation of Akh/Bmm/Mdy pathway and the reduction of oxidative stress by aerobic endurance exercise. Moreover, as an upstream regulator of Akh gene in muscle tissue, 3-week aerobic endurance exercise also can effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in muscle tissue, the mechanism of which is related to the reduction of oxidative stress and enhancement of muscle mitochondrial function by aerobic endurance exercise. More and more studies have confirmed that the physiological mechanism of endurance exercise to reduce obesity and its related complications is related to the improvement of the signaling pathway related to lipid metabolism. For instance, Exercise-training enhances intracellular lipid metabolism and phenotypic changes in skeletal muscle through epigenomic modifications on Serine Hydrolase Like 2, and Hypomethylation of the Serine Hydrolase Like 2 promoter influences Nr4a transcription factor binding, promoter activity, and gene expression, linking exercise-induced epigenomic regulation of Serhl2 to lipid oxidation and triacylglycerol synthesis 51 . Besides, Activation of calmodulin dependent protein kinase (CaMK)II by exercise is beneficial in controlling membrane lipids associated with type 2 diabetes and obesity since CaMKII activation by exercise increased the levels of arachidonic acid and 11,14-eicosadienoic acid while a decrease in the level of linolenic acid 52 . Moreover, exercise training upregulated the decrease in cardiac mtp expression induced by a high-fat diet. Increased Had1 and Acox3 expression were observed, consistent with changes in cardiac mtp expression 53 . Exercise-training during a high-fat diet feeding can down-regulate the expression of apoLpp, reduce the whole-body TG levels, improve cardiac recovery, and improve exercise capacity 54 . Cardiac Nmnat/NAD+/SIR2 pathway activation is an important underlying molecular mechanism by which endurance exercise and cardiac Nmnat overexpression give protection against lipotoxic cardiomyopathy in Drosophila 55 . Therefore, endurance exercise can positively regulate the expression of adipose tissue, skeletal muscle and myocardial related genes in obese individuals, and improve obesity and obesity-related complications. Additionally, more and more studies have reported that endurance exercise can improve oxidative stress and mitochondrial function in obese individuals. For instance, the increased oxidative stress is usually observed in obese population, but the control of body weight by calorie restriction and/or exercise training can ameliorate oxidative stress, 4-week exercise intervention coupled with dietary restriction is benefit for the loss of body weight and the mitigation of oxidative stress by enhancing the activity of SOD and GPx in obese 56 . Resistance exercise can positively regulate cardiac oxidative stress parameters and TNF-α content in diet-related obese mice 57 . Moderate intensity exercise is an effective approach to promote changes in body composition, physical fitness and to reduce oxidative damage in older women with and without sarcopenic obesity. Moreover, exercise may stimulate mitochondrial biogenesis and promote mitochondrial fusion/fission in the skeletal muscle of obese individual 58 . Obesity is associated with impairment of mitochondrial function (e.g., decrease in O2 respiration and increase in oxidative stress) in skeletal muscle 59 . Exercise training attenuates mitochondrial dysfunction, allows mitochondria to maintain the balance between mitochondrial dynamics and mitophagy, and reduces apoptotic signaling in obese skeletal muscle 60 . Exercise training enhances muscle mitochondrial metabolism in diet-resistant obesity 61 . Exercise training alleviates obesity-induced skeletal muscle remodeling and skeletal muscle mitochondria-mediated apoptosis 62 . 5 Conclusion Our present findings demonstrated for the first time that endurance exercise could act as the upstream regulator of Akh gene in adipose tissue and muscle tissue, improve obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene via activating Akh/Bmm/Mdy pathway, Akh/srl pathway, and Akh/SOD/MDA pathway.( Fig.7) Declarations A cknowledgements We thank the Core Facility of Drosophila Resource and Technology, Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences,for providing fly stocks and reagengts. Author Contributions Research idea and study design: Y.L., X.F.M.; data acquisition: D.t.W. Y.L., X.F.M.; data analysis/interpretation: X.F.M., J.Y.S.; statistical analysis: H.Y.L.; supervision: Z.Q.G. Each author contributed during manuscript drafting or revision and approved the final version of the manuscript. Additional Information Competing Interests: Authors have no conflicts of interest. Funding: This work is supported by the CollegeYouth Innovation Team Program of Shandong Province (No. 2023RW057) and the National Natural Science Foundation of China (No. 32000832); Ludong University graduate innovation project (No. 810201 and No.IPGS 2024-032 ) Associated Data Data Availability Statement All the generated data and the analysis developed in this study are included in this article. References Plaza-Diaz J, Izquierdo D, Torres-Martos Á et al. Impact of Physical Activity and Exercise on the Epigenome in Skeletal Muscle and Effects on Systemic Metabolism. Biomedicines. 2022 Jan 7;10(1):126. Powell-Wiley TM, Poirier P, et al. Obesity and Cardiovascular Disease: A Scientific Statement From the American Heart Association. Circulation. 2021 May 25;143(21):e984-e1010. Nicze M, Dec A, Borówka M et al. Molecular Mechanisms behind Obesity and Their Potential Exploitation in Current and Future Therapy. Int J Mol Sci. 2024 Jul 27;25(15):8202. Kovac L, Goj T, Ouni M et al. Skeletal Muscle Gene Expression Signatures of Obese High and Low Responders to Endurance Exercise Training. J Clin Endocrinol Metab. 2024 Apr 19;109(5):1318-1327. Andriessen C, Fealy CE, Veelen A, et al. Three weeks of time-restricted eating improves glucose homeostasis in adults with type 2 diabetes but does not improve insulin sensitivity: a randomised crossover trial. Diabetologia. 2022 Oct;65(10):1710-1720. Martino MR, Habibi M, Ferguson D et al.. Disruption of hepatic mitochondrial pyruvate and amino acid metabolism impairs gluconeogenesis and endurance exercise capacity in mice. Am J Physiol Endocrinol Metab. 2024 Apr 1;326(4):E515-E527. Hughson BN. The Glucagon-Like Adipokinetic Hormone in Drosophila melanogaster - Biosynthesis and Secretion. Front Physiol. 2021 Dec 23;12:710652. Neumann J, Hofmann B, Dhein S, Gergs U. Glucagon and Its Receptors in the Mammalian Heart. Int J Mol Sci. 2023 Aug 15;24(16):12829. de Brito Sanchez G, Expósito Muñoz A, Chen L, Huang W, Su S, Giurfa M. Adipokinetic hormone (AKH), energy budget and their effect on feeding and gustatory processes of foraging honey bees. Sci Rep. 2021 Sep 15;11(1):18311. Knuth CM, Auger C, Jeschke MG. Burn-induced hypermetabolism and skeletal muscle dysfunction. Am J Physiol Cell Physiol. 2021 Jul 1;321(1):C58-C71. Meschi E, Duquenoy L, Otto N, Dempsey G, Waddell S. Compensatory enhancement of input maintains aversive dopaminergic reinforcement in hungry Drosophila. Neuron. 2024 Jul 17;112(14):2315-2332.e8. Yin XY, Wen DT, Li HY, Gao ZQ, Gao Y, Hao W. Endurance exercise attenuates Gαq-RNAi induced hereditary obesity and skeletal muscle dysfunction via improving skeletal muscle Srl/MRCC-I pathway in Drosophila. Sci Rep. 2024 Nov 15;14(1):28207. Kawai T, Autieri MV, Scalia R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am J Physiol Cell Physiol. 2021 Mar 1;320(3):C375-C391. Malita A, Kubrak O, Koyama T, Ahrentløv N, Texada MJ, Nagy S, Halberg KV, Rewitz K. A gut-derived hormone suppresses sugar appetite and regulates food choice in Drosophila. Nat Metab. 2022 Nov;4(11):1532-1550. Yi J, Zhou Q, Huang J, Niu S, Ji G, Zheng T. Lipid metabolism disorder promotes the development of intervertebral disc degeneration. Biomed Pharmacother. 2023 Oct;166:115401. Lafuse WP, Wozniak DJ, Rajaram MVS. Role of Cardiac Macrophages on Cardiac Inflammation, Fibrosis and Tissue Repair. Cells. 2020 Dec 31;10(1):51. Hughson BN, Shimell M, O'Connor MB. AKH Signaling in D. melanogaster Alters Larval Development in a Nutrient-Dependent Manner That Influences Adult Metabolism. Front Physiol. 2021 Feb 23;12:619219. Braco JT, Nelson JM, Saunders CJ, Johnson EC. Modulation of Metabolic Hormone Signaling via a Circadian Hormone and Biogenic Amine in Drosophila melanogaster. Int J Mol Sci. 2022 Apr 12;23(8):4266. Xiao Z, Kong B, Fang J, Qin T, Dai C, Shuai W, Huang H. Ferrostatin-1 alleviates lipopolysaccharide-induced cardiac dysfunction. Bioengineered. 2021 Dec;12(2):9367-9376. Li J, Dang P, Li Z, Zhao T, Cheng D, Pan D, Yuan Y, Song W. Peroxisomal ERK mediates Akh/glucagon action and glycemic control. Cell Rep. 2023 Oct 31;42(10):113200. Ahmad M, He L, Perrimon N. Regulation of insulin and adipokinetic hormone/glucagon production in flies. Wiley Interdiscip Rev Dev Biol. 2020 Mar;9(2):e360. Wan GJ, Jiang SL, Zhang M, Zhao JY, Zhang YC, Pan WD, Sword GA, Chen FJ. Geomagnetic field absence reduces adult body weight of a migratory insect by disrupting feeding behavior and appetite regulation. Insect Sci. 2021 Feb;28(1):251-260. Gäde G, Marco HG. The Adipokinetic Peptides of Hemiptera: Structure, Function, and Evolutionary Trends. Front Insect Sci. 2022 Jun 15;2:891615. Ko S, Yeom E, Chun YL, Mun H, Howard-McGuire M, Millison NT, Jung J, Lee KP, Lee C, Lee KS, Delaney JR, Yoon JH. Profiling of RNA-binding Proteins Interacting With Glucagon and Adipokinetic Hormone mRNAs. J Lipid Atheroscler. 2022 Jan;11(1):55-72. Liao S, Amcoff M, Nässel DR. Impact of high-fat diet on lifespan, metabolism, fecundity and behavioral senescence in Drosophila. Insect Biochem Mol Biol. 2021 Jun;133:103495. Beckham JL, van Venrooy AR, Kim S, Li G, Li B, Duret G, Arnold D, Zhao X, Li JT, Santos AL, Chaudhry G, Liu D, Robinson JT, Tour JM. Molecular machines stimulate intercellular calcium waves and cause muscle contraction. Nat Nanotechnol. 2023 Sep;18(9):1051-1059. Cinel SD, Hahn DA, Kawahara AY. Predator-induced stress responses in insects: A review. J Insect Physiol. 2020 Apr;122:104039. Hu Q, Vélez-Avilés AN, Wolfner MF. Drosophila Plc21C is involved in calcium wave propagation during egg activation. MicroPubl Biol. 2020 Apr 1;2020:10.17912/micropub.biology.000235. He H, Boehringer R, Huang AJY, Overton ETN, Polygalov D, Okanoya K, McHugh TJ. CA2 inhibition reduces the precision of hippocampal assembly reactivation. Neuron. 2021 Nov 17;109(22):3674-3687.e7. Ahmad M, Wu S, Luo S, Shi W, Guo X, Cao Y, Perrimon N, He L. Dietary amino acids promote glucagon-like hormone release to generate global calcium waves in adipose tissues in Drosophila. Nat Commun. 2025 Jan 2;16(1):247. Nazario-Yepiz NO, Fernández Sobaberas J, Lyman R, Campbell MR 3rd, Shankar V, Anholt RRH, Mackay TFC. Physiological and metabolomic consequences of reduced expression of the Drosophila brummer triglyceride Lipase. PLoS One. 2021 Sep 21;16(9):e0255198. Chao CF, Pesch YY, Yu H, Wang C, Aristizabal MJ, Huan T, Tanentzapf G, Rideout E. An important role for triglyceride in regulating spermatogenesis. Elife. 2024 May 28;12:RP87523. Shang L, Aughey E, Kim H, Heden TD, Wang L, Najt CP, Esch N, Brunko S, Abrahante JE, Macchietto M, Mashek MT, Fairbanks T, Promislow DEL, Neufeld TP, Mashek DG. Systemic lipolysis promotes physiological fitness in Drosophila melanogaster. Aging (Albany NY). 2022 Aug 30;14(16):6481-6506. Diop SB, Bisharat-Kernizan J, Birse RT, Oldham S, Ocorr K, Bodmer R. PGC-1/Spargel Counteracts High-Fat-Diet-Induced Obesity and Cardiac Lipotoxicity Downstream of TOR and Brummer ATGL Lipase. Cell Rep. 2015 Mar 10;10(9):1572-1584. Ben-Menahem D. GnRH-Related Neurohormones in the Fruit Fly Drosophila melanogaster. Int J Mol Sci. 2021 May 10;22(9):5035. Buszczak M, Lu X, Segraves WA, Chang TY, Cooley L. Mutations in the midway gene disrupt a Drosophila acyl coenzyme A: diacylglycerol acyltransferase. Genetics. 2002 Apr;160(4):1511-8. Martínez BA, Hoyle RG, Yeudall S, Granade ME, Harris TE, Castle JD, Leitinger N, Bland ML. Innate immune signaling in Drosophila shifts anabolic lipid metabolism from triglyceride storage to phospholipid synthesis to support immune function. PLoS Genet. 2020 Nov 23;16(11):e1009192. Castillo ÍMP, Argilés JM, Rueda R, Ramírez M, Pedrosa JML. Skeletal muscle atrophy and dysfunction in obesity and type-2 diabetes mellitus: Myocellular mechanisms involved. Rev Endocr Metab Disord. 2025 Mar 10. Wan Z, Root-McCaig J, Castellani L, Kemp BE, Steinberg GR, Wright DC. Evidence for the role of AMPK in regulating PGC-1 alpha expression and mitochondrial proteins in mouse epididymal adipose tissue. Obesity (Silver Spring). 2014 Mar;22(3):730-8. Jun L, Tao YX, Geetha T, Babu JR. Mitochondrial Adaptation in Skeletal Muscle: Impact of Obesity, Caloric Restriction, and Dietary Compounds. Curr Nutr Rep. 2024 Sep;13(3):500-515. Yin Z, Wan B, Gong G, Yin J. ROS: Executioner of regulating cell death in spinal cord injury. Front Immunol. 2024 Jan 23;15:1330678. Santos-Araujo S, Bomfim L, Araripe LO, Bruno R, Ramos I, Gondim KC. Silencing of ATG6 and ATG8 promotes increased levels of triacylglycerol (TAG) in the fat body during prolonged starvation periods in the Chagas disease vector Rhodnius prolixus. Insect Biochem Mol Biol. 2020 Dec;127:103484. Cota-Magaña AI, Vazquez-Moreno M, Rocha-Aguado A, Ángeles-Mejía S, Valladares-Salgado A, Díaz-Flores M, López-Díazguerrero NE, Cruz M. Obesity Is Associated with Oxidative Stress Markers and Antioxidant Enzyme Activity in Mexican Children. Antioxidants (Basel). 2024 Apr 12;13(4):457. Huang Y, Chen H, Liu Q, Hu J, Hu D, Huang Z, Xu Z, Wan R. Obesity difference on association blood malondialdehyde level and diastolic hypertension in the elderly population: a cross-sectional analysis. Eur J Med Res. 2023 Jan 24;28(1):44. Ahn C, Zhang T, Yang G, Rode T, Varshney P, Ghayur SJ, Chugh OK, Jiang H, Horowitz JF. Years of endurance exercise training remodel abdominal subcutaneous adipose tissue in adults with overweight or obesity. Nat Metab. 2024 Sep;6(9):1819-1836. Skrypnik D, Bogdański P, Mądry E, Karolkiewicz J, Ratajczak M, Kryściak J, Pupek-Musialik D, Walkowiak J. Effects of Endurance and Endurance Strength Training on Body Composition and Physical Capacity in Women with Abdominal Obesity. Obes Facts. 2015;8(3):175-87. Resistance exercise-trained mice had a lean phenotype and counteracted diet-induced obesity and glucose tolerance, even after exercise cessation. Hansen D, Meeusen R, Mullens A, Dendale P. Effect of acute endurance and resistance exercise on endocrine hormones directly related to lipolysis and skeletal muscle protein synthesis in adult individuals with obesity. Sports Med. 2012 May 1;42(5):415-31. Di Meo S, Iossa S, Venditti P. Improvement of obesity-linked skeletal muscle insulin resistance by strength and endurance training. J Endocrinol. 2017 Sep;234(3):R159-R181. Skrypnik D, Bogdański P, Mądry E, Karolkiewicz J, Ratajczak M, Kryściak J, Pupek-Musialik D, Walkowiak J. Effects of Endurance and Endurance Strength Training on Body Composition and Physical Capacity in Women with Abdominal Obesity. Obes Facts. 2015;8(3):175-87. Katayama M, Nomura K, Mudry JM, Chibalin AV, Krook A, Zierath JR. Exercise-induced methylation of the Serhl2 promoter and implication for lipid metabolism in rat skeletal muscle. Mol Metab. 2025 Feb;92:102081. Joseph JS, Ayeleso AO, Mukwevho E. Role of exercise-induced calmodulin protein kinase (CaMK)II activation in the regulation of omega-6 fatty acids and lipid metabolism genes in rat skeletal muscle. Physiol Res. 2017 Dec 20;66(6):969-977. Peng T, Ding M, Yan H, Li Q, Zhang P, Tian R, Zheng L. Exercise Training Upregulates Cardiac mtp Expression in Drosophila melanogaster with HFD to Improve Cardiac Dysfunction and Abnormal Lipid Metabolism. Biology (Basel). 2022 Nov 30;11(12):1745. Ding M, Zheng L, Li QF, Wang WL, Peng WD, Zhou M. Exercise-Training Regulates Apolipoprotein B in Drosophila to Improve HFD-Mediated Cardiac Function Damage and Low Exercise Capacity. Front Physiol. 2021 Jul 7;12:650959. Wen DT, Zheng L, Lu K, Hou WQ. Activation of cardiac Nmnat/NAD+/SIR2 pathways mediates endurance exercise resistance to lipotoxic cardiomyopathy in aging Drosophila. J Exp Biol. 2021 Sep 15;224(18):jeb242425. Li C, Feng F, Xiong X, Li R, Chen N. Exercise coupled with dietary restriction reduces oxidative stress in male adolescents with obesity. J Sports Sci. 2017 Apr;35(7):663-668. Effting PS, Brescianini SMS, Sorato HR, Fernandes BB, Fidelis GDSP, Silva PRLD, Silveira PCL, Nesi RT, Ceddia RB, Pinho RA. Resistance Exercise Modulates Oxidative Stress Parameters and TNF-α Content in the Heart of Mice with Diet-Induced Obesity. Arq Bras Cardiol. 2019 May;112(5):545-552. Chen PB, Yang JS, Park Y. Adaptations of Skeletal Muscle Mitochondria to Obesity, Exercise, and Polyunsaturated Fatty Acids. Lipids. 2018 Mar;53(3):271-278. Gutiérrez-López L, Olivares-Corichi IM, Martínez-Arellanes LY, Mejía-Muñoz E, Polanco-Fierro JA, García-Sánchez JR. A moderate intensity exercise program improves physical function and oxidative damage in older women with and without sarcopenic obesity. Exp Gerontol. 2021 Jul 15;150:111360. Heo JW, No MH, Park DH, Kang JH, Seo DY, Han J, Neufer PD, Kwak HB. Effects of exercise on obesity-induced mitochondrial dysfunction in skeletal muscle. Korean J Physiol Pharmacol. 2017 Nov;21(6):567-577. Pileggi CA, Blondin DP, Hooks BG, Parmar G, Alecu I, Patten DA, Cuillerier A, O'Dwyer C, Thrush AB, Fullerton MD, Bennett SA, Doucet É, Haman F, Cuperlovic-Culf M, McPherson R, Dent RRM, Harper ME. Exercise training enhances muscle mitochondrial metabolism in diet-resistant obesity. EBioMedicine. 2022 Sep;83:104192. Heo JW, Yoo SZ, No MH, Park DH, Kang JH, Kim TW, Kim CJ, Seo DY, Han J, Yoon JH, Jung SJ, Kwak HB. Exercise Training Attenuates Obesity-Induced Skeletal Muscle Remodeling and Mitochondria-Mediated Apoptosis in the Skeletal Muscle. Int J Environ Res Public Health. 2018 Oct 19;15(10):2301. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6632687","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":516426890,"identity":"d7d8dafb-3b97-4f53-971d-32d3b7db7622","order_by":0,"name":"Ying Lin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACfvnDBw5IVNTI8bM3HyBOi+QMtsQDFmeOGUv2HEsgTovBDR7lA5VtzIkbbvgYEOmy2z0MB26cYUucOYPn4403DHZyug0EdDDOOXvg4IwKGeN+6d7NlnMYko3NDhDQwsyQl3BY4gyb7Mw5Z7dJ8zAcSNxGSAsbQ47B4b9tzIwbbuQ8I04Lj0SOwQHJNmZFoBY24rRI8BxLOCABCWRjyzkGRPjF/njz4Q/QqHx4402FnRxBLWhWEhs1SFpI1TEKRsEoGAUjAgAAR+1LQeyy+/kAAAAASUVORK5CYII=","orcid":"","institution":"Ludong University","correspondingAuthor":true,"prefix":"","firstName":"Ying","middleName":"","lastName":"Lin","suffix":""},{"id":516426895,"identity":"16617157-d665-4abe-994b-d28e5d204794","order_by":1,"name":"Xing-feng Ma","email":"","orcid":"","institution":"Ludong University","correspondingAuthor":false,"prefix":"","firstName":"Xing-feng","middleName":"","lastName":"Ma","suffix":""},{"id":516426897,"identity":"ed129c3b-cc30-4e54-b4b0-6116f1129e66","order_by":2,"name":"Qing yao Sun","email":"","orcid":"","institution":"Ludong University","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"yao","lastName":"Sun","suffix":""},{"id":516426898,"identity":"21b38420-b75e-4cf7-aef1-954c975f8568","order_by":3,"name":"Han-yu Li","email":"","orcid":"","institution":"Ludong University","correspondingAuthor":false,"prefix":"","firstName":"Han-yu","middleName":"","lastName":"Li","suffix":""},{"id":516426899,"identity":"6a5820d6-f42a-4009-836d-9b0ac905bba3","order_by":4,"name":"Zhao-qing Gao","email":"","orcid":"","institution":"Ludong University","correspondingAuthor":false,"prefix":"","firstName":"Zhao-qing","middleName":"","lastName":"Gao","suffix":""},{"id":516426900,"identity":"5e0f2707-d708-4976-9c5d-4d06c4d646b2","order_by":5,"name":"Deng-tai Wen","email":"","orcid":"","institution":"Ludong University","correspondingAuthor":false,"prefix":"","firstName":"Deng-tai","middleName":"","lastName":"Wen","suffix":""}],"badges":[],"createdAt":"2025-05-10 05:53:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6632687/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6632687/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91982455,"identity":"4bae0f3f-da42-4dd3-b0c3-5c35abe9bf53","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3735797,"visible":true,"origin":"","legend":"","description":"","filename":"Enduranceexercisepreventshereditaryobesityand21.docx","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/7f9e067d3c293c78340d08a9.docx"},{"id":91982451,"identity":"082b10d3-ec96-4dfb-ac9e-c52bc6742595","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7725,"visible":true,"origin":"","legend":"","description":"","filename":"40540e8dc6c649a8bf5355936f1c37f9.json","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/453cb50bb510819a14421a3e.json"},{"id":91983386,"identity":"9209ad32-66ed-4f5d-b237-40d219288e2c","added_by":"auto","created_at":"2025-09-23 11:32:48","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87873,"visible":true,"origin":"","legend":"","description":"","filename":"40540e8dc6c649a8bf5355936f1c37f91enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/d577bf74e0aa685373fc8669.xml"},{"id":91983188,"identity":"7c02c925-1479-4c15-a570-c27b735da5e7","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122326,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/d240277b545400c062db1929.png"},{"id":91982472,"identity":"659a3c4f-92ff-474b-81b8-c30241526168","added_by":"auto","created_at":"2025-09-23 11:16:49","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":586636,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/2f82a264a2b2eaaca1e9c139.png"},{"id":91983389,"identity":"5ff2ce76-b55a-4b06-b1a8-ac1d5e87d578","added_by":"auto","created_at":"2025-09-23 11:32:48","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":608819,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/bc8ad79fa5fc77e0e111f982.jpeg"},{"id":91983190,"identity":"91e071eb-83c2-462c-8e84-fb08e6de9bcd","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":479729,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/40f8a9e2ec5ca43d9e0caf42.png"},{"id":91983388,"identity":"fb539de2-6e14-44cc-ae9b-a0f43ee6817a","added_by":"auto","created_at":"2025-09-23 11:32:48","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":581169,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/3e4665b69746f3537d60df34.png"},{"id":91982460,"identity":"05f97da3-1863-4d4e-aae0-d7f5971cd840","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":566709,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/b1d5fa51e49638d39d666ad4.png"},{"id":91983192,"identity":"a89fb6a1-dcd8-4199-b931-345d264fd567","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":493562,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/c5ef23add00b17e115c8e8f0.png"},{"id":91982465,"identity":"75e43366-ff5c-4356-afad-9978a3e0f936","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30348,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/19694bef02d12165d9e19f86.png"},{"id":91983194,"identity":"5a7431ce-ed62-4b07-8dc4-b3286f367407","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":89881,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/5c2b08397c6c281f316bd4f2.png"},{"id":91982458,"identity":"aef7089e-359d-4616-95af-ff6bf7a9c32e","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128857,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/026593feddbcbb9635d3839d.png"},{"id":91982462,"identity":"b48c2877-7ace-4200-9914-89ccb8b428e9","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108557,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/4e241fa899f522ad7cff4f5b.png"},{"id":91983197,"identity":"3f6d2927-fc24-4501-944d-ab9aa11e13eb","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100335,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/7b5cb5839ad745dede531739.png"},{"id":91983390,"identity":"36e3e5d0-3327-4d59-a8be-563a18dbf45f","added_by":"auto","created_at":"2025-09-23 11:32:48","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79038,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/5fcb180a0ae90e56a39296b6.png"},{"id":91983196,"identity":"afa2d996-5080-4359-96d8-8626fe46ab03","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114479,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/7b20058c9700acf5ef47911c.png"},{"id":91982467,"identity":"33e3b782-0f8c-4776-9b3a-c1eb2288b92b","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":86494,"visible":true,"origin":"","legend":"","description":"","filename":"40540e8dc6c649a8bf5355936f1c37f91structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/d905f6f28e3eb68bec8953cd.xml"},{"id":91982470,"identity":"572fbb19-7cda-431d-b8f8-d8bb1fddfb80","added_by":"auto","created_at":"2025-09-23 11:16:49","extension":"html","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98500,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/175c7e3647140511eeb6495d.html"},{"id":91982446,"identity":"0c4c0831-be3a-4b05-a404-9e9e392fb3e3","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":388512,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Akh knockdown in adipose tissue(AT) on Drosophila. (A) The relative expression of Akh gene. (B) Body weight. (C) Body triglyceride(TG) level. (D) Muscular TG level. (E) Body Bmm expression. (F) Body Mdy expression. (G) Drosophila obesity. (H, I, and J) Climbing endurance of Drosophila at 1, 2 and 3 weeks of age. (K) Heart rate. (L) Cardiac shortening fraction. (M) Body SOD level. (N) Body MDA level. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/a86a876be621f6d479227057.png"},{"id":91983187,"identity":"c34f26f2-c5a1-4428-aef4-b46a465e8a40","added_by":"auto","created_at":"2025-09-23 11:24:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":376723,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Akh knockdown in muscle tissue(MT) on Drosophila. (A) The relative expression of Akh gene. (B) Body weight. (C) Body TG level. (D) Muscular TG level. (E) Muscular Bmm expression. (F) Drosophila obesity. (G) Skeletal muscle oil red staining. The red arrow points to the lipid droplet, and the green arrow points to the nucleus. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/25cfeb2fd43cf8f74da4cd06.png"},{"id":91982449,"identity":"2dbdb757-098a-4b17-9051-9b31bd23014f","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":365537,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Akh knockdown in muscle tissue(MT) on Drosophila. (A, B, and C) Climbing time to fatigue of Drosophila at 1, 2 and 3 weeks of age. (D) Heart rate. (E) Cardiac shortening fraction. (F) Body SOD level. (G) Body MDA level. (H) Muscular srl gene expression. (I) Transmission electron microscopy image of skeletal muscle. The white arrow points to the mitochondria, and the red arrow points to the Z line. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/08f8a9b2c07c90c879ac4e7b.png"},{"id":91982447,"identity":"0e695306-c3c8-4b5d-97d0-e8d5557b9b8f","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":453422,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of exercise on Drosophila with Akh knockdown in adipose tissue(AT). (A) The relative expression of Akh gene. (B) Body weight. (C) Body triglyceride(TG) level. (D) Muscular TG level. (E) Body Bmm expression. (F) Body Mdy expression. (G) Drosophila obesity. (H, I, and J) Climbing endurance of Drosophila at 1, 2 and 3 weeks of age. (K) Heart rate. (L) Cardiac shortening fraction. (M) Body SOD level. (N) Body MDA level. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/8bf86945f14430b15c571ca3.png"},{"id":91982450,"identity":"91f7c7d1-768a-4ad6-bb1f-c25332394f7b","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":280184,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of exercise on Drosophila with Akh knockdown in muscular tissue(MT). (A) The relative expression of Akh gene. (B) Body weight. (C) Body TG level. (D) Muscular TG level. (E) Muscular Bmm expression. (F) Drosophila obesity. (G) Skeletal muscle oil red staining. The red arrow points to the lipid droplet, and the green arrow points to the nucleus. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/e13a73bc02c6e0f59e6dc541.png"},{"id":91982454,"identity":"0554a529-1383-41c7-bf21-934398f9760b","added_by":"auto","created_at":"2025-09-23 11:16:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":400721,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Akh knockdown in muscle tissue(MT) on Drosophila. (A, B, and C) Climbing time to fatigue of Drosophila at 1, 2 and 3 weeks of age. (D) Heart rate. (E) Cardiac shortening fraction. (F) Body SOD level. (G) Body MDA level. (H) Muscular srl gene expression. (I) Transmission electron microscopy image of skeletal muscle. The white arrow points to the mitochondria, and the red arrow points to the Z line. Independent samples t-tests were used to determine between-group differences. Data are represented as mean ± standard deviation. *P \u0026lt; 0.05; **P \u0026lt; 0.01; ns means no significant difference.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/ace1a3268e54d477a7d2dd6f.png"},{"id":91983387,"identity":"70d1fd47-0d34-4eab-897e-aa9e2f122e8d","added_by":"auto","created_at":"2025-09-23 11:32:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":122898,"visible":true,"origin":"","legend":"\u003cp\u003eThe interaction relationship between exercise training and the Akh gene\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/b1b908e6f41509ab4aba0e50.png"},{"id":96252083,"identity":"6f978123-ec22-4e78-8291-5e34144400bb","added_by":"auto","created_at":"2025-11-19 07:40:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3349629,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6632687/v1/51a3f071-d5e2-4041-a2ed-e4d3b8fb7ea9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Endurance exercise prevents genetic obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene in different tissues in Drosophila","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eOver the past few decades, the incidence of obesity has been rising rapidly worldwide, which poses a serious threat to human health, and obesity has also been recognized by the World Health Organization as a global health crisis \u003csup\u003e1\u003c/sup\u003e. Obesity is a chronic metabolic disorder closely related to chronic diseases such as coronary heart disease, hypertension, cancer and type 2 diabetes, and its causes include both genetic factors and environmental factors acquired later in life \u003csup\u003e2\u003c/sup\u003e. Studies have shown that environmental factors acquired later in life, such as sedentary lifestyle and long-term high-fat/high-sugar diet, are prone to induce obesity and can alter obesity-related genetic genes, thereby increasing the risk of obesity in offspring \u003csup\u003e3\u003c/sup\u003e. Furthermore, numerous studies have confirmed that aerobic endurance exercise is an effective and very economical means to combat secondary obesity and its related complications \u003csup\u003e4\u003c/sup\u003e, and the physiological mechanism lies in that aerobic endurance exercise can reduce fat accumulation by increasing energy consumption, and rebalance various metabolic and signaling pathways within the body by enhancing insulin sensitivity \u003csup\u003e5,6\u003c/sup\u003e. However, the molecular mechanism of endurance exercise in combating genetic obesity and its complications remains to be explored.\u003c/p\u003e\n\u003cp\u003eDrosophila is a classic model organism for genetic studies. Constructing target gene mutations through Drosophila genetic hybridization is an important means to study genetic obesity and its complications. Akh is a peptide hormone that plays a key role in regulating energy metabolism and lipid mobilization in insects, including Drosophila \u003csup\u003e7\u003c/sup\u003e. Functionally, Akh is similar to mammalian glucagon and participates in stimulating lipid breakdown and energy release during periods of high metabolic demand \u003csup\u003e8\u003c/sup\u003e. Studies have shown that the Akh signal is crucial for maintaining lipid homeostasis, and dysfunction of the Akh gene can lead to excessive fat accumulation in Drosophila and induce obesity \u003csup\u003e9,10,11\u003c/sup\u003e. However, regarding whether the Akh gene in adipose tissue and skeletal muscle tissue has the function of regulating systemic lipid metabolism, exercise capacity, and cardiac function, as well as whether endurance exercise can effectively counteract genetic obesity induced by Akh gene knockout and concurrent exercise capacity and cardiac function disorders, there are still few research reports.\u003c/p\u003e\n\u003cp\u003eThis study first constructed the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e/Ppl-Gal4 and Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e/Mef2-Gal4 systems in F1 generation Drosophila through genetic hybridization, respectively knocking out the Akh gene in adipose tissue and skeletal muscle tissue, to verify whether F1 can be induced to develop genetic obesity and concurrent skeletal muscle and cardiac dysfunction, and analyze its molecular mechanism; then, for F1 generation Drosophila with genetic obesity, a 3-week aerobic endurance exercise intervention was carried out, and the expression of the Akh gene in adipose tissue and skeletal muscle tissue, the levels of triglycerides (TG) in the body and skeletal muscle, the expression of lipid metabolism-related genes Bmm and Mdy, the expression of mitochondrial synthesis-related gene PGC-1\u0026alpha;(srl) in skeletal muscle tissue, and the oxidative/antioxidant balance state were measured, aiming to reveal the molecular mechanism of aerobic endurance exercise in counteracting genetic obesity and concurrent skeletal muscle and cardiac dysfunction induced by the Akh gene knockout, and providing theoretical support for the prevention and treatment of genetic obesity and its complications through endurance exercise in humans.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003ch2\u003e2.1 Drosophila strains and hybridization groups\u003c/h2\u003e\n\u003cp\u003eThe w[1118]P{GD4582}v12345 flies (stock ID: V12345; FlyBase Genotype: w[1118] P{GD4582}v12345) were obtained from the Vienna Drosophila Resource Center. The Ppl-Gal4 flies (stock ID: BCF-673; FlyBase Genotype: w; P{ppl-GAL4.P}2) and Mef2-Gal4 flies (stock ID: 27390; FlyBase Genotype: w; P{Mef2-GAL4.247}) were obtained from the Bloomington Drosophila Stock Center. Male Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e flies were crossed to female Ppl-Gal4 and Mef2-Gal4 lines.\u0026ldquo;w[1118] P{GD4582}v12345\u0026gt;w[1118] P{GD4582}v12345\u0026rdquo;was represented as\u0026ldquo;Akh normal expression (Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C)\u0026rdquo;and \u0026ldquo;Akh normal expression exercise (Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-E).\u0026ldquo;w[1118] P{GD4582}v12345\u0026gt;P{ppl-GAL4.P}2\u0026rdquo;was represented as\u0026ldquo;Akh adipose tissue knockdown (Akh\u0026times;Ppl\u003csup\u003eRNAi\u003c/sup\u003e-C)\u0026rdquo;and\u0026ldquo;Akh adipose tissue knockdown exercise (Akh\u0026times;Ppl\u003csup\u003eRNAi\u003c/sup\u003e-E)\u0026rdquo;.\u0026ldquo;w[1118] P{GD4582}v 12345\u0026gt;P{Mef2-GAL4.247}\u0026rdquo;was represented as \u0026ldquo;Akh skeletal muscle knockdown (Akh\u0026times;Mef2\u003csup\u003eRNAi-\u003c/sup\u003eC)\u0026rdquo; and \u0026ldquo;Akh skeletal muscle knockdown exercise (Akh\u0026times;Mef2\u003csup\u003eRNAi\u003c/sup\u003e-E)\u0026rdquo;. All flies were maintained in a controlled environment at 25\u0026deg;C, 50% constant humidity, and a 12-h light/dark cycle.\u003c/p\u003e\n\u003ch2\u003e2.2 Exercise training\u003c/h2\u003e\n\u003cp\u003eThe upward climbing endurance training was conducted on an exercise platform that leveraged the anti-gravity climbing behavior of Drosophila. The setup involved fixing the test tube vertically on a clamp, perpendicular to the ground. As the fruit flies climbed from the bottom to the top of the tube, the tube would automatically rotate 180\u0026deg;(at a speed of 60 rad/s with uniform motion), returning the flies to the bottom to climb again. This cycle was continuously repeated. The climbing load for the fruit flies was their own body weight, with 20 flies per tube. An 8 cm space was left between the medium at the bottom of the tube and the lower end of the cotton plug to provide an activity area for the flies. After being returned to the bottom of the tube, the flies had 10 seconds to initiate each climbing attempt. The exercise group started training from 1 day of age and continued until the end of week 3. The training protocol involved 15 minutes of exercise followed by 5 minutes of rest, repeated four times daily. (Table 1) \u003csup\u003e12\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003eTable 1 Training protocols\u0026nbsp;\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDay\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eExercise\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRest\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eExercise\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRest\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eExercise\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRest\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eExercise\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eRest\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eMonday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTuesday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eWednesday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"8\" valign=\"top\"\u003e\n \u003cp\u003eRest\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eThursday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eFriday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e15min\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5min\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSaturday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"8\" valign=\"top\"\u003e\n \u003cp\u003eRest\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eSunday\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"8\" valign=\"top\"\u003e\n \u003cp\u003eRest\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch2\u003e2.3 Preparation of Drosophila culture medium\u003c/h2\u003e\n\u003cp\u003eThe preparation of the Drosophila culture medium was adapted from the standard diet used in previous studies. To configure 2 L of Drosophila culture medium, add 20 g of soybean flour, 84 g of cornmeal, 26 g of yeast powder, and 16 g of agar strips to a pot. Pour in 2 L of distilled water and mix thoroughly. Continuously stir the mixture while heating until the agar strips are completely dissolved and the solution reaches boiling. Once boiling is achieved, remove from heat and add 62 g of maltose and 62 g of sucrose while the mixture is cooling. After the sucrose and maltose are fully dissolved, incorporate 4000 \u0026micro;l of the preservative propionic acid and 2 g of sodium benzoate. Immediately dispense the medium into clean culture vials, filling each to a thickness of approximately 0.5 cm after thorough mixing \u003csup\u003e12\u003c/sup\u003e.\u003c/p\u003e\n\u003ch2\u003e2.4 ELISA assay\u003c/h2\u003e\n\u003cp\u003eThe levels and activities of triglyceride (TG), superoxide dismutase (SOD) in Drosophila skeletal muscle were measured using insect-specific ELISA kits for TG, SOD. The specific steps for the ELISA assay are as follows: (1) Standard addition: Prepare standard wells according to the kit instructions. (2) Sample addition: Set up blank control wells and sample wells to be tested. Add 40 \u0026micro;l of diluent to the sample wells, followed by 10 \u0026micro;l of the test sample. (3) Enzyme addition: Add 100 \u0026micro;l of enzyme-conjugated reagent to each well, excluding the blank wells. (4) Incubation: Cover the plate with a sealing film and incubate at 37\u0026deg;C for 60 minutes. (5) Washing buffer preparation: Dilute the 20x concentrated washing buffer with distilled water at a 1:20 ratio for use. (6) Washing: Remove the sealing film, discard the liquid in the wells, thoroughly wash the plate, and allow it to dry. (7) Color development: Add 50 \u0026micro;l of color-developing agent A to each well, followed by 50 \u0026micro;l of color-developing agent B. Gently mix and incubate at 37\u0026deg;C in the dark for 15 minutes. (8) Reaction termination: Add 50 \u0026micro;l of stop solution to each well to halt the reaction (the color will immediately change from blue to yellow). (9) Measurement: Determine the absorbance (OD value) of each well using a microplate reader at the appropriate wavelength.\u003c/p\u003e\n\u003ch2\u003e2.5 Real-time quantitative PCR\u003c/h2\u003e\n\u003cp\u003eAt the end of the third week, 50 samples of Drosophila skeletal muscle (thorax) and adipose tissue (abdomen) were collected from each group and immersed in 1000 \u0026micro;l of Trizol reagent for the detection of relevant pathway gene expression levels. (1) Total RNA Extraction: A homogenizer tube was pre-chilled on ice, and 1 ml of RNA extraction solution was added. Approximately 100 mg of tissue was placed into the tube and thoroughly homogenized until no visible tissue chunks remained. The mixture was then centrifuged at 12,000 rpm at 4\u0026deg;C for 10 minutes. The white precipitate at the bottom of the tube represented the RNA. The supernatant was discarded, and 1.5 ml of 75% ethanol was added to wash and precipitate the RNA. After centrifugation at 12,000 rpm at 4\u0026deg;C for 5 minutes, the liquid was removed, and the tube was left on a clean bench for 3 minutes. The RNA was dissolved in 15 \u0026micro;l of Nuclease-Free Water and incubated at 55\u0026deg;C for 5 minutes. RNA concentration and purity were measured using a Nanodrop 2000 spectrophotometer. After blank calibration, 2.5 \u0026micro;l of RNA solution was placed on the detection platform, and the sample arm was lowered. The software was used to measure absorbance. RNA samples with excessive concentration were diluted to achieve a final concentration of 100\u0026ndash;500 ng/\u0026micro;l. (2) Reverse Transcription: The reverse transcription reaction mixture was prepared, gently mixed, and briefly centrifuged. The reverse transcription program was set according to the manufacturer\u0026apos;s instructions. (3) Quantitative PCR: A 0.2 ml PCR tube was used to prepare the reaction mixture. Each cDNA sample was prepared in triplicate for PCR amplification.Results Analysis: Quantification was performed using the CT method. The primer sequences for Rp-49 were as follows: F: 5\u0026rsquo;- CTAAGCTGTCGCACAAATGG-3\u0026rsquo;, R: 5\u0026rsquo;-AACTTCTTGAATCCGGTGGG-3\u0026rsquo;. Primer sequences for Akh were as follows: F: 5\u0026rsquo; -GGTCCTCAGCGAGATGCAATAA-3\u0026rsquo;, R: 5\u0026rsquo;- TAAGGTTCGATTGCAGAATTGTG T C-3\u0026rsquo;. Primer sequences for Bmm were as follows: 5\u0026rsquo;-CAGTCCCTCCTTCAACATCCAG-3\u0026rsquo;, R: 5\u0026rsquo;-GACCTC TTCCCGT GACTCAAACT-3\u0026rsquo;. Primer sequences for Srl were as follows: F: 5\u0026rsquo;-ACCTGGCGATTCTGATTATGACT-3\u0026rsquo;, R: 5\u0026rsquo;-C CTTTAC ATTGTCCACATAGCGT-3\u0026rsquo;.\u003c/p\u003e\n\u003ch2\u003e2.6 Transmission electron microscopy of the skeletal muscle\u003c/h2\u003e\n\u003cp\u003eFor electron microscopic examination, muscles were carefully dissected in an ice-cold fixative solution composed of 2.5% glutaraldehyde in 0.1 mol/L PIPES buffer (pH 7.4). Following a fixation period of 10 hours at 4 \u0026deg;C, the samples were rinsed with 0.1 mol/L PIPES buffer. Subsequently, post-fixation was conducted using 1% OsO4 for 30 minutes, and the samples were stained with 2% uranyl acetate for 1 hour. Dehydration was achieved through a graded ethanol series (50%, 70%, and 100%), and the samples were embedded in epoxy resin. Ultrathin sections were prepared and examined using an HT-7700 transmission electron microscope, with images captured for subsequent analysis \u003csup\u003e12\u003c/sup\u003e.\u003c/p\u003e\n\u003ch2\u003e2.7 Oil red staining analysis of skeletal muscle\u003c/h2\u003e\n\u003cp\u003eSkeletal muscle samples were harvested and fixed in tissue fixative for 15 minutes, washed with water, and air-dried. An oil red O working solution was prepared by combining 6 parts of saturated oil red O dye solution with 4 parts of distilled water. This mixture was heated in a water bath at 60\u0026ndash;70 \u0026deg;C for 30 minutes, allowed to cool naturally, and then filtered through qualitative filter paper. The sections were stained in the oil red O working solution for 8\u0026ndash;10 minutes (covered to prevent light exposure). After removal, the sections were briefly air-dried for 3 seconds and then immersed sequentially in two containers of 60% isopropyl alcohol for differentiation (3 seconds and 5 seconds, respectively). The sections were rinsed in two containers of distilled water for 10 seconds each. Subsequently, the sections were air-dried for 3 seconds and stained with hematoxylin for 3\u0026ndash;5 minutes. They were then rinsed in three containers of distilled water for 5 seconds, 10 seconds, and 30 seconds, respectively. Differentiation was performed using a differentiation solution for 2\u0026ndash;8 seconds, followed by rinsing in two containers of distilled water for 10 seconds each. The sections were briefly washed in a bluing solution for 1 second. Finally, the sections were gently immersed in two containers of tap water for 5 seconds and 10 seconds, respectively, and the staining results were examined under a microscope. The sections were mounted with glycerol gelatin, and images were captured and analyzed using a microscope. Microscopy, image acquisition, and analysis were conducted using an upright light microscope. A 40\u0026times; oil immersion objective with a numerical aperture (NA) of 1.3 was selected for high-resolution imaging. A high-resolution digital camera was used to capture clear images, allowing precise measurement and documentation of details at a scale of 5 \u0026mu;m. A 10\u0026times; low magnification objective was used to quickly locate the target area during initial observation and to understand the overall distribution of the sample \u003csup\u003e12\u003c/sup\u003e.\u003c/p\u003e\n\u003ch2\u003e2.8 Athletic ability testing\u003c/h2\u003e\n\u003cp\u003eOne hundred fruit flies were randomly chosen from each group and divided into five tubes, with 20 flies per tube. Each tube was placed under a high-definition video camera for recording. Once the camera was activated, the fruit flies were gently shaken to the bottom of the tube every 15 seconds. After three consecutive shakes, the flies in the current tube were replaced with those from the next tube. The best performance out of three climbing attempts for each tube of fruit flies was selected for data analysis. Screenshots capturing the climbing height of the fruit flies 3 seconds after they were shaken from the bottom were taken using AVS Video Editor Software. These images clearly displayed the climbing height of the flies. The 3-second climbing heights were then processed and analyzed using HEYEAR software and Prism software.\u003c/p\u003e\n\u003ch2\u003e2.9 Statistical methods\u003c/h2\u003e\n\u003cp\u003eTo compare the G\u0026alpha;q gene expression among the normal G\u0026alpha;q expression group, the adipose tissue G\u0026alpha;q knockdown group, and the skeletal muscle tissue G\u0026alpha;q knockdown group, one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test was employed to assess differences between groups. For comparisons between the control and exercise groups, independent samples t-tests were conducted to determine between-group differences. Experimental data were presented as mean \u0026plusmn; standard deviation (SD), with the significance level set at \u0026alpha; = 0.05 (or 0.01).\u003c/p\u003e"},{"header":"3 Results","content":"\u003ch2\u003e3.1 Adipose tissue Akh knockdown induced lipid accumulation, exercise endurance limitation, and cardiac dysfunction.\u003c/h2\u003e\n\u003cp\u003eIt has been reports that the manipulation of the Akh gene expression influences multiple aspects of fly physiology \u003csup\u003e13\u003c/sup\u003e. Akh signaling in the fat body is crucial for calcium oscillations and triglyceride breakdown, and its impairment results in abnormal lipid storage and metabolic dysfunction \u003csup\u003e14\u003c/sup\u003e. However, it is still unclear whether Akh hereditary knockdown can induce hereditary obesity and associated skeletal and myocardial dysfunction.\u003c/p\u003e\n\u003cp\u003eIn this study, we first constructed the Akh-UAS-RNAi\u0026gt;Ppl-gal4 system in Drosophila F1 generation by genetic hybridization. The results showed that in fly adipose tissue(AT), the relative expression of Akh gene of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group was significantly lower than that of Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1-A), suggesting that the Akh-UAS-RNAi/Ppl-gal4 system was successfully constructed in Drosophila F1 generation.\u003c/p\u003e\n\u003cp\u003eBesides, the body weight, systemic TG levels, and muscular TG levels, and the expression of Bmm gene and Mdy gene of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies were significantly higher than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1- B, C, D, E, and F), and images of flies show that Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group fly was significantly fatter than Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group fly (Fig.1-G), suggesting that genetic Akh knockdown in AT disrupted the balance of lipid metabolism and led to hereditary obesity in flies.\u003c/p\u003e\n\u003cp\u003eMoreover, at the end of 1, 2 and 3 weeks of age, the climbing endurance of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly shorter than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1-H, I, and J). What\u0026rsquo;s more, the heart rate of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly faster than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1-K), but the fraction shortening of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly lower than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1-L). These results indicated that genetic Akh knockdown in AT also impaired the flies\u0026apos; ability to exercise and their heart function.\u003c/p\u003e\n\u003cp\u003eFinally, the SOD level of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly lower than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.1-M), and the MDA of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly higher than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.05) (Fig.1-N), suggesting that genetic Akh knockdown in AT may exacerbate oxidative stress damage in the body.\u003c/p\u003e\n\u003cp\u003eTaken together, these results suggested that genetic knockdown of Akh gene in adipose tissue could lead to hereditary obesity, accompanied by reduced exercise capacity and cardiac function, and the physiological mechanism may be related to the damage of cells in the body under high oxidative stress.\u003cbr\u003e3.2 Muscle Akh knockdown also induced lipid accumulation, exercise endurance limitation, and cardiac dysfunction.\u003c/p\u003e\n\u003cp\u003eAlthough a large number of studies have confirmed that Akh is related to intracellular calcium ion regulation and energy metabolism\u003csup\u003e15,16\u003c/sup\u003e, our results also verified that Akh gene in adipose tissue is involved in lipid metabolism, exercise ability, heart function and oxidative stress, but the function of Akh gene in muscle tissue is still unclear.\u003c/p\u003e\n\u003cp\u003eIn this study, we also constructed the Akh-UAS-RNAi\u0026gt;Mef2-gal4 system in Drosophila F1 generation by genetic hybridization. The results showed that compared with Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies, the relative expression in MT of Akh gene in Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly decreased (P \u0026lt; 0.01) (Fig.2-A), suggesting that the Akh-UAS-RNAi/ Mef2-gal4 system was successfully constructed in Drosophila F1 generation.\u003c/p\u003e\n\u003cp\u003eBesides, the body weight, systemic TG levels, and muscular TG levels, and the expression of Bmm gene of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies were also significantly higher than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.2-B) (Fig.3- B, C, D, and E), and images of flies show that Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group fly was significantly fatter than Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group fly (Fig.2-F), and skeletal muscle oil red O staining microscopic images showed that Akh knockdown in muscle tissue resulted in a significant increase in lipid droplets in skeletal muscle cells (Fig.2-G). These results suggested that genetic Akh knockdown in MT also disrupted the balance of lipid metabolism and led to hereditary obesity in flies.\u003c/p\u003e\n\u003cp\u003eIn addition, at the end of 1, 2 and 3 weeks of age, the climbing endurance of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly shorter than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.3-A, B, and C). What\u0026rsquo;s more, the heart rate of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly faster than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.2-D), but the fraction shortening of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly lower than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.3-E). These results indicated that genetic Akh knockdown in MT also impaired the flies\u0026apos; ability to exercise and their heart function.\u003c/p\u003e\n\u003cp\u003eWhat\u0026rsquo;s more, the SOD level of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly lower than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.2-F), and the MDA of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly higher than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.05) (Fig.2-G), suggesting that genetic Akh knockdown in MT may exacerbate oxidative stress damage in the body.\u003c/p\u003e\n\u003cp\u003eFinally, the expression of srl(PCG-1\u0026alpha;) gene of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies were also significantly higher than that of the Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies (P \u0026lt; 0.01) (Fig.3-H), and projective electron microscopy images of skeletal muscle showed that knockdown of Akh gene resulted in decreased mitochondrial number and increased mitochondrial damage(Fig.3-I), suggesting that genetic Akh knockdown in AT may impair mitochondrial synthesis and function.\u003c/p\u003e\n\u003cp\u003eTaken together, these results suggested that genetic knockdown of Akh gene in muscle tissue could also lead to hereditary obesity, accompanied by reduced exercise capacity and cardiac function, and the physiological mechanism may be related to the damage of cells in the body under high oxidative stress and the impairment of mitochondrial synthesis and function in muscle.\u003c/p\u003e\n\u003ch2\u003e3.3 Endurance exercise prevented AT-Akh knockdown-induced hereditary obesity.\u003c/h2\u003e\n\u003cp\u003eA large number of studies have confirmed that aerobic endurance exercise can prevent and reduce obesity and obesity-related complications\u003csup\u003e17181920\u003c/sup\u003e, but it is still unclear whether exercise can effectively combat Akh knockdown induced hereditary obesity and its complications. In this study, we performed aerobic endurance exercise intervention on AT-Akh gene knockdown Drosophila for 3 weeks.\u003c/p\u003e\n\u003cp\u003eThe results showed that in both Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies, aerobic endurance exercise for 3 weeks significantly upregulates the expression of Akh gene in adipose tissue(P \u0026lt; 0.01) (Fig.4-A), suggesting that exercise may be the upstream regulator of Akh gene in adipose tissue.\u003c/p\u003e\n\u003cp\u003eBesides, the body weight of Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies significantly decreased after exercise training(P \u0026lt; 0.01) (Fig.4-B), and exercise training significantly reduced the systemic TG levels, muscular TG levels, and the expression of Bmm gene and Mdy gene in Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies(P \u0026lt; 0.05 or P \u0026lt; 0.01) (Fig.4-C, D, E, and F), and images of flies show that Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group fly was significantly fatter than Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-E group fly (Fig.4-G). These results suggested that aerobic endurance exercise for 3 weeks prevented lipid metabolism disorder and hereditary obesity induced by Akh gene knockdown in adipose tissue.\u003c/p\u003e\n\u003cp\u003eIn addition, at the end of 3 weeks of age, the climbing endurance of Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies was significantly increased after exercise training(P \u0026lt; 0.01), but this change did not occur at the end of 1 and 2 weeks of age (P \u0026gt; 0.05) (Fig.4-H, I, and J). In both Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies, exercise training significantly decreased the heart rate(P \u0026lt; 0.05) (Fig.4-K), and it significantly increased the fraction shortening of heart(P \u0026lt; 0.01) (Fig.4-L). These results suggested that aerobic endurance exercise genetic prevented AT-Akh knockdown induced the impairments of exercise ability and heart function in flies.\u003c/p\u003e\n\u003cp\u003eWhat\u0026rsquo;s more, in both Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies, exercise training significantly increased the SOD level(P \u0026lt; 0.05 or P \u0026lt; 0.01) (Fig.4-M), and it significantly decreased the MDA level(P \u0026lt; 0.01) (Fig.4-N), suggesting that aerobic endurance exercise genetic prevented AT-Akh knockdown induced oxidative stress damage in flies.\u003c/p\u003e\n\u003cp\u003eTaken together, these results suggested that as an upstream regulator of Akh gene in adipose tissue, 3-week aerobic endurance exercise effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in adipose tissue, the mechanism of which was related to the reduction of oxidative stress by aerobic endurance exercise.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Endurance exercise also prevented MT-Akh knockdown-induced hereditary obesity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we also performed aerobic endurance exercise intervention on MT-Akh gene knockdown Drosophila for 3 weeks. The results showed that in Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies, aerobic endurance exercise for 3 weeks significantly upregulates the expression of Akh gene in muscle tissue(P \u0026lt; 0.01) (Fig.5-A), suggesting that exercise may be an upstream regulator of Akh gene in muscle tissue.\u003c/p\u003e\n\u003cp\u003eBesides, the body weight of Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies significantly decreased after exercise training(P \u0026lt; 0.01), and exercise training significantly reduced the systemic TG levels, muscular TG levels, and the expression of Bmm gene in Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies(P \u0026lt; 0.01) (Fig.5-B, C, D, and E), and images of flies show that Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group fly was significantly fatter than Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-E group fly (Fig.5-F). Skeletal muscle oil red O staining microscopic images showed that exercise prevented the accumulation of lipid droplets induced by MT-Akh knockdown in skeletal muscle cells(Fig.5-G). These results suggested that aerobic endurance exercise for 3 weeks prevented lipid metabolism disorder and hereditary obesity induced by Akh gene knockdown in muscle tissue.\u003c/p\u003e\n\u003cp\u003eIn addition, at the end of 3 weeks of age, the climbing endurance of Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies was significantly increased after exercise training(P \u0026lt; 0.01) (Fig.6-A, B, and C). In both Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies, exercise training significantly decreased the heart rate(P \u0026lt; 0.05) (Fig.6-D), and it significantly increased the fraction shortening of heart(P \u0026lt; 0.01) (Fig.6-E). These results suggested that aerobic endurance exercise genetic prevented MT-Akh knockdown induced the impairments of exercise ability and heart function in flies.\u003c/p\u003e\n\u003cp\u003eWhat\u0026rsquo;s more, in both Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eAT-RNAi\u003c/sup\u003e-C group flies, exercise training significantly increased the SOD level(P \u0026lt; 0.05 or P \u0026lt; 0.01) (Fig.6-F), and it significantly decreased the MDA level(P \u0026lt; 0.01) (Fig.6-G), suggesting that aerobic endurance exercise genetic prevented MT-Akh knockdown induced oxidative stress damage in flies.\u003c/p\u003e\n\u003cp\u003eFinally, In both Akh\u003csup\u003eUAS-RNAi\u003c/sup\u003e-C group flies and Akh\u003csup\u003eMT-RNAi\u003c/sup\u003e-C group flies, exercise training significantly increased the expression of muscle srl(PCG-1\u0026alpha;) gene(P \u0026lt; 0.05 or P \u0026lt; 0.01) (Fig.6-H), and projective electron microscopy images of skeletal muscle showed that exercise training prevented the decrease in mitochondrial number and mitochondrial damages induced by MT-Akh knockdown(Fig.6-I).\u003c/p\u003e\n\u003cp\u003eTaken together, these results suggested that as an upstream regulator of Akh gene in muscle tissue, 3-week aerobic endurance exercise effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockdown in muscle tissue, the mechanism of which was related to the reduction of oxidative stress and enhancement of muscle mitochondrial function by aerobic endurance exercise.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003ch2\u003e4.1\u0026nbsp;Effects of Akh knockdown in adipose tissue and muscle tissue on Drosophila.\u003c/h2\u003e\n\u003cp\u003eThe adipokine hormone (Akh) plays a crucial role in regulating energy metabolism and stress responses. Studies have shown that knockdown of Akh can impair the lipid mobilization process, leading to increased fat storage and thereby disrupting energy balance and glucose homeostasis \u003csup\u003e21, 22, 23, 24\u003c/sup\u003e. In Drosophila, Akh is a homolog of glucagon and is essential for lipid mobilization from adipose tissue, especially during starvation \u003csup\u003e25\u003c/sup\u003e. When Akh is knocked out, the lipid breakdown function is impaired, resulting in increased accumulation of triglycerides due to the disruption of the Ca\u0026sup2;⁺ signaling pathway and intercellular calcium waves \u003csup\u003e26\u003c/sup\u003e, and the Akh signal is crucial for maintaining energy homeostasis through Ca\u0026sup2;⁺ influx and downstream effectors such as G\u0026alpha;q and PLC21C \u003csup\u003e27, 28\u003c/sup\u003e. Conversely, dietary amino acids can promote the release of Akh by adipokine cells, thereby stimulating lipolysis and accelerating lipid breakdown metabolism \u003csup\u003e29, 30.\u003c/sup\u003e Therefore, these studies emphasize the importance of Akh in regulating lipid homeostasis, but it is currently unclear whether Akh in adipose tissue and muscle tissue has the function of regulating systemic lipid metabolism, regulating exercise capacity and cardiac function.\u003c/p\u003e\n\u003cp\u003eThe results of this study indicate that genetic knockdown of the Akh gene in adipose tissue can induce lipid accumulation and cause hereditary obesity in Drosophila, accompanied by obesity-related impairments in locomotor ability and cardiac function. The molecular mechanism is related to the activation of the Bmm/Mdy pathway by Akh and the inhibition of the SOD/MDA pathway by Akh. Moreover, genetic knockdown of the Akh gene in muscle tissue can also cause obesity in Drosophila, accompanied by weakened locomotor ability and cardiac function. The physiological mechanism is related to abnormal regulation of Akh/Bmm, Akh/PGC-1\u0026alpha;, and Akh/SOD in muscle cells, which leads to abnormal lipid breakdown, mitochondrial function, and oxidative stress in skeletal muscle tissue.\u003c/p\u003e\n\u003cp\u003eLipid metabolism disorder and obesity in \u003cem\u003eDrosophila\u003c/em\u003e are closely related to the abnormal changes of related molecular pathways. For instance, Brummer (Bmm) encodes a triglyceride lipase orthologous to mammalian Adipose Triglyceride Lipase, and bmm knockdown reveals a marked reduction in medium chain fatty acids, long chain saturated fatty acids and long chain monounsaturated and polyunsaturated fatty acids, and an increase in diacylglycerol levels \u003csup\u003e31, 32\u003c/sup\u003e. Global overexpression of Bmm strongly promoted numerous markers of physiological fitness, including increased mitochondrial biogenesis and oxidative metabolism, and it also upregulated the heat shock protein 70 (Hsp70) family of proteins, which equipped the flies with higher resistance to heat, cold, and ER stress via improved proteostasis \u003csup\u003e33\u003c/sup\u003e. High-fat-diet feeding lowers cardiac PGC-1\u0026alpha;/srl expression by elevating TOR signaling and inhibiting expression of the Drosophila Bmm, both of which function as upstream modulators of PGC-1\u0026alpha;/srl \u003csup\u003e34\u003c/sup\u003e. \u0026nbsp;Additionally, Mdy (Midway), on the other hand, is involved in lipid droplet dynamics and regulation \u003csup\u003e35\u003c/sup\u003e. The midway gene encodes a protein similar to mammalian acyl coenzyme A: diacylglycerol acyltransferase, which converts diacylglycerol into triacylglycerol (TG) \u003csup\u003e36\u003c/sup\u003e. Genetic or physiological activation of fat body Toll signaling leads to a tissue-autonomous reduction in triglyceride storage, and this is paralleled by decreased transcript levels of the DGAT homolog Mdy, which carries out the final step of triglyceride synthesis \u003csup\u003e37\u003c/sup\u003e. These evidences indicate that Bmm gene and Mdy gene are key factors regulating lipid metabolism, and Akh gene in skeletal muscle and adipose tissue is the upstream regulator of both, and the genetic obesity caused by Akh gene knockdown may be related to the abnormal expression of Bmm gene and Mdy gene in skeletal muscle and adipose tissue.\u003c/p\u003e\n\u003cp\u003eObesity-related skeletal muscle dysfunction and cardiac dysfunction are associated with mitochondrial dysfunction and increased oxidative stress in cells. For example, obesity may trigger different myocellular mechanisms proposed to contribute to insulin resistance and aggravate skeletal muscle atrophy and dysfunction, and skeletal muscle atrophy and dysfunction can also impair whole-body metabolism and reduce physical exercise capacity, thus instigating a vicious cycle that further deteriorates the underlying conditions. These mechanisms mainly include the inactivation of insulin signaling components through sustained activation of stress-related pathways, mitochondrial dysfunction, a shift to glycolytic skeletal muscle fibers, and hyperglycemia \u003csup\u003e38\u003c/sup\u003e. PGC-1\u0026alpha; is a transcriptional co-activator and master regulator of mitochondrial biogenesis, obesity can reduce the expression of PGC-1\u0026alpha; in skeletal muscle and heart muscle cells, leading to their dysfunction \u003csup\u003e39, 40\u003c/sup\u003e. Moreover, the oxidation/antioxidant balance in the body is an important condition for maintaining cell function. Both the decrease of oxidase activity (such as SOD) and the increase of oxygen free radicals in vivo can lead to the increase of oxidative stress damage \u003csup\u003e41,\u0026nbsp;42\u003c/sup\u003e. Obesity is easy to cause insufficient lipid oxidation in the body, which combines with oxygen free radicals to form malondialdehyde, and malondialdehyde has strong cytotoxicity and can damage cell structures such as cell membranes, mitochondria, and even DNA\u003csup\u003e43,\u0026nbsp;44\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTherefore, these evidences suggest that Akh knockdown in adipose tissue can induce hereditary obesity, and the physiological mechanism is that the upstream of Akh in adipose tissue regulates the expression of fat metabolism-related genes Bmm and Mdy, leading to lipid accumulation. At the same time, obesity also reduces exercise capacity and heart function by enhancing oxidative stress in the body. In addition, muscle Akh gene also acts as an upstream regulator of PGC-1 in muscle cells, controlling the synthesis and function of mitochondria. Muscle Akh gene knockdown leads to mitochondrial dysfunction of skeletal muscle cells and cardiomyocytes, as well as intracellular lipid metabolism disorder and increased oxidative stress, thus exhibiting obesity, impaired exercise ability and cardiac dysfunction.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ch2\u003e4.2 Effects of exercise on Drosophila with Akh knockdown in adipose tissue and muscular tissue\u003c/h2\u003e\n\u003cp\u003eA large number of studies have shown that endurance exercise is a classic means to prevent and reduce obesity and obesity-related complications. For instance, regular exercise may play a role in remodelling abdominal subcutaneous adipose tissue structure and proteomic profile in ways that may contribute to preserved cardiometabolic health \u003csup\u003e45\u003c/sup\u003e. In subjects with obesity, the implementation of long-term exercise intervention increases lean tissue mass and lowers adipose tissue mass \u003csup\u003e46\u003c/sup\u003e. In the obese, some endocrinological disturbances during acute endurance and resistance exercise have been identified: a blunted blood growth hormone, atrial natriuretic peptide and epinephrine release, and greater cortisol and insulin release. These hormonal disturbances might contribute to a suppressed lipolytic response, and/or suppressed skeletal muscle protein synthesis, as a result of acute endurance or resistance exercise, respectively \u003csup\u003e47,\u0026nbsp;48\u003c/sup\u003e. Moreover, obesity-linked insulin resistance is mainly due to fatty acid overload in non-adipose tissues, particularly skeletal muscle and liver, where it results in high production of reactive oxygen species and mitochondrial dysfunction. Accumulating evidence indicates that resistance and endurance training alone and in combination can counteract the harmful effects of obesity increasing insulin sensitivity, thus preventing diabetes \u003csup\u003e49\u003c/sup\u003e. 3-month endurance and endurance strength training have positive effects on anthropometric parameters, body composition, physical capacity, and circulatory system function in women with abdominal obesity \u003csup\u003e50\u003c/sup\u003e. Although these studies have shown that endurance exercise is beneficial for obesity and obesity-related exercise impairment and cardiac dysfunction, few studies have reported whether endurance exercise is effective against Akh knockdown in dipose tissue or muscular tissue induced hereditary obesity and its concomitant exercise function and cardiac dysfunction.\u003c/p\u003e\n\u003cp\u003eIn this study, our results suggest that as an upstream regulator of Akh gene in adipose tissue, 3-week aerobic endurance exercise can effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in adipose tissue and skeletal muscle, the mechanism of which is related to positively regulation of Akh/Bmm/Mdy pathway and the reduction of oxidative stress by aerobic endurance exercise. Moreover, as an upstream regulator of Akh gene in muscle tissue, 3-week aerobic endurance exercise also can effectively prevented hereditary obesity and its concurrent exercise ability impairment and cardiac dysfunction induced by Akh gene knockout in muscle tissue, the mechanism of which is related to the reduction of oxidative stress and enhancement of muscle mitochondrial function by aerobic endurance exercise.\u003c/p\u003e\n\u003cp\u003eMore and more studies have confirmed that the physiological mechanism of endurance exercise to reduce obesity and its related complications is related to the improvement of the signaling pathway related to lipid metabolism. For instance, Exercise-training enhances intracellular lipid metabolism and phenotypic changes in skeletal muscle through epigenomic modifications on Serine Hydrolase Like 2, and Hypomethylation of the Serine Hydrolase Like 2 promoter influences Nr4a transcription factor binding, promoter activity, and gene expression, linking exercise-induced epigenomic regulation of Serhl2 to lipid oxidation and triacylglycerol synthesis \u003csup\u003e51\u003c/sup\u003e. Besides, Activation of calmodulin dependent protein kinase (CaMK)II by exercise is beneficial in controlling membrane lipids associated with type 2 diabetes and obesity since CaMKII activation by exercise increased the levels of arachidonic acid and 11,14-eicosadienoic acid while a decrease in the level of linolenic acid \u003csup\u003e52\u003c/sup\u003e. Moreover, exercise training upregulated the decrease in cardiac mtp expression induced by a high-fat diet. Increased Had1 and Acox3 expression were observed, consistent with changes in cardiac mtp expression \u003csup\u003e53\u003c/sup\u003e. Exercise-training during a high-fat diet feeding can down-regulate the expression of apoLpp, reduce the whole-body TG levels, improve cardiac recovery, and improve exercise capacity\u003csup\u003e54\u003c/sup\u003e. Cardiac Nmnat/NAD+/SIR2 pathway activation is an important underlying molecular mechanism by which endurance exercise and cardiac Nmnat overexpression give protection against lipotoxic cardiomyopathy in Drosophila \u003csup\u003e55\u003c/sup\u003e. Therefore, endurance exercise can positively regulate the expression of adipose tissue, skeletal muscle and myocardial related genes in obese individuals, and improve obesity and obesity-related complications.\u003c/p\u003e\n\u003cp\u003eAdditionally, more\u0026nbsp;and more studies have reported that endurance exercise can improve oxidative stress and mitochondrial function in obese individuals. For instance, the increased oxidative stress is usually observed in obese population, but the control of body weight by calorie restriction and/or exercise training can ameliorate oxidative stress, 4-week exercise intervention coupled with dietary restriction is benefit for the loss of body weight and the mitigation of oxidative stress by enhancing the activity of SOD and GPx in obese \u003csup\u003e56\u003c/sup\u003e. Resistance exercise can positively regulate cardiac oxidative stress parameters and TNF-\u0026alpha; content in diet-related obese mice\u003csup\u003e57\u003c/sup\u003e. Moderate intensity exercise is an effective approach to promote changes in body composition, physical fitness and to reduce oxidative damage in older women with and without sarcopenic obesity. Moreover, exercise may stimulate mitochondrial biogenesis and promote mitochondrial fusion/fission in the skeletal muscle of obese individual\u003csup\u003e58\u003c/sup\u003e. Obesity is associated with impairment of mitochondrial function (e.g., decrease in O2 respiration and increase in oxidative stress) in skeletal muscle\u003csup\u003e59\u003c/sup\u003e. Exercise training attenuates mitochondrial dysfunction, allows mitochondria to maintain the balance between mitochondrial dynamics and mitophagy, and reduces apoptotic signaling in obese skeletal muscle \u003csup\u003e60\u003c/sup\u003e. Exercise training enhances muscle mitochondrial metabolism in diet-resistant obesity \u003csup\u003e61\u003c/sup\u003e. Exercise training alleviates obesity-induced skeletal muscle remodeling and skeletal muscle mitochondria-mediated apoptosis \u003csup\u003e62\u003c/sup\u003e.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eOur present findings demonstrated for the first time that endurance exercise could act as the upstream regulator of Akh gene in adipose tissue and muscle tissue, improve obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene via activating Akh/Bmm/Mdy pathway, Akh/srl pathway, and Akh/SOD/MDA pathway.( Fig.7)\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003cstrong\u003ecknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Core Facility of Drosophila Resource and Technology, Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences,for providing fly stocks and reagengts.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eResearch idea and study design: Y.L., X.F.M.; data acquisition: D.t.W. Y.L., X.F.M.; data analysis/interpretation: X.F.M., J.Y.S.; statistical analysis: H.Y.L.; supervision: Z.Q.G. Each author contributed during manuscript drafting or revision and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAdditional Information\u0026nbsp;\u003c/strong\u003e\u003cbr\u003e\u0026nbsp;Competing Interests: Authors have no conflicts of interest.\u003cbr\u003e\u0026nbsp;Funding: This work is supported by the CollegeYouth Innovation Team Program of Shandong Province (No. 2023RW057) and the National Natural Science Foundation of China (No. 32000832); Ludong University graduate innovation project (No. 810201 and No.IPGS 2024-032 )\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAssociated Data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData Availability Statement\u003c/p\u003e\n\u003cp\u003eAll the generated data and the analysis developed in this study are included in this article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePlaza-Diaz J, Izquierdo D, Torres-Martos \u0026Aacute; et al. Impact of Physical Activity and Exercise on the Epigenome in Skeletal Muscle and Effects on Systemic Metabolism. Biomedicines. 2022 Jan 7;10(1):126. \u003c/li\u003e\n\u003cli\u003ePowell-Wiley TM, Poirier P, et al. Obesity and Cardiovascular Disease: A Scientific Statement From the American Heart Association. Circulation. 2021 May 25;143(21):e984-e1010. \u003c/li\u003e\n\u003cli\u003eNicze M, Dec A, Bor\u0026oacute;wka M et al. Molecular Mechanisms behind Obesity and Their Potential Exploitation in Current and Future Therapy. Int J Mol Sci. 2024 Jul 27;25(15):8202.\u003c/li\u003e\n\u003cli\u003eKovac L, Goj T, Ouni M et al. Skeletal Muscle Gene Expression Signatures of Obese High and Low Responders to Endurance Exercise Training. J Clin Endocrinol Metab. 2024 Apr 19;109(5):1318-1327. \u003c/li\u003e\n\u003cli\u003eAndriessen C, Fealy CE, Veelen A, et al. Three weeks of time-restricted eating improves glucose homeostasis in adults with type 2 diabetes but does not improve insulin sensitivity: a randomised crossover trial. Diabetologia. 2022 Oct;65(10):1710-1720.\u003c/li\u003e\n\u003cli\u003eMartino MR, Habibi M, Ferguson D et al.. Disruption of hepatic mitochondrial pyruvate and amino acid metabolism impairs gluconeogenesis and endurance exercise capacity in mice. Am J Physiol Endocrinol Metab. 2024 Apr 1;326(4):E515-E527. \u003c/li\u003e\n\u003cli\u003eHughson BN. The Glucagon-Like Adipokinetic Hormone in Drosophila melanogaster - Biosynthesis and Secretion. Front Physiol. 2021 Dec 23;12:710652. \u003c/li\u003e\n\u003cli\u003eNeumann J, Hofmann B, Dhein S, Gergs U. Glucagon and Its Receptors in the Mammalian Heart. Int J Mol Sci. 2023 Aug 15;24(16):12829. \u003c/li\u003e\n\u003cli\u003ede Brito Sanchez G, Exp\u0026oacute;sito Mu\u0026ntilde;oz A, Chen L, Huang W, Su S, Giurfa M. Adipokinetic hormone (AKH), energy budget and their effect on feeding and gustatory processes of foraging honey bees. Sci Rep. 2021 Sep 15;11(1):18311. \u003c/li\u003e\n\u003cli\u003eKnuth CM, Auger C, Jeschke MG. Burn-induced hypermetabolism and skeletal muscle dysfunction. Am J Physiol Cell Physiol. 2021 Jul 1;321(1):C58-C71. \u003c/li\u003e\n\u003cli\u003eMeschi E, Duquenoy L, Otto N, Dempsey G, Waddell S. Compensatory enhancement of input maintains aversive dopaminergic reinforcement in hungry Drosophila. Neuron. 2024 Jul 17;112(14):2315-2332.e8.\u003c/li\u003e\n\u003cli\u003eYin XY, Wen DT, Li HY, Gao ZQ, Gao Y, Hao W. Endurance exercise attenuates G\u0026alpha;q-RNAi induced hereditary obesity and skeletal muscle dysfunction via improving skeletal muscle Srl/MRCC-I pathway in Drosophila. Sci Rep. 2024 Nov 15;14(1):28207.\u003c/li\u003e\n\u003cli\u003eKawai T, Autieri MV, Scalia R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am J Physiol Cell Physiol. 2021 Mar 1;320(3):C375-C391. \u003c/li\u003e\n\u003cli\u003eMalita A, Kubrak O, Koyama T, Ahrentl\u0026oslash;v N, Texada MJ, Nagy S, Halberg KV, Rewitz K. A gut-derived hormone suppresses sugar appetite and regulates food choice in Drosophila. Nat Metab. 2022 Nov;4(11):1532-1550. \u003c/li\u003e\n\u003cli\u003eYi J, Zhou Q, Huang J, Niu S, Ji G, Zheng T. Lipid metabolism disorder promotes the development of intervertebral disc degeneration. Biomed Pharmacother. 2023 Oct;166:115401.\u003c/li\u003e\n\u003cli\u003eLafuse WP, Wozniak DJ, Rajaram MVS. Role of Cardiac Macrophages on Cardiac Inflammation, Fibrosis and Tissue Repair. Cells. 2020 Dec 31;10(1):51.\u003c/li\u003e\n\u003cli\u003eHughson BN, Shimell M, O\u0026apos;Connor MB. AKH Signaling in D. melanogaster Alters Larval Development in a Nutrient-Dependent Manner That Influences Adult Metabolism. Front Physiol. 2021 Feb 23;12:619219. \u003c/li\u003e\n\u003cli\u003eBraco JT, Nelson JM, Saunders CJ, Johnson EC. Modulation of Metabolic Hormone Signaling via a Circadian Hormone and Biogenic Amine in Drosophila melanogaster. Int J Mol Sci. 2022 Apr 12;23(8):4266.\u003c/li\u003e\n\u003cli\u003eXiao Z, Kong B, Fang J, Qin T, Dai C, Shuai W, Huang H. Ferrostatin-1 alleviates lipopolysaccharide-induced cardiac dysfunction. Bioengineered. 2021 Dec;12(2):9367-9376. \u003c/li\u003e\n\u003cli\u003eLi J, Dang P, Li Z, Zhao T, Cheng D, Pan D, Yuan Y, Song W. Peroxisomal ERK mediates Akh/glucagon action and glycemic control. Cell Rep. 2023 Oct 31;42(10):113200.\u003c/li\u003e\n\u003cli\u003eAhmad M, He L, Perrimon N. Regulation of insulin and adipokinetic hormone/glucagon production in flies. Wiley Interdiscip Rev Dev Biol. 2020 Mar;9(2):e360.\u003c/li\u003e\n\u003cli\u003eWan GJ, Jiang SL, Zhang M, Zhao JY, Zhang YC, Pan WD, Sword GA, Chen FJ. Geomagnetic field absence reduces adult body weight of a migratory insect by disrupting feeding behavior and appetite regulation. Insect Sci. 2021 Feb;28(1):251-260. \u003c/li\u003e\n\u003cli\u003eG\u0026auml;de G, Marco HG. The Adipokinetic Peptides of Hemiptera: Structure, Function, and Evolutionary Trends. Front Insect Sci. 2022 Jun 15;2:891615. \u003c/li\u003e\n\u003cli\u003eKo S, Yeom E, Chun YL, Mun H, Howard-McGuire M, Millison NT, Jung J, Lee KP, Lee C, Lee KS, Delaney JR, Yoon JH. Profiling of RNA-binding Proteins Interacting With Glucagon and Adipokinetic Hormone mRNAs. J Lipid Atheroscler. 2022 Jan;11(1):55-72. \u003c/li\u003e\n\u003cli\u003eLiao S, Amcoff M, N\u0026auml;ssel DR. Impact of high-fat diet on lifespan, metabolism, fecundity and behavioral senescence in Drosophila. Insect Biochem Mol Biol. 2021 Jun;133:103495. \u003c/li\u003e\n\u003cli\u003eBeckham JL, van Venrooy AR, Kim S, Li G, Li B, Duret G, Arnold D, Zhao X, Li JT, Santos AL, Chaudhry G, Liu D, Robinson JT, Tour JM. Molecular machines stimulate intercellular calcium waves and cause muscle contraction. Nat Nanotechnol. 2023 Sep;18(9):1051-1059. \u003c/li\u003e\n\u003cli\u003eCinel SD, Hahn DA, Kawahara AY. Predator-induced stress responses in insects: A review. J Insect Physiol. 2020 Apr;122:104039. \u003c/li\u003e\n\u003cli\u003eHu Q, V\u0026eacute;lez-Avil\u0026eacute;s AN, Wolfner MF. Drosophila Plc21C is involved in calcium wave propagation during egg activation. MicroPubl Biol. 2020 Apr 1;2020:10.17912/micropub.biology.000235. \u003c/li\u003e\n\u003cli\u003eHe H, Boehringer R, Huang AJY, Overton ETN, Polygalov D, Okanoya K, McHugh TJ. CA2 inhibition reduces the precision of hippocampal assembly reactivation. Neuron. 2021 Nov 17;109(22):3674-3687.e7. \u003c/li\u003e\n\u003cli\u003eAhmad M, Wu S, Luo S, Shi W, Guo X, Cao Y, Perrimon N, He L. Dietary amino acids promote glucagon-like hormone release to generate global calcium waves in adipose tissues in Drosophila. Nat Commun. 2025 Jan 2;16(1):247. \u003c/li\u003e\n\u003cli\u003eNazario-Yepiz NO, Fern\u0026aacute;ndez Sobaberas J, Lyman R, Campbell MR 3rd, Shankar V, Anholt RRH, Mackay TFC. Physiological and metabolomic consequences of reduced expression of the Drosophila brummer triglyceride Lipase. PLoS One. 2021 Sep 21;16(9):e0255198. \u003c/li\u003e\n\u003cli\u003eChao CF, Pesch YY, Yu H, Wang C, Aristizabal MJ, Huan T, Tanentzapf G, Rideout E. An important role for triglyceride in regulating spermatogenesis. Elife. 2024 May 28;12:RP87523. \u003c/li\u003e\n\u003cli\u003eShang L, Aughey E, Kim H, Heden TD, Wang L, Najt CP, Esch N, Brunko S, Abrahante JE, Macchietto M, Mashek MT, Fairbanks T, Promislow DEL, Neufeld TP, Mashek DG. Systemic lipolysis promotes physiological fitness in Drosophila melanogaster. Aging (Albany NY). 2022 Aug 30;14(16):6481-6506. \u003c/li\u003e\n\u003cli\u003eDiop SB, Bisharat-Kernizan J, Birse RT, Oldham S, Ocorr K, Bodmer R. PGC-1/Spargel Counteracts High-Fat-Diet-Induced Obesity and Cardiac Lipotoxicity Downstream of TOR and Brummer ATGL Lipase. Cell Rep. 2015 Mar 10;10(9):1572-1584. \u003c/li\u003e\n\u003cli\u003eBen-Menahem D. GnRH-Related Neurohormones in the Fruit Fly Drosophila melanogaster. Int J Mol Sci. 2021 May 10;22(9):5035. \u003c/li\u003e\n\u003cli\u003eBuszczak M, Lu X, Segraves WA, Chang TY, Cooley L. Mutations in the midway gene disrupt a Drosophila acyl coenzyme A: diacylglycerol acyltransferase. Genetics. 2002 Apr;160(4):1511-8. \u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez BA, Hoyle RG, Yeudall S, Granade ME, Harris TE, Castle JD, Leitinger N, Bland ML. Innate immune signaling in Drosophila shifts anabolic lipid metabolism from triglyceride storage to phospholipid synthesis to support immune function. PLoS Genet. 2020 Nov 23;16(11):e1009192. \u003c/li\u003e\n\u003cli\u003eCastillo \u0026Iacute;MP, Argil\u0026eacute;s JM, Rueda R, Ram\u0026iacute;rez M, Pedrosa JML. Skeletal muscle atrophy and dysfunction in obesity and type-2 diabetes mellitus: Myocellular mechanisms involved. Rev Endocr Metab Disord. 2025 Mar 10. \u003c/li\u003e\n\u003cli\u003eWan Z, Root-McCaig J, Castellani L, Kemp BE, Steinberg GR, Wright DC. Evidence for the role of AMPK in regulating PGC-1 alpha expression and mitochondrial proteins in mouse epididymal adipose tissue. Obesity (Silver Spring). 2014 Mar;22(3):730-8. \u003c/li\u003e\n\u003cli\u003eJun L, Tao YX, Geetha T, Babu JR. Mitochondrial Adaptation in Skeletal Muscle: Impact of Obesity, Caloric Restriction, and Dietary Compounds. Curr Nutr Rep. 2024 Sep;13(3):500-515. \u003c/li\u003e\n\u003cli\u003eYin Z, Wan B, Gong G, Yin J. ROS: Executioner of regulating cell death in spinal cord injury. Front Immunol. 2024 Jan 23;15:1330678. \u003c/li\u003e\n\u003cli\u003eSantos-Araujo S, Bomfim L, Araripe LO, Bruno R, Ramos I, Gondim KC. Silencing of ATG6 and ATG8 promotes increased levels of triacylglycerol (TAG) in the fat body during prolonged starvation periods in the Chagas disease vector Rhodnius prolixus. Insect Biochem Mol Biol. 2020 Dec;127:103484.\u003c/li\u003e\n\u003cli\u003eCota-Maga\u0026ntilde;a AI, Vazquez-Moreno M, Rocha-Aguado A, \u0026Aacute;ngeles-Mej\u0026iacute;a S, Valladares-Salgado A, D\u0026iacute;az-Flores M, L\u0026oacute;pez-D\u0026iacute;azguerrero NE, Cruz M. Obesity Is Associated with Oxidative Stress Markers and Antioxidant Enzyme Activity in Mexican Children. Antioxidants (Basel). 2024 Apr 12;13(4):457. \u003c/li\u003e\n\u003cli\u003eHuang Y, Chen H, Liu Q, Hu J, Hu D, Huang Z, Xu Z, Wan R. Obesity difference on association blood malondialdehyde level and diastolic hypertension in the elderly population: a cross-sectional analysis. Eur J Med Res. 2023 Jan 24;28(1):44. \u003c/li\u003e\n\u003cli\u003eAhn C, Zhang T, Yang G, Rode T, Varshney P, Ghayur SJ, Chugh OK, Jiang H, Horowitz JF. Years of endurance exercise training remodel abdominal subcutaneous adipose tissue in adults with overweight or obesity. Nat Metab. 2024 Sep;6(9):1819-1836. \u003c/li\u003e\n\u003cli\u003eSkrypnik D, Bogdański P, Mądry E, Karolkiewicz J, Ratajczak M, Kryściak J, Pupek-Musialik D, Walkowiak J. Effects of Endurance and Endurance Strength Training on Body Composition and Physical Capacity in Women with Abdominal Obesity. Obes Facts. 2015;8(3):175-87. \u003c/li\u003e\n\u003cli\u003eResistance exercise-trained mice had a lean phenotype and counteracted diet-induced obesity and glucose tolerance, even after exercise cessation.\u003c/li\u003e\n\u003cli\u003eHansen D, Meeusen R, Mullens A, Dendale P. Effect of acute endurance and resistance exercise on endocrine hormones directly related to lipolysis and skeletal muscle protein synthesis in adult individuals with obesity. Sports Med. 2012 May 1;42(5):415-31.\u003c/li\u003e\n\u003cli\u003eDi Meo S, Iossa S, Venditti P. Improvement of obesity-linked skeletal muscle insulin resistance by strength and endurance training. J Endocrinol. 2017 Sep;234(3):R159-R181. \u003c/li\u003e\n\u003cli\u003eSkrypnik D, Bogdański P, Mądry E, Karolkiewicz J, Ratajczak M, Kryściak J, Pupek-Musialik D, Walkowiak J. Effects of Endurance and Endurance Strength Training on Body Composition and Physical Capacity in Women with Abdominal Obesity. Obes Facts. 2015;8(3):175-87. \u003c/li\u003e\n\u003cli\u003eKatayama M, Nomura K, Mudry JM, Chibalin AV, Krook A, Zierath JR. Exercise-induced methylation of the Serhl2 promoter and implication for lipid metabolism in rat skeletal muscle. Mol Metab. 2025 Feb;92:102081.\u003c/li\u003e\n\u003cli\u003eJoseph JS, Ayeleso AO, Mukwevho E. Role of exercise-induced calmodulin protein kinase (CaMK)II activation in the regulation of omega-6 fatty acids and lipid metabolism genes in rat skeletal muscle. Physiol Res. 2017 Dec 20;66(6):969-977.\u003c/li\u003e\n\u003cli\u003ePeng T, Ding M, Yan H, Li Q, Zhang P, Tian R, Zheng L. Exercise Training Upregulates Cardiac mtp Expression in Drosophila melanogaster with HFD to Improve Cardiac Dysfunction and Abnormal Lipid Metabolism. Biology (Basel). 2022 Nov 30;11(12):1745. \u003c/li\u003e\n\u003cli\u003eDing M, Zheng L, Li QF, Wang WL, Peng WD, Zhou M. Exercise-Training Regulates Apolipoprotein B in Drosophila to Improve HFD-Mediated Cardiac Function Damage and Low Exercise Capacity. Front Physiol. 2021 Jul 7;12:650959. \u003c/li\u003e\n\u003cli\u003eWen DT, Zheng L, Lu K, Hou WQ. Activation of cardiac Nmnat/NAD+/SIR2 pathways mediates endurance exercise resistance to lipotoxic cardiomyopathy in aging Drosophila. J Exp Biol. 2021 Sep 15;224(18):jeb242425.\u003c/li\u003e\n\u003cli\u003eLi C, Feng F, Xiong X, Li R, Chen N. Exercise coupled with dietary restriction reduces oxidative stress in male adolescents with obesity. J Sports Sci. 2017 Apr;35(7):663-668. \u003c/li\u003e\n\u003cli\u003eEffting PS, Brescianini SMS, Sorato HR, Fernandes BB, Fidelis GDSP, Silva PRLD, Silveira PCL, Nesi RT, Ceddia RB, Pinho RA. Resistance Exercise Modulates Oxidative Stress Parameters and TNF-\u0026alpha; Content in the Heart of Mice with Diet-Induced Obesity. Arq Bras Cardiol. 2019 May;112(5):545-552. \u003c/li\u003e\n\u003cli\u003eChen PB, Yang JS, Park Y. Adaptations of Skeletal Muscle Mitochondria to Obesity, Exercise, and Polyunsaturated Fatty Acids. Lipids. 2018 Mar;53(3):271-278.\u003c/li\u003e\n\u003cli\u003eGuti\u0026eacute;rrez-L\u0026oacute;pez L, Olivares-Corichi IM, Mart\u0026iacute;nez-Arellanes LY, Mej\u0026iacute;a-Mu\u0026ntilde;oz E, Polanco-Fierro JA, Garc\u0026iacute;a-S\u0026aacute;nchez JR. A moderate intensity exercise program improves physical function and oxidative damage in older women with and without sarcopenic obesity. Exp Gerontol. 2021 Jul 15;150:111360.\u003c/li\u003e\n\u003cli\u003eHeo JW, No MH, Park DH, Kang JH, Seo DY, Han J, Neufer PD, Kwak HB. Effects of exercise on obesity-induced mitochondrial dysfunction in skeletal muscle. Korean J Physiol Pharmacol. 2017 Nov;21(6):567-577. \u003c/li\u003e\n\u003cli\u003ePileggi CA, Blondin DP, Hooks BG, Parmar G, Alecu I, Patten DA, Cuillerier A, O\u0026apos;Dwyer C, Thrush AB, Fullerton MD, Bennett SA, Doucet \u0026Eacute;, Haman F, Cuperlovic-Culf M, McPherson R, Dent RRM, Harper ME. Exercise training enhances muscle mitochondrial metabolism in diet-resistant obesity. EBioMedicine. 2022 Sep;83:104192. \u003c/li\u003e\n\u003cli\u003eHeo JW, Yoo SZ, No MH, Park DH, Kang JH, Kim TW, Kim CJ, Seo DY, Han J, Yoon JH, Jung SJ, Kwak HB. Exercise Training Attenuates Obesity-Induced Skeletal Muscle Remodeling and Mitochondria-Mediated Apoptosis in the Skeletal Muscle. Int J Environ Res Public Health. 2018 Oct 19;15(10):2301. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Exercise, hereditary obesity, skeletal muscle, mitochondria, Akh gene","lastPublishedDoi":"10.21203/rs.3.rs-6632687/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6632687/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Adipokinetic hormone (Akh) is a key regulator of energy metabolism in Drosophila melanogaster, analogous to glucagon in mammals. Aerobic endurance exercise is considered to be an important means to prevent and reduce obesity and its related complications, but it is still unclear whether it can effectively combat obesity and obesity-related exercise impairment and heart dysfunction induced by Akh genetic knockdown. In this study, Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e/Ppl-Gal4 and Akh-\u003csup\u003eUAS-RNAi\u003c/sup\u003e/Mef2-Gal4 systems were constructed in F1 generation Drosophila through hybridization, and the Akh gene was knocked down in adipose tissue and muscle tissue. Experimental flies underwent an endurance exercise intervention lasting 3 weeks starting at 1 week of age. The results showed that the knockdown of Akh in both adipose tissue and skeletal muscle tissue significantly increased body weight, triglyceride levels, the expression of Bmm gene and Mdy gene, and MDA level, and it also significantly decreased exercise endurance, cardiac fractional shortening, SOD level, and the expression of Srl gene. Moreover, the microscopic images of oil red O staining and the ultraimages of transmission electron microscopy indicated that Akh knockdown led to the increase of lipid dropper accumulation and the destruction of mitochondrial structure. Importantly, endurance exercise effectively prevented these changes induced by Akh knockdown in adipose tissue and muscle tissue by up regulating Akh gene. Therefore, our present findings demonstrated for the first time that endurance exercise could act as the upstream regulator of Akh gene in adipose tissue and muscle tissue, improve obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene via activating Akh/Bmm/Mdy pathway, Akh/srl pathway, and Akh/SOD/MDA pathway.\u003c/p\u003e","manuscriptTitle":"Endurance exercise prevents genetic obesity, exercise tolerance limitation, and cardiac dysfunction induced by knockdown of Akh gene in different tissues in Drosophila","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-23 11:16:43","doi":"10.21203/rs.3.rs-6632687/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5a73d675-2513-4d8a-a680-0804a1f95dda","owner":[],"postedDate":"September 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":54868015,"name":"Biological sciences/Physiology/Metabolism/Metabolic diseases/Obesity"},{"id":54868018,"name":"Biological sciences/Physiology/Metabolism/Fat metabolism"}],"tags":[],"updatedAt":"2025-11-18T22:53:23+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-23 11:16:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6632687","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6632687","identity":"rs-6632687","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0