Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats

preprint OA: gold CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

The paper studied how opsin genes evolved in 18 closely related Morpho butterfly species, using a combined approach of genomics, transcriptomics, and immunochemistry, focusing in detail on the expression and spatial distribution of opsin proteins in the eyes of Morpho helenor. It found species-specific ommatidial types, signatures of positive selection on two opsin genes, and identified key co-evolving amino acids that shape diversification of the Morpho visual system, with opsin evolution correlated to both light environment and wing coloration. A major limitation is that the work is primarily correlative at the level of selective pressures (light environment and wing coloration) rather than experimentally disentangling causal mechanisms. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Multiple selective pressures can shape the evolution of color vision in animals, by acting on the co- evolution of the opsin genes. How do adaptive processes shape the duplications of opsins, the evolution of their amino acids and the modification of their patterns of expression? At large phylogenetic scales, natural selection due to the contrasted light environments has been found to have a profound impact on the evolution of the opsin gene family. However, in closely-related species, species interactions due to sexual selection or competition may also influence opsin evolution. Here, we investigate the diversification of opsin sequences and their expression in closely-related blue Morpho butterfly species, living in different microhabitats, to shed light on the effect of biotic and abiotic selective pressures shaping the evolution of their opsin gene family. First, we combined genomics, transcriptomics and immunochemistry to precisely characterize the expression and the spatial distribution of the opsin proteins found in the eyes of Morpho helenor . We found unique ommatidial types compared to other butterfly species. We then investigated the evolution of opsin genes among 18 Morpho species, found signature of positive selection on two opsin genes, and identified key co-evolving amino-acids shaping the diversification of the Morpho visual system. We showed that such opsin evolution was correlated to both light environment and wing coloration, highlighting the joint effect of several selective pressures in the evolution of those proteins. Overall, our study underlines the peculiar evolution of visual systems in closely-related species specialized in divergent microhabitats.
Full text 97,252 characters · extracted from preprint-html · click to expand
Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats View ORCID Profile Joséphine Ledamoisel , Andrew Dang , View ORCID Profile Julien Devilliers , Tiphaine Marvillet , View ORCID Profile Sophie Lemoine , View ORCID Profile Manuela Lopez-Villavicencio , View ORCID Profile Adriana Briscoe , View ORCID Profile Vincent Debat , View ORCID Profile Violaine Llaurens doi: https://doi.org/10.1101/2025.06.13.659549 Joséphine Ledamoisel 1 Centre Interdisciplinaire de Recherche en Biologie (UMR 7241, Collège de France/CNRS/INSERM) , Paris, France 2 Institut de Systématique, Evolution et Biodiversité (ISYEB UMR 7205), Muséum National d’Histoire Naturelle , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Joséphine Ledamoisel For correspondence: josephine.ledamoisel{at}outlook.fr Andrew Dang 3 Department of Ecology and Evolutionary Biology, UC Irvine , Irvine, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Julien Devilliers 2 Institut de Systématique, Evolution et Biodiversité (ISYEB UMR 7205), Muséum National d’Histoire Naturelle , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Julien Devilliers Tiphaine Marvillet 4 GenomiqueENS, Institut de Biologie de l’ENS (IBENS), Département de biologie, École normale supérieure, CNRS, INSERM, Université PSL , 75005 Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sophie Lemoine 4 GenomiqueENS, Institut de Biologie de l’ENS (IBENS), Département de biologie, École normale supérieure, CNRS, INSERM, Université PSL , 75005 Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sophie Lemoine Manuela Lopez-Villavicencio 2 Institut de Systématique, Evolution et Biodiversité (ISYEB UMR 7205), Muséum National d’Histoire Naturelle , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Manuela Lopez-Villavicencio Adriana Briscoe 3 Department of Ecology and Evolutionary Biology, UC Irvine , Irvine, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Adriana Briscoe Vincent Debat 2 Institut de Systématique, Evolution et Biodiversité (ISYEB UMR 7205), Muséum National d’Histoire Naturelle , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Vincent Debat Violaine Llaurens 1 Centre Interdisciplinaire de Recherche en Biologie (UMR 7241, Collège de France/CNRS/INSERM) , Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Violaine Llaurens Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Multiple selective pressures can shape the evolution of color vision in animals, by acting on the co- evolution of the opsin genes. How do adaptive processes shape the duplications of opsins, the evolution of their amino acids and the modification of their patterns of expression? At large phylogenetic scales, natural selection due to the contrasted light environments has been found to have a profound impact on the evolution of the opsin gene family. However, in closely-related species, species interactions due to sexual selection or competition may also influence opsin evolution. Here, we investigate the diversification of opsin sequences and their expression in closely-related blue Morpho butterfly species, living in different microhabitats, to shed light on the effect of biotic and abiotic selective pressures shaping the evolution of their opsin gene family. First, we combined genomics, transcriptomics and immunochemistry to precisely characterize the expression and the spatial distribution of the opsin proteins found in the eyes of Morpho helenor . We found unique ommatidial types compared to other butterfly species. We then investigated the evolution of opsin genes among 18 Morpho species, found signature of positive selection on two opsin genes, and identified key co-evolving amino-acids shaping the diversification of the Morpho visual system. We showed that such opsin evolution was correlated to both light environment and wing coloration, highlighting the joint effect of several selective pressures in the evolution of those proteins. Overall, our study underlines the peculiar evolution of visual systems in closely-related species specialized in divergent microhabitats. Introduction The sensitivity to different wavelengths of light has been extensively studied in multiple species, and these studies have revealed striking diversification of color discrimination capacities throughout animals. Yet, the selective pressures generated by the light environment and the ecological interactions within and among species shaping the diversification of the opsin gene family are largely unknown in most animal species. Opsin proteins have been shown to be much more diversified in the eyes of diurnal species compared to nocturnal species in both vertebrates ( Musilova et al. 2021 ) and invertebrates ( Sondhi et al. 2021 ), suggesting a prominent impact of selective pressures brought from the light environment on their evolution. Evidence of concerted evolution, due to gene duplication, mutations and gene conversion has been reported in the opsin gene family ( Brandon et al. 2017 ). Variations in the amino-acid sequences of opsins can also directly influence the sensitivity of the opsin-chromophore complex known as a visual pigment to different light wavelengths, and the combination of opsins expressed within and among the different photoreceptor cells within the eye strongly impacts color discrimination ( Hofmann and Lamb 2023 ). In insects, the chromophore bound to the opsin protein is 11-cis-hydroxy retinal ( Smith and Goldsmith 1990 ) and the evolution of the light-absorbing properties of each visual pigment is strongly linked to the nature of amino acids located around this chromophore ( Hofmann and Lamb 2023 ). In Lepidoptera, phylogenetic reconstructions inferred an ancestral visual system with three main opsin proteins ( Briscoe 2008 ): ultraviolet-sensitive opsins ( UVRh ), blue-sensitive opsins ( BRh ), and long wavelength-sensitive opsins ( LWRh ). However, in many butterfly families, multiple events of opsin gene duplications and mutations affecting the chromophore-interacting amino-acids have been documented ( Arikawa 2003 ; Chen et al. 2016 ). The duplication of opsin genes, accompanied by shifts in their spectral sensitivity, has been shown to result in the absorbance of a wider wavelength range, as for instance in Nymphalidae ( Frentiu et al. 2007 ) or Lycaenidae ( Sison-Mangus et al. 2008 ). Variation in the combination of opsins with different amino-acid compositions in the binding pocket surrounding the chromophore, as well as their distribution in different photoreceptive cells, shape the evolution of color discrimination capacities in butterflies ( Stavenga and Arikawa 2006 ). The compound eyes of butterflies are composed of ommatidia, formed by a cluster of nine photoreceptive cells (named R1 to R9), which may contain different sets of opsin proteins. Variations in the spatial expression of the different opsins within the different cell types, as well as in the spatial distribution of ommatidial types throughout the compound eyes also strongly influence the evolution of sensitivity to light and color discrimination ( Arikawa 2003 ). The co-expression of opsins in cells has been documented in Heliconius butterflies, with LWRh and BRh co-expression participating in spectral- tuning ( McCulloch et al. 2022 ). However, the discrimination of a wider range of colors is also influenced by the evolution of filtering pigments occurring within the ommatidia ( Wakakuwa et al. 2004 ; Zaccardi et al. 2006 ). The evolution of color discrimination might therefore stem from various molecular and cellular processes: reconstructing the evolutionary steps leading to divergent visual systems thus requires investigating not only the evolution of opsins sequences, but also their levels of expression as well as their spatial distribution within and among ommatidia. Identifying the respective contribution of the different selective pressures acting on the evolution of opsin properties and spatial distribution within the eyes is challenging, because vision is involved in multiple fitness-related traits in many animals, such as foraging (Zhang 2012), mate recognition ( Smith et al. 2002 ; Gomez et al. 2010 ) and/or orientation ( Franzke et al. 2020 ). Contrasted evolution of opsins has been shown among species living in different light environments ( Horth 2007 ): for example, in aquatic environments, opsins were found to be differentially expressed between cichlids ( Ricci et al. 2023 ) and cardinalfishes ( Luehrmann et al. 2020 ) species living in different photic micro-habitats (shallow vs . deep waters). Ecological interactions can also shape the evolution of color discrimination capacities in animals. Visual cues are often used in mate choice and species recognition (in invertebrates; ( Detto 2007 ), and in vertebrates; ( Dollion et al. 2020 ), potentially promoting the selection of different visual sensitivities in different taxa. As the display of bright colorations is often associated with traits contributing to fitness ( e.g. boldness; ( Godin and Dugatkin 1996 ), low parasite load; ( Maan et al. 2006 ), body condition; (Pérez i de Lanuza et al. 2014)), sexual selection could favour the evolution of specific color sensitivity. The evolution of color discrimination could also be promoted between closely-related species sharing the same habitat, as poor species recognition could lead to substantial deleterious reproductive interference ( Gröning and Hochkirch 2008 ), although the literature still lacks empirical evidence. The rise of genomics has permitted the study of the evolution of opsin sequences at very large phylogenetic scales ( Musilova et al. 2021 ; Murphy and Westerman 2022 ; Schott et al. 2024 ), highlighting an important effect of the light environment on the macro-evolution of visual systems. However, sexual selection is more likely to influence opsin evolution at a smaller phylogenetic scale, as revealed in fishes ( Sandkam et al. 2015 ) and butterflies ( Chakraborty et al. 2023 ). Investigating the diversification of opsin gene sequences and patterns of expression in closely-related species with contrasted ecologies can thus shed light on the respective effects of biotic and abiotic selective pressures shaping the evolution of the opsin gene family. Here, we focus on the evolution of visual proteins within the neotropical butterfly genus Morpho, where sympatric species are distributed across different vertical forest strata ( Chazot et al. 2016 ; Chazot et al. 2021 ), as well as different temporal niches (Le Roy et al. 2021). Such specialisation into different spatio- temporal microhabitats is associated with a strong heterogeneity in the light environment ( Nilsson et al. 2022 ). The divergent light environment encountered by different Morpho species could thus influence the evolution of their color discrimination capacities. Furthermore, these different species strongly differ in the structural and pigmentary colors of their wings. Behavioral experiments carried out in blue Morpho species showed that iridescent blue coloration can be a cue used by males in intra or interspecific interactions, like male-male competition and female recognition (Le Roy et al. 2021; Ledamoisel et al. 2025 ). Consequently, as shades of iridescent blue vary between species, different sensitivities to blue light could have evolved within this genus. In a lycaenid species displaying a blue wing color pattern, a blue opsin duplication was indeed detected ( Sison-Mangus et al. 2006 ). Similarly, some Heliconius species displaying UV-colored pigments on their wings have accurate UV discrimination due to duplicated UVRh ( Briscoe et al. 2010 ). Visual modelling combined with behavioral experiments revealed that this additional violet receptor could facilitate the discrimination of conspecifics during mate choice ( McCulloch et al. 2017 ; Finkbeiner and Briscoe 2021 ), highlighting the effect of sexual interactions as selective agent acting on opsin evolution in butterflies. The recent sequencing of the genomes of three blue Morpho species has revealed duplications in the LWRh opsins with three gene copies, in sharp contrast with other Satyrinae butterflies ( Bastide et al. 2022 ), raising the question of the evolutionary origin of such duplications and of the selective regimes acting on the five opsin genes throughout the Morpho genus. Recent studies also investigated the different light sensitivities of the photoreceptor cells in the blue species Morpho helenor ( Belušič et al. 2021 ; Pirih et al. 2022 ), also calling for an investigation of the spatial distribution of opsins in different photoreceptors. We thus investigate the evolution of opsin gene sequences and expression in the genus Morpho , where divergent selection stemming from the light environment and from the wing coloration in closely-related species might have shaped the evolution of opsins properties. We conducted a comprehensive study of the visual system of M. helenor by characterizing all the sequences of opsin genes found in its genome, quantifying opsin mRNA expression in the eyes of males and females, and localizing the corresponding opsin proteins within the receptive cells in different ommatidia composing their retina. We then investigated the evolution of opsin genes among 18 Morpho species, by (1) testing for signature of selection against the null hypothesis of neutral evolution and (2) assessing the role of amino-acid co- evolution in shaping the diversification of their visual systems. In particular, we tested whether the ecological environment or the co-evolution with their wing coloration could have influenced the diversification of their photosensitive proteins. Our study thus aims at identifying the ecological and molecular mechanisms driving the evolution of visual systems. Results Opsin diversity, expression and localization in the eye of M. helenor The complete coding sequences of the butterfly opsins were retrieved from the previously published M. helenor genome ( Bastide et al. 2022 ) allowing recovery of the three LWRh genes (further referred as LW1Rh , LW2Rh and LW3Rh ), as well as the UVRh and BRh genes. We established contig-to- chromosome correspondence between the M. helenor genome assembly and the Maniola jurtina reference chromosomes and found that LW1Rh , LW2Rh and LW3Rh genes were located collinearly on the contig corresponding to chromosome 4 in M. jurtina . In contrast, UVRh and BRh were found on the contig corresponding to chromosome 9, separated by a distance of approximately 4 to 6 Mb (see Table S1). An Illumina analysis of the eye RNA expression confirmed that all five opsin genes ( UVRh , BRh , LW1Rh , LW2Rh and LW3Rh ) are expressed in the eye tissues of both males and females. A differential gene expression analysis did not reveal any differential expression of those opsin genes between sexes (Figure S1). However, individual ANOVAs performed on the expression levels of each opsin gene separately show that females express more LW1Rh (Kruskal-Wallis test; adjusted p-value = 0.045) and LW2Rh (Kruskal-Wallis test; adjusted p-value = 0.045) opsin genes than males (Figure S2). UVRh, BRh, and LW1Rh opsin proteins are expressed in the R1 and R2 photoreceptor cells of Morpho helenor eyes Using custom polyclonal antibodies, we then specifically characterized the localization of the UVRh , BRh and LW1Rh opsin proteins within M. helenor eyes using an immunochemistry approach. We found expression of the UVRh , BRh , and LW1Rh opsin proteins in the R1 and R2 photoreceptors of both female and male specimens of M. helenor ( Figure 1 A & B). There was no cross reaction between these three antibodies and we saw no evidence of co-localization of BRh , UVRh , or LW1Rh . Download figure Open in new tab Figure 1. Characterization of opsin protein expression in the different ommatidia of males and females M. helenor. Anti-BRh (blue), anti-LW1Rh (green), and anti-UVRh (magenta) antibody staining of (A) female and (B) male M. helenor retina. Scale bars represent 20 microns. Individual ommatidium types identified in (C) female and (D) male retina based on BRh, LW1Rh, and UVRh opsin expression. (J) Cartoon of the at least six ommatidia types based on opsin expression in the R1 and R2 photoreceptor cells of M. helenor. The proportion of cells expressing the different opsin proteins was strongly uneven: while more than half of the photoreceptor cells expressed the BRh opsins in both males and females, the proportion of photoreceptor expressing UVRh and LW1Rh was around 20% each, in both sexes (Figure S3). Although the retina of both males and females expressed a majority of BRh photoreceptors, males expressed significantly more BRh photoreceptors than females (Chi-square: p-value < 0.001 ). Based on the proteins detected in the R1 and R2 photoreceptors, we then inferred that there are at least six ommatidial types within the eye of M. helenor ( Fig. 1 C-E), and we characterized the distribution of these ommatidial types in males and females. Chi-square testing shows a significant difference between male and female ommatidium distribution (Chi-square: p-value < 0.001 ). In males, the most abundant ommatidial type is BRh - BRh , representing approximately 35% of receptors compared to approximately 25% of ommatidia in females (Figure S3). Overall, our results thus show similar ommatidial types in males and females of M. helenor , and sexual dimorphism in the proportion of these different types of ommatidia. Opsin diversification at the genus scale in Morpho butterflies In order to study the evolution of opsin genes throughout the Morpho genus, we used Morpho genome assemblies from ( Bastide et al. 2022 ) and (López Villavicencio et al. 2024) to retrieve the opsin sequences from additional Morpho species. The UVRh , BRh and LWRh genes detected in the genome of M. helenor were also found in the assembled genomes of 14 other Morpho species ( M. marcus , M. eugenia , M. granadensis , M. amathonte , M. menelaus , M. deidamia , M. achilles , M. godartii , M. telemachus , M. hecuba, M. theseus, M. niepelti, M. cypris and M. rhetenor). All 15 species contain the complete coding sequences of the five opsins, covering all 8 exons. Because the LWRh gene was found in three distinctive copies in all 15 assembled species, the two duplication events are not limited to M. helenor , but rather likely occurred before the diversification of the Morpho genus. The analysis of the transcriptome of the eyes of M. achilles, M. deidamia, M. hecuba, M. rhetenor and M. marcus males showed that all five opsin genes are expressed in the eyes of those species (Table S2). These results suggest that the five UVRh , BRh , LW1Rh , LW2Rh and LW3Rh genes could be fully functional and involved in color vision in understory species ( M. achilles, M. deidamia ), canopy species ( M. hecuba, M. rhetenor ) and phylogenetically basal species ( M. marcus ). Complementarily, we used PCR amplification to retrieve the opsin sequences of the Morpho species for which assembled genomes were not available. The PCR amplification allowed to retrieve some partial genomic LW2Rh and LW3Rh opsin sequences (6 exons) in 3 additional Morpho species ( M. aurora, M. sulkowskyi and M. cisseis ). We thus obtained opsin sequences for 18 Morpho species out of 30, including blue and non-blue species, inhabiting both the canopy and the understory ( Figure 2 ). Download figure Open in new tab Figure 2: Opsin duplications and ecological and morphological characteristics of the 18 species of the genus Morpho used in this study. The phylogenetic relationships among the studied species was retrieved from the phylogeny published in ( Chazot et al. 2021 )). The colored tiles show the retrieved UVRh , BRh , LW1Rh , LW2Rh and LW3Rh opsin genes for each Morpho species. The opsin sequences retrieved from the species marked with black stars were amplified using PCR and are thus only partial sequences. Note that the absence of some opsins in species where whole-genome sequence was not available is more likely due to a lack of amplification because of genetic divergence between species, rather than an actual absence of the genes. The male dorsal wing pattern (Wing color: filled blue symbols = blue-iridescent wings vs. open symbols = non blue-iridescent wings), and the habitat (Habitat: light- green symbols = understory species vs. dark-green symbols = canopy species) is provided for each studied species. The phylogenetic reconstruction of the partial LWRh genes of Morpho butterflies ( Figure 3 ) showed that the LW3Rh gene is the most divergent gene compared to the other two LW1Rh and LW2Rh genes. Download figure Open in new tab Figure 3: Maximum likelihood gene tree for the partial 6 exon sequences of LWRh Morpho opsins and amino acid substitutions associated with putative spectral sensitivity shifts. The gene tree was inferred using IQtree under a TIM2e+I+G4 evolutionary model estimated with the ModelFinder option using nucleotide LWRh sequences. Bootstrap values for each node are represented in the tree. The long wavelength opsins of Bicyclus anynana (GenBank number: AY918895.2 , ( Frentiu et al. 2007 )) and Danaus plexippus (GenBank number: AY605545.1 , ( Sauman et al. 2005 )) were used as outgroups. LW3Rh genes are shown in dark-red, LW2Rh genes in orange and LW1Rh genes in yellow. We used colored dots to designate amino acid substitutions found on the LWRh sequences of Morpho associated with a spectral shift in other butterfly species (respective AA from ( Frentiu et al. 2007 ) are numbered on Limenitis archippus archippus and AA from ( Saito et al. 2019 ) are numbered on bovine rhodopsin. The homologous Morpho numbering can be found in Table S3).] The phylogeny of the LW3Rh gene follows the phylogenetic species tree of the Morpho genus. However, the extensive length of the branch of the LW3Rh opsin of M. eugenia and M. marcus might stem from a particular selective regime acting on the visual sensitivities in these two species. The history of the LW1Rh and LW2Rh duplications reveals a slightly more complex pattern. For instance, the LW1Rh and LW2Rh genes of M. eugenia and M. marcus have a contrasted history as compared to the other species and do not branch with their respective LW1Rh and LW2Rh clade formed by the rest of the Morpho species. This pattern suggests that the 6 exons used to reconstruct this tree may undergo a different regime of selection in M. marcus and M. eugenia than on the other branches. Note that when reconstructing the phylogenetic tree of the LWRh opsins using only complete sequences (with less individuals but covering 8 exons), LW1Rh and LW2Rh genes from M. marcus and M. eugenia both branch at the base of their respective monophyletic clade (Figure S4), further suggesting that different regime of selection might only affect some specific exons. Variations at spectral tuning sites: evidence of putative spectral sensitivity shifts in BRh and LWRh opsin genes in the Morpho genus Because the amino acid sequence of a photoreceptive protein determines its capacity to absorb specific wavelengths, we checked whether variations of amino acids associated with tuning sites known in other butterflies could be observed in Morpho species. Amino acid numberings are taken from the original sources ( Frentiu et al. 2007 ; Wakakuwa et al. 2010; Frentiu et al. 2015 ; Saito et al. 2019 ; Liénard et al. 2021 ) but the equivalent Morpho numbering is given in Table S3. BRh opsin tuning sites Compared to previous observations made on other butterflies, Morpho BRh opsin sequences are composed of amino acids associated with visual blue sensitivity shifts such as S116, F177 (Wakakuwa et al. 2010; Frentiu et al. 2015 ; Liénard et al. 2021 ) and R216 ( Frentiu et al. 2015 ). A F177Y substitution is observed in two blue Morpho living in the canopy ( M. rhetenor and M. cypris ) and two blue Morpho living in the understory ( M. amathonte and M. godartii ) only, suggesting that the absorption of the BRh protein of those species might be slightly red-shifted compared to the other Morpho species. However, the amino acid sequences of M. rhetenor and M. cypris are also composed of A301 ( Frentiu et al. 2015 ), an amino acid associated with subtle blue sensitivity shifts, suggesting that some amino acid shifts are unique to blue canopy species (see Figure S5 and Figure S6). Functional validation is still needed to understand the combined effect of substitutions associated with putatively opposite effects. LWRh opsins tuning sites The amino acid changes involved in spectral shifts detected among Morpho LWRh opsins are shown in Figure 3 . The amino acid changes N70S and S137A are both correlated with a blue spectral shift of the L-opsin absorption in nymphalid butterflies ( Frentiu et al. 2007 ). In Morpho , the S137A amino acid change occurred in the LW1Rh and LW2Rh lineages but not in the LW3Rh opsin, suggesting the LW1Rh and LW2Rh opsin proteins might be sensitive to shorter wavelengths than the LW3Rh protein. Interestingly, a A137S reversion was found in the LW1Rh opsin of the non-blue canopy species M. hecuba, which could thus have a LW1Rh protein with a closer sensitivity to the LW3Rh protein compared to the other Morpho species. Amongst the amino acid changes linked with a spectral shift of the protein, some can also cause red absorption shifts. For instance, the A116G amino acid change shifts the maximum of absorbance of opsins toward red wavelengths ( Saito et al. 2019 ). In Morpho , the corresponding amino acid change occurs in the LW3Rh opsin protein for five species only, including 2 blue canopy species ( M. rhetenor and M. cypris ) and 3 blue understory species ( M. marcus , M. eugenia and M. sulkowskyi , see Figure 3 , Figure S7). The blue-shifting amino acid mutations in the LW1Rh and LW2Rh protein sequences and red-shifting amino acid mutations in the LW3Rh opsin sequences strongly suggest that the duplicated Morpho LWRh opsins might be sensitive to different long wavelengths, consistent with the evolution of divergent visual systems in the Morpho genus. Evidence of positive selection on the BRh and LW3Rh Morpho opsin genes We then studied the ratio between non-synonymous and synonymous substitutions in the coding sequence of the different Morpho opsins ( dN/dS = ω ) to characterize the selection regime acting on the evolution of the five opsin sequences. No signal of pervasive positive selection was found on the 5 Morpho opsin genes using random site models implemented in PAML (Table S4). However, we found significant evidence of episodic positive selection on the BRh opsin gene ( ωBRh = 4.890, p-value = 0.002) and the LW3Rh opsin gene ( ωBRh = 2.89, p-value < 0.0001) using BUSTED at a gene-wide scale (Table S5). A FUBAR analysis was run on those two genes to identify specific positively selected amino acid sites (Table S6). The sites 113, 189, 224, 232, 246, 310 and 363 (site numbering relative to Morpho opsins) were found to be under positive selection in the BRh opsin gene, and the sites 88, 133, 136, 179, 183, 205, 224, 229, 236, 305 and 318 showed signatures of positive selection in the LW3Rh gene. While none of these sites corresponds to known tuning sites in other butterfly species, they are either located near those sites or in the vicinity of the chromophore (see Figure 4 ). Download figure Open in new tab Figure 4: Positive selection on the BRh (A) and LW3Rh (B) opsin proteins in Morpho . The amino acids detected by the FUBAR analysis are represented in stick figures, and colored depending on their probability of being under positive selection (posterior probabilities): from 65 to 80% (green), from 80 to 95% (orange) and from 95% to 100% (red). The approximated chromophore location is pictured in purple. To investigate the potential change in evolutionary rates among the three LWRh opsin duplications, we performed branch-site models to test for positive selection on different LWRh tree branches (see Methods). All branch-site models testing for positive selection on the LWRh tree came out non- significant. We also tested for positive selection in the branch leading to the M. rhetenor / M. cypris pair (the only two blue iridescent Morpho species living in the canopy) vs. the rest of the tree in the BRh gene and found no signal of positive selection on these branches (Table S7). Testing for ecological factors influencing the evolution of Morpho opsins We looked for shifts in selective regimes acting on the sequences of the five Morpho opsin genes depending on the species ecologies, using the CmC PAML model. We specifically annotated the BRh , UVRh , and LWRh opsin trees depending on their wing phenotype and habitat ( Figure 5 , statistical analyses in Table S8). Download figure Open in new tab Figure 5: Variation of Morpho opsin dN/dS depending on wing coloration (A), habitat (B) and Light environment (C). The dN/dS of blue species are marked in blue, in white for non-blue species, in dark-green in canopy species, in light-green in understory (Fg = foreground, Bg = background). The number of analyzed genes are shown below each opsin type. First, we found a significant effect of wing coloration on the evolution of the LW2Rh and LW3Rh genes, with the species exhibiting blue wings having a higher ω than the non-blue species ( LW2Rh : ωLW3Rh_Blue = 0.61 vs. ωLW3Rh_Non-blue = 0.00 and LW3Rh : ωLW3Rh_Blue = 0.91 vs . ωLW3Rh_Non-blue = 0.03). Second, the CmC analysis based on the habitat distribution of Morpho suggests that UVRh and LW3Rh opsins show different evolutionary rates between understory and canopy species, with canopy species having a higher ω UVRh than understory species ( ωUVRh_canopy = 0.55 vs . ωUVRh_understory = 0.31), while the trend is reversed for the LW3Rh gene ( ωLW3Rh_canopy = 0.22 vs . ωLW3Rh_understory = 0.77). Finally, when performing a clade model on the global phylogeny of the LWRh genes, comprising the data for LW1Rh , LW2Rh and LW3Rh , both the wing color partition and the habitat partition were significant, with blue species having a higher ω than the non-blue species ( ωLWRh_Blue = 0.23 vs. ωLWRh_Non-blue = 0.14), and understory species having a higher ω than the canopy species ( ωLWRh_canopy = 0.09 vs. ωLWRh_understory = 0.24). Evidence of correlated amino acid evolution between LWRh opsin genes Finally, we used the Evo-Scope pipeline ( Godfroid et al. 2024 ) to determine whether the evolution of some amino acids in Morpho opsins could influence the evolution of other amino acids within the same protein or impact the evolution of the sequence of other opsin proteins. The Evoscope analysis showed signals of correlated evolution between amino acids both (1) within the same opsin protein and (2) among different LWRh proteins ( Figure 6 , statistical analysis in Table S9). Download figure Open in new tab Figure 6: Correlated amino-acid evolution within and between the three LWRh opsins observed throughout the genus Morpho . The sequence of the LW1Rh protein is colored in yellow, the sequence of the LW2Rh is colored in orange and the LW3Rh protein is colored in dark-red. The tuning sites and the positively selected sites are located on each protein using blue and red arrows respectively. The amino acid correlations detected by Evo-scope are represented by arcs coloured depending on the p- value for each test, using arrows to represent the direction of the induction and displaying the amino acid numbering involved in the correlated evolution. The hotspot zone identified in the LW3Rh protein is highlighted in the box. Within the LW3Rh opsin protein, several amino acids exhibiting a significant signal of correlated evolution were located in areas characterized by a high density of tuning sites and sites under positive selection (between sites 131 and 145), suggesting a hot-spot of adaptive evolution in this region of the protein. In particular, site 134, located near two sites under positive selection (133 and 136) and two tuning sites (137 and 140), has been identified as being linked to the evolution of site 138. The Evoscope results also highlighted that the evolution of the amino acids at site 134 can also induce the evolution of amino acids at site 224, a site located near the chromophore of the protein, and showing signs of positive selection. Interestingly, signals of correlated evolution were also found between amino acids belonging to different LWRh proteins: the evolution of two sites located in the LW1Rh protein and 3 sites in the LW2Rh protein was linked to the evolution of sites sitting in the LW3Rh protein. Among these sites of the LW3Rh proteins potentially influenced by the evolution of the other two LWRh opsins, two sites (site 135 and site 140) were located in the previously identified hotspot zone (between sites 131 and 145). We separately analyzed the correlated evolution of the amino acids found within the BRh opsin protein (Figure S8) and the UVRh opsin protein (Figure S9) respectively. We found only two pairs of amino acids evolving under correlated evolution in the UVRh protein. In the BRh protein, some pairs of amino acids are located next to known tuning sites for this protein, but we found no hotspot zone similar to the one found in the LW3Rh protein. Discussion Duplications and patterns of expression of opsins form a peculiar visual system in M. helenor The RNA expression analyses performed on M. helenor eye tissue confirmed that all 5 opsin genes, including the three different LWRh copies, are expressed in the eyes of M. helenor butterflies from both sexes. Our immunohistochemical assays then showed that UVRh and BRh opsins are expressed in R1 and R2 photoreceptive cells, consistent with previous observations in other butterfly visual systems ( e.g. Vanessa cardui , ( Briscoe et al. 2003 ); Heliconius , ( McCulloch et al. 2017 ); Danaus plexippus , ( Sauman et al. 2005 ); Pieris rapae , ( Arikawa et al. 2005 )). Surprisingly, LW1Rh expression in M. helenor was restricted to the R1-R2 receptive cells, and we did not detect any co-expression of BRh , UVRh or LW1Rh in any cell type. This LWRh pattern of expression is uncommon among various butterfly families as long-wavelength sensitive opsin genes are usually expressed in R3 to R8 cells ( Briscoe 2008 ). However, these results are consistent with previous polarization sensitivity measurements performed on the eyes of M. helenor ( Pirih et al. 2022 ), showing that R1 and R2 cells are strongly sensitive to UV and Blue light, and also sensitive to Green or Green/Yellow light, which could be absorbed by LW1Rh opsins. Although we were not able to characterize the pattern of expression of the LW2Rh and LW3Rh proteins in the eyes of Morpho , we assume these are likely to be expressed in cells R3 to R8 because these cells are also sensitive the Green and Yellow light according to the polarisation sensitivity reported in ( Pirih et al. 2022 ). We thus described 6 different ommatidial types in M . helenor ( Figure 1 ), but unknown LW2Rh or LW3Rh expression patterns may increase the number of possible ommatidia types in M. helenor . This peculiar expression pattern of opsins is also associated with a sexually dimorphic expression pattern of some opsins in M. helenor . In particular, higher RNA LW1Rh expression was found in the eyes of females, supported by a higher LW1Rh photoreceptor count at the protein level. Furthermore, a high number of BRh photoreceptors was found in males M. helenor eyes, associated with a high frequency of BRh - BRh ommatidia types in males compared to females (see Figure S3). Such sexual dimorphism in opsin protein expression has been reported in several taxa, and can take many forms: sexual dimorphism can encompass variation in opsin co-expression in different eye photoreceptor cells (Sison- Mangus et al. 2006), the lack of opsin expression in a photoreceptor cell of one sex compared to the other ( McCulloch et al. 2017 ), and variations in the number of photoreceptor cells ( Hilbrant et al. 2014 ). Sexual dimorphism could arise from different selective pressures affecting the evolution of the visual systems of males and females. For instance, the behaviors of Morpho males and females strongly differ: in the wild, males display a typical patrolling behavior and show a striking response to blue stimuli (Le Roy et al. 2021). On the other hand, females tend to fly in dense forest areas and to spend time locating and flying around host-plants. Those different ecological conditions encountered by males and females might generate divergent selection on visual systems. Long-distance detection of blue color might be advantageous in males searching for females and might promote increased sensitivity to blue wavelengths. Although M. helenor males do not have duplicated BRh opsin genes as other blue sensitive butterflies (Lycaenids, ( Sison-Mangus et al. 2006 ); Pieridae, ( Arikawa et al. 2005 ; Awata et al. 2009 ; Wakakuwa et al. 2010)), their retina is composed of a higher proportion of BRh - BRh photoreceptors than other blue butterflies ( Sison-Mangus et al. 2006 ). In contrast, discrimination in the green wavelength might be promoted in females, because of the significance of host-plant detection in this sex, as suggested in other butterflies with sexually-dimorphic visual sensitivities ( Finkbeiner and Briscoe 2021 ). The novelty of the M. helenor eye organization compared to other butterflies and the number of expressed opsin genes in its visual system shows a divergent evolution of opsin gene expression in Morpho butterflies as compared to other Nymphalidae, that may result in the evolution of color discrimination capacities. Light environment and wing iridescence strongly influence the evolution of the genes involved in the visual system of Morpho The five opsin genes described in M. helenor were also found in the genome of 14 additional Morpho species. RNA expression data confirmed that those five genes are expressed in the eyes of all tested species, suggesting that this specific visual system organization might likely be ancestral to the diversification of Morpho . While neutral evolution contributes to the divergence of opsin genes among species, the divergent selection generated by the different biotic and abiotic conditions encountered in the different micro-habitats occupied by the different species could also impact the evolution of the opsin sequences across the genus. Models testing for episodic positive selection on the 5 opsin genes revealed significant signals of positive selection mostly on the sequences of BRh and LW3Rh genes. Since several positively selected sites detected in our study are located close to previously-documented tuning sites and/or close to the chromophore, our results are consistent with an effect of selection on the diversification of visual sensitivities in those genes. First, the analysis of the amino acid sequence of the BRh gene in Morpho showed that four species exhibit amino acid changes involving known tuning sites. In particular, M. rhetenor and M. cypris , the only two blue Morpho species living in the canopy in this dataset, display amino acid substitutions at two different tuning sites, that could putatively cause shifts in visual perception. This result suggests that M. rhetenor and M. cypris could have a different visual perception than the rest of the Morpho genus. However, no significant signal of selection specific to this lineage was found, suggesting that this difference might be due to phylogenetic divergence only. Overall, we found that the evolutionary rate of the BRh opsin was not significantly different between canopy and understory species, and surprisingly did not find a correlation between the evolution of the BRh opsin sequences and the presence or absence of blue iridescent coloration on the wings of Morpho butterflies. In the context of mate choice or male- male competition, we would expect that blue visual perception would be different between blue and non-blue species. Interestingly, while spectral sensitivity data suggest that the blue absorbing cells of M. helenor might be sensitive to approximately 450 nm ( Pirih et al. 2022 ), iridescence quantification showed that the peak of reflectance of M. helenor wings can vary from 350 nm to 500 nm (UV/purple to green) depending on the angle of illumination ( Ledamoisel et al. 2025 ), suggesting that different color signals generated by the wings might be processed by other opsin genes during mate searching. In line with this hypothesis, we found that LWRh genes are very diversified among Morpho . Our results show that some amino acid substitutions found on those proteins could be associated with different spectral shifts affecting the three LWRh gene copies: indeed, LW1Rh and LW2Rh tend to bear blue- shifting amino acids as compared to LW3Rh . Although functional validation is needed, the LW3Rh protein could thus be responsible for the absorption peak found in Morpho at 570 nm in ( Pirih et al. 2022 ), while the LW1Rh and LW2Rh proteins could be associated with the absorbance peaks found at 505nm and 551nm ( Pirih et al. 2022 ). Long-wavelength sensitive opsin diversification has been reported in a number of taxa (fishes: ( Watson et al. 2011 ); Hemiptera: ( Xu et al. 2021 ); Coleoptera: (Sharkey et al. 2021); Anurans: ( Schott et al. 2022 )) including butterflies ( Papilio xuthus , ( Briscoe 2008 )), and is often associated with change in light habitats and/or niche differentiation ( Carleton et al. 2020 ). In Morpho , we found that the dN/dS of the LW2Rh and LW3Rh opsins of the blue iridescent species is significantly higher than the dN/dS of the LW2Rh and LW3Rh genes of the non-blue iridescent species, consistent with higher rate of adaptive evolution of LWRh genes in blue iridescent species. Such evolution might have been promoted by selection favouring detection and discrimination of the blue- green iridescent signals displayed by the wings of blue Morpho species. Interestingly, we also found that the evolutionary rate of the LW3Rh gene is significantly higher in the Morpho species living in the understory compared to those living in the canopy. The understory habitat is dominated by vegetation: as the discrimination of subtle long-wavelength color variation might be advantageous in a forest environment in terms of foraging and oviposition ( Kelber 1999 ), this habitat is likely an important driver of green/red color discrimination in Morpho . The understory is also a darker environment than the canopy: in particular, the amount of UV-light is significantly reduced in the understory in tropical forests compared to the canopy ( Brown et al. 1994 ; Nilsson et al. 2022 ). The higher evolutionary rate of the UVRh opsin in the canopy as compared to understory species suggests that heterogeneous light availability might have influenced the evolution of this specific opsin gene in those habitats. The co-occurrence of mutations between sites located on different opsin proteins suggests a joint evolution of LWRh genes Because wavelength discrimination by the visual systems depends on the shape of sensitivity peaks and on the distance among them, controlled by the respective sensitivities of each opsin protein, its evolution might involve integrated changes across the different opsin genes. To assess this coevolution, we specifically tested for correlated shifts in amino acids both within and among opsins. Within the LW3Rh protein, five pairs of amino acid sites displayed a significant signal of correlated evolution, meaning that a change of amino acid at site A was found to coincide with a change of amino acid at site B more often than expected by chance given the Morpho phylogeny. Because purifying selection tends to promote mutations that would stabilize the structure or the function of a protein, coupled amino acid evolution within a protein is expected: amino acid substitutions at a site could compensate for deleterious substitutions at other sites of the protein ( Pál et al. 2006 ). However, amino acid changes could also be driven by adaptation. Considering the direct link between amino acid sequence and wavelength sensitivity ( Hofmann and Lamb 2023 ), this seems particularly plausible in opsin proteins. Amino acid variations in the LW3Rh revealed correlated evolution between 2 pairs of sites located very close (1 or 2 sites away) to either known tuning sites in butterflies, or positively selected sites detected by our previous analysis. Among those, site 134 was found to induce amino acid changes at the positively selected site 224, highlighting the intertwined evolution of key-sites in specific areas of the protein. Moreover, we also found co-occurring mutations between amino acid sites belonging to different LWRh proteins, suggesting concerted evolution among those three genes. Specifically, we show that mutations found on specific amino acid sites in LW1Rh co-evolved with mutations found on LW3Rh amino acid sites close to tuning sites, in what looks like a hotspot of adaptive evolution. Correlated mutations between proteins have been extensively observed between proteins part of a network and physically interacting with one another ( Pazos et al. 1997 ), but correlations in the evolution of genes sharing functional relationships are much less documented. Yet, visual perception can be seen as the result of the integration of visual signals absorbed by different opsin proteins, potentially creating an indirect link between the evolution of those genes, whether in the form of shared regulatory mechanisms or similar evolutionary forces. For example, following an opsin duplication, the gain of function of the new protein could impact the selection regime of the other to maintain fine-tuned spectral sensitivity. It is the case in Lycaenidae where coordinated shifts of amino acids have been found in the BRh and LWRh opsins, enhancing their visual perception ( Liénard et al. 2021 ). Although our approach is only correlative and functional validation is needed, it underlines the importance of studying the molecular co-evolution of opsins, because of the extensive evolutionary tinkering involved in the diversification of visual system Conclusions Altogether, our results evidence the peculiar evolution of visual systems in closely-related species evolving in divergent microhabitats and illustrate how the evolution of the different opsins protein properties and patterns of expression may be shaped by the specific selective pressures generated by different micro-habitats or contrasted sexual selection. By jointly studying the correlated evolution of different genes as well as their spatial pattern of expression, our study highlights the multiple pathways enabling the evolution of visual discrimination capacities finely-tuned by selective processes. Materials and Methods Characterisation of opsins expression and spatial localisation in Morpho helenor Testing RNA differential expression between males and females M. helenor We used the previously assembled genome of M. helenor ( Bastide et al. 2022 ) to retrieve the sequence of the 5 opsin genes ( BRh , UVRh , LW1Rh , LW2Rh and LW3Rh ) found in this Morpho species. In order to test whether opsin genes were expressed in Morpho helenor tissues, the eye transcriptome of five males and five females M. helenor theodorus were sequenced. The specimens were purchased from a breeding farm located in Ecuador (Quinta De Goulaine, https://quintadegoulaine.com/es/papillons.php ) and raised in insectaries at STRI in Gamboa, Panama, between January and March 2023. The Qiagen RNAeasy Mini Kit was used to extract the RNA of each sample following the manufacturer’s instructions. Library preparation and Illumina sequencing were performed at the Ecole normale supérieure GenomiqueENS core facility (Paris, France). Messenger (polyA+) RNAs were purified from 250 ng of total RNA using oligo(dT). Libraries were performed using the strand specific RNA-Seq library preparation Stranded mRNA Prep, Ligation kit (Illumina) and were multiplexed by 39 on a P3 flowcell (Illumina). A 118 bp single end read sequencing was performed on a NextSeq 2000 device (Illumina). The analyses were performed using the Eoulsan pipeline ( Jourdren et al. 2012 ), including read filtering, mapping, and alignment filtering. Before mapping, poly N read tails were trimmed, reads ≤40 bases were removed, and reads with quality mean ≤30 were discarded. Reads were then aligned against the Morpho helenor genome using STAR version 2.7.8a ( Dobin et al. 2013 ). Alignments from reads matching more than once on the reference genome were removed using Java version of samtools (Li et al. 2009). To compute gene expression, the Morpho helenor genome annotation was used. All overlapping regions between alignments and referenced exons were counted and aggregated by genes using FeatureCounts v2.0.6 ( Liao et al. 2014 ). The sample counts were normalized using DESeq2 1.42.1 ( Love et al. 2014 ). Statistical treatments and differential analyses were also performed using DESeq2 1.42.1, using an adjusted p-value threshold set at 0.05. The number of opsin reads was extracted and their relative expression was analyzed separately from the rest of the transcriptome, and Kruskall-Wallis tests were used to test for the effect of sex in the number of expressed opsin reads. To account for the multiple testing on the 5 opsin genes, we use a Bonferroni test to compute adjusted p-values. Spatial distribution of opsin protein within Morpho helenor eyes revealed by immunohistochemistry We used an immunohistochemistry approach to locate the opsin proteins within the eyes of M. helenor . First, we used the translated amino acid sequences of M. helenor UVRh, BRh , LW1Rh , LW2Rh, and LW3Rh opsins to identify antigenic, accessible, and unique peptides as candidate targets for polyclonal antibody production. An antibody against the peptide GIVKQVFAHEAALRE in the loop domain between helix 5 and 6 of UVRh was generated in guinea pigs, an antibody against the peptide GWNIPEEHQDLVHE in the N-terminus domain of BRh was generated in goat, an antibody against a peptide GSDTGPGISC in the N-terminus domain of LW1Rh was generated in rabbit (Biosynth International, Gardner, MA, USA). Then, we purchased M. helenor pupae from Costa Rica Entomological Supply to test these specific antibodies on fresh eyes. Upon delivery, pupae were hung in greenhouse enclosures where they were housed post-eclosure and until processing. Butterflies freely flew in the enclosures and fed on moistened orange slices. Five male and five females were processed for immunohistochemistry. Methods were adapted from previous studies ( Hsiao et al. 2012 ; Perry et al. 2016 ; McCulloch et al. 2017 ; Chakraborty et al. 2023 ). Butterflies were euthanized by quickly crushing the thorax and beheading them. In 1x PBS, the heads were bisected and excess tissue was removed under a dissecting scope. The eyes were fixed in 4% paraformaldehyde for 30 minutes in a cold room (approximately 15 °C) with rotation. Fixed eyes then underwent step-wise sucrose baths (10, 20, then 30% sucrose in 1x PBS) for two hours for each step in a 15°C cold room with rotation. The corneal lenses of the eyes were carefully removed under a dissecting scope, and each eye was then embedded in gelatin-albumin blocks. Blocks were then fixed in 4% formalin (in 1x PBS) for 15 hours at 4 °C. Embedded tissue gelatin- albumin blocks were sliced with a Precisionary Compresstome VF-310-0Z to 60 micron slices. Slices were blocked in a blocking solution of 5% (v/v) normal donkey serum and 0.3% triton-X in 1x PBS (0.3% PBST) for one hour at room temperature. The slices were incubated overnight at 4 °C with primary antibodies (1:200 goat anti-Blue, 1:100 guinea pig anti-UVRh, and 1:100 rabbit anti-LW1 in blocking solution). Afterwards, the slides underwent five washes with 0.3% PBST for 15 minutes per wash at room temperature. The slides were then incubated overnight in darkness at 4 °C with secondary antibodies (1:250 donkey anti-goat AlexaFluor 488, 1:250 donkey anti-guinea pig AlexaFluor 647, and 1:250 donkey anti-rabbit Cy3 in blocking solution). Again, they were washed five times with 0.3% PBST for 15 minutes per wash and mounted in 70% glycerol. Images were taken using a Zeiss LSM 900 Airyscan 2 confocal microscope under a 20x/0.8NA dry objective in the UC Irvine Optical Core Facility and exported using ZenBlue 3.5. Investigating the evolution of opsin sequences throughout the Morpho genus Retrieving the opsin sequences from 15 Morpho reference genomes The visual opsin sequences of 8 Morpho species observed in the understory habitat ( M. helenor , M. marcus , M. eugenia , M. granadensis , M. amathonte , M. menelaus , M. deidamia , M. achilles) and 3 Morpho species found in the canopy habitat ( M. telemachus , M. hecuba, and M. rhetenor) were retrieved from the annotations of the Morpho genome assemblies published in ( Bastide et al. 2022 ) and (López Villavicencio et al. 2024). Four additional genomes including 1 understory species ( M. godartii ) and 3 canopy species ( M. theseus , M. niepelti and M. cypris ) were specifically obtained for this study and their sequencing, assembly and annotation were performed following the same pipeline as described in (López Villavicencio et al. 2024). Among the 30 Morpho species described in the literature ( Chazot et al. 2021 ), we thus had access to the genomic data of 15 Morpho species scattered across the phylogeny. Overall, one UVRh , one BRh and three LWRh (referred to as LW1Rh , LW2Rh and LW3Rh hereafter) opsin genes were identified within each of these 15 genomes. To compare opsin gene positions across all Morpho species with available chromosome level assemblies, we scaffolded Morpho contigs against the Maniola jurtina chromosome-level assembly (ilManJurt1.1) using RagTag ( Alonge et al. 2022 ). All scaffolds were renamed to match the chromosome nomenclature of M. jurtina . Sequencing of eye transcriptome of six Morpho species To check for opsin RNA expression in different Morpho species scattered across the phylogeny of the genus, the eyes of freshly caught males belonging to 5 sympatric species from French Guiana ( M. achilles , M. deidamia , M. hecuba , M. rhetenor and M. marcus ), were dissected and stored in RNAlater at -80°C before extraction. RNA was extracted using the Qiagen RNeasy Mini Kit according to the manufacturer’s instructions and stored at −80 °C until use. The transcriptome of each sample was sequenced using Nanopore technology. Library preparation and Nanopore sequencing were performed at the Ecole normale supérieure GenomiqueENS core facility (Paris, France). 10 ng of total RNA were amplified and converted to cDNA using a modified version of the protocol described in ( Guilcher et al. 2021 ). Briefly, the ligation and rRNA depletion steps were skipped and the oligo GCAGGGGAAATCATCAGCGTATAACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN was used for the first strand cDNA synthesis. The oligos TTTCTGTTGGTGCTGATATTGCAAGCAGTGGTATCAACGCAGAGTAC and ACTTGCCTGTCGCTCTATCTTCGCAGGGGAAATCATCAGCGTATAAC were used for the amplification of the full-length cDNAs. Afterwards an average of 15 fmol of amplified cDNA was used for the library preparation. After the PCR adapter ligation, a 0,6X Agencourt Ampure XP beads clean- up was optimised and 2 fmol of the purified product was taken into PCR for amplification and barcodes addition with a 17 minutes elongation at each 18 cycles (barcodes from SQK-PCB111, ONT). Samples were pooled in equimolar quantities to obtain 25 fmol of cDNA and the rapid adapter ligation step was performed. Libraries were multiplexed by 9 on one flowcell FLO-PRO002 according to the manufacturer’s protocol. Sequencing was performed with the SQK-PCB111 72-hour sequencing protocol run on the PromethION P2 solo, using the MinKNOW software (versions 5.9.12). A mean of 11 ± 2,8 million passing ONT quality filter reads was obtained for each of the samples. Base-calling from read event data was performed by dorado-0.7.1 sup. Structural annotation was performed following a custom protocol published in protocols.io (DOI: dx.doi.org/10.17504/protocols.io.36wgqd5qyvk5/v1). The extracted reads were assembled on the respective Morpho reference genomes from ( Bastide et al. 2022 ) and (López Villavicencio et al. 2024) and the RNA counts were extracted using FeatureCounts v2.0.6 ( Liao et al. 2014 ). As we collected data for only one individual per species, this analysis was used to assess the presence of expressed opsin genes in the eyes of Morpho but not their absence, using TPM counts. Amplification of additional opsin sequences throughout the Morpho genus In order to retrieve the opsin sequences of the 15 Morpho species for which assembled genomes are not available, the coding sequences of the UVRh , BRh and LWRh opsins from M. helenor and M. telemachus were used to design specific PCR primers (see Table S10) targeting these three genes with Primer3 ( Untergasser et al. 2012 ). PCRs were performed on these 15 Morpho species, using DNA samples from collection specimens stored in the National Museum of Natural History in Paris, France. The DNA of those Morpho was extracted using the Qiagen extraction DNeasy Blood Tissue Kits. Each PCR reaction was run using 20µL of solution containing 11.25µL of water, 4µL of Buffer 5X for Taq LongAmp, 1.25µL of dNTPs (6.6mM), 1µL of BSA (5mg/mL), 0.625µL of DMSO, 0.475µL of primers (10pM), 0.375µL of Taq LongAmp (ThermiFischer) and 3µL DNA. The thermal cycling conditions for the amplification started with a 30s denaturation at 94°C, followed by a gradual decrease of the hybridization temperature during 18 PCR cycles, from 61°C to 52°C, and a 10 min elongation step at 65°C (touch-down method). For the following 50 cycles, the hybridization temperature was fixed to 52°C. The PCR products were sequenced using the short-read Illumina technology. The Geneious Prime program (2022.1.1 version) was then used to reconstruct the whole opsin sequences. Adding to the 15 Morpho species already studied from Morpho genomes, this method allowed to retrieve partial LWRh opsin sequences for 2 other understory species ( M. aurora , M. sulkowskyi ) and 1 canopy species ( M. cisseis ). Sequence alignment and tree reconstruction The coding opsin sequences (exons only) of each opsin, retrieved from 18 Morpho species, were aligned using the MUSCLE algorithm ( Edgar 2004 ) implemented in MEGA X ( Tamura et al. 2021 ). As our UVRh and BRh opsin sequence dataset is composed of complete sequences only, the phylogenetic tree of the UVRh and BRh opsins were generated using the alignment of those complete genes (8 exons) across 15 Morpho species. However, because the LW1Rh , LW2Rh and LW3Rh opsins sequence dataset contains both complete ( i.e. whole-genome based) and partial opsin ( i.e. PCR based) sequences, we generated the associated LWRh phylogenetic tree using an alignment of the 6 exons sequences in all species studied ( n = 18). Independent phylogenetic trees were also generated for the LW1Rh , LW2Rh and LW3Rh genes respectively, allowing for separate analyses within each LWRh copy. IQtree ( Nguyen et al. 2015 ) was used to generate the phylogenies, and the ModelFinder option ( Kalyaanamoorthy et al. 2017 ) was used to select the best respective evolutionary models for each tree. Nodes’ robustness was estimated using Ultrafast Bootstrap ( Hoang et al. 2018 ) on 10000 iterations. Detection of amino-acids changes acting on spectral sensitivity To identify amino acid changes associated with changes in spectral sensitivity in other butterfly species, we used data from the literature ( Frentiu et al. 2007 ; Wakakuwa et al. 2010; Frentiu et al. 2015 ; Saito et al. 2019 ; Liénard et al. 2021 ) to locate so-called tuning sites within the BRh and LWRh opsin sequences of the Morpho butterflies studied here. We used the MUSCLE algorithm ( Edgar 2004 ) implemented in MEGA X ( Tamura et al. 2021 ) to align the Morpho opsin sequences to the opsin sequences of other butterfly species to find the tuning-sites in Morpho . This method allows identifying whether the amino acids variations observed among Morpho species detected in our positive selection analyses are likely to modify the sensitivity to different wavelengths. Detection of signature of selection acting on the evolution of opsin sequences To characterize the selection regime acting on the evolution of opsin sequences and assess departure from neutral evolution, we studied the ratio between the non-synonymous ( dN ) and synonymous ( dS ) mutations in the coding sequences of the different opsins ⍵ =dN/dS . A gene with a higher non- synonymous substitution rate compared to its synonymous substitution rate (⍵>1) is said to be under positive selection. The codeml program from the software package PAML 4.9j (Yang and others 1997) was used to test for gene-wide pervasive selection acting on the evolution of visual opsins. To investigate whether selection is acting on specific codons in every branch of the opsin gene trees, we performed model comparisons using several optional models proposed by PAML (Site Models M0, M1a, M2a, M7, M8). First, to ensure the selective pressure varies among the codons of opsin genes, the M0 model was compared to the M1a model. Then, the M2a and M8 models were used to assess positive selection on each opsin gene, by comparing their prediction to their respective null models M1a and M7. A Bayes Empirical Bayes (BEB) analysis was used to identify the positively selected amino acids among the genes under positive selection. As PAML’s Site Model is not suited to detect gene-wide selection occurring only in a few subsets of branches and sites, we also used the BUSTED program ( Murrell et al. 2015 ) from the software HYPHY v2.5.65 (Kosakovsky Pond et al. 2020) to test for episodic selection on Morpho opsin genes. This method uses a mixed effects model allowing ⍵ to vary across sites and branches, and detects signature of selection happening on at least one branch. For genes showing significant results, we applied the FUBAR program ( Murrell et al. 2013 ) to identify specific amino acids evolving under positive selection across lineages. The gene trees used for PAML’s site model, BUSTED and FUBAR are available in Figure S10. Additionally, PAML’s branch-site models were also computed to estimate the selective pressures acting at specific codon sites within different lineages of the LWRh gene phylogeny. In order to test whether the duplicated LWRh opsin genes follow distinct regimes of selection, the branches of the gene phylogeny were partitioned into three clades comprising the branches leading to (1) the LW1Rh genes, (2) the LW2Rh genes and (3) the LW3Rh genes, excluding M. marcus and M. eugenia branches. We generated three distinct branch-site models to test whether the ⍵ of those clades were different from the ⍵ of the branches of the rest of the phylogeny. As M. eugenia and M. marcus , the most basal species of the phylogeny, seem to follow a peculiar evolution, the branches leading to (1) the LW1Rh genes, (2) the LW2Rh genes and (3) the LW3Rh genes of those two species were also used as “foreground” branches and to generate three additional branch-site models (see Figure S11 for branch annotations). Furthermore, we also used PAML’s branch site model to test for positive selection in specific branches of the BRh gene, especially to look for any specific pattern of selection in the pair M. rhetenor / M. cypris vs. the rest of the phylogeny. To assess positive selection, the results of the branch-site models were compared to their respective null models, which assume the same ⍵ among all branches. Finally, in order to test the effects of ecological factors on the evolution of opsin sequences, while accounting for phylogenetic relationships between species, we used a clade model (PAML’s Cmc Model: M2a_rell (null) vs. Model C) to analyze putative differential evolution of the opsin genes between species sharing a blue iridescent phenotype and others (Blue vs. Non-Blue), species living in the canopy or the understory (Canopy vs. Understory). Detection of correlated amino acid evolution We used the Evo-Scope pipeline described in ( Godfroid et al. 2024 ) to determine whether the evolution of some amino acids in a given opsin protein could (i) influence the evolution of other amino acids within the same protein or (ii) impact the evolution of the sequence of other opsin proteins. The Evo- Scope pipeline was designed to study correlated evolution of biological discrete traits by accounting for the phylogenetic structure of the data. After a step of ancestral character reconstruction, a first tool ( epics , ( Behdenna et al. 2016 ) is used to identify pairs of co-occuring mutations on each branch of the tree. Second, after selecting the pairs of traits showing a significant signal of correlated evolution, the epocs method ( Behdenna et al. 2022 ) determines which trait influences the evolution of the other under different scenarios among each pair. In order to apply this method to our data, we considered each amino acid of the 3 partial LWRh opsin proteins (6 exons) as discrete traits to analyze the co-occurence of amino acid shifts found across the phylogeny. We applied this method only for the species for which we had the opsin data for the 3 LWRh genes ( n = 15). As the gene trees of the 3 LWRh opsins are similar but not identical, we first performed Shimodaira-Hasegawa tests implemented in IQ-tree ( Nguyen et al. 2015 ) to evaluate whether the likelihood difference between each gene’s own topology and alternative trees was statistically different (Table S11). As the LW3Rh gene tree showed the highest compatibility with the LW1Rh , LW2Rh and LW3Rh alignments, we used this phylogeny to study the correlated evolution of the amino acids found in the LW1Rh , LW2Rh and LW3Rh opsin genes. After identifying amino acid pairs showing signals of correlated evolution, we compared whether some of those amino acid sites were associated with known tuning sites or positively selected sites, to understand the global impact selection can have on the evolution of LWRh opsin proteins. As BRh and UVRh genes are more divergent compared to the LWRh genes, we did not measure the correlated evolution of the amino acids of those three proteins. However, we computed the correlated evolution of the amino acids among BRh and UVRh opsins respectively. Structural representation of opsin proteins To locate the positively selected amino acid sites and the sites associated with a signal of correlated evolution within the protein and specifically their proximity to the chromophore, we predicted the 3D structure of the different opsins of M. helenor using the online platform CollabFold v 1.5.2 ( Mirdita et al. 2022 ). The platform combines the Alphafold2 algorithm ( Jumper et al. 2021 ) for protein structure prediction, and the model MMseq2 to generate the sequence alignments. The protein structures were edited in PyMOL (The PyMOL Molecular Graphic System, Version 2.6 Schrödinger, LLC) to highlight the amino acids previously detected as under positive selection. The putative chromophore location was inferred from the chromophore location determined in the jumping spider rhodopsin ( Varma et al. 2019 ). Complementarily, we used Protter ( Omasits et al. 2014 ) to generate a 2D representation of each gene and annotated it with the relevant amino acid sites detected in this study. Data availability All sequences used for the analyses will be available on GenBank upon publication. Acknowledgements The authors would like to thank Guillaume Achaz for the advice provided on the use of the EvoScope pipeline. We are also grateful to Owen McMillan from the Smithsonian Tropical Research Institute (Panama) for providing facilities to raise M. helenor theodorus . We thank Etienne Delannoy from the POPS facility (IPS2) for conducting with GenomiqueENS the adaptation of the ONT RNA-seq protocol. All the bioinformatic analyses were performed on the Plateforme de Calcul Intensif et Algorithmique PCIA (Muséum national d’histoire naturelle, Centre national de la recherche scientifique), the MeSU platform at Sorbonne-Université and the Genotoul bioinformatics platform Toulouse Occitanie (Bioinfo Genotoul, https://doi.org/10.15454/1.5572369328961167E12 ). We exported the eyes of M. helenor theodorus from Panama using exportation permit number PA-01-ARB-028-2023, and declared to the French authorities the exportation of butterfly eyes from French Guiana to the French metropole. J.L PhD was funded by an IBEES grant from Sorbonne Université. The GenomiqueENS core facility was supported by the France Génomique national infrastructure, funded as part of the "Investissements d’Avenir" program managed by the Agence Nationale de la Recherche (contract ANR-10-INBS-0009). This study was funded by the European Union (ERC-2022-COG - OUTOFTHEBLUE - 101088089) and by the Human Frontier Science Program grant (RGP005/2023, https://doi.org/10.52044/HFSP.RGP0052023.pc.gr.168591 ). Views and opinions expressed are however those of the authors only and do not necessarily reflect those of the European Union or the European Research Council. Neither the European Union nor the granting authority can be held responsible for them. Funder Information Declared European Union (ERC-2022-COG - OUTOFTHEBLUE - 101088089) Human Frontier Science Program References 1. ↵ Alonge M , Lebeigle L , Kirsche M , Jenike K , Ou S , Aganezov S , Wang X , Lippman ZB , Schatz MC , Soyk S . 2022 . Automated assembly scaffolding using RagTag elevates a new tomato system for high-throughput genome editing . Genome Biol 23 : 258 . OpenUrl CrossRef PubMed 2. ↵ Arikawa K . 2003 . Spectral organization of the eye of a butterfly, Papilio . J Comp Physiol A 189 : 791 – 800 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Arikawa K , Wakakuwa M , Qiu X , Kurasawa M , Stavenga DG . 2005 . Sexual Dimorphism of Short- Wavelength Photoreceptors in the Small White Butterfly, Pieris rapae crucivora . J. Neurosci . 25 : 5935 – 5942 . OpenUrl Abstract / FREE Full Text 4. ↵ Awata H , Wakakuwa M , Arikawa K . 2009 . Evolution of color vision in pierid butterflies: blue opsin duplication, ommatidial heterogeneity and eye regionalization in Colias erate . J Comp Physiol A 195 : 401 – 408 . OpenUrl CrossRef PubMed Web of Science 5. ↵ Bastide H , López-Villavicencio M , Ogereau D , Lledo J , Dutrillaux A-M , Debat V , Llaurens V . 2022 . Genome assembly of 3 Amazonian Morpho butterfly species reveals Z-chromosome rearrangements between closely related species living in sympatry . GigaScience 12 :giad033. 6. ↵ Behdenna A , Godfroid M , Petot P , Pothier J , Lambert A , Achaz G . 2022 . A Minimal yet Flexible Likelihood Framework to Assess Correlated Evolution . Systematic Biology 71 : 823 – 838 . OpenUrl CrossRef PubMed 7. ↵ Behdenna A , Pothier J , Abby SS , Lambert A , Achaz G . 2016 . Testing for Independence between Evolutionary Processes . Systematic Biology 65 : 812 – 823 . OpenUrl CrossRef PubMed 8. ↵ Belušič G , Ilić M , Meglič A , Pirih P . 2021 . Red-green opponency in the long visual fibre photoreceptors of brushfoot butterflies (Nymphalidae) . Proceedings of the Royal Society B: Biological Sciences 288 : 20211560 . OpenUrl CrossRef PubMed 9. ↵ Brandon CS , Greenwold MJ , Dudycha JL . 2017 . Ancient and Recent Duplications Support Functional Diversity of Daphnia Opsins . J Mol Evol 84 : 12 – 28 . OpenUrl CrossRef PubMed 10. ↵ Briscoe AD . 2008 . Reconstructing the ancestral butterfly eye: focus on the opsins . Journal of Experimental Biology 211 : 1805 – 1813 . OpenUrl Abstract / FREE Full Text 11. ↵ Briscoe AD , Bernard GD , Szeto AS , Nagy LM , White RH . 2003 . Not all butterfly eyes are created equal: Rhodopsin absorption spectra, molecular identification, and localization of ultraviolet-, blue-, and green-sensitive rhodopsin-encoding mRNAs in the retina of Vanessa cardui . Journal of Comparative Neurology 458 : 334 – 349 . OpenUrl CrossRef PubMed Web of Science 12. ↵ Briscoe AD , Bybee SM , Bernard GD , Yuan F , Sison-Mangus MP , Reed RD , Warren AD , Llorente- Bousquets J , Chiao C-C . 2010 . Positive selection of a duplicated UV-sensitive visual pigment coincides with wing pigment evolution in Heliconius butterflies . Proceedings of the National Academy of Sciences 107 : 3628 – 3633 . OpenUrl Abstract / FREE Full Text 13. ↵ Brown MJ , Parker GG , Posner NE . 1994 . A Survey of Ultraviolet-B Radiation in Forests . Journal of Ecology 82 : 843 – 854 . OpenUrl CrossRef Web of Science 14. ↵ Carleton KL , Escobar-Camacho D , Stieb SM , Cortesi F , Marshall NJ . 2020 . Seeing the rainbow: mechanisms underlying spectral sensitivity in teleost fishes . Journal of Experimental Biology 223 :jeb193334. 15. ↵ Chakraborty M , Lara AG , Dang A , McCulloch KJ , Rainbow D , Carter D , Ngo LT , Solares E , Said I , Corbett-Detig RB , et al. 2023 . Sex-linked gene traffic underlies the acquisition of sexually dimorphic UV color vision in Heliconius butterflies . Proceedings of the National Academy of Sciences 120 : e2301411120 . OpenUrl CrossRef PubMed 16. ↵ Chazot N , Blandin P , Debat V , Elias M , Condamine FL . 2021 . Punctuational ecological changes rather than global factors drive species diversification and the evolution of wing phenotypes in Morpho butterflies . J of Evolutionary Biology 34 : 1592 – 1607 . OpenUrl CrossRef 17. ↵ Chazot N , Panara S , Zilbermann N , Blandin P , Le Poul Y , Cornette R , Elias M , Debat V. 2016 . Morpho morphometrics: shared ancestry and selection drive the evolution of wing size and shape in Morpho butterflies . Evolution 70 : 181 – 194 . OpenUrl CrossRef PubMed 18. ↵ Chen P-J , Awata H , Matsushita A , Yang E-C , Arikawa K. 2016 . Extreme Spectral Richness in the Eye of the Common Bluebottle Butterfly, Graphium sarpedon . Front. Ecol. Evol. [Internet] 4. Available from: https://www.frontiersin.org/journals/ecology-and-evolution/articles/10.3389/fevo.2016.00018/full 19. ↵ Detto T . 2007 . The fiddler crab Uca mjoebergi uses colour vision in mate choice . Proceedings of the Royal Society B: Biological Sciences 274 : 2785 – 2790 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Dobin A , Davis CA , Schlesinger F , Drenkow J , Zaleski C , Jha S , Batut P , Chaisson M , Gingeras TR . 2013 . STAR: ultrafast universal RNA-seq aligner . Bioinformatics 29 : 15 – 21 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Dollion AY , Herrel A , Marquis O , Leroux-Coyau M , Meylan S . 2020 . The colour of success: does female mate choice rely on male colour change in the chameleon Furcifer pardalis? Journal of Experimental Biology 223 :jeb224550. 22. ↵ Edgar RC . 2004 . MUSCLE: multiple sequence alignment with high accuracy and high throughput . Nucleic Acids Research 32 : 1792 – 1797 . OpenUrl CrossRef PubMed Web of Science 23. ↵ Finkbeiner SD , Briscoe AD . 2021 . True UV color vision in a female butterfly with two UV opsins . Journal of Experimental Biology 224 :jeb242802. 24. ↵ Franzke M , Kraus C , Dreyer D , Pfeiffer K , Beetz MJ , Stöckl AL , Foster JJ, Warrant EJ, el Jundi B. 2020 . Spatial orientation based on multiple visual cues in non-migratory monarch butterflies . Journal of Experimental Biology 223 :jeb223800. 25. ↵ Frentiu FD , Bernard GD , Sison-Mangus MP , Van Zandt Brower A , Briscoe AD. 2007 . Gene Duplication Is an Evolutionary Mechanism for Expanding Spectral Diversity in the Long- Wavelength Photopigments of Butterflies . Molecular Biology and Evolution 24 : 2016 – 2028 . OpenUrl CrossRef PubMed Web of Science 26. ↵ Frentiu FD , Yuan F , Savage WK , Bernard GD , Mullen SP , Briscoe AD . 2015 . Opsin Clines in Butterflies Suggest Novel Roles for Insect Photopigments . Molecular Biology and Evolution 32 : 368 – 379 . OpenUrl CrossRef PubMed 27. ↵ Godfroid M , Coluzzi C , Lambert A , Glaser P , Rocha EPC , Achaz G . 2024 . Evo-Scope: Fully automated assessment of correlated evolution on phylogenetic trees . Methods in Ecology and Evolution 15 : 282 – 289 . OpenUrl CrossRef 28. ↵ Godin JG , Dugatkin LA . 1996 . Female mating preference for bold males in the guppy, Poecilia reticulata . Proceedings of the National Academy of Sciences 93 : 10262 – 10267 . OpenUrl Abstract / FREE Full Text 29. ↵ Gomez D , Richardson C , Lengagne T , Derex M , Plenet S , Joly P , Léna J-P , Théry M . 2010 . Support for a role of colour vision in mate choice in the nocturnal European treefrog (Hyla arborea) . Behaviour 147 : 1753 – 1768 . OpenUrl CrossRef 30. ↵ Gröning J , Hochkirch A . 2008 . Reproductive Interference Between Animal Species . The Quarterly Review of Biology 83 : 257 – 282 . OpenUrl CrossRef PubMed Web of Science 31. ↵ Guilcher M , Liehrmann A , Seyman C , Blein T , Rigaill G , Castandet B , Delannoy E . 2021 . Full Length Transcriptome Highlights the Coordination of Plastid Transcript Processing . International Journal of Molecular Sciences 22 : 11297 . OpenUrl CrossRef PubMed 32. ↵ Hilbrant M , Almudi I , Leite DJ , Kuncheria L , Posnien N , Nunes MD , McGregor AP . 2014 . Sexual dimorphism and natural variation within and among species in the Drosophilaretinal mosaic . BMC Evol Biol 14 : 240 . OpenUrl CrossRef PubMed 33. ↵ Hoang DT , Chernomor O , Von Haeseler A , Minh BQ , Vinh LS. 2018 . UFBoot2: improving the ultrafast bootstrap approximation . Molecular biology and evolution 35 : 518 – 522 . OpenUrl CrossRef PubMed 34. ↵ Hofmann KP , Lamb TD . 2023 . Rhodopsin, light-sensor of vision . Progress in Retinal and Eye Research 93 : 101116 . OpenUrl CrossRef PubMed 35. ↵ Horth L . 2007 . Sensory genes and mate choice: Evidence that duplications, mutations, and adaptive evolution alter variation in mating cue genes and their receptors . Genomics 90 : 159 – 175 . OpenUrl CrossRef PubMed Web of Science 36. ↵ Hsiao H-Y , Johnston RJ , Jukam D , Vasiliauskas D , Desplan C , Rister J . 2012 . Dissection and Immunohistochemistry of Larval, Pupal and Adult Drosophila Retinas . J Vis Exp : 4347 . 37. ↵ Jourdren L , Bernard M , Dillies M-A , Le Crom S. 2012 . Eoulsan: a cloud computing-based framework facilitating high throughput sequencing analyses . Bioinformatics 28 : 1542 – 1543 . OpenUrl CrossRef PubMed Web of Science 38. ↵ Jumper J , Evans R , Pritzel A , Green T , Figurnov M , Ronneberger O , Tunyasuvunakool K , Bates R , Žídek A, Potapenko A, et al. 2021 . Highly accurate protein structure prediction with AlphaFold . Nature 596 : 583 – 589 . OpenUrl CrossRef PubMed 39. ↵ Kalyaanamoorthy S , Minh BQ , Wong TK , Von Haeseler A , Jermiin LS. 2017 . ModelFinder: fast model selection for accurate phylogenetic estimates . Nature methods 14 : 587 – 589 . OpenUrl CrossRef PubMed 40. ↵ Kelber A . 1999 . Ovipositing butterflies use a red receptor to see green . Journal of Experimental Biology 202 : 2619 – 2630 . OpenUrl Abstract 41. Kosakovsky Pond SL , Poon AFY , Velazquez R , Weaver S , Hepler NL , Murrell B , Shank SD , Magalis BR , Bouvier D , Nekrutenko A , et al. 2020 . HyPhy 2.5—A Customizable Platform for Evolutionary Hypothesis Testing Using Phylogenies . Molecular Biology and Evolution 37 : 295 – 299 . OpenUrl CrossRef PubMed 42. Le Roy C, Roux C, Authier E, Parrinello H, Bastide H, Debat V, Llaurens V. 2021 . Convergent morphology and divergent phenology promote the coexistence of Morpho butterfly species . Nature communications 12 : 7248 . OpenUrl CrossRef PubMed 43. ↵ Ledamoisel J , Buatois B , Mauxion R , Andraud C , McClure M , Debat V , Llaurens V . 2025 . Sending mixed signals: convergent iridescence and divergent chemical signals in sympatric sister- species of Amazonian butterflies . eLife [Internet ] 14 . Available from: https://elifesciences.org/reviewed-preprints/106098 44. Li H , Handsaker B , Wysoker A , Fennell T , Ruan J , Homer N , Marth G , Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment/Map format and SAMtools . Bioinformatics 25:2078–2079. 45. ↵ Liao Y , Smyth GK , Shi W . 2014 . featureCounts: an efficient general purpose program for assigning sequence reads to genomic features . Bioinformatics 30 : 923 – 930 . OpenUrl CrossRef PubMed Web of Science 46. ↵ Liénard MA , Bernard GD , Allen A , Lassance J-M , Song S , Childers RR , Yu N , Ye D , Stephenson A , Valencia-Montoya WA , et al. 2021 . The evolution of red color vision is linked to coordinated rhodopsin tuning in lycaenid butterflies . Proceedings of the National Academy of Sciences 118 : e2008986118 . OpenUrl Abstract / FREE Full Text 47. López Villavicencio M , Ledamoisel J , Poloni R , Lopez-Roques C , Debat V , Llaurens V . 2024 . Increased Evolutionary Rate in the Z chromosome of Sympatric and Allopatric Species of Morpho Butterflies . Genome Biology and Evolution 16 :evae227. 48. ↵ Love MI , Huber W , Anders S . 2014 . Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biology 15 : 550 . OpenUrl CrossRef PubMed 49. ↵ Luehrmann M , Cortesi F , Cheney KL , de Busserolles F , Marshall NJ. 2020 . Microhabitat partitioning correlates with opsin gene expression in coral reef cardinalfishes (Apogonidae) . Functional Ecology 34 : 1041 – 1052 . OpenUrl CrossRef 50. ↵ Maan ME , van der Spoel M , Jimenez PQ , van Alphen JJM , Seehausen O. 2006 . Fitness correlates of male coloration in a Lake Victoria cichlid fish . Behavioral Ecology 17 : 691 – 699 . OpenUrl CrossRef Web of Science 51. ↵ McCulloch KJ , Macias-Muñoz A , Mortazavi A , Briscoe AD . 2022 . Multiple Mechanisms of Photoreceptor Spectral Tuning in Heliconius Butterflies . Molecular Biology and Evolution 39 :msac067. 52. ↵ McCulloch KJ , Yuan F , Zhen Y , Aardema ML , Smith G , Llorente-Bousquets J , Andolfatto P , Briscoe AD . 2017 . Sexual Dimorphism and Retinal Mosaic Diversification following the Evolution of a Violet Receptor in Butterflies . Molecular Biology and Evolution 34 : 2271 – 2284 . OpenUrl CrossRef PubMed 53. ↵ Mirdita M , Schütze K , Moriwaki Y , Heo L , Ovchinnikov S , Steinegger M . 2022 . ColabFold: making protein folding accessible to all . Nat Methods 19 : 679 – 682 . OpenUrl CrossRef PubMed 54. ↵ Murphy MJ , Westerman EL . 2022 . Evolutionary history limits species’ ability to match colour sensitivity to available habitat light . Proceedings of the Royal Society B: Biological Sciences 289 : 20220612 . OpenUrl PubMed 55. ↵ Murrell B , Moola S , Mabona A , Weighill T , Sheward D , Kosakovsky Pond SL , Scheffler K . 2013 . FUBAR: A Fast, Unconstrained Bayesian AppRoximation for Inferring Selection . Molecular Biology and Evolution 30 : 1196 – 1205 . OpenUrl CrossRef PubMed Web of Science 56. ↵ Murrell B , Weaver S , Smith MD , Wertheim JO , Murrell S , Aylward A , Eren K , Pollner T , Martin DP , Smith DM , et al. 2015 . Gene-Wide Identification of Episodic Selection . Molecular Biology and Evolution 32 : 1365 – 1371 . OpenUrl CrossRef PubMed 57. ↵ Musilova Z , Salzburger W , Cortesi F . 2021 . The Visual Opsin Gene Repertoires of Teleost Fishes: Evolution, Ecology, and Function . Annu. Rev. Cell Dev. Biol . 37 : 441 – 468 . OpenUrl CrossRef PubMed 58. ↵ Nguyen L-T , Schmidt HA , Von Haeseler A , Minh BQ. 2015 . IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies . Molecular biology and evolution 32 : 268 – 274 . OpenUrl CrossRef PubMed 59. ↵ Nilsson D-E , Smolka J , Bok M. 2022 . T he vertical light-gradient and its potential impact on animal distribution and behavior . Front. Ecol. Evol. [Internet] 10. Available from: https://www.frontiersin.org/journals/ecology-and-evolution/articles/10.3389/fevo.2022.951328/full 60. ↵ Omasits U , Ahrens CH , Müller S , Wollscheid B . 2014 . Protter: interactive protein feature visualization and integration with experimental proteomic data . Bioinformatics 30 : 884 – 886 . OpenUrl CrossRef PubMed Web of Science 61. ↵ Pál C , Papp B , Lercher MJ . 2006 . An integrated view of protein evolution . Nat Rev Genet 7 : 337 – 348 . OpenUrl CrossRef PubMed Web of Science 62. ↵ Pazos F , Helmer-Citterich M , Ausiello G , Valencia A . 1997 . Correlated mutations contain information about protein-protein interaction 1 . Journal of Molecular Biology 271 : 511 – 523 . OpenUrl CrossRef PubMed Web of Science 63. Pérez i de Lanuza G , Carazo P, Font E. 2014. Colours of quality: structural (but not pigment) coloration informs about male quality in a polychromatic lizard . Animal Behaviour 90 : 73 – 81 . 64. ↵ Perry M , Kinoshita M , Saldi G , Huo L , Arikawa K , Desplan C . 2016 . Molecular logic behind the three-way stochastic choices that expand butterfly colour vision . Nature 535 : 280 – 284 . OpenUrl CrossRef PubMed 65. ↵ Pirih P , Ilić M , Meglič A , Belušič G . 2022 . Opponent processing in the retinal mosaic of nymphalid butterflies . Philosophical Transactions of the Royal Society B: Biological Sciences 377 : 20210275 . OpenUrl CrossRef PubMed 66. ↵ Ricci V , Ronco F , Boileau N , Salzburger W . 2023 . Visual opsin gene expression evolution in the adaptive radiation of cichlid fishes of Lake Tanganyika . Science Advances 9 :eadg6568. 67. ↵ Saito T , Koyanagi M , Sugihara T , Nagata T , Arikawa K , Terakita A . 2019 . Spectral tuning mediated by helix III in butterfly long wavelength-sensitive visual opsins revealed by heterologous action spectroscopy . Zoological Lett 5 : 35 . OpenUrl CrossRef PubMed 68. ↵ Sandkam B , Young CM , Breden F . 2015 . Beauty in the eyes of the beholders: colour vision is tuned to mate preference in the Trinidadian guppy (Poecilia reticulata) . Molecular Ecology 24 : 596 – 609 . OpenUrl CrossRef 69. ↵ Sauman I , Briscoe AD , Zhu H , Shi D , Froy O , Stalleicken J , Yuan Q , Casselman A , Reppert SM . 2005 . Connecting the Navigational Clock to Sun Compass Input in Monarch Butterfly Brain . Neuron 46 : 457 – 467 . OpenUrl CrossRef PubMed Web of Science 70. ↵ Schott RK , Fujita MK , Streicher JW , Gower DJ , Thomas KN , Loew ER , Bamba Kaya AG , Bittencourt-Silva GB , Guillherme Becker C , Cisneros-Heredia D , et al. 2024 . Diversity and Evolution of Frog Visual Opsins: Spectral Tuning and Adaptation to Distinct Light Environments . Molecular Biology and Evolution 41 :msae049. 71. ↵ Schott RK , Perez L , Kwiatkowski MA , Imhoff V , Gumm JM . 2022 . Evolutionary analyses of visual opsin genes in frogs and toads: Diversity, duplication, and positive selection . Ecology and Evolution 12 : e8595 . OpenUrl CrossRef 72. Sharkey CR , Powell GS , Bybee SM . 2021. Opsin Evolution in Flower-Visiting Beetles . Front. Ecol. Evol. [Internet] 9. Available from: https://www.frontiersin.org/journals/ecology-and-evolution/articles/10.3389/fevo.2021.676369/full 73. ↵ Sison-Mangus MP , Bernard GD , Lampel J , Briscoe AD . 2006 . Beauty in the eye of the beholder: the two blue opsins of lycaenid butterflies and the opsin gene-driven evolution of sexually dimorphic eyes . Journal of Experimental Biology 209 : 3079 – 3090 . OpenUrl Abstract / FREE Full Text 74. ↵ Sison-Mangus MP , Briscoe AD , Zaccardi G , Knüttel H , Kelber A . 2008 . The lycaenid butterfly Polyommatus icarus uses a duplicated blue opsin to see green . Journal of Experimental Biology 211 : 361 – 369 . OpenUrl Abstract / FREE Full Text 75. ↵ Smith EJ , Partridge JC , Parsons KN , White EM , Cuthill IC , Bennett ATD , Church SC . 2002 . Ultraviolet vision and mate choice in the guppy (Poecilia reticulata) . Behavioral Ecology 13 : 11 – 19 . OpenUrl CrossRef Web of Science 76. ↵ Smith WC , Goldsmith TH . 1990 . Phyletic aspects of the distribution of 3-hydroxyretinal in the class insecta . J Mol Evol 30 : 72 – 84 . OpenUrl CrossRef PubMed Web of Science 77. ↵ Sondhi Y , Ellis EA , Bybee SM , Theobald JC , Kawahara AY . 2021 . Light environment drives evolution of color vision genes in butterflies and moths . Commun Biol 4 : 1 – 11 . OpenUrl CrossRef PubMed 78. ↵ Stavenga DG , Arikawa K . 2006 . Evolution of color and vision of butterflies . Arthropod Structure & Development 35 : 307 – 318 . OpenUrl CrossRef PubMed 79. ↵ Tamura K , Stecher G , Kumar S . 2021 . MEGA11: Molecular Evolutionary Genetics Analysis Version 11 . Molecular Biology and Evolution 38 : 3022 – 3027 . OpenUrl CrossRef PubMed 80. ↵ Untergasser A , Cutcutache I , Koressaar T , Ye J , Faircloth BC , Remm M , Rozen SG . 2012 . Primer3— new capabilities and interfaces . Nucleic Acids Research 40 : e115 . OpenUrl CrossRef PubMed 81. ↵ Varma N , Mutt E , Mühle J , Panneels V , Terakita A , Deupi X , Nogly P , Schertler GFX , Lesca E . 2019 . Crystal structure of jumping spider rhodopsin-1 as a light sensitive GPCR . Proc. Natl. Acad. Sci. U.S.A . 116 : 14547 – 14556 . OpenUrl Abstract / FREE Full Text 82. ↵ Wakakuwa M , Stavenga DG , Kurasawa M , Arikawa K . 2004 . A unique visual pigment expressed in green, red and deep-red receptors in the eye of the small white butterfly, Pieris rapae crucivora . Journal of Experimental Biology 207 : 2803 – 2810 . OpenUrl Abstract / FREE Full Text 83. Wakakuwa M , Terakita A , Koyanagi M , Stavenga DG , Shichida Y , Arikawa K. 2010. Evolution and Mechanism of Spectral Tuning of Blue-Absorbing Visual Pigments in Butterflies.Warrant EJ, editor . PLoS ONE 5:e15015. 84. ↵ Watson CT , Gray SM , Hoffmann M , Lubieniecki KP , Joy JB , Sandkam BA , Weigel D , Loew E , Dreyer C , Davidson WS , et al. 2011 . Gene Duplication and Divergence of Long Wavelength- Sensitive Opsin Genes in the Guppy, Poecilia reticulata . J Mol Evol 72 : 240 – 252 . OpenUrl CrossRef PubMed 85. ↵ Xu P , Lu B , Chao J , Holdbrook R , Liang G , Lu Y . 2021 . The evolution of opsin genes in five species of mirid bugs: duplication of long-wavelength opsins and loss of blue-sensitive opsins . BMC Ecol Evo 21 : 66 . OpenUrl CrossRef 86. Yang Z , others. 1997 . PAML: a program package for phylogenetic analysis by maximum likelihood . Computer applications in the biosciences 13 : 555 – 556 . OpenUrl CrossRef PubMed 87. ↵ Zaccardi G , Kelber A , Sison-Mangus MP , Briscoe AD . 2006 . Color discrimination in the red range with only one long-wavelength sensitive opsin . Journal of Experimental Biology 209 : 1944 – 1955 . OpenUrl Abstract / FREE Full Text 88. Zhang S. 2012. Visually Guided Decision Making in Foraging Honeybees . Front. Neurosci. [Internet] 6. Available from: https://www.frontiersin.org/journals/neuroscience/articles/10.3389/fnins.2012.00088/full View the discussion thread. Back to top Previous Next Posted June 19, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats Joséphine Ledamoisel , Andrew Dang , Julien Devilliers , Tiphaine Marvillet , Sophie Lemoine , Manuela Lopez-Villavicencio , Adriana Briscoe , Vincent Debat , Violaine Llaurens bioRxiv 2025.06.13.659549; doi: https://doi.org/10.1101/2025.06.13.659549 Share This Article: Copy Citation Tools Evolution of opsin genes in closely-related species of butterflies specialized in different microhabitats Joséphine Ledamoisel , Andrew Dang , Julien Devilliers , Tiphaine Marvillet , Sophie Lemoine , Manuela Lopez-Villavicencio , Adriana Briscoe , Vincent Debat , Violaine Llaurens bioRxiv 2025.06.13.659549; doi: https://doi.org/10.1101/2025.06.13.659549 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Evolutionary Biology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17648) Bioengineering (13871) Bioinformatics (41880) Biophysics (21423) Cancer Biology (18561) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13364) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22475) Immunology (17713) Microbiology (40328) Molecular Biology (17148) Neuroscience (88473) Paleontology (666) Pathology (2827) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-21T05:10:58.409756+00:00
License: CC-BY-4.0