Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Background: Equine herpesvirus 4 (EHV-4) causes respiratory disease in horses, and the virus is considered endemic in the global equine population. However, outbreaks can occur when several horses are gathered in relation to shows, competitions, breeding units and at hospitals. In the spring year 2022, an EHV-4 outbreak occurred at the Large Animal Teaching Hospital, University of Copenhagen, Denmark. Nine horses were tested EHV-4 positive during the outbreak, which lasted approx. seven weeks. In addition, a tenth horse “Eq10” tested EHV-4 positive almost three weeks after the last of the outbreak horses tested positive. Detailed clinical registrations were obtained from all ten horses as well as their location and movement during hospitalization. Nasal swabs were obtained throughout the outbreak and tested by real-time qPCR for EHV-4. Additionally, pre- and post-infection sera were tested for the presence of EHV-4 antibodies. Selected samples were characterized by partial and full genome sequencing. Results: : The most common clinical signs of the EHV-4 infected horses during this outbreak were pyrexia, nasal discharge, mandibular lymphadenopathy and increased lung sounds upon auscultation. Based on the locations of the horses, EHV-4 detection and antibody responses the most likely “patient zero” was identified as being “Eq1”. Partial genome sequencing revealed that Eq10 was infected by another wild type EHV-4 strain, suggesting that the hospital was able to eliminate the outbreak by testing and reinforcing biosecurity measures. The complete genome sequence of the outbreak strain was obtained and revealed a closer relation to Australian and Japanese EHV-4 strains rather than to other European EHV-4 strains. Conclusion: The study illustrated the transmission of EHV-4 within an equine facility/hospital and provided new insights into the viral shedding, antibody responses and clinical signs related to EHV-4 infections. Finally, sequencing proved a useful tool in understanding the transmission within the hospital, and in characterizing of the outbreak strain.
Full text 124,945 characters · extracted from preprint-html · click to expand
Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization Pia Ryt-Hansen, Victoria Kyhl Johansen, Marta Maria Cuicani, Lars Erik Larsen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3376825/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 13 You are reading this latest preprint version Abstract Background: Equine herpesvirus 4 (EHV-4) causes respiratory disease in horses, and the virus is considered endemic in the global equine population. However, outbreaks can occur when several horses are gathered in relation to shows, competitions, breeding units and at hospitals. In the spring year 2022, an EHV-4 outbreak occurred at the Large Animal Teaching Hospital, University of Copenhagen, Denmark. Nine horses were tested EHV-4 positive during the outbreak, which lasted approx. seven weeks. In addition, a tenth horse “Eq10” tested EHV-4 positive almost three weeks after the last of the outbreak horses tested positive. Detailed clinical registrations were obtained from all ten horses as well as their location and movement during hospitalization. Nasal swabs were obtained throughout the outbreak and tested by real-time qPCR for EHV-4. Additionally, pre- and post-infection sera were tested for the presence of EHV-4 antibodies. Selected samples were characterized by partial and full genome sequencing. Results: The most common clinical signs of the EHV-4 infected horses during this outbreak were pyrexia, nasal discharge, mandibular lymphadenopathy and increased lung sounds upon auscultation. Based on the locations of the horses, EHV-4 detection and antibody responses the most likely “patient zero” was identified as being “Eq1”. Partial genome sequencing revealed that Eq10 was infected by another wild type EHV-4 strain, suggesting that the hospital was able to eliminate the outbreak by testing and reinforcing biosecurity measures. The complete genome sequence of the outbreak strain was obtained and revealed a closer relation to Australian and Japanese EHV-4 strains rather than to other European EHV-4 strains. Conclusion: The study illustrated the transmission of EHV-4 within an equine facility/hospital and provided new insights into the viral shedding, antibody responses and clinical signs related to EHV-4 infections. Finally, sequencing proved a useful tool in understanding the transmission within the hospital, and in characterizing of the outbreak strain. Figures Figure 1 Figure 2 Figure 3 Figure 4 Background In the family of Herpesviridae , nine equine herpesviruses (EHV-1-EHV-9) have been defined, with EHV-1, EHV-3, EHV-4, EHV-6, EHV-8 and EHV-9 belonging to the subfamily of Alphaherpesvirinae ( 1 ). EHV-1 and EHV-4 are two important agents in relation to upper respiratory tract infections in horses ( 2 ). The two viruses are closely related both genetically and antigenically with considerable level of immunological cross reactivity ( 5 ). However, EHV-1 distinguishes from EHV-4 by frequent induction of abortions and neurological disease ( 2 – 4 ). The genome of EHV-4 consists of linear double stranded DNA, approximately 145 kilo base pairs (kbp) in length. The genome contains 79 open reading frames (ORFs) ( 4 ) encoding 76 homologous genes, with three genes (ORF 64, 65 and 66) which are duplicated within the repeat regions ( 5 ). Several studies have performed whole genome sequencing ( 3 – 5 ), whereas other studies solely focused on sequencing of ORF30 and ORF33 ( 6 , 7 ), encoding a catalytic subunit of replicative DNA polymerase and an envelope glycoprotein, respectively. Whole genome sequencing analysis have shown 98.9–99.9% shared nucleotide identity among different Australian EHV-4 strains, corresponding to 179 single nucleotide polymorphisms (SNPs) ( 5 ). Conversely, a German outbreak at a breeding stable revealed 99.9% identity corresponding to 76–98 SNPs ( 3 ). EHV-4 infection can lead to respiratory disease ( 8 ) with clinical symptoms including lethargy, anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge ( 3 , 8 , 9 ) with a duration between two and 14 days ( 3 , 10 ). Clinical disease is most often reported in foals and youngsters ( 3 , 8 ). EHV-4 is transmitted by aerosols and by direct contact ( 9 , 11 ). Studies have reported a seroprevalence of > 80% in different geographical locations ( 3 ). A key property of EHV-4 is its ability to establish latent infections. One study revealed that 56/70 horses, euthanized due to none-infectious causes, tested EHV-4 positive in the trigeminal ganglia ( 12 ). Following the establishment of latency, EHV-4 can be periodically reactivated due to stressors such as transport, new environment etc., with recrudescence and shedding of EHV-4 as a result ( 2 , 3 , 9 ). The aims of this study was to characterize the outbreak strain of an EHV-4 outbreak and to describe the transmission and clinical disease related to an acute EHV-4 at a referral hospital. Results Real-time qPCR results of nasal swabs (Laboklin and VCM analyses) Initially, the first three horses showing clinical symptoms of respiratory disease (Eq. 1, Eq. 2 and Eq. 3) all tested positive for EHV-5 and Streptococcus Equi Subsp. Zooepidemicus in addition to them being EHV-4 positive. Additional four horses tested EHV-4 positive after 4–5 days, and the last two horses, 8 and 13 days after the first EHV-4 positive horse, respectively (Fig. 1). Eq10 was referred to the hospital for the first time, while the last EHV-4 positive horses (Eq. 2) was still isolated in the quarantine. However, Eq. 10 was re-admitted to the hospital 17 days after Eq. 2 tested EHV-4 positive for the last time. Three horses did not have consecutive positive EHV-4 tests during the “infection period”. A nasal swab from Eq. 2 tested negative (Laboklin), with four positive EHV-4 tests prior and four positive EHV-4 tests following. Almost four weeks later, the same horse had another negative EHV-4 test followed by a positive EHV-4 test three days later. Eq. 4 also had a negative EHV-4 test results on nasal swab, with two positive test prior and four positive EHV-4 test during the following weeks. May 16, two nasal swab were collected from horse Eq. 8, one nasal swab had a negative EHV-4 test from Laboklin, and the other swab showed a high Ct value of 35.05 when tested at VCM. For Eq. 8, nasal swab obtained at three consecutive samplings prior and on one sampling occasion, three days after this date were all EHV-4 positive. All serum tested for the presence of EHV-4 by qPCR were negative, except for Eq. 2, that had one blood sample obtained the 5th of May, with a Ct value of 34.49. A detailed overview of the real-time qPCR results from both laboratories are shown in Additional File 1. Pre- and post-infection antibody responses The ELISA results of the pre- and post-infection sera revealed that only three of the ten horses were naïve to EHV-4 antibodies at the time of arrival at the hospital (Table 1 ). These were all foals being between ten months to one year of age (Additional File 2). Two of these horses subsequently tested positive in the ELISA following EHV-4 infection, whereas the last horse remained negative. However, the post-infection sera of this horse was only obtained only eight days after the initial EHV-4 positive test result. The remaining seven horses were seropositive already upon arrival. In total, seven horses showed an increase in EHV-4 antibodies following infection. Seven out of the ten horses from the outbreak had an OD value 1.0 post infection, with seven of them being > 2.0. Table 1 EHV-4 antibody ELISA results of the sera obtained from the ten horses pre- and post-infection presented as corrected OD-values. Pre-infection Post first positive EHV-4 test (days) Eq1 2.0 2.976 (22) Eq2 0.062 0.287 (7) 2.557 (20) 2.886 (26) Eq3 0.022 0.052 (8) Eq4 0.995 2.925 (16) 2.762 (23) Eq5 0.817 1.095 (16) Eq6 1.683 2.583 (16) Eq7 0.081 2.223 (15) 2.212 (81) Eq8 0.946 and 1.29 - Eq9 2.212 2.023 (8) 2.024 (14) Eq10 0.677 and 0.707 2.731 (4) For the post-infection sera the number of days after the initial EHV-4 positive real-time qPCR test results are presented in the parenthesis. Antibody negative samples are marked with bold letters. The pre-infection sera were obtained at arrival, but for Eq. 8 and Eq. 10 additional pre-infection sera were also analyzed. In addition, Eq. 2, Eq. 4, Eq. 7 and Eq. 9 had several post-infection sera analyzed. Clinical signs C linical signs related to the ten EHV-4 infected horses during the outbreak included pyrexia, mandibular lymphadenopathy, nasal discharge, coughing and increased lung sounds and are listed for each horse in Additional File 3. The reason for admission to the Large Animal Teaching Hospital and other clinical signs observed during their hospitalization can be found in Additional File 2. It should be noted that 2/10 horses showed anorexia and 5/10 horses had ocular discharge. Based on clinical signs, the ten infected horses could be divided into three groups. One group, including horses above the age of ten being subclinically to mildy affected, which consisted of three horses without clinical signs of respiratory disease, or only one day with reported nasal discharge (Eq. 4, Eq. 5 and Eq. 9). The second group consisted of horses below one year of age that were moderately affected characterized by being subfebrile and with mandibular lymphadenopathy, nasal discharge, and increased lung sounds (Eq. 1, Eq. 2 and Eq. 6). Eq. 1 and Eq. 2 also had two and one day of mild fever, respectively and Eq. 2 had several days with coughing registered. The third group included horses between 11 months to 2 years, except from a 7-year-old horse (Eq. 10) being severely affected with pyrexia for three-five days, nasal discharge and increased lung sounds (Eq. 3, Eq. 7, Eq. 8 and Eq. 10). None of the severely affected horses had mandibular lymphadenopathy. Eq. 10 had a high fever for four days during hospitalization and was reported with a high fever for several days prior to the second admission to the hospital. Tracing movements of the horses Eq1 stabled in box 32 E, and Eq. 3 stabled in the outside box, were the first two horses to test positive for EHV-4 (Fig. 2). The horses were transferred to the isolation unit 1 following their first EHV-4 positive test, and remained there until tested negative. Eq. 2, Eq. 4 and Eq. 5 were all housed in stable E, and were moved to isolation units 1 or 2. The horses remained individual isolated until being discharged from the hospital. Stable E was “closed down” for intake of patients during most of the outbreak. Initially, to quarantine other close-contact horses that had been in contact with the first positive confirmed infected horse, and later in the outbreak period, it became isolation unit due to lack of space in the isolation unit. Eq. 6 remained in stable E during its entire hospitalization. Eq. 7 and Eq. 9 was initially in stable D, but when testing positive for EHV-4, they were moved to the isolation unit 1 and 2, respectively. Eq. 8 was initially in the intensive care unit (stable A), until it developed clinical signs of disease, and was then moved to the isolation unit 2. The remaining horses in stable A subsequently tested negative for EHV-4. Eq. 10, was initially hospitalized for minor surgery of skin tumors, and was stabled in stable D during its hospitalization. It was stabled in a box that no EHV-4 positive horse had been placed during the outbreak and with over a month since the last EHV-4 positive horse had been in that specific stable. At the time of surgery of Eq. 10, all but one horse from the outbreak had been discharged, and the last EHV-4 infected horse was, as mentioned earlier, stabled in the isolation unit 1. Eq. 10 was discharged from the hospital three days following the surgery. When the horse was re-admitted to the hospital six days later, showing clinical signs of disease, it was stabled in isolation unit 1 upon arrival. Biosecurity was upregulated during the outbreak to limit contamination and transmission. The horses were stabled in green, yellow and red zones, with different personnel for each section and in the yellow and red zone, the personnel had to wear protective clothing, changing between each individual horses. Until the first EHV-4 positive test results, the hospitalized horses were taken out of their boxes to be examined and exercised, thereby introducing possible transmission routes. However, during the outbreak, infected or close-contact horses were only taken to an examination room in urgent circumstances and with proper disinfection and rest time after. Within the stables A, E and D the horses can have indirect contact with the horses in neighboring boxes and with shared airspace, with walls of the box being around 2.5 meters high, and with wooden planks separating the boxes. In addition, larger horses will be able to come in direct contact if they stretch their necks over the separating walls between boxes. The outdoor boxes also had shared airspace, but with no possibility for either indirect or direct contact. The boxes of the isolation units were completely separated from each other, so that the horses could not have any contact, although still with shared airspace. Virus isolation in cells Following four passages in the Equine dermal cells, a viral isolate was successfully obtained from Eq. 7 with a Ct value of 12.4 in the real-time qPCR carried out at VCM. Analyses of the complete EHV-4 genome of the Danish outbreak strain We successfully obtained a complete genome from the viral isolate of Eq. 7 accession number: OR576810 in NCBI GenBank. The raw data contained ~ 23.000 paired end reads which after filtering and mapping remained ~ 4700 reads with a proportion of endogenous content equal to 20.6%. After mapping and filtering the average coverage of the sample was approx. 169x (Fig. 3A and B) with 99.87% of the genome that was covered at least 1x, 99.55% was covered 5x, 99.03% was covered 10x and 94.85% was covered 50x (Fig. 3C). Low coverage regions (below 25x) were specifically identified in areas associated to repeated regions in the Irish reference genome and were more prevalent towards the end of the genome (Fig. 3A). The consensus genome for Eq. 7 was generated and used together with one Irish, four German, eight Japanese and 14 Australian whole genome sequences to build a full genome phylogeny. The Maximum Likelihood tree was highly supported and revealed the Danish EHV-4 genome as closest to a cluster of sequences from Japan and Australia (Fig. 3D). The number of nucleotide dissimilarity between our sample (Eq. 7) and the rest of the full genome sequences in the dataset ranged from 348 to 782 bases with the highest sequence identity to Equid alphaherpesvirus 4 isolate 405 − 76 from Australia (NCBI Genbank accession number: KT324740). Analyses of the partial ORF30 sequences In total, 2870 nts of the ORF30 were successfully obtained from three of the EHV-4 infected horses including Eq. 7 (accession number OR532440), Eq. 8 (accession number OR532439) and Eq. 10 (accession number OR532441). Subsequently, a pairwise comparison was performed including the three partial ORF30 sequences. The results of this sequence comparison revealed that the ORF30 of two of the horses Eq. 7 and Eq. 8 were 100% identical, whereas the sequence of Eq. 10 showed six nucleotide differences compared to Eq. 7 and Eq. 8. The partial ORF30 sequences were also compared to two German reference sequences obtained from another outbreak. These two German sequences were also 100% identical to each other, while only four nucleotide differences were observed to Eq. 7 and Eq. 8 and six nucleotide differences were found to Eq. 10 (Fig. 4). Discussion and conclusions On average, the EHV-4 infected foals and horses included in this study tested PCR positive on nasal swabs for viral DNA for approximately 17 days. This is in accordance with a recent study showing that 75% of EHV-4 infected foals shed virus for 14 days, measured by PCR in nasal swabs ( 3 ) and another revealing that foals shed high levels of EHV-4 viral DNA for approx. four weeks in nasal swabs ( 10 ). The same study found that EHV-4 could only be detected in the peripheral blood leukocytes shortly at the beginning of infection, and with very low concentration when compared to the amount of virus in nasal swabs, which correlated well with the fact that only one serum sample in our study tested weakly positive for EHV-4. However, the detection in the blood did correlate with a positive nasal swab obtained at the same day. Detection of the EHV-4 by PCR in nasal swab do not necessary correlate with shedding of infectious virus. In a previous study, detection of EHV-4 mRNA as a measure of active replication correlated well with both clinical signs and detection of high levels of EHV-4 DNA and lasted for approximately 7 days ( 10 ), whereas another study showed that EHV-4 could be isolated in cell culture for up to three days after experimental infection ( 13 ). None of these methods can precisely predict the period where infected horses can transmit the virus on to other horses because the PCR tests may pick of reminiscence of non-infectious viral RNA and the detection limit of the cell culture isolations is probably above the infectious dose. Furthermore, the infectious dose will depend on a variety of individual host -and environmental factors. Nevertheless, based on our findings, the epidemiological information and results of previous studies it is reasonable to estimate that on average an infected horse may transmit the virus on to other susceptible horses 2–9 days after infection, but there will be significant individual differences. As observed in previous studies, the EHV-4 infected horses of the Danish outbreak presented with clinical signs such as anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge ( 3 , 8 , 9 ). The majority of the ten horses showed nasal discharge, lymphadenopathy and increased lung sounds and 8/10 horses were either subfebrile or had pyrexia during their infection. An additional observation in this Danish outbreak, was that 50% of the horses also had ocular discharge, which was also reported by an American study ( 14 ). Five of the ten infected horses in the Danish outbreak were younger than one year, which is slightly higher than the prevalence observed in other studies ranging from 35–46% of the infected horses ( 3 , 8 ). However, an outbreak in China showed that only foals was infected ( 15 ). In our study, it was observed that the horses classified as subclinical to mildly affected all were all above ten years old. However, Eq. 10 who was seven years old, were among the four horses with the most severe clinical signs. The remaining three horses most severely affected were all between 11 months and two years of age. This indicate that not only the age is a key factor for severity and development of symptoms, but also co-infections and/or the immune status at the time of infection could play an important role in the evolution of disease. Interestingly, the four most severely affected horses all had a relatively low EHV-4 pre-infection antibody levels. The three horses that were EHV-4 naïve upon arrival at the hospital were all ≤ 1 year old, thereby making it likely that they did not encounter EHV-4 before. The vaccination status of the included horses in this study was unknown, but foals are seldom EHV vaccinated in Denmark and the ELISA also tested for EHV-1 antibodies and all horses tested negative indicating that they had not been vaccinated with the EHV-1/EHV-4 vaccine available in Denmark. The seroprevalence of 70% found in our study corresponded well to the approx. 80% seroprevalence found in a German study ( 3 ). Two of the three antibody negative horses seroconverted after the EHV-4 infection, whereas the third horse remained seronegative, probably because the blood sample was obtained only eight days following the first EHV-4 positive test, which may be before a detectable antibody response can be detected. An increase in OD-value was observed in five out of six horses, from which a post-infection serum sample was obtained. The majority of the post-infection sera was obtained two-three weeks after the first EHV-4 positive nasal swab. Interestingly an 81 days post-infection serum sample from Eq. 7 was obtained with no significant decrease in the OD-value compared to the sample taken 66 days earlier. Based on the viral detections, antibody responses, clinical registrations, stable locations and horse movement it was possible to identity Eq. 1 as a potential “patient zero” of the outbreak. Only two horses, Eq. 1 and Eq. 9, had high levels of EHV-4 antibody titer at arrival to the hospital, indicating that they could have an active EHV-4 infection or re-activation of latent EHV-4 virus due to stress induced by recent disease, transportation and/or hospitalization. Re-activation is known to cause a boost of prior EHV-4 antibody response resulting in the high antibody levels observed ( 16 ). As Eq. 9 was hospitalized several days after the first three confirmed EHV-4 cases this horse was ruled out as patient zero. The first horses to present with EHV-4 positive nasal swabs and clinical signs of disease were Eq. 1, Eq. 2 and Eq. 3. Eq. 2 and Eq. 3 were both negative for EHV-4 antibodies at arrival to the hospital, however, a rise in antibodies post infection is not measurable until 8–10 days after infection ( 17 ). Eq. 2 and/or Eq. 3 could therefore possibly have been infected shortly before being hospitalized and can thereby not be entirely ruled out as patient zero. Nevertheless, the fact that Eq. 1 were among the first to show clinical signs combined with its antibody positive status point at this horse being patient zero. Noteworthy is also that Eq. 6 also showed clinical signs of disease at an early point and had a relatively high level of antibodies at arrival at the hospital, however, this horse was not tested until a week after the three first confirmed EHV-4 cases. Interestingly, Eq. 6 originated from the same premise as Eq. 1, and the two horses were transported and admitted to the hospital together. Five out of ten horses were stabled in stable E, where two of the first EHV-4 positive horses were located, this creating a high-risk environment for transmission both by direct contact trough aerosols ( 18 ) or indirect contact such as personal, use of the same equipment, examination rooms and feeding trucks. In addition, equine herpesviruses are also known to be transmitted to some extent trough aerosols ( 18 ). Neither Eq. 3, Eq. 7 nor Eq. 8 were stabled in stable E and may have encountered viral transmission by indirect contact. EHV-1 has been shown to persist in the environment for up to 48 hours ( 19 ) and for three weeks in water ( 20 ). Eq. 9 was initially located in stable D, where Eq. 7 was present at time of infection thereby providing a transmission route. Eq. 10 was hospitalized two months after the beginning of the EHV-4 outbreak at a time where only one prior EHV-4 infected horse was present at the hospital and this horse was kept in the isolation unit. The results of the partial ORF30 sequencing further confirms that Eq. 10 was indeed infected with another EHV-4 strain than the one related to the outbreak, as the sequences of Eq. 7 and Eq. 8 only showed 99.79% sequence identity to that of Eq. 10, which is equal to the genetic difference between German, Australian and Japanese sequences (Pavulraj et al 2021) (Fig. 3). On the contrary, the sequence identity of Eq. 7 and Eq. 8 were 100%. This strongly suggests that the EHV-4 genome from Eq. 10 was not the same virus strain as the outbreak strain, but another wild type virus, indicating that the internal biosecurity measures at the hospital was able to eliminate the outbreak virus. The presence of another EHV-4 positive horse infected with a different strain emphasize that EHV-4 infections are relatively common, and that it is important to have good biosecurity plans especially in equine hospitals where several horses are housed together, have co-morbidities and high stressors that can re-activate a latent EHV-4 infection. The first tested horses also tested positive for co-infections for EHV-5 and Streptococcus Equi subsp. Zooepidemicus. Both pathogens are known commensals, but can potentially enhance disease ( 8 , 11 , 21 ). Interestingly, the three horses with the co-infection belonged to the moderately or severely clinically affected groups. A recent study by Pusterla et al showed that 20% of EHV-4 infected horses were co-infected with one or multiple of the following pathogens: Equine Influenza virus, Streptococcus Equi subsp. Equi and Equine Rhinitis virus ( 8 ) but the horses of that study were not tested for Streptococcus Equi subsp. Zooepidemicus or EHV-5. In addition, a full genome sequence of EHV-4 isolated from Eq. 7 was generated and resulted to be more differentiated and basal to the Australian, Japanese and German cluster, and closer related to other Australian and Japanese cluster (Fig. 4). However, very few full genome EHV-4 sequences are available for comparison. Methods Study design Included in the study were nine horses (mean age of five years), that were all part of an EHV-4 outbreak at a referral hospital in Denmark. The exact age and additional information are available in Additional File 3. Inclusion criteria was a minimum of one EHV-4 positive nasal swab analyzed by the commercial laboratory Laboklin, Germany. Horses hospitalized during the outbreak and tested negative for EHV-4 were not included in the study. The “outbreak period” defined as the period from the first horse tested EHV-4 positive (27th of April) until the last EHV-4 positive horse was discharged after testing negative lasted for a total of seven weeks (17th of June) with the last test positive horse testing positive June 10th. The given dates indicate the collection day of the nasal swab that later tested positive in the laboratory. Horses displaying clinical signs compatible with EHV-4, and close-contacts of infected horses, were all tested by nasal swabs send for analysis at a commercial laboratory. Isolation of EHV-4 positive horses and close-contact horses was initiated following the American Association of Equine Practitioners (AAEP) Biosecurity Guidelines ( 22 ). In addition, all EHV-4 positive horses were tested continuously until they tested negative. A selection of these samples was also tested at the Section of Veterinary Clinical Microbiology at the University of Copenhagen (VCM). Clinical files, stable/box locations and paraclinical test results were included from the infected horses. An additional horse, Eq. 10, initially hospitalized from the 15th -18th of June 2022 and re-admitted to the isolations facilities on June 24th due to pyrexia was also included into the study, as it tested positive for EHV-4 on the 27th of June. The clinical file and samples similar to the once described above was included for this horse. Additional file 4 describe the complete sample list. Nasal swab for PCR Nasal swabs for analyses at a commercial laboratory were obtained by the use of 15 cm long dry swabs (Kruuse, Denmark), passed as far as possible into the nasopharynx by the ventral meatus and rotated for 15–30 seconds. The swabs were inserted into an empty sterile container and kept in a refrigerator until being shipped and analyzed by the laboratory. The first samples were tested for a number of respiratory pathogens including: EHV-1, EHV-5, Streptococcus Equi subsp. Zooepidemicus and Streptococcus Equi subsp. Equi, Coronavirus and Influenza A, whereas the last samples were tested solely for the presence of EHV-4 by real time PCR. The time span between sampling and test results was approximately 3 working days. In addition to the nasal swabs obtained and analyzed by the commercial laboratory during the outbreak, additional nasal swabs (Medical Wire, Corsham, UK) were collected from the EHV-4 positive horses, for analysis at VCM. The swabs were subsequently immersed in Sigma Virocult Media (Medical Wire) and stored at minimum − 20°C until further analysis. In total, 28 nasal swabs were tested at VCM, which together with the results of the nasal swabs tested at Laboklin (n = 38) equaled 66 qPCR results on EHV-4 detection from the ten horses. Clinical findings Each horse was clinically examined at least once daily. The following data was extracted from the files: rectal temperature, palpation of the mandibular lymphnodes (size and painfulness), the presence or not of nasal discharge (colour and viscocity), the presence of cough (yes/no), lung auscultation (normal/abnormal) and the presence or not of ocular discharge. Serum sample collection, storage, and handling Serum samples were routinely drawn from all horses at admittance and on indication during the stay. Samples were stored at -20 C. All possible serum samples obtained from the ten outbreak horses were included (n = 26) with the aim of obtaining one pre-infection and at least one post-infection serum sample from each horse. Extraction of DNA The DNA extraction of the 28 nasal swab samples analyzed at VCM laboratory was performed using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) automated on the QIAcube connect (QIAGEN), according to manufacturer’s protocol ( 23 ). The DNA of the serum samples and the viral isolate were extracted manually using the same extraction kit. Real time qPCR The extracted DNA was subsequently used in a previously published real-time qPCR targeting the glycoprotein B of EHV-4 ( 10 ). In brief, 20 𝜇L of reaction mix (Sensifast No-Rox (2x), primers (EHV4-F: CGCAGAGGATGGAGACTTTTACA and EHV4-R: CATGACCGTGGGGGTTCAA) and probe (EHV4-P: FAM-CTGCCCGCCGCCTACTGGATC-TAM)) was mixed with 5 𝜇L of DNA and analyzed on the Rotor-gene Q machine (QIAGEN) using the following program: 95°C for 2 min, 40 x (95°C for 3 secs and 60°C for 60 secs (acquire on green channel)) and 60°C for 60 sec. The raw data was analyzed using the following settings: cycle threshold (Ct) 0.02, ignore the first cycle, using dynamic tube, slope correct, and an outlier removal of 10%. A positive and a negative control were included in all runs, and all samples were analyzed in duplicates. ELISA The serum samples obtained were tested at the VCM laboratory for the presence of EHV-4 antibodies using a commercial ELISA( 24 ) able to differentiate between EHV-1 and EHV-4 antibodies. As mentioned, the samples were selected to obtain minimum one pre- and one post-infection sample, with the post infection sample being as far in time from the first EHV-4 positive test as possible. The commercial kit was the Svanovir® EHV1/EHV4-Ab kit (Svanova, Uppsala, Sweden), which is an indirect ELISA based on type-specific recombinant glycoprotein G fusion protein. The preparation of reagents and the ELISA procedure were performed according to the instruction manual ( 24 ). A corrected OD value of > 0.2 was regarded as positive, whereas a corrected OD value < 0.1 was regarded as negative and a corrected OD value of 0.1–0.2 were considered as doubtful. Virus isolation in cells Equine Dermal cells, NBL-6 (ATCC, Denmark) was cultivated using MEM (Gibco, Termofisher Scientific, Roskilde, Denmark), Non-Essential Amino Acids (Merck, Darmstadt, Germany), Na-Pyruvate 100mM (Gibco, Termofisher Scientific), Penicillin-Streptomycin-Neomycin (PSN) Antibiotic Mixture (Termofisher Scientific) and 10% Fetal Calf Sera. At 100% confluence, the cells were inoculated with 200𝜇L nasal swab sample of Eq. 7 that was first sterile filtrated using 0.45𝜇m Minisart NML Plus Surfactant-free Cellulose Acetate Syringe Filters (Sartorius, Göttingen, Germany). The cells and the supernatant were passaged using 0.05% Trypsin-EDTA (Gibco, Termofisher Scientific) four times adding 1/5 new cells in each passage in a larger cell flasks. At each passage 200𝜇L of cells were harvested and subjected to the DNA extraction and the real-time qPCR described above in order to determine if the viral isolation had been successful. Next-generation Sequencing (NGS). The supernatant and the cells of the fourth passage were harvested and centrifuged at 3000 RPM for 15 minutes to remove cellular debris. Thereafter the supernatant was subjected to ultracentrifugation at 25.000RPM for one hour at 4 0 C. The pellet containing the virions were then disrupted using 200µL PBS, and the DNA extracted manually using the DNA Purification protocol “Blood or Body Fluid“ of the QIAamp DNA mini kit (QIAGEN). The extracted DNA was used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq platform (Statens Serum Institut, Copenhagen S, Denmark). Analysis of the NGS data Illumina raw reads from the isolate of Eq. 7 were filtered using fastp v0.20.1 ( 25 ) to filter out low complexity reads and with quality below 25. The filtered reads were then aligned to the German reference genome (MW892436) using bwa v0.7.17 ( 26 , 27 ) and potential duplicates were identified and removed using picard MarkDuplicates v2.27.2 ( http://broadinstitute.github.io/picard ). Samtools v1.16.1( 28 ) was then used to sort and index the bam file and to determine the read coverage along the whole genome. The consensus genome was generated using bcftools mpileup and bcftools call v1.14 ( 28 ). Genomic position with read coverage below 5x were assigned as missing site "N". The consensus sequence was concatenated with the 27 full reference genomes retrieved from NCBI from Australia, New Zealand, Germany, Ireland and Japan (NCBI Genbank accession numbers: AF030027, KT324741, KT324740, KT324743, KT324746, KT324745, KT324744, KT324748, KT324736, KT324738, KT324739, KT324747, KT324742, KT324735, KT324737, MW892435, MW892436, MW892437, MW892438, LC075586, LC063142, LC075587, LC075582, LC075585, LC075584, LC075588 and LC075583). The sequences were aligned using mafft v7.486 ( 29 ) and trimAl v1.4 ( 30 ) with a gap threshold of 95% and a conservation percentage of minimum 60% (-gt 0.95 -cons 60) was used to remove gaps related to highly repetitive regions. A pairwise comparison and a maximum likelihood phylogenetic tree of the full genome data was generated with IQ-TREE v2.1.2 ( 31 ) with the option -m TEST to calculate the best evolutionary model for the alignment using ModelFinder ( 32 ) and 1000 bootstrap replicates. PCR amplification of ORF30 For other EHV-4 samples, it was not possible to obtain an isolate, and therefore conventional PCR amplification of ORF30 was performed. Four primer-pairs previously published for ORF30 were used ( 3 ), along with the Accuprime Taq High Fidelity kit (Termo Fisher Scientific, Denmark). Four different PCR programs were applied for each primer pair (see Additional File 5). The resulting PCR products were visualized using the Invitrogen E-gel 1% SYBR Safe agarose gel, Termo Fisher Scientific and purified using the High Pure PCR Product Purification Kit, Roche, Basel, Switzerland. The PCR products were used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq (Statens Serum Institut, Copenhagen S). Analysis of the ORF30 sequencing data The data from the next-generation sequencing (NGS) was analyzed using the CLC genomics workbench version 22.0.2 (QIAGEN). Fastq files were imported, and all of the reads were paired and trimmed with a quality limit of 0.2 and a maximum number of ambiguities of two. The trimmed reads were then mapped to a full-length reference genome of a recent German EHV-4 strain (accession number: MW892438). A consensus sequence of ORF30 was extracted and subsequently aligned using the MUSCLE alignment tool ( 33 ) and to the partial ORF30 derived from all EHV-4 sequences available at NCBI GenBank described above (n = 27). Following the alignment, a “pairwise comparison” was created to examine nucleotide differences between Eq. 7, Eq. 8 and Eq. 10 and two German reference sequences (accession numbers: MW892436 and MW892438) derived from a single outbreak. Declarations Ethics approval and consent to participate. The authors confirm that the ethical policies of the journal, as noted on the journal’s author guidelines page, have been followed and the appropriate ethical review committee approval has been received. The study was approved by the Ethical Committee of the Department of Veterinary Clinical Sciences, University of Copenhagen (permit #2020-014). In addition, all methods were performed in accordance with the relevant guidelines and regulations. Explicit owner informed consent for inclusion of samples from included horses in this study was not sought but owners were aware that excess material from clinical samples would be retained for research; in general, and all owners have the option to opt out of research. In addition, all samples and clinical journals were handled anonymously. Consent for publication Not applicable. Availability of data and materials All data generated or analyzed during this study are included in the article and its supplementary files. Competing interests All authors declare no competing interest. Funding No funding was obtained for this study. Authors' contributions PRH designed the overall study, analyzed the results and drafted the final manuscript. VKJ carried out the laboratory analysis of the nasal swabs and serum samples, obtained the clinical journals, analyzed the results and contributed to the final manuscript. MMC carried out the sequencing, sequencing analysis, analyzed the results and approved the final manuscript, LEL helped in the design of the overall study and contributed to the final manuscript and SH designed the overall study, analyzed the results and contributed to the final manuscript. Acknowledgements We acknowledge all owners of the horses that contributed to this study. References Azab W, Kato K, Abdel-Gawad A, Tohya Y, Akashi H. Equine herpesvirus 4: Recent advances using BAC technology. Vet Microbiol. 2011 May 12;150(1–2):1–14. Badenhorst M, Page P, Ganswindt A, Laver P, Guthrie A, Schulman M. Detection of equine herpesvirus-4 and physiological stress patterns in young Thoroughbreds consigned to a South African auction sale. BMC Vet Res [Internet]. 2015 Jun 2 [cited 2023 Mar 29];11(1). Available from: /pmc/articles/PMC4450643/ Pavulraj S, Eschke K, Theisen J, Westhoff S, Reimers G, Andreotti S, et al. Equine herpesvirus type 4 (Ehv-4) outbreak in germany: Virological, serological, and molecular investigations. Pathogens [Internet]. 2021 Jul 1 [cited 2023 Mar 29];10(7). Available from: /pmc/articles/PMC8308676/ Izume S, Kirisawa R, Ohya K, Ohnuma A, Kimura T, Omatsu T, et al. The full genome sequences of 8 equine herpesvirus type 4 isolates from horses in Japan. J Vet Med Sci [Internet]. 2017 Jan 1 [cited 2023 Mar 29];79(1):206. Available from: /pmc/articles/PMC5289262/ Vaz PK, Horsington J, Hartley CA, Browning GF, Ficorilli NP, Studdert MJ, et al. Evidence of widespread natural recombination among field isolates of equine herpesvirus 4 but not among field isolates of equine herpesvirus 1. J Gen Virol [Internet]. 2016 Mar 1 [cited 2023 Mar 29];97(Pt 3):747. Available from: /pmc/articles/PMC5381393/ Cuxson JL, Hartley CA, Ficorilli NP, Symes SJ, Devlin JM, Gilkerson JR. Comparing the genetic diversity of ORF30 of Australian isolates of 3 equid alphaherpesviruses. Vet Microbiol. 2014 Feb 21;169(1–2):50–7. Radalj A, Milic N, Stevanovic O, Nisavic J. The detection and phylogenetic analysis of equine herpesviruses 1, 4 and 5 identified in nasal swab samples of asymptomatic horses from Serbia and Bosnia and Herzegovina. Vet Ital [Internet]. 2021 May 20 [cited 2023 Mar 29];57(4):265–74. Available from: https://pubmed.ncbi.nlm.nih.gov/35593499/ Pusterla N, James K, Barnum S, Bain F, Barnett DC, Chappell D, et al. Frequency of Detection and Prevalence Factors Associated with Common Respiratory Pathogens in Equids with Acute Onset of Fever and/or Respiratory Signs (2008–2021). Pathogens [Internet]. 2022 Jul 1 [cited 2023 Mar 29];11(7). Available from: /pmc/articles/PMC9317490/ Ma G, Azab W, Osterrieder N. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)--masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol [Internet]. 2013 Nov [cited 2023 Mar 29];167(1–2):123–34. Available from: https://pubmed.ncbi.nlm.nih.gov/23890672/ Pusterla N, Leutenegger CM, Wilson WD, Watson JL, Ferraro GL, Madigan JE. Equine herpesvirus-4 kinetics in peripheral blood leukocytes and nasopharyngeal secretions in foals using quantitative real-time TaqMan PCR. J Vet Diagn Invest [Internet]. 2005 [cited 2023 Mar 29];17(6):578–81. Available from: https://pubmed.ncbi.nlm.nih.gov/16475518/ El-Hage C, Mekuria Z, Dynon K, Hartley C, McBride K, Gilkerson J. Association of Equine Herpesvirus 5 with Mild Respiratory Disease in a Survey of EHV1, -2, -4 and -5 in 407 Australian Horses. Anim an open access J from MDPI [Internet]. 2021 Dec 1 [cited 2023 Mar 29];11(12). Available from: https://pubmed.ncbi.nlm.nih.gov/34944194/ Pusterla N, Mapes S, David Wilson W. Prevalence of latent alpha-herpesviruses in Thoroughbred racing horses. Vet J [Internet]. 2012 Aug [cited 2023 Mar 29];193(2):579–82. Available from: https://pubmed.ncbi.nlm.nih.gov/22405721/ Patel JR, Földi J, Bateman H, Williams J, Didlick S, Stark R. Equid herpesvirus (EHV-1) live vaccine strain C147: Efficacy against respiratory diseases following EHV types 1 and 4 challenges. Vet Microbiol [Internet]. 2003 Mar 20 [cited 2023 Sep 5];92(1–2):1–17. Available from: https://pubmed.ncbi.nlm.nih.gov/12488066/ Pusterla N, Bain F, James K, Mapes S, Kenelty K, Barnett DC, et al. Frequency of molecular detection of equine herpesvirus-4 in nasal secretions of 3028 horses with upper airway infection. Vet Rec [Internet]. 2017 Jun 17 [cited 2023 Apr 3];180(24):593. Available from: https://pubmed.ncbi.nlm.nih.gov/28386031/ Xie J, Tong P, Zhang L, Ren M, Song X, Jia C, et al. First detection and genetic characterization of equid herpesvirus 2, 4, and 5 in China. Arch Virol [Internet]. 2021 May 1 [cited 2023 Apr 3];166(5):1421–6. Available from: https://pubmed.ncbi.nlm.nih.gov/33656577/ Kydd JH, Townsend HGG, Hannant D. The equine immune response to equine herpesvirus-1: The virus and its vaccines. [cited 2023 Sep 13]; Available from: www.elsevier.com/locate/vetimm Sellon DC, Long MT. Equine infectious diseases. 2013. Dayaram A, Seeber PA, Greenwood AD. Environmental Detection and Potential Transmission of Equine Herpesviruses. Pathogens [Internet]. 2021 Apr 1 [cited 2023 Apr 4];10(4). Available from: /pmc/articles/PMC8066653/ Saklou NT, Burgess BA, Ashton L V., Morley PS, Goehring LS. Environmental persistence of equid herpesvirus type-1. Equine Vet J [Internet]. 2021 Mar 1 [cited 2023 Mar 31];53(2):349–55. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/evj.13313 Dayaram A, Franz M, Schattschneider A, Damiani AM, Bischofberger S, Osterrieder N, et al. Long term stability and infectivity of herpesviruses in water. Sci Rep [Internet]. 2017 [cited 2023 Apr 4];7. Available from: /pmc/articles/PMC5399353/ Pusterla N, Rice M, Henry T, Barnum S, James K. Investigation of the Shedding of Selected Respiratory Pathogens in Healthy Horses Presented for Routine Dental Care. https://doi.org/101177/0898756420949135 [Internet]. 2020 Aug 25 [cited 2023 Apr 4];37(2):88–93. Available from: https://journals.sagepub.com/doi/10.1177/0898756420949135 AAEP. General Biosecurity Guidelines [Internet]. Guideline. 2022 [cited 2022 Apr 1]. p. 1–17. Available from: https://aaep.org/document/general-biosecurity-guidelines QIAGEN. QIAamp® DNA Mini and Blood Mini Handbook [Internet]. 2016. p. 72. Available from: https://www.qiagen.com/us/resources/resourcedetail?id=62a200d6-faf4-469b-b50f-2b59cf738962&lang=en Indical bioscience. Handbook SVANOVIR EHV1/EHV4-Ab [Internet]. 2021. Available from: https://shop.indical.com/index.php? cl=details&anid=2b05cf3ab758820ec001dd7d8813152b&f orce_admin_sid=o5pe7kkq49cvinffcq4tqhorg3&st oken=93014DE9&shp=1&preview=e7d04d86fd89153f68a4a3f88edf4b41 Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics [Internet]. 2018 Sep 1 [cited 2023 Aug 4];34(17):i884–90. Available from: https://dx.doi.org/10.1093/bioinformatics/bty560 Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics [Internet]. 2009 Jul [cited 2023 Aug 4];25(14):1754–60. Available from: https://pubmed.ncbi.nlm.nih.gov/19451168/ Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. 2013 Mar 16 [cited 2023 Aug 4]; Available from: https://arxiv.org/abs/1303.3997v2 Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience [Internet]. 2021 Jan 29 [cited 2023 Aug 4];10(2):1–4. Available from: https://dx.doi.org/10.1093/gigascience/giab008 Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol [Internet]. 2013 Apr [cited 2023 Aug 4];30(4):772. Available from: /pmc/articles/PMC3603318/ Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics [Internet]. 2009 Aug 8 [cited 2023 Aug 4];25(15):1972. Available from: /pmc/articles/PMC2712344/ Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol Biol Evol [Internet]. 2015 Jan 1 [cited 2023 Aug 4];32(1):268–74. Available from: https://dx.doi.org/10.1093/molbev/msu300 Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 2017 146 [Internet]. 2017 May 8 [cited 2023 Aug 4];14(6):587–9. Available from: https://www.nature.com/articles/nmeth.4285 C. Edgar R. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 2013 [cited 2019 Jun 27]; Available from: https://findit.dtu.dk/en/catalog/2354275506 Additional Declarations No competing interests reported. Supplementary Files AdditionalFile1.docx AdditionalFile2.docx AdditionalFile3.docx AdditionalFile4.docx AdditionalFile5.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 25 Jan, 2024 Reviews received at journal 27 Nov, 2023 Reviewers agreed at journal 17 Nov, 2023 Reviews received at journal 14 Nov, 2023 Reviewers agreed at journal 08 Nov, 2023 Reviewers agreed at journal 30 Oct, 2023 Reviewers agreed at journal 30 Oct, 2023 Reviewers agreed at journal 27 Oct, 2023 Reviewers invited by journal 27 Oct, 2023 Editor invited by journal 23 Oct, 2023 Editor assigned by journal 26 Sep, 2023 Submission checks completed at journal 26 Sep, 2023 First submitted to journal 22 Sep, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3376825","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":236051485,"identity":"c2f50699-7e9f-464b-bb23-c477c0e9603c","order_by":0,"name":"Pia Ryt-Hansen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYDACZhCqALESmEFcAyK1nCFJC0gZYxspWszZmZ99LpxXl7idPYHZmIfB2pigFstmNuPZM7cdTtzZ84A5mYch3YygFoPDDMbMvNsOJG64kcB8mIfhsA0RWtg/M/POqSNJCw/QlgZmsBagww4TdphlM08xM8+xw8YbzjxsNpxjkE7Y++b8xzcz89TUyW44nnxY4k2FtWEDQYchmIwNKFxitIyCUTAKRsEowAEANdA0k2KjMD8AAAAASUVORK5CYII=","orcid":"","institution":"University of Copenhagen","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Pia","middleName":"","lastName":"Ryt-Hansen","suffix":""},{"id":236051486,"identity":"965c805f-4150-4fee-841a-0fbb42c8cf30","order_by":1,"name":"Victoria Kyhl Johansen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Victoria","middleName":"Kyhl","lastName":"Johansen","suffix":""},{"id":236051487,"identity":"ae1fdf10-af61-4a17-8752-d6bb42b6aed4","order_by":2,"name":"Marta Maria Cuicani","email":"","orcid":"","institution":"Statens Serum Institut","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Marta","middleName":"Maria","lastName":"Cuicani","suffix":""},{"id":236051488,"identity":"403e510a-794e-4c3e-91f3-a198be32b2cc","order_by":3,"name":"Lars Erik Larsen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lars","middleName":"Erik","lastName":"Larsen","suffix":""},{"id":236051489,"identity":"0b20d96b-de04-4e38-ab04-00a397333790","order_by":4,"name":"Sanni Hansen","email":"","orcid":"","institution":"University of Copenhagen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sanni","middleName":"","lastName":"Hansen","suffix":""}],"badges":[],"createdAt":"2023-09-22 07:59:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3376825/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3376825/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":44037784,"identity":"0de2e934-6632-4c06-9a79-a835290e82dd","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":442373,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTimeline of the hospitalizations and EHV-4 detections of Eq1-Eq10.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe figure illustrates the duration of hospitalization of each of the ten horses (grey) and period from when each horse had its first nasal swab collected that tested EHV-4 positive until the last collected nasal swab tested positive (red). The black horizontal line represents the timeline of the study from April-July 2022. The specific dates of the collection of the nasal swabs are indicated underneath the timelines of each horse. The qPCR test results are both derived from the analyses performed at Laboklin and VCM, and negative PCR results within the “detection period” (red) are not included. The horses are illustrated as either foals ≤1 year old (foal symbol) or adult horses \u0026gt; 1 year old (horse symbol).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/32397ec71ac5d9a7b971824d.png"},{"id":44037785,"identity":"7d2a083d-8c70-44a6-b885-fbfd95bcd097","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":299570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverview of different stables of the Large Animal Teaching Hospital and the location of the horses at their initial EHV-4 positive test.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe figure represents a simplified overview of the different stables at the Large Animal Teaching Hospital, the true distances are not illustrated but white areas indicate that the stables are in separate buildings. Additional horses were housed in the same stables of the hospital during the outbreak, but only EHV-4 positive horses are included in this figure. “Iso1” and “Iso2” indicates the isolation units and “Out” indicates outdoor stables with open boxes to the outside. The location of Eq10 at its initial hospitalization is also included even though it was not tested for EHV-4 at this time.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/82a9a5a8a0f97ce9a2935226.png"},{"id":44038360,"identity":"f93e0a70-7d2e-4543-9644-385aff561845","added_by":"auto","created_at":"2023-10-03 18:16:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1673463,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenomic characterization of Eq7.\u003cbr\u003e\nA)\u003c/strong\u003e Depth distribution across the genome. \u003cstrong\u003eB)\u003c/strong\u003e Violin plot showing the average depth of coverage. \u003cstrong\u003eC)\u003c/strong\u003e Plot showing the breadth of coverage at 1x, 5x, 10x, 50x and 100x. The red dotted line represents a threshold of 99%. \u003cstrong\u003eD)\u003c/strong\u003e Maximum likelihood tree based on the whole genome sequencing data from the sample Eq7 and the 27 reference sequences available from NCBI Genbank. The bootstrap support is shown at the base of each node. The accession number of each reference sequence is indicated in the taxon.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/5fc4556a05a79b95ffc89e2f.png"},{"id":44037789,"identity":"81bb175d-b5f5-42ee-9010-9f11ba6cce46","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":786134,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of the partial ORF30 sequences of Eq7, Eq8 and Eq10.\u003c/strong\u003e\u003cbr\u003e\nPairwise distance plot of the three partial ORF30 EHV-4 sequences obtained from the three Danish horses (Eq7, Eq8 and Eq10) and two selected German reference sequences with the NCBI Genbank accession numbers: MW892436 and MW892438. The bottom section of the plot shows the count of nucleotide differences while the upper part shows the percentage of identity among the sequences.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/87f8678bf7daf63992879639.png"},{"id":44038443,"identity":"7959d004-e3cb-47eb-8b76-28944839200d","added_by":"auto","created_at":"2023-10-03 18:24:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1171794,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/6a3ce339-18ff-485f-a3ec-4fa1ca604464.pdf"},{"id":44037790,"identity":"ae1d6558-4056-4d91-98c1-00708ecc6179","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":29635,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFile1.docx","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/03f5108bbfc3cb1012771e0e.docx"},{"id":44037786,"identity":"2fb43749-db21-4d3f-ba12-e544b36f06ea","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":17458,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFile2.docx","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/46fb1c334de531e456f77b33.docx"},{"id":44037791,"identity":"e99fab4a-5bf3-48ef-97cc-6a00372dda3a","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":58354,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFile3.docx","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/ef472754ba20d81da5de4d0c.docx"},{"id":44037787,"identity":"ecbe5fb3-496d-45a4-ba14-7bdb9993373e","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":21832,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFile4.docx","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/36702a91d307a24d7582d910.docx"},{"id":44037792,"identity":"e060642e-0660-4df0-b04c-173d6914df45","added_by":"auto","created_at":"2023-10-03 18:08:56","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":16879,"visible":true,"origin":"","legend":"","description":"","filename":"AdditionalFile5.docx","url":"https://assets-eu.researchsquare.com/files/rs-3376825/v1/e7c401b0aba9fa5584ecbe18.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization","fulltext":[{"header":"Background","content":"\u003cp\u003eIn the family of \u003cem\u003eHerpesviridae\u003c/em\u003e, nine equine herpesviruses (EHV-1-EHV-9) have been defined, with EHV-1, EHV-3, EHV-4, EHV-6, EHV-8 and EHV-9 belonging to the subfamily of \u003cem\u003eAlphaherpesvirinae\u003c/em\u003e (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). EHV-1 and EHV-4 are two important agents in relation to upper respiratory tract infections in horses (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). The two viruses are closely related both genetically and antigenically with considerable level of immunological cross reactivity (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). However, EHV-1 distinguishes from EHV-4 by frequent induction of abortions and neurological disease (\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe genome of EHV-4 consists of linear double stranded DNA, approximately 145 kilo base pairs (kbp) in length. The genome contains 79 open reading frames (ORFs) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) encoding 76 homologous genes, with three genes (ORF 64, 65 and 66) which are duplicated within the repeat regions (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral studies have performed whole genome sequencing (\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e), whereas other studies solely focused on sequencing of ORF30 and ORF33 (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e), encoding a catalytic subunit of replicative DNA polymerase and an envelope glycoprotein, respectively. Whole genome sequencing analysis have shown 98.9\u0026ndash;99.9% shared nucleotide identity among different Australian EHV-4 strains, corresponding to 179 single nucleotide polymorphisms (SNPs) (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Conversely, a German outbreak at a breeding stable revealed 99.9% identity corresponding to 76\u0026ndash;98 SNPs (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eEHV-4 infection can lead to respiratory disease (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e) with clinical symptoms including lethargy, anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e) with a duration between two and 14 days (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Clinical disease is most often reported in foals and youngsters (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). EHV-4 is transmitted by aerosols and by direct contact (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Studies have reported a seroprevalence of \u0026gt;\u0026thinsp;80% in different geographical locations (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). A key property of EHV-4 is its ability to establish latent infections. One study revealed that 56/70 horses, euthanized due to none-infectious causes, tested EHV-4 positive in the trigeminal ganglia (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Following the establishment of latency, EHV-4 can be periodically reactivated due to stressors such as transport, new environment etc., with recrudescence and shedding of EHV-4 as a result (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe aims of this study was to characterize the outbreak strain of an EHV-4 outbreak and to describe the transmission and clinical disease related to an acute EHV-4 at a referral hospital.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReal-time qPCR results of nasal swabs (Laboklin and VCM analyses)\u003c/h2\u003e \u003cp\u003eInitially, the first three horses showing clinical symptoms of respiratory disease (Eq.\u0026nbsp;1, Eq.\u0026nbsp;2 and Eq.\u0026nbsp;3) all tested positive for EHV-5 and Streptococcus Equi Subsp. Zooepidemicus in addition to them being EHV-4 positive. Additional four horses tested EHV-4 positive after 4\u0026ndash;5 days, and the last two horses, 8 and 13 days after the first EHV-4 positive horse, respectively (Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003eEq10 was referred to the hospital for the first time, while the last EHV-4 positive horses (Eq.\u0026nbsp;2) was still isolated in the quarantine. However, Eq.\u0026nbsp;10 was re-admitted to the hospital 17 days after Eq.\u0026nbsp;2 tested EHV-4 positive for the last time.\u003c/p\u003e \u003cp\u003eThree horses did not have consecutive positive EHV-4 tests during the \u0026ldquo;infection period\u0026rdquo;. A nasal swab from Eq.\u0026nbsp;2 tested negative (Laboklin), with four positive EHV-4 tests prior and four positive EHV-4 tests following. Almost four weeks later, the same horse had another negative EHV-4 test followed by a positive EHV-4 test three days later. Eq.\u0026nbsp;4 also had a negative EHV-4 test results on nasal swab, with two positive test prior and four positive EHV-4 test during the following weeks. May 16, two nasal swab were collected from horse Eq.\u0026nbsp;8, one nasal swab had a negative EHV-4 test from Laboklin, and the other swab showed a high Ct value of 35.05 when tested at VCM. For Eq.\u0026nbsp;8, nasal swab obtained at three consecutive samplings prior and on one sampling occasion, three days after this date were all EHV-4 positive. All serum tested for the presence of EHV-4 by qPCR were negative, except for Eq.\u0026nbsp;2, that had one blood sample obtained the 5th of May, with a Ct value of 34.49. A detailed overview of the real-time qPCR results from both laboratories are shown in Additional File 1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ePre- and post-infection antibody responses\u003c/h2\u003e \u003cp\u003eThe ELISA results of the pre- and post-infection sera revealed that only three of the ten horses were na\u0026iuml;ve to EHV-4 antibodies at the time of arrival at the hospital (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These were all foals being between ten months to one year of age (Additional File 2). Two of these horses subsequently tested positive in the ELISA following EHV-4 infection, whereas the last horse remained negative. However, the post-infection sera of this horse was only obtained only eight days after the initial EHV-4 positive test result. The remaining seven horses were seropositive already upon arrival. In total, seven horses showed an increase in EHV-4 antibodies following infection. Seven out of the ten horses from the outbreak had an OD value\u0026thinsp;\u0026lt;\u0026thinsp;1.0 at arrival at the hospital, whereas eight of the horses had an OD value\u0026thinsp;\u0026gt;\u0026thinsp;1.0 post infection, with seven of them being \u0026gt;\u0026thinsp;2.0.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eEHV-4 antibody ELISA results of the sera obtained from the ten horses pre- and post-infection presented as corrected OD-values.\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePre-infection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePost first positive EHV-4 test (days)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.976 (22)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.062\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.287 (7) 2.557 (20) 2.886 (26)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.022\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.052 (8)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.995\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.925 (16) 2.762 (23)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.817\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.095 (16)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.683\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.583 (16)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.081\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.223 (15) 2.212 (81)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.946 and 1.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.212\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.023 (8) 2.024 (14)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEq10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.677 and 0.707\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.731 (4)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor the post-infection sera the number of days after the initial EHV-4 positive real-time qPCR test results are presented in the parenthesis. Antibody negative samples are marked with bold letters. The pre-infection sera were obtained at arrival, but for Eq.\u0026nbsp;8 and Eq.\u0026nbsp;10 additional pre-infection sera were also analyzed. In addition, Eq.\u0026nbsp;2, Eq.\u0026nbsp;4, Eq.\u0026nbsp;7 and Eq.\u0026nbsp;9 had several post-infection sera analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eClinical signs\u003c/h2\u003e \u003cp\u003e \u003cem\u003eC\u003c/em\u003elinical signs related to the ten EHV-4 infected horses during the outbreak included pyrexia, mandibular lymphadenopathy, nasal discharge, coughing and increased lung sounds and are listed for each horse in Additional File 3. The reason for admission to the Large Animal Teaching Hospital and other clinical signs observed during their hospitalization can be found in Additional File 2. It should be noted that 2/10 horses showed anorexia and 5/10 horses had ocular discharge. Based on clinical signs, the ten infected horses could be divided into three groups. One group, including horses above the age of ten being subclinically to mildy affected, which consisted of three horses without clinical signs of respiratory disease, or only one day with reported nasal discharge (Eq.\u0026nbsp;4, Eq.\u0026nbsp;5 and Eq.\u0026nbsp;9). The second group consisted of horses below one year of age that were moderately affected characterized by being subfebrile and with mandibular lymphadenopathy, nasal discharge, and increased lung sounds (Eq.\u0026nbsp;1, Eq.\u0026nbsp;2 and Eq.\u0026nbsp;6). Eq.\u0026nbsp;1 and Eq.\u0026nbsp;2 also had two and one day of mild fever, respectively and Eq.\u0026nbsp;2 had several days with coughing registered. The third group included horses between 11 months to 2 years, except from a 7-year-old horse (Eq.\u0026nbsp;10) being severely affected with pyrexia for three-five days, nasal discharge and increased lung sounds (Eq.\u0026nbsp;3, Eq.\u0026nbsp;7, Eq.\u0026nbsp;8 and Eq.\u0026nbsp;10). None of the severely affected horses had mandibular lymphadenopathy. Eq.\u0026nbsp;10 had a high fever for four days during hospitalization and was reported with a high fever for several days prior to the second admission to the hospital.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTracing movements of the horses\u003c/h2\u003e \u003cp\u003eEq1 stabled in box 32 E, and Eq.\u0026nbsp;3 stabled in the outside box, were the first two horses to test positive for EHV-4 (Fig.\u0026nbsp;2). The horses were transferred to the isolation unit 1 following their first EHV-4 positive test, and remained there until tested negative. Eq.\u0026nbsp;2, Eq.\u0026nbsp;4 and Eq.\u0026nbsp;5 were all housed in stable E, and were moved to isolation units 1 or 2. The horses remained individual isolated until being discharged from the hospital. Stable E was \u0026ldquo;closed down\u0026rdquo; for intake of patients during most of the outbreak. Initially, to quarantine other close-contact horses that had been in contact with the first positive confirmed infected horse, and later in the outbreak period, it became isolation unit due to lack of space in the isolation unit. Eq.\u0026nbsp;6 remained in stable E during its entire hospitalization. Eq.\u0026nbsp;7 and Eq.\u0026nbsp;9 was initially in stable D, but when testing positive for EHV-4, they were moved to the isolation unit 1 and 2, respectively. Eq.\u0026nbsp;8 was initially in the intensive care unit (stable A), until it developed clinical signs of disease, and was then moved to the isolation unit 2. The remaining horses in stable A subsequently tested negative for EHV-4. Eq.\u0026nbsp;10, was initially hospitalized for minor surgery of skin tumors, and was stabled in stable D during its hospitalization. It was stabled in a box that no EHV-4 positive horse had been placed during the outbreak and with over a month since the last EHV-4 positive horse had been in that specific stable. At the time of surgery of Eq.\u0026nbsp;10, all but one horse from the outbreak had been discharged, and the last EHV-4 infected horse was, as mentioned earlier, stabled in the isolation unit 1. Eq.\u0026nbsp;10 was discharged from the hospital three days following the surgery. When the horse was re-admitted to the hospital six days later, showing clinical signs of disease, it was stabled in isolation unit 1 upon arrival. Biosecurity was upregulated during the outbreak to limit contamination and transmission. The horses were stabled in green, yellow and red zones, with different personnel for each section and in the yellow and red zone, the personnel had to wear protective clothing, changing between each individual horses.\u003c/p\u003e \u003cp\u003eUntil the first EHV-4 positive test results, the hospitalized horses were taken out of their boxes to be examined and exercised, thereby introducing possible transmission routes. However, during the outbreak, infected or close-contact horses were only taken to an examination room in urgent circumstances and with proper disinfection and rest time after. Within the stables A, E and D the horses can have indirect contact with the horses in neighboring boxes and with shared airspace, with walls of the box being around 2.5 meters high, and with wooden planks separating the boxes. In addition, larger horses will be able to come in direct contact if they stretch their necks over the separating walls between boxes. The outdoor boxes also had shared airspace, but with no possibility for either indirect or direct contact. The boxes of the isolation units were completely separated from each other, so that the horses could not have any contact, although still with shared airspace.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eVirus isolation in cells\u003c/h2\u003e \u003cp\u003eFollowing four passages in the Equine dermal cells, a viral isolate was successfully obtained from Eq.\u0026nbsp;7 with a Ct value of 12.4 in the real-time qPCR carried out at VCM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnalyses of the complete EHV-4 genome of the Danish outbreak strain\u003c/h2\u003e \u003cp\u003eWe successfully obtained a complete genome from the viral isolate of Eq.\u0026nbsp;7 accession number: OR576810 in NCBI GenBank. The raw data contained\u0026thinsp;~\u0026thinsp;23.000 paired end reads which after filtering and mapping remained\u0026thinsp;~\u0026thinsp;4700 reads with a proportion of endogenous content equal to 20.6%. After mapping and filtering the average coverage of the sample was approx. 169x (Fig.\u0026nbsp;3A and B) with 99.87% of the genome that was covered at least 1x, 99.55% was covered 5x, 99.03% was covered 10x and 94.85% was covered 50x (Fig.\u0026nbsp;3C). Low coverage regions (below 25x) were specifically identified in areas associated to repeated regions in the Irish reference genome and were more prevalent towards the end of the genome (Fig.\u0026nbsp;3A). The consensus genome for Eq.\u0026nbsp;7 was generated and used together with one Irish, four German, eight Japanese and 14 Australian whole genome sequences to build a full genome phylogeny. The Maximum Likelihood tree was highly supported and revealed the Danish EHV-4 genome as closest to a cluster of sequences from Japan and Australia (Fig.\u0026nbsp;3D). The number of nucleotide dissimilarity between our sample (Eq.\u0026nbsp;7) and the rest of the full genome sequences in the dataset ranged from 348 to 782 bases with the highest sequence identity to Equid alphaherpesvirus 4 isolate 405\u0026thinsp;\u0026minus;\u0026thinsp;76 from Australia (NCBI Genbank accession number: KT324740).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eAnalyses of the partial ORF30 sequences\u003c/h2\u003e \u003cp\u003eIn total, 2870 nts of the ORF30 were successfully obtained from three of the EHV-4 infected horses including Eq.\u0026nbsp;7 (accession number OR532440), Eq.\u0026nbsp;8 (accession number OR532439) and Eq.\u0026nbsp;10 (accession number OR532441). Subsequently, a pairwise comparison was performed including the three partial ORF30 sequences. The results of this sequence comparison revealed that the ORF30 of two of the horses Eq.\u0026nbsp;7 and Eq.\u0026nbsp;8 were 100% identical, whereas the sequence of Eq.\u0026nbsp;10 showed six nucleotide differences compared to Eq.\u0026nbsp;7 and Eq.\u0026nbsp;8. The partial ORF30 sequences were also compared to two German reference sequences obtained from another outbreak. These two German sequences were also 100% identical to each other, while only four nucleotide differences were observed to Eq.\u0026nbsp;7 and Eq.\u0026nbsp;8 and six nucleotide differences were found to Eq.\u0026nbsp;10 (Fig.\u0026nbsp;4).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion and conclusions","content":"\u003cp\u003eOn average, the EHV-4 infected foals and horses included in this study tested PCR positive on nasal swabs for viral DNA for approximately 17 days. This is in accordance with a recent study showing that 75% of EHV-4 infected foals shed virus for 14 days, measured by PCR in nasal swabs (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) and another revealing that foals shed high levels of EHV-4 viral DNA for approx. four weeks in nasal swabs (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). The same study found that EHV-4 could only be detected in the peripheral blood leukocytes shortly at the beginning of infection, and with very low concentration when compared to the amount of virus in nasal swabs, which correlated well with the fact that only one serum sample in our study tested weakly positive for EHV-4. However, the detection in the blood did correlate with a positive nasal swab obtained at the same day.\u003c/p\u003e \u003cp\u003eDetection of the EHV-4 by PCR in nasal swab do not necessary correlate with shedding of infectious virus. In a previous study, detection of EHV-4 mRNA as a measure of active replication correlated well with both clinical signs and detection of high levels of EHV-4 DNA and lasted for approximately 7 days (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e), whereas another study showed that EHV-4 could be isolated in cell culture for up to three days after experimental infection (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). None of these methods can precisely predict the period where infected horses can transmit the virus on to other horses because the PCR tests may pick of reminiscence of non-infectious viral RNA and the detection limit of the cell culture isolations is probably above the infectious dose. Furthermore, the infectious dose will depend on a variety of individual host -and environmental factors. Nevertheless, based on our findings, the epidemiological information and results of previous studies it is reasonable to estimate that on average an infected horse may transmit the virus on to other susceptible horses 2–9 days after infection, but there will be significant individual differences.\u003c/p\u003e \u003cp\u003eAs observed in previous studies, the EHV-4 infected horses of the Danish outbreak presented with clinical signs such as anorexia, pyrexia, mandibular lymphadenopathy, coughing and nasal discharge (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The majority of the ten horses showed nasal discharge, lymphadenopathy and increased lung sounds and 8/10 horses were either subfebrile or had pyrexia during their infection. An additional observation in this Danish outbreak, was that 50% of the horses also had ocular discharge, which was also reported by an American study (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFive of the ten infected horses in the Danish outbreak were younger than one year, which is slightly higher than the prevalence observed in other studies ranging from 35–46% of the infected horses (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). However, an outbreak in China showed that only foals was infected (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). In our study, it was observed that the horses classified as subclinical to mildly affected all were all above ten years old. However, Eq.\u0026nbsp;10 who was seven years old, were among the four horses with the most severe clinical signs. The remaining three horses most severely affected were all between 11 months and two years of age. This indicate that not only the age is a key factor for severity and development of symptoms, but also co-infections and/or the immune status at the time of infection could play an important role in the evolution of disease. Interestingly, the four most severely affected horses all had a relatively low EHV-4 pre-infection antibody levels.\u003c/p\u003e \u003cp\u003eThe three horses that were EHV-4 naïve upon arrival at the hospital were all ≤ 1 year old, thereby making it likely that they did not encounter EHV-4 before. The vaccination status of the included horses in this study was unknown, but foals are seldom EHV vaccinated in Denmark and the ELISA also tested for EHV-1 antibodies and all horses tested negative indicating that they had not been vaccinated with the EHV-1/EHV-4 vaccine available in Denmark. The seroprevalence of 70% found in our study corresponded well to the approx. 80% seroprevalence found in a German study (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Two of the three antibody negative horses seroconverted after the EHV-4 infection, whereas the third horse remained seronegative, probably because the blood sample was obtained only eight days following the first EHV-4 positive test, which may be before a detectable antibody response can be detected. An increase in OD-value was observed in five out of six horses, from which a post-infection serum sample was obtained. The majority of the post-infection sera was obtained two-three weeks after the first EHV-4 positive nasal swab. Interestingly an 81 days post-infection serum sample from Eq.\u0026nbsp;7 was obtained with no significant decrease in the OD-value compared to the sample taken 66 days earlier.\u003c/p\u003e \u003cp\u003eBased on the viral detections, antibody responses, clinical registrations, stable locations and horse movement it was possible to identity Eq.\u0026nbsp;1 as a potential “patient zero” of the outbreak. Only two horses, Eq.\u0026nbsp;1 and Eq.\u0026nbsp;9, had high levels of EHV-4 antibody titer at arrival to the hospital, indicating that they could have an active EHV-4 infection or re-activation of latent EHV-4 virus due to stress induced by recent disease, transportation and/or hospitalization. Re-activation is known to cause a boost of prior EHV-4 antibody response resulting in the high antibody levels observed (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). As Eq.\u0026nbsp;9 was hospitalized several days after the first three confirmed EHV-4 cases this horse was ruled out as patient zero.\u003c/p\u003e \u003cp\u003eThe first horses to present with EHV-4 positive nasal swabs and clinical signs of disease were Eq.\u0026nbsp;1, Eq.\u0026nbsp;2 and Eq.\u0026nbsp;3. Eq.\u0026nbsp;2 and Eq.\u0026nbsp;3 were both negative for EHV-4 antibodies at arrival to the hospital, however, a rise in antibodies post infection is not measurable until 8–10 days after infection (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Eq.\u0026nbsp;2 and/or Eq.\u0026nbsp;3 could therefore possibly have been infected shortly before being hospitalized and can thereby not be entirely ruled out as patient zero. Nevertheless, the fact that Eq.\u0026nbsp;1 were among the first to show clinical signs combined with its antibody positive status point at this horse being patient zero. Noteworthy is also that Eq.\u0026nbsp;6 also showed clinical signs of disease at an early point and had a relatively high level of antibodies at arrival at the hospital, however, this horse was not tested until a week after the three first confirmed EHV-4 cases. Interestingly, Eq.\u0026nbsp;6 originated from the same premise as Eq.\u0026nbsp;1, and the two horses were transported and admitted to the hospital together.\u003c/p\u003e \u003cp\u003eFive out of ten horses were stabled in stable E, where two of the first EHV-4 positive horses were located, this creating a high-risk environment for transmission both by direct contact trough aerosols (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) or indirect contact such as personal, use of the same equipment, examination rooms and feeding trucks. In addition, equine herpesviruses are also known to be transmitted to some extent trough aerosols (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Neither Eq.\u0026nbsp;3, Eq.\u0026nbsp;7 nor Eq.\u0026nbsp;8 were stabled in stable E and may have encountered viral transmission by indirect contact. EHV-1 has been shown to persist in the environment for up to 48 hours (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) and for three weeks in water (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Eq.\u0026nbsp;9 was initially located in stable D, where Eq.\u0026nbsp;7 was present at time of infection thereby providing a transmission route. Eq.\u0026nbsp;10 was hospitalized two months after the beginning of the EHV-4 outbreak at a time where only one prior EHV-4 infected horse was present at the hospital and this horse was kept in the isolation unit. The results of the partial ORF30 sequencing further confirms that Eq.\u0026nbsp;10 was indeed infected with another EHV-4 strain than the one related to the outbreak, as the sequences of Eq.\u0026nbsp;7 and Eq.\u0026nbsp;8 only showed 99.79% sequence identity to that of Eq.\u0026nbsp;10, which is equal to the genetic difference between German, Australian and Japanese sequences (Pavulraj et al 2021) (Fig.\u0026nbsp;3). On the contrary, the sequence identity of Eq.\u0026nbsp;7 and Eq.\u0026nbsp;8 were 100%. This strongly suggests that the EHV-4 genome from Eq.\u0026nbsp;10 was not the same virus strain as the outbreak strain, but another wild type virus, indicating that the internal biosecurity measures at the hospital was able to eliminate the outbreak virus. The presence of another EHV-4 positive horse infected with a different strain emphasize that EHV-4 infections are relatively common, and that it is important to have good biosecurity plans especially in equine hospitals where several horses are housed together, have co-morbidities and high stressors that can re-activate a latent EHV-4 infection.\u003c/p\u003e \u003cp\u003eThe first tested horses also tested positive for co-infections for EHV-5 and Streptococcus Equi subsp. Zooepidemicus. Both pathogens are known commensals, but can potentially enhance disease (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Interestingly, the three horses with the co-infection belonged to the moderately or severely clinically affected groups. A recent study by Pusterla et al showed that 20% of EHV-4 infected horses were co-infected with one or multiple of the following pathogens: Equine Influenza virus, Streptococcus Equi subsp. Equi and Equine Rhinitis virus (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e) but the horses of that study were not tested for Streptococcus Equi subsp. Zooepidemicus or EHV-5.\u003c/p\u003e \u003cp\u003eIn addition, a full genome sequence of EHV-4 isolated from Eq.\u0026nbsp;7 was generated and resulted to be more differentiated and basal to the Australian, Japanese and German cluster, and closer related to other Australian and Japanese cluster (Fig.\u0026nbsp;4). However, very few full genome EHV-4 sequences are available for comparison.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003c/div\u003e \u003c/div\u003e "},{"header":"Methods","content":"\u003ch2\u003eStudy design\u003c/h2\u003e\u003cp\u003eIncluded in the study were nine horses (mean age of five years), that were all part of an EHV-4 outbreak at a referral hospital in Denmark. The exact age and additional information are available in Additional File 3. Inclusion criteria was a minimum of one EHV-4 positive nasal swab analyzed by the commercial laboratory Laboklin, Germany. Horses hospitalized during the outbreak and tested negative for EHV-4 were not included in the study.\u003c/p\u003e\u003cp\u003eThe “outbreak period” defined as the period from the first horse tested EHV-4 positive (27th of April) until the last EHV-4 positive horse was discharged after testing negative lasted for a total of seven weeks (17th of June) with the last test positive horse testing positive June 10th. The given dates indicate the collection day of the nasal swab that later tested positive in the laboratory. Horses displaying clinical signs compatible with EHV-4, and close-contacts of infected horses, were all tested by nasal swabs send for analysis at a commercial laboratory. Isolation of EHV-4 positive horses and close-contact horses was initiated following the American Association of Equine Practitioners (AAEP) Biosecurity Guidelines (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). In addition, all EHV-4 positive horses were tested continuously until they tested negative. A selection of these samples was also tested at the Section of Veterinary Clinical Microbiology at the University of Copenhagen (VCM). Clinical files, stable/box locations and paraclinical test results were included from the infected horses.\u003c/p\u003e\u003cp\u003eAn additional horse, Eq.\u0026nbsp;10, initially hospitalized from the 15th -18th of June 2022 and re-admitted to the isolations facilities on June 24th due to pyrexia was also included into the study, as it tested positive for EHV-4 on the 27th of June. The clinical file and samples similar to the once described above was included for this horse. Additional file 4 describe the complete sample list.\u003c/p\u003e\u003ch2\u003eNasal swab for PCR\u003c/h2\u003e\u003cp\u003eNasal swabs for analyses at a commercial laboratory were obtained by the use of 15 cm long dry swabs (Kruuse, Denmark), passed as far as possible into the nasopharynx by the ventral meatus and rotated for 15–30 seconds. The swabs were inserted into an empty sterile container and kept in a refrigerator until being shipped and analyzed by the laboratory. The first samples were tested for a number of respiratory pathogens including: EHV-1, EHV-5, Streptococcus Equi subsp. Zooepidemicus and Streptococcus Equi subsp. Equi, Coronavirus and Influenza A, whereas the last samples were tested solely for the presence of EHV-4 by real time PCR. The time span between sampling and test results was approximately 3 working days. In addition to the nasal swabs obtained and analyzed by the commercial laboratory during the outbreak, additional nasal swabs (Medical Wire, Corsham, UK) were collected from the EHV-4 positive horses, for analysis at VCM. The swabs were subsequently immersed in Sigma Virocult Media (Medical Wire) and stored at minimum − 20°C until further analysis. In total, 28 nasal swabs were tested at VCM, which together with the results of the nasal swabs tested at Laboklin (n = 38) equaled 66 qPCR results on EHV-4 detection from the ten horses.\u003c/p\u003e\u003ch2\u003eClinical findings\u003c/h2\u003e\u003cp\u003eEach horse was clinically examined at least once daily. The following data was extracted from the files: rectal temperature, palpation of the mandibular lymphnodes (size and painfulness), the presence or not of nasal discharge (colour and viscocity), the presence of cough (yes/no), lung auscultation (normal/abnormal) and the presence or not of ocular discharge.\u003c/p\u003e\u003ch2\u003eSerum sample collection, storage, and handling\u003c/h2\u003e\u003cp\u003eSerum samples were routinely drawn from all horses at admittance and on indication during the stay. Samples were stored at -20 C. All possible serum samples obtained from the ten outbreak horses were included (n = 26) with the aim of obtaining one pre-infection and at least one post-infection serum sample from each horse.\u003c/p\u003e\u003ch2\u003eExtraction of DNA\u003c/h2\u003e\u003cp\u003eThe DNA extraction of the 28 nasal swab samples analyzed at VCM laboratory was performed using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) automated on the QIAcube connect (QIAGEN), according to manufacturer’s protocol (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). The DNA of the serum samples and the viral isolate were extracted manually using the same extraction kit.\u003c/p\u003e\u003ch2\u003eReal time qPCR\u003c/h2\u003e\u003cp\u003eThe extracted DNA was subsequently used in a previously published real-time qPCR targeting the glycoprotein B of EHV-4 (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). In brief, 20 𝜇L of reaction mix (Sensifast No-Rox (2x), primers (EHV4-F: CGCAGAGGATGGAGACTTTTACA and EHV4-R: CATGACCGTGGGGGTTCAA) and probe (EHV4-P: FAM-CTGCCCGCCGCCTACTGGATC-TAM)) was mixed with 5 𝜇L of DNA and analyzed on the Rotor-gene Q machine (QIAGEN) using the following program: 95°C for 2 min, 40 x (95°C for 3 secs and 60°C for 60 secs (acquire on green channel)) and 60°C for 60 sec. The raw data was analyzed using the following settings: cycle threshold (Ct) 0.02, ignore the first cycle, using dynamic tube, slope correct, and an outlier removal of 10%. A positive and a negative control were included in all runs, and all samples were analyzed in duplicates.\u003c/p\u003e\u003ch2\u003eELISA\u003c/h2\u003e\u003cp\u003eThe serum samples obtained were tested at the VCM laboratory for the presence of EHV-4 antibodies using a commercial ELISA(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e) able to differentiate between EHV-1 and EHV-4 antibodies. As mentioned, the samples were selected to obtain minimum one pre- and one post-infection sample, with the post infection sample being as far in time from the first EHV-4 positive test as possible. The commercial kit was the Svanovir® EHV1/EHV4-Ab kit (Svanova, Uppsala, Sweden), which is an indirect ELISA based on type-specific recombinant glycoprotein G fusion protein. The preparation of reagents and the ELISA procedure were performed according to the instruction manual (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). A corrected OD value of \u0026gt; 0.2 was regarded as positive, whereas a corrected OD value \u0026lt; 0.1 was regarded as negative and a corrected OD value of 0.1–0.2 were considered as doubtful.\u003c/p\u003e\u003ch2\u003eVirus isolation in cells\u003c/h2\u003e\u003cp\u003eEquine Dermal cells, NBL-6 (ATCC, Denmark) was cultivated using MEM (Gibco, Termofisher Scientific, Roskilde, Denmark), Non-Essential Amino Acids (Merck, Darmstadt, Germany), Na-Pyruvate 100mM (Gibco, Termofisher Scientific), Penicillin-Streptomycin-Neomycin (PSN) Antibiotic Mixture (Termofisher Scientific) and 10% Fetal Calf Sera. At 100% confluence, the cells were inoculated with 200𝜇L nasal swab sample of Eq.\u0026nbsp;7 that was first sterile filtrated using 0.45𝜇m Minisart NML Plus Surfactant-free Cellulose Acetate Syringe Filters (Sartorius, Göttingen, Germany). The cells and the supernatant were passaged using 0.05% Trypsin-EDTA (Gibco, Termofisher Scientific) four times adding 1/5 new cells in each passage in a larger cell flasks. At each passage 200𝜇L of cells were harvested and subjected to the DNA extraction and the real-time qPCR described above in order to determine if the viral isolation had been successful.\u003c/p\u003e\u003cp\u003e \u003cem\u003eNext-generation Sequencing (NGS).\u003c/em\u003e \u003c/p\u003e\u003cp\u003eThe supernatant and the cells of the fourth passage were harvested and centrifuged at 3000 RPM for 15 minutes to remove cellular debris. Thereafter the supernatant was subjected to ultracentrifugation at 25.000RPM for one hour at 4\u003csup\u003e0\u003c/sup\u003eC. The pellet containing the virions were then disrupted using 200µL PBS, and the DNA extracted manually using the DNA Purification protocol “Blood or Body Fluid“ of the QIAamp DNA mini kit (QIAGEN). The extracted DNA was used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq platform (Statens Serum Institut, Copenhagen S, Denmark).\u003c/p\u003e\u003ch2\u003eAnalysis of the NGS data\u003c/h2\u003e\u003cp\u003eIllumina raw reads from the isolate of Eq.\u0026nbsp;7 were filtered using fastp v0.20.1 (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) to filter out low complexity reads and with quality below 25. The filtered reads were then aligned to the German reference genome (MW892436) using bwa v0.7.17 (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e) and potential duplicates were identified and removed using picard MarkDuplicates v2.27.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://broadinstitute.github.io/picard\u003c/span\u003e\u003cspan address=\"http://broadinstitute.github.io/picard\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Samtools v1.16.1(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) was then used to sort and index the bam file and to determine the read coverage along the whole genome. The consensus genome was generated using bcftools mpileup and bcftools call v1.14 (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Genomic position with read coverage below 5x were assigned as missing site \"N\".\u003c/p\u003e\u003cp\u003eThe consensus sequence was concatenated with the 27 full reference genomes retrieved from NCBI from Australia, New Zealand, Germany, Ireland and Japan (NCBI Genbank accession numbers: AF030027, KT324741, KT324740, KT324743, KT324746, KT324745, KT324744, KT324748, KT324736, KT324738, KT324739, KT324747, KT324742, KT324735, KT324737, MW892435, MW892436, MW892437, MW892438, LC075586, LC063142, LC075587, LC075582, LC075585, LC075584, LC075588 and LC075583).\u003c/p\u003e\u003cp\u003eThe sequences were aligned using mafft v7.486 (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) and trimAl v1.4 (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e) with a gap threshold of 95% and a conservation percentage of minimum 60% (-gt 0.95 -cons 60) was used to remove gaps related to highly repetitive regions. A pairwise comparison and a maximum likelihood phylogenetic tree of the full genome data was generated with IQ-TREE v2.1.2 (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e) with the option -m TEST to calculate the best evolutionary model for the alignment using ModelFinder (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e) and 1000 bootstrap replicates.\u003c/p\u003e\u003ch2\u003ePCR amplification of ORF30\u003c/h2\u003e\u003cp\u003eFor other EHV-4 samples, it was not possible to obtain an isolate, and therefore conventional PCR amplification of ORF30 was performed. Four primer-pairs previously published for ORF30 were used (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), along with the Accuprime Taq High Fidelity kit (Termo Fisher Scientific, Denmark). Four different PCR programs were applied for each primer pair (see Additional File 5). The resulting PCR products were visualized using the Invitrogen E-gel 1% SYBR Safe agarose gel, Termo Fisher Scientific and purified using the High Pure PCR Product Purification Kit, Roche, Basel, Switzerland. The PCR products were used as input for the Nextera XT library prep protocol, and the samples were sequenced using the Illumina MiSeq (Statens Serum Institut, Copenhagen S).\u003c/p\u003e\u003ch2\u003eAnalysis of the ORF30 sequencing data\u003c/h2\u003e\u003cp\u003eThe data from the next-generation sequencing (NGS) was analyzed using the CLC genomics workbench version 22.0.2 (QIAGEN). Fastq files were imported, and all of the reads were paired and trimmed with a quality limit of 0.2 and a maximum number of ambiguities of two. The trimmed reads were then mapped to a full-length reference genome of a recent German EHV-4 strain (accession number: MW892438). A consensus sequence of ORF30 was extracted and subsequently aligned using the MUSCLE alignment tool (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e) and to the partial ORF30 derived from all EHV-4 sequences available at NCBI GenBank described above (n = 27). Following the alignment, a “pairwise comparison” was created to examine nucleotide differences between Eq.\u0026nbsp;7, Eq.\u0026nbsp;8 and Eq.\u0026nbsp;10 and two German reference sequences (accession numbers: MW892436 and MW892438) derived from a single outbreak.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eEthics approval and consent to participate.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that the ethical policies of the journal, as noted on the\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ejournal\u0026rsquo;s author guidelines page, have been followed and the appropriate\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eethical review committee approval has been received. The study was approved by the Ethical Committee of the Department of Veterinary Clinical Sciences, University of Copenhagen (permit #2020-014). In addition, all methods were performed in accordance\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ewith the relevant guidelines and regulations. Explicit owner informed consent for inclusion of samples from included horses in this study was not sought but owners were aware that excess material from clinical samples would be retained for research; in general, and all owners have the option to opt out of research. In addition, all samples and clinical journals were handled anonymously.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAvailability of data and materials\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in the article and its supplementary files.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNo funding was obtained for this study.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAuthors\u0026apos; contributions\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePRH designed the overall study, analyzed the results and drafted the final manuscript. VKJ carried out the laboratory analysis of the nasal swabs and serum samples, obtained the clinical journals, analyzed the results and contributed to the final manuscript. MMC carried out the sequencing, sequencing analysis, analyzed the results and approved the final manuscript, LEL helped in the design of the overall study and contributed to the final manuscript and SH designed the overall study, analyzed the results and contributed to the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAcknowledgements\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge all owners of the horses that contributed to this study.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAzab W, Kato K, Abdel-Gawad A, Tohya Y, Akashi H. Equine herpesvirus 4: Recent advances using BAC technology. Vet Microbiol. 2011 May 12;150(1\u0026ndash;2):1\u0026ndash;14. \u003c/li\u003e\n\u003cli\u003eBadenhorst M, Page P, Ganswindt A, Laver P, Guthrie A, Schulman M. Detection of equine herpesvirus-4 and physiological stress patterns in young Thoroughbreds consigned to a South African auction sale. BMC Vet Res [Internet]. 2015 Jun 2 [cited 2023 Mar 29];11(1). Available from: /pmc/articles/PMC4450643/\u003c/li\u003e\n\u003cli\u003ePavulraj S, Eschke K, Theisen J, Westhoff S, Reimers G, Andreotti S, et al. Equine herpesvirus type 4 (Ehv-4) outbreak in germany: Virological, serological, and molecular investigations. Pathogens [Internet]. 2021 Jul 1 [cited 2023 Mar 29];10(7). Available from: /pmc/articles/PMC8308676/\u003c/li\u003e\n\u003cli\u003eIzume S, Kirisawa R, Ohya K, Ohnuma A, Kimura T, Omatsu T, et al. The full genome sequences of 8 equine herpesvirus type 4 isolates from horses in Japan. J Vet Med Sci [Internet]. 2017 Jan 1 [cited 2023 Mar 29];79(1):206. Available from: /pmc/articles/PMC5289262/\u003c/li\u003e\n\u003cli\u003eVaz PK, Horsington J, Hartley CA, Browning GF, Ficorilli NP, Studdert MJ, et al. Evidence of widespread natural recombination among field isolates of equine herpesvirus 4 but not among field isolates of equine herpesvirus 1. J Gen Virol [Internet]. 2016 Mar 1 [cited 2023 Mar 29];97(Pt 3):747. Available from: /pmc/articles/PMC5381393/\u003c/li\u003e\n\u003cli\u003eCuxson JL, Hartley CA, Ficorilli NP, Symes SJ, Devlin JM, Gilkerson JR. Comparing the genetic diversity of ORF30 of Australian isolates of 3 equid alphaherpesviruses. Vet Microbiol. 2014 Feb 21;169(1\u0026ndash;2):50\u0026ndash;7. \u003c/li\u003e\n\u003cli\u003eRadalj A, Milic N, Stevanovic O, Nisavic J. The detection and phylogenetic analysis of equine herpesviruses 1, 4 and 5 identified in nasal swab samples of asymptomatic horses from Serbia and Bosnia and Herzegovina. Vet Ital [Internet]. 2021 May 20 [cited 2023 Mar 29];57(4):265\u0026ndash;74. Available from: https://pubmed.ncbi.nlm.nih.gov/35593499/\u003c/li\u003e\n\u003cli\u003ePusterla N, James K, Barnum S, Bain F, Barnett DC, Chappell D, et al. Frequency of Detection and Prevalence Factors Associated with Common Respiratory Pathogens in Equids with Acute Onset of Fever and/or Respiratory Signs (2008\u0026ndash;2021). Pathogens [Internet]. 2022 Jul 1 [cited 2023 Mar 29];11(7). Available from: /pmc/articles/PMC9317490/\u003c/li\u003e\n\u003cli\u003eMa G, Azab W, Osterrieder N. Equine herpesviruses type 1 (EHV-1) and 4 (EHV-4)--masters of co-evolution and a constant threat to equids and beyond. Vet Microbiol [Internet]. 2013 Nov [cited 2023 Mar 29];167(1\u0026ndash;2):123\u0026ndash;34. Available from: https://pubmed.ncbi.nlm.nih.gov/23890672/\u003c/li\u003e\n\u003cli\u003ePusterla N, Leutenegger CM, Wilson WD, Watson JL, Ferraro GL, Madigan JE. Equine herpesvirus-4 kinetics in peripheral blood leukocytes and nasopharyngeal secretions in foals using quantitative real-time TaqMan PCR. J Vet Diagn Invest [Internet]. 2005 [cited 2023 Mar 29];17(6):578\u0026ndash;81. Available from: https://pubmed.ncbi.nlm.nih.gov/16475518/\u003c/li\u003e\n\u003cli\u003eEl-Hage C, Mekuria Z, Dynon K, Hartley C, McBride K, Gilkerson J. Association of Equine Herpesvirus 5 with Mild Respiratory Disease in a Survey of EHV1, -2, -4 and -5 in 407 Australian Horses. Anim an open access J from MDPI [Internet]. 2021 Dec 1 [cited 2023 Mar 29];11(12). Available from: https://pubmed.ncbi.nlm.nih.gov/34944194/\u003c/li\u003e\n\u003cli\u003ePusterla N, Mapes S, David Wilson W. Prevalence of latent alpha-herpesviruses in Thoroughbred racing horses. Vet J [Internet]. 2012 Aug [cited 2023 Mar 29];193(2):579\u0026ndash;82. Available from: https://pubmed.ncbi.nlm.nih.gov/22405721/\u003c/li\u003e\n\u003cli\u003ePatel JR, F\u0026ouml;ldi J, Bateman H, Williams J, Didlick S, Stark R. Equid herpesvirus (EHV-1) live vaccine strain C147: Efficacy against respiratory diseases following EHV types 1 and 4 challenges. Vet Microbiol [Internet]. 2003 Mar 20 [cited 2023 Sep 5];92(1\u0026ndash;2):1\u0026ndash;17. Available from: https://pubmed.ncbi.nlm.nih.gov/12488066/\u003c/li\u003e\n\u003cli\u003ePusterla N, Bain F, James K, Mapes S, Kenelty K, Barnett DC, et al. Frequency of molecular detection of equine herpesvirus-4 in nasal secretions of 3028 horses with upper airway infection. Vet Rec [Internet]. 2017 Jun 17 [cited 2023 Apr 3];180(24):593. Available from: https://pubmed.ncbi.nlm.nih.gov/28386031/\u003c/li\u003e\n\u003cli\u003eXie J, Tong P, Zhang L, Ren M, Song X, Jia C, et al. First detection and genetic characterization of equid herpesvirus 2, 4, and 5 in China. Arch Virol [Internet]. 2021 May 1 [cited 2023 Apr 3];166(5):1421\u0026ndash;6. Available from: https://pubmed.ncbi.nlm.nih.gov/33656577/\u003c/li\u003e\n\u003cli\u003eKydd JH, Townsend HGG, Hannant D. The equine immune response to equine herpesvirus-1: The virus and its vaccines. [cited 2023 Sep 13]; Available from: www.elsevier.com/locate/vetimm\u003c/li\u003e\n\u003cli\u003eSellon DC, Long MT. Equine infectious diseases. 2013. \u003c/li\u003e\n\u003cli\u003eDayaram A, Seeber PA, Greenwood AD. Environmental Detection and Potential Transmission of Equine Herpesviruses. Pathogens [Internet]. 2021 Apr 1 [cited 2023 Apr 4];10(4). Available from: /pmc/articles/PMC8066653/\u003c/li\u003e\n\u003cli\u003eSaklou NT, Burgess BA, Ashton L V., Morley PS, Goehring LS. Environmental persistence of equid herpesvirus type-1. Equine Vet J [Internet]. 2021 Mar 1 [cited 2023 Mar 31];53(2):349\u0026ndash;55. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/evj.13313\u003c/li\u003e\n\u003cli\u003eDayaram A, Franz M, Schattschneider A, Damiani AM, Bischofberger S, Osterrieder N, et al. Long term stability and infectivity of herpesviruses in water. Sci Rep [Internet]. 2017 [cited 2023 Apr 4];7. Available from: /pmc/articles/PMC5399353/\u003c/li\u003e\n\u003cli\u003ePusterla N, Rice M, Henry T, Barnum S, James K. Investigation of the Shedding of Selected Respiratory Pathogens in Healthy Horses Presented for Routine Dental Care. https://doi.org/101177/0898756420949135 [Internet]. 2020 Aug 25 [cited 2023 Apr 4];37(2):88\u0026ndash;93. Available from: https://journals.sagepub.com/doi/10.1177/0898756420949135\u003c/li\u003e\n\u003cli\u003eAAEP. General Biosecurity Guidelines [Internet]. Guideline. 2022 [cited 2022 Apr 1]. p. 1\u0026ndash;17. Available from: https://aaep.org/document/general-biosecurity-guidelines\u003c/li\u003e\n\u003cli\u003eQIAGEN. QIAamp\u0026reg; DNA Mini and Blood Mini Handbook [Internet]. 2016. p. 72. Available from: https://www.qiagen.com/us/resources/resourcedetail?id=62a200d6-faf4-469b-b50f-2b59cf738962\u0026amp;lang=en\u003c/li\u003e\n\u003cli\u003eIndical bioscience. Handbook SVANOVIR EHV1/EHV4-Ab [Internet]. 2021. Available from: https://shop.indical.com/index.php?\u003cbr\u003ecl=details\u0026amp;anid=2b05cf3ab758820ec001dd7d8813152b\u0026amp;f\u003cbr\u003eorce_admin_sid=o5pe7kkq49cvinffcq4tqhorg3\u0026amp;st\u003cbr\u003eoken=93014DE9\u0026amp;shp=1\u0026amp;preview=e7d04d86fd89153f68a4a3f88edf4b41\u003c/li\u003e\n\u003cli\u003eChen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics [Internet]. 2018 Sep 1 [cited 2023 Aug 4];34(17):i884\u0026ndash;90. Available from: https://dx.doi.org/10.1093/bioinformatics/bty560\u003c/li\u003e\n\u003cli\u003eLi H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics [Internet]. 2009 Jul [cited 2023 Aug 4];25(14):1754\u0026ndash;60. Available from: https://pubmed.ncbi.nlm.nih.gov/19451168/\u003c/li\u003e\n\u003cli\u003eLi H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. 2013 Mar 16 [cited 2023 Aug 4]; Available from: https://arxiv.org/abs/1303.3997v2\u003c/li\u003e\n\u003cli\u003eDanecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience [Internet]. 2021 Jan 29 [cited 2023 Aug 4];10(2):1\u0026ndash;4. Available from: https://dx.doi.org/10.1093/gigascience/giab008\u003c/li\u003e\n\u003cli\u003eKatoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol [Internet]. 2013 Apr [cited 2023 Aug 4];30(4):772. Available from: /pmc/articles/PMC3603318/\u003c/li\u003e\n\u003cli\u003eCapella-Guti\u0026eacute;rrez S, Silla-Mart\u0026iacute;nez JM, Gabald\u0026oacute;n T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics [Internet]. 2009 Aug 8 [cited 2023 Aug 4];25(15):1972. Available from: /pmc/articles/PMC2712344/\u003c/li\u003e\n\u003cli\u003eNguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol Biol Evol [Internet]. 2015 Jan 1 [cited 2023 Aug 4];32(1):268\u0026ndash;74. Available from: https://dx.doi.org/10.1093/molbev/msu300\u003c/li\u003e\n\u003cli\u003eKalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 2017 146 [Internet]. 2017 May 8 [cited 2023 Aug 4];14(6):587\u0026ndash;9. Available from: https://www.nature.com/articles/nmeth.4285\u003c/li\u003e\n\u003cli\u003eC. Edgar R. MUSCLE: multiple sequence alignment with high accuracy and high throughput. 2013 [cited 2019 Jun 27]; Available from: https://findit.dtu.dk/en/catalog/2354275506\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3376825/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3376825/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eBackground: \u003c/em\u003eEquine herpesvirus 4 (EHV-4) causes respiratory disease in horses, and the virus is considered endemic in the global equine population. However, outbreaks can occur when several horses are gathered in relation to shows, competitions, breeding units and at hospitals. In the spring year 2022, an EHV-4 outbreak occurred at the Large Animal Teaching Hospital, University of Copenhagen, Denmark.\u003c/p\u003e\n\u003cp\u003eNine horses were tested EHV-4 positive during the outbreak, which lasted approx. seven weeks. In addition, a tenth horse “Eq10” tested EHV-4 positive almost three weeks after the last of the outbreak horses tested positive. Detailed clinical registrations were obtained from all ten horses as well as their location and movement during hospitalization. Nasal swabs were obtained throughout the outbreak and tested by real-time qPCR for EHV-4. Additionally, pre- and post-infection sera were tested for the presence of EHV-4 antibodies. Selected samples were characterized by partial and full genome sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eResults:\u003c/em\u003e The most common clinical signs of the EHV-4 infected horses during this outbreak were pyrexia, nasal discharge, mandibular lymphadenopathy and increased lung sounds upon auscultation. Based on the locations of the horses, EHV-4 detection and antibody responses the most likely “patient zero” was identified as being “Eq1”. Partial genome sequencing revealed that Eq10 was infected by another wild type EHV-4 strain, suggesting that the hospital was able to eliminate the outbreak by testing and reinforcing biosecurity measures. The complete genome sequence of the outbreak strain was obtained and revealed a closer relation to Australian and Japanese EHV-4 strains rather than to other European EHV-4 strains.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConclusion:\u003c/em\u003e The study illustrated the transmission of EHV-4 within an equine facility/hospital and provided new insights into the viral shedding, antibody responses and clinical signs related to EHV-4 infections. Finally, sequencing proved a useful tool in understanding the transmission within the hospital, and in characterizing of the outbreak strain.\u003c/p\u003e","manuscriptTitle":"Outbreak of equine herpesvirus 4 (EHV-4) in Denmark: tracing patient zero and viral characterization","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-03 18:08:51","doi":"10.21203/rs.3.rs-3376825/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-01-25T08:27:55+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-11-27T15:34:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"92925730-861c-4536-9df9-b606edc32e0d","date":"2023-11-17T14:06:23+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-11-14T23:34:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"354a5d7c-6225-4369-94bf-d3ff38173b3b_SNPRID","date":"2023-11-08T23:15:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"cc41e584-b438-40dc-9c6b-a407cb984ab9","date":"2023-10-30T10:57:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"dfdb489a-cb2d-451d-a618-1e12111bfa13","date":"2023-10-30T08:21:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"e0003604-441a-4425-9bfe-0f7584717992","date":"2023-10-27T10:46:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-10-27T10:04:46+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2023-10-23T07:47:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-09-26T06:40:37+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-09-26T06:40:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2023-09-22T07:56:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4f395193-e798-4b77-8e6a-e67c02543a16","owner":[],"postedDate":"October 3rd, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-19T09:00:51+00:00","versionOfRecord":[],"versionCreatedAt":"2023-10-03 18:08:51","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3376825","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3376825","identity":"rs-3376825","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0