Cadmium Sulphate Induces Pro-Atherogenic Phenotypic Switching in Human Aortic Smooth Muscle Cells

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Background & Objectives: Vascular smooth muscle cells (VSMCs) maintain vascular integrity but can transition from a quiescent, contractile phenotype to a synthetic, migratory, and proliferative state, a critical driver of atherosclerosis. Cadmium, a persistent and bioaccumulative environmental toxicant, common in cigarette smoke and industrial emissions, has been epidemiologically associated with coronary artery disease; however, its mechanistic effects on VSMC behavior remain unclear. This study investigated whether cadmium sulphate (CdSO₄) promotes phenotypic switching in human aortic smooth muscle cells (HASMCs) and examined associated molecular and functional consequences. Methods: HASMCs (ATCC) were cultured under standard conditions and exposed to graded concentrations of CdSO₄. Cytotoxicity and metabolic activity were assessed using the CCK-8 assay to determine sub-toxic exposure ranges. Based on viability profiling, three concentrations (1 µM, 15 µM, 25 µM) were selected for mechanistic analyses. Phenotypic switching was evaluated by quantitative polymerase chain reaction (qPCR) analysis of contractile markers (ACTA2, TAGLN), osteogenic marker (BMP2), and inflammatory marker (CD68). Functional alterations were assessed using the scratch wound migration assay and Ki-67 immunostaining to evaluate cellular proliferation. Results: CdSO₄ exposure induced significant phenotypic modulation in HASMCs characterized by upregulation of BMP2 and CD68, accompanied by marked downregulation of ACTA2 and TAGLN, indicating loss of contractile identity and acquisition of osteogenic and inflammatory features. Sub-toxic cadmium exposure significantly increased cell migration and proliferation, consistent with a synthetic, pro-atherogenic phenotype. Conclusions: CdSO₄ promotes pro-atherogenic phenotypic switching and functional activation of HASMCs, providing mechanistic evidence linking cadmium exposure to vascular remodeling and atherosclerosis, and reinforce the importance of mitigating heavy metal exposure to prevent cardiovascular disease burden.
Full text 107,871 characters · extracted from preprint-html · click to expand
Cadmium Sulphate Induces Pro-Atherogenic Phenotypic Switching in Human Aortic Smooth Muscle Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cadmium Sulphate Induces Pro-Atherogenic Phenotypic Switching in Human Aortic Smooth Muscle Cells Brishna Khan, Shafaq Ramzan, Mati-Ur-Rehman Rehman, Anum Aziz, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8973731/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background & Objectives: Vascular smooth muscle cells (VSMCs) maintain vascular integrity but can transition from a quiescent, contractile phenotype to a synthetic, migratory, and proliferative state, a critical driver of atherosclerosis. Cadmium, a persistent and bioaccumulative environmental toxicant, common in cigarette smoke and industrial emissions, has been epidemiologically associated with coronary artery disease; however, its mechanistic effects on VSMC behavior remain unclear. This study investigated whether cadmium sulphate (CdSO₄) promotes phenotypic switching in human aortic smooth muscle cells (HASMCs) and examined associated molecular and functional consequences. Methods: HASMCs (ATCC) were cultured under standard conditions and exposed to graded concentrations of CdSO₄. Cytotoxicity and metabolic activity were assessed using the CCK-8 assay to determine sub-toxic exposure ranges. Based on viability profiling, three concentrations (1 µM, 15 µM, 25 µM) were selected for mechanistic analyses. Phenotypic switching was evaluated by quantitative polymerase chain reaction (qPCR) analysis of contractile markers (ACTA2, TAGLN), osteogenic marker (BMP2), and inflammatory marker (CD68). Functional alterations were assessed using the scratch wound migration assay and Ki-67 immunostaining to evaluate cellular proliferation. Results: CdSO₄ exposure induced significant phenotypic modulation in HASMCs characterized by upregulation of BMP2 and CD68, accompanied by marked downregulation of ACTA2 and TAGLN, indicating loss of contractile identity and acquisition of osteogenic and inflammatory features. Sub-toxic cadmium exposure significantly increased cell migration and proliferation, consistent with a synthetic, pro-atherogenic phenotype. Conclusions: CdSO₄ promotes pro-atherogenic phenotypic switching and functional activation of HASMCs, providing mechanistic evidence linking cadmium exposure to vascular remodeling and atherosclerosis, and reinforce the importance of mitigating heavy metal exposure to prevent cardiovascular disease burden. Cadmium sulphate Vascular smooth muscle cells Phenotypic switching Atherosclerosis Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction Atherosclerosis is a chronic inflammatory disease and is the leading cause of global morbidity and mortality [ 1 , 2 ]. Endothelial dysfunction, immune cell infiltration, and oxidative stress disrupt the normal function of vascular smooth muscle cells (VSMCs), leading to lipid deposition and the development of atherosclerotic plaques inside the arterial wall. In response to pathological stimuli, VSMCs, which usually retain a contractile phenotype, may undergo phenotypic switching and develop synthetic, inflammatory, and osteogenic properties that contribute to vascular remodeling, development of plaque and calcification [ 3 , 4 ]. Environmental exposure to toxic heavy metals has become a significant but often overlooked risk factor for cardiovascular disease. Cadmium is a non-essential, highly persistent heavy metal frequently found in cigarette smoke, industrial emissions, contaminated food, and water sources [ 5 ]. Due to its long biological half-life and excretion in small amounts, cadmium accumulates in vascular tissues, where it causes endothelial dysfunction, inflammation and promotes oxidative stress [ 6 ]. Although, epidemiological data has linked cadmium exposure to a higher incidence of hypertension, coronary artery disease, and atherosclerosis, the underlying cellular mechanisms are not fully understood. Increasing evidence indicates that cadmium may have direct impact on VSMC behavior by changing cell viability, proliferation, and migration [ 7 , 8 ]. Experimental studies have shown that low-dose cadmium exposure can stimulate VSMC proliferation and migration activity, while higher concentrations can cause cytotoxicity, indicating a dose-dependent and biphasic cellular response [ 9 , 10 ]. Nonetheless, it is still unclear whether these cadmium-induced changes cause human VSMCs to switch to synthetic, inflammatory, or osteogenic phenotypes. The goal of this study is to systematically analyze changes in cell viability, proliferative activity, migratory behavior, and phenotypic marker expression in human aortic smooth muscle cells (HASMCs) to assess the effects of cadmium sulfate. This study aims to determine whether cadmium exposure induces phenotypic switching of HASMCs toward a synthetic and proatherogenic state by assessing cadmium-induced modulation of contractile, inflammatory, and osteogenic markers. Collectively, these findings may help clarify the pathogenic role of cadmium in cardiovascular disease and support the development of preventive and therapeutic strategies targeting environmentally driven vascular dysfunction. 2. Materials and Methods 2.1 Cell Lines, Culture Conditions Human aortic smooth muscle cells (HASMCs) (ATCC, USA; PCS-100-012) were used as the primary experimental cell line in this study. Cells were cultured in Vascular Smooth Muscle Cell Growth Medium (ATCC Primary Cell Solutions™, PCS-100-030), supplemented with Vascular Smooth Muscle Cell Growth Kit PCS-100-042™. All experiments were conducted using cells between passages 3 and 8 to ensure phenotypic stability and reproducibility. 2.2 Cadmium-Induced Cytotoxicity Analysis in HASMCs: HASMCs were seeded at a density of 8,000 cells per well in 200 µL of culture media in 96-well plates, and they were incubated for 24 hours at 37°C with 5% CO2. Following a PBS wash, the cells were exposed to cadmium sulfate (2630–4105, Sigma-Aldrich) at doses of 0.5, 1, 5, 10, 15, 25, and 50 µM for 24 hours. Wells with just media were utilized as blanks, while untreated cells were used as controls. Phase-contrast microscopy was used to evaluate cell morphology. The CCK-8 assay (Sigma-Aldrich; 96992) was used to measure cell viability in accordance with the manufacturer's instructions. A microplate reader (Bio-Rad iMarkTM, USA) was used to measure absorbance at 450 nm. Every experiment was carried out three times. Cell viability (%) was calculated using blank-corrected absorbance values as follows: To identify sub-toxic and cytotoxic concentrations, IC₁₀ (ED 90 ) and IC₂₀ values were calculated using 24-hour exposure data. An unpaired two-tailed t-test was used for statistical analysis, and the findings were presented as a percentage of viability in comparison to controls. 2.3 Gene Expression Analysis HASMCs were seeded in 6-well plates and allowed to adhere for 24 h. At 75–80% confluence, cells were treated with cadmium sulfate for 24 h. Total RNA was extracted using the Quick-RNA™ Miniprep Plus Kit (R1057, Zymo Research, USA), and cDNA was synthesized using the RevertAid cDNA Synthesis Kit (K1621, Thermo Scientific). Quantitative real-time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (K0221, Thermo Scientific) on a Bio-Rad CFX96 Touch™ Real-Time PCR system. All reactions were run in triplicate, and relative gene expression was calculated using the 2⁻ΔΔCt method, with GAPDH used as the internal reference gene. The primers used in the study, along with their annealing temperatures, are listed in Table 1 . Table 1 Primers used in qPCR experiments. Gene Name Sense/antisense Temperature KLF4 Krüppel-like factor 4 TGCAGCTTCACCTATCCGAT/ GGAATGTACACCGGGTCCAA 60°C BMP2 Bone Morphogenetic Protein 2 ATTCCCCGTGACCAGACTTT/ GCTGTGTTCATCTTGGTGCA 60°C CD68 Cluster of Differentiation 68 GTCCTGCCACCACTAGTCAT/ TCTGAATCTGGGCTTGGAGG 62°C ACTA2 Actin alpha 2 AAGATCCTGACTGAGCGTGG/ GTAGGTGGTTTCATGGATGCC 62°C TAGLN Transgelin AACAGCCTGTACCCTGATGG/ CGGTAGGCCCATCATTCTT 60°C ALPL Alkaline phosphatase CACTGAAATATGCCCTGGAGC/CCTGGGCATTGGTGTTGTAC 62°C CD34 Hematopoietic progenitor cell antigen CD34 GCAATGAGGCCACAACAAAC/ TGGGAGATGTTGCAAGGCTA 60°C GAPDH Glyceraldehyde-3-phosphate dehydrogenase GAGTCAACGGATTTGGTCGT/ TTGATTTTGGAGGGATCTCG 59°C 2.4 Scratch wound migration assay HASMC migration was assessed using a scratch wound assay. Cells were seeded into 6-well plates and grown to 75–80% confluence, after which a linear scratch was created using a sterile 200-µL pipette tip. Wells were washed twice with prewarmed PBS to remove debris, and cells were incubated in medium containing 0.1% FBS to minimize proliferation. Control cells received low-serum medium alone, while treated cells received low-serum medium supplemented with CdSO₄. Cells were incubated for 24 h under standard culture conditions. Images were captured at 0 h and 24 h from three predefined, non-overlapping fields per well using a Nikon Eclipse 39 microscope (4×). The same fields were relocated at 24 h by marking the underside of the plate. Image Analysis Wound areas were quantified using Fiji (ImageJ, NIH). Scratch margins were outlined using the polygon selection tool, and wound closure (%) was calculated as: Migration rate was calculated by dividing the percentage wound closure by 24 h. Three independent experiments were performed (n = 3), with three fields analyzed per condition. 2.5 Immunocytochemistry (ICC) for Ki-67 Immunocytochemistry for Ki-67 was performed to evaluate proliferative activity in human aortic smooth muscle cells (HASMCs). Using conventional methods, cells were fixed, permeabilized, and blocked before being treated with rabbit anti-Ki-67 primary antibody (1:250 dilution) and Alexa Fluor™ 647 donkey anti-rabbit IgG (H + L) secondary antibody (1:1000 dilution). DAPI was used to counterstain the nuclei. The pictures were taken at a magnification of 20x. Image Analysis Quantitative analysis of Ki-67 staining was performed using Fiji (ImageJ, NIH, USA). Regions of interest (ROIs) were manually selected within each well, and background subtraction was applied to calculate corrected mean fluorescence intensity (MFI) values in arbitrary units (a.u.). Corrected MFIs from control and treated groups were compared using an unpaired two-tailed t-test. 2.6 Data analysis and visualization All experiments were conducted in 3 independent biological replicates, and results are expressed as mean ± standard deviation (SD) unless otherwise specified. Statistical analyses were performed using Microsoft Excel 2019 (Microsoft Corp., USA) and R version 4.2.2 (R Foundation for Statistical Computing, Austria). Excel was employed for descriptive statistics, basic significance testing, and preliminary plotting, while R (utilizing the tidyverse, drc and ggplot2 packages) was used for advanced statistical analyses and the generation of publication quality figures. Statistical significance was determined using an unpaired two-sample t -test, with p < 0.05 considered statistically significant. 3. Results 3.1 Analysis of morphological changes of HASMCs In Vitro Model Exposed to CdSO4 HASMC morphology was affected by CdSO₄ in a dose- and time-dependent manner. Control cells kept a typical spindle-shaped, elongated morphology and created a consistent monolayer at 24 hours. This morphology was mostly preserved in cells treated with 0.5–1 µM, but there were a marked rounding and a decrease in cell density at 5 µM. Increasing concentrations caused increasing disruption: 15 µM induced noticeable rounding and early detachment, 25 µM resulted in significant loss of monolayer integrity with visible gaps, and 50 µM caused widespread detachment with floating rounded cells. These tendencies became more pronounced at 48 hours, showing a distinct dose-dependent cytomorphological response to CdSO₄ exposure, with moderate effects at 0.5–1 µM, moderate disruption at 5–15 µM, and significant detachment at 25–50 µM (Fig. 1 a & b). 3.1.1 Effect of CdSO₄ Exposure on HASMCs Viability The viability of HASMCs exposed to increasing concentrations of CdSO₄ was assessed. Lower levels (0.5–5 µM) did not reduce viability after 24 hours; instead, they caused a little increase in metabolic activity (112–113% of control). Early cytotoxicity signals showed at 15 µM (106%), but the decline was more evident at 25 µM (94%). At 50 µM, the viability dropped greatly to 25%, indicating great toxicity. After 48 hours, CdSO4's cytotoxic effects became more apparent. Consistent with the biphasic tendency seen at 24 hours, viability only slightly fell (96–97%) at 0.5–1 µM, whereas 5 µM showed a little stimulatory impact (103%). Increasing doses led in marked cytotoxicity; viability declined to 86% at 15 µM, 42% at 25 µM, and 3% at 50 µM (Fig. 1 c). The 1 µM concentration preserved the regular cell morphology and was noncytotoxic; the 15 µM concentration marked the beginning of cytotoxic stress without substantial cell death; and viability began to decline at the 25 µM concentration. These three concentrations were selected for every subsequent research based on these qualities. This range made it feasible to examine phenotypic responses at subtoxic, modest, and near-toxic exposure levels while avoiding doses leading to substantial cell detachment. 3.2 qPCR Analysis of CdSO₄-Induced Phenotypic Switching For 24 hours, cells were exposed to 1, 15, and 25 µM CdSO₄ to assess whether such exposure modifies the phenotype of HASMCs. qPCR was used to examine the expression of chosen gene markers—including inflammatory (CD68), osteogenic (BMP2), and contractile (TAGLN, ACTA2) ones (Fig. 2 ). Using the ΔΔCt method, expression levels were computed relative to untreated controls; findings are displayed as mean fold changes. KLF4, ALPL, and CD34 were consistently undetectable across three biological replicates under all circumstances and were removed from subsequent study. BMP2 expression was strongly upregulated in response to CdSO₄ treatment. The highest increase occurred at 1 µM (53.1 ± 4.0-fold; p = 5.3 × 10⁻⁵). Significant elevations were also observed at 15 µM (30.8 ± 6.6-fold; p = 0.003) and 25 µM (22.7 ± 7.2-fold; p = 0.013), showing a strong but decreasing dose-dependent increase. These results indicate CdSO₄ induces an osteogenic phenotypic switch in HASMCs. CD68 expression was elevated at all CdSO₄ concentrations. At 1 µM, CD68 increased 5.0 ± 1.4-fold (p = 0.0175), remained upregulated at 15 µM (3.44 ± 0.92-fold; p = 0.0204), and peaked at 25 µM (8.83 ± 1.1-fold; p = 6.3 × 10⁻⁴). These findings demonstrate a robust, dose-responsive inflammatory response following CdSO₄ exposure. In contrast, contractile markers TAGLN and ACTA2 were consistently downregulated in HASMCs exposed to CdSO₄ compared with controls. TAGLN expression decreased to 0.48 ± 0.13-fold at 1 µM (p = 0.0052), 0.39 ± 0.12-fold at 15 µM (p = 0.0017), and 0.37 ± 0.10-fold at 25 µM (p = 7.7 × 10⁻⁴). Similarly, ACTA2 expression declined to 0.27 ± 0.11-fold at 1 µM (p = 7.1 × 10⁻⁴), 0.18 ± 0.09-fold at 15 µM (p = 2.4 × 10⁻⁴), and 0.12 ± 0.09-fold at 25 µM (p = 1.4 × 10⁻⁴). A change from a contractile phenotype to one that is osteogenic and inflammatory is shown by upregulation of BMP2 and CD68 combined with downregulation of TAGLN and ACTA2. 3.3 Low-Dose CdSO₄ Promotes Migration and Proliferation of HASMCs A sub-toxic concentration of 1 µM CdSO₄ enhanced HASMC migration in the scratch-wound assay. Wound closure increased from 45.2 ± 6.3% in controls to 60.1 ± 6.0% (p = 0.04), and the migration rate rose from 1.88 ± 0.26%/h to 2.50 ± 0.25%/h. At a non-cytotoxic dose, this result was seen; low-level cadmium exposure thus fosters HASMC motility. One characteristic of synthetic VSMCs is more migration, which could exacerbate neointimal development and vascular remodeling during early atherogenesis. 3.3.1 Quantitative Assessment of Cell Migration At a non-cytotoxic dosage, this effect was seen, hence low-level cadmium exposure boosts HASMC motility. Synthetic VSMCs are distinguished by more migration, which might help to create neointima and shape blood vessels early on in atherosclerosis (Table 2 , Fig. 3 a & b). Table 2 Summary statistics for scratch-wound migration of HASMCs after 24 h CdSO₄ exposure . Group % Wound closure (Mean ± SD) Migration Rate (% /h, mean ± SD) p value Control 45.2 ± 6.3 1.9 ± 0.26 - 1 µM CdSO₄ 60.1 ± 6 2.5 ± 0.24 0.04 3.4 Ki-67 immunocytochemistry for proliferation analysis: Since wound closure can occur through a combination of cell migration and proliferation, Ki-67 immunocytochemistry was performed to evaluate the extent to which proliferative activity contributed. This was of particular interest as CCK-8 assay results also suggested proliferative changes following CdSO₄ exposure. Control cells exhibited little to no Ki-67 staining, consistent with low basal proliferative activity as the corrected MFI values for this group. The mean MFI in control HASMCs was 18.98 ± 9.94, whereas cells treated with 1 µM CdSO₄ showed markedly higher intensity values (44.78 ± 4.17, p = 0.014) (Fig. 4 a & b). These findings suggest that both proliferation and migration contributed to wound closure when HASMCs were exposed to a subtoxic dose of CdSO₄ (1 µM). 4. Discussion This study shows that cadmium sulfate directly causes human aortic smooth muscle cells (HASMCs) to undergo a pro-atherogenic phenotypic change. Exposure to CdSO4 caused a dose-dependent, biphasic response, with higher doses causing cytotoxicity and sub-toxic concentrations promotes cellular migration and proliferation. Cadmium exposure significantly increased the expression of osteogenic (BMP2) and inflammatory (CD68) genes while suppressing canonical contractile markers (ACTA2, TAGLN). This suggests a coordinated loss of contractile identity and acquisition of synthetic, inflammatory, and osteoblast-like features typical of VSMC phenotypic modulation during atherogenesis [ 3 , 4 , 11 – 13 ]. Despite the fact that epidemiological research has connected cadmium exposure to cardiovascular disease [ 5 , 10 , 14 , 15 ], these results establish phenotypic switching as a likely mechanism by which environmental cadmium contributes to vascular remodeling and the development of atherosclerotic disease and offer direct mechanistic evidence that VSMCs are a crucial cellular target of cadmium toxicity. Building on this dose-dependent phenotypic modulation, our findings show that CdSO₄ causes a biphasic response in HASMCs that depends on exposure duration and concentration. Sub-toxic cadmium exposure (≤ 5 µM) increased cellular survival and proliferative activity, which were previously linked to epigenetic modification of growth-related genes. This is consistent with hormetic effects observed in other cell types, such as hepatocytes, ovarian cells, and lymphocytes [ 16 – 19 ]. In our model, the rise in viability was supported by increased Ki-67 expression, indicating enhanced proliferation rather than metabolic activity alone. In contrast, higher amounts of cadmium (≥ 15 µM) caused significant cytotoxicity, which led to morphological changes and a decrease in viability. This impact is consistent with earlier research demonstrating that cadmium causes oxidative stress, mitochondrial malfunction, calcium dysregulation, and activation of the intrinsic apoptotic pathway through BAX, BCL2, and caspase-3 [ 20 – 23 ]. These findings underscore the importance of dose selection when studying phenotypic switching, as high toxicity may confound interpretation of surviving cell behaviour. Low-level cadmium exposure promotes a motile phenotype, as shown by the increase in HASMC migration at a sub-toxic concentration (1 µM). Atherogenesis and intimal thickening both involve VSMC migration as a critical step [ 24 ]. Previous research suggests that cadmium can activate signaling pathways like p38, MAPK, Akt, COX-2, and MMP2, which control extracellular matrix remodeling and cytoskeletal dynamics, even if the reactive oxygen species (ROS) were not directly measured in this study [ 25 , 26 ]. Comparable cadmium-responsive mechanisms have been identified in cancer and vascular cells, in which low-dose exposure increases proliferation and motility, frequently accompanied by oxidative stress-related signaling [ 27 ]. BMP2 upregulation at sub-toxic cadmium concentrations demonstrated phenotypic switching toward an osteogenic state. By activating SMAD/RUNX2 signaling to drive osteogenic gene transcription, BMP2 plays a critical role in controlling vascular calcification and plaque instability [ 28 – 30 ]. Calcified atherosclerotic lesions and experimental models of vascular calcification have consistently shown higher BMP2 expression, which promotes osteoblast-like features and loss of the contractile phenotype [ 31 , 32 ]. In addition to its function in calcification, BMP2 has been shown to stimulate VSMC migration during vascular remodeling by connecting osteogenic signaling with increased cellular motility via ERK1/2-dependent cytoskeletal reorganization and modulation of actin dynamics [ 33 , 34 ]. As demonstrated by increased CD68, a macrophage-like marker, exposure to CdSO₄ induced an inflammatory phenotype. It's interesting to note that CD68 expression exhibited a non-monotonic pattern, declining at intermediate concentrations before increasing once more at higher ones. This trend would indicate a transient stress-adaptive inhibition of protein synthesis that is subsequently overturned by pro-inflammatory signaling via the MAPK and NF-κB pathways [ 35 , 36 ]. The rise in CD68 expression raises the possibility that VSMCs will become more like macrophages, which could promote the production of foam cells and accelerates the development of atherosclerotic plaque. Studies on humans and animals have shown that throughout this process, VSMCs lose their contractile properties and acquire characteristics of macrophages, which can improve lipid uptake and promote lesion formation [ 11 , 37 ]. Ultimately, cadmium exposure reduced the production of the contractile markers TAGLN and ACTA2, suggesting a transition away from the contractile phenotype. This aligns with research demonstrating that disruption of the myocardin-serum response factor (SRF) transcriptional program, which is a major regulator of smooth muscle contractile gene expression, is linked to downregulation of contractile markers and phenotypic switching in vascular smooth muscle cells [ 12 , 13 ]. The increased proliferative and migratory responses seen in HASMCs after sub-toxic CdSO4 treatment, in addition to phenotypic change, are biologically significant in relation to atherogenesis. When VSMCs change from a contractile to a synthetic phenotype, they show decreased expression of contractile markers while gaining more proliferative and migratory potential. These processes promote intimal thickening and neointima formation during the early stages of plaque development and, depending on the situation, either contribute to plaque stability or progression (38, 39). According to recent reviews, vascular remodeling and lesion development are largely dependent on the regulation of VSMC proliferation and migration, which are influenced by molecular and environmental cues that interfere with normal vascular homeostasis [ 40 ]. These results collectively support the hypothesis that CdSO₄-induced increases in HASMC migration and proliferation may have pathophysiological implications related to atherosclerosis. Collectively, these findings indicate that cadmium induces dose-dependent phenotypic switching in HASMCs, promoting migratory, osteogenic, and inflammatory characteristics while suppressing contractile features. Although the precise upstream mediators remain to be fully defined, these data support a role for environmental cadmium exposure in vascular remodeling and atherogenesis and highlight pathways that may warrant further mechanistic investigation. Abbreviations VSMCs (vascular smooth muscle cells) HASMCs (human aortic smooth muscle cells) ICC (immunocytochemistry) ROIs (Regions of interest) CCK-8 (Cell Counting Kit-8) ACTA2 (alpha-smooth muscle actin) TAGLN (transgelin) BMP2 (bone morphogenetic protein 2) CD68 (cluster of differentiation 68) Declarations Funding: Supported by the University Research Council, Aga Khan University, Karachi, Pakistan. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Ethics Approval: This study was approved by the Ethics Committee of The Aga Khan University, Karachi, Pakistan (Protocol No. 2024-7704-30610). Funding: Supported by the University Research Council, Aga Khan University, Karachi, Pakistan. Author Contribution SH, SR and MUR designed the study. BK and SR performed the experiments. SR and BR wrote the manuscript and analyzed the data. All authors read and edited the manuscript. SH is the guarantor of this study. Acknowledgement SR is joint first author References Chen W, Li Z, Zhao Y, Chen Y, Huang R (2023) Global and national burden of atherosclerosis from 1990 to 2019: trend analysis based on the Global Burden of Disease Study 2019. Chin Med J 136:2442–2450 Chong B, Jayabaskaran J, Jauhari SM, Chan SP, Goh R, Kueh MTW et al (2025) Global burden of cardiovascular diseases: projections from 2025 to 2050. Eur J Prev Cardiol 32:1001–1015 Libby P, Buring JE, Badimon L, Hansson GK, Deanfield J, Bittencourt MS et al (2019) Atherosclerosis. Nat Rev Dis Primers 5:56 Tang H-Y, Chen A-Q, Zhang H, Gao X-F, Kong X-Q, Zhang J-J (2022) Vascular smooth muscle cells phenotypic switching in cardiovascular diseases. Cells 11(24):4060 Lamas GA, Bhatnagar A, Jones MR, Mann KK, Nasir K, Tellez-Plaza M et al (2023) Contaminant metals as cardiovascular risk factors: a scientific statement from the American Heart Association. J Am Heart Association 12(13):e029852 Ozarde Y, Purandare D, Deshmukh S, Gadhave R (2025) Heavy metals and cardiovascular health: Uncovering links and health challenges. J Trace Elem Med Biol 127648 Washington B, Williams S, Armstrong P, Mtshali C, Robinson JT, Myles EL (2006) Cadmium toxicity on arterioles vascular smooth muscle cells of spontaneously hypertensive rats. Int J Environ Res Public Health 3:323–328 Zhang Y, Sun L, Wang X, Zhou Q (2023) Integrative analysis of HASMCs gene expression profile revealed the role of thrombin in the pathogenesis of atherosclerosis. BMC Cardiovasc Disord 23:191 Prozialeck WC, Edwards JR, Nebert DW, Woods JM, Barchowsky A, Atchison WD (2008) The vascular system as a target of metal toxicity. Toxicol Sci 102:207–218 Tinkov AA, Filippini T, Ajsuvakova OP, Skalnaya MG, Aaseth J, Bjørklund G et al (2018) Cadmium and atherosclerosis: a review of toxicological mechanisms and a meta-analysis of epidemiologic studies. Environ Res 162:240–260 Grootaert MO, Bennett MR (2021) Vascular smooth muscle cells in atherosclerosis: time for a re-assessment. Cardiovasc Res 117:2326–2339 Owens GK, Kumar MS, Wamhoff BR (2004) Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol Rev 84:767–801 Bennett MR, Sinha S, Owens GK (2016) Vascular smooth muscle cells in atherosclerosis. Circ Res 118:692–702 Tellez-Plaza M, Jones MR, Dominguez-Lucas A, Guallar E, Navas-Acien A (2013) Cadmium exposure and clinical cardiovascular disease: a systematic review. Curr Atheroscler Rep 15:356 Verzelloni P, Giuliano V, Wise LA, Urbano T, Baraldi C, Vinceti M, Filippini T (2024) Cadmium exposure and risk of hypertension: a systematic review and dose-response meta-analysis. Environ Res 263:120014 Henson MC, Chedrese PJ (2004) Endocrine disruption by cadmium, a common environmental toxicant with paradoxical effects on reproduction. Exp Biol Med 229:383–392 Wang B, Ji K, Wang Y, Li Y, Tang Y, Gu J, Cai L (2015) Exposure to low dose cadmium enhances FL83B cells proliferation through down-regulation of caspase-8 by DNA hypermethylation. Toxicol Res 4:248–259 Zhang X, Ma L, Tang Y, Han J, Qi Y, Huang D (2021) Low-dose cadmium exposure facilitates cell proliferation by promoter hypermethylation of RASSF1A and DAPK1 genes. Environ Toxicol 36:2313–2321 Yuan D, Ye S, Pan Y, Bao Y, Chen H, Shao C (2013) Long-term cadmium exposure leads to the enhancement of lymphocyte proliferation via down-regulating p16 by DNA hypermethylation. Mutat Res Genet Toxicol Environ Mutagen 757:125–131 Biagioli M, Waètjen W, Beyersmann D, Zoncu R, Cappellini C, Ragghianti M et al (2001) Cadmium-induced apoptosis in murine fibroblasts is suppressed by Bcl-2. Arch Toxicol 75:313–320 Zhang T, Sun S, Gavrilović A, Li D, Tang R (2023) Selenium alleviates cadmium-induced oxidative stress, endoplasmic reticulum stress, and apoptosis in L8824 cells. Ecotoxicol Environ Saf 262:115337 Yan Y, Yi W, Fei Fei H, Jin Long Y, Shi Wen Z, Jian Hong G et al (2016) Cadmium activates reactive oxygen species-dependent AKT/mTOR and mitochondrial apoptotic pathways in neuronal cells. Biomed Environ Sci 29:117–126 Mahdavi S, Khodarahmi P, Roodbari N (2018) Effects of cadmium on Bcl-2/Bax expression ratio in rat cortex brain and hippocampus. Hum Exp Toxicol 37:321–328 Yu Y, Cai Y, Yang F, Yang Y, Cui Z, Shi D, Bai R (2024) Vascular smooth muscle cell phenotypic switching in atherosclerosis. Heliyon 10:18 Naji S, Issa K, Eid A, Iratni R, Eid AH (2019) Cadmium induces migration of colon cancer cells: roles of reactive oxygen species, P38 and cyclooxygenase-2. Cell Physiol Biochem 52:1517–1534 Zhai H, Pan T, Yang H, Wang H, Wang Y (2019) Cadmium induces A549 cell migration and invasion by activating ERK. Exp Ther Med 18:1793–1799 Liang Y, Pi H, Liao L, Tan M, Deng P, Yue Y et al (2021) Cadmium promotes breast cancer cell proliferation, migration and invasion by inhibiting ACSS2/ATG5-mediated autophagy. Environ Pollut 273:116504 Boström K, Watson K, Horn S, Wortham C, Herman I, Demer L (1993) Bone morphogenetic protein expression in human atherosclerotic lesions. J Clin Invest 91:1800–1809 Cai T, Sun D, Duan Y, Wen P, Dai C, Yang J, He W (2016) WNT/β-catenin signaling promotes VSMCs to osteogenic transdifferentiation and calcification through directly modulating Runx2 gene expression. Exp Cell Res 345:206–217 Durham AL, Speer MY, Scatena M, Giachelli CM, Shanahan CM (2018) Role of smooth muscle cells in vascular calcification: implications in atherosclerosis and arterial stiffness. Cardiovasc Res 114:590–600 Giachelli CM (2009) The emerging role of phosphate in vascular calcification. Kidney Int 75:890–897 Shanahan CM, Crouthamel MH, Kapustin A, Giachelli CM (2011) Arterial calcification in chronic kidney disease: key roles for calcium and phosphate. Circ Res 109:697–711 Zhang M, Yang M, Liu L-p, Lau WB, Gao H, Xin M-k et al (2014) BMP-2 overexpression augments vascular smooth muscle cell motility by upregulating Myosin Va via Erk signaling. Oxid Med Cell Longev 2014:294150 Yang M, Fan Z, Wang F, Tian Z-h, Ma B, Dong B et al (2018) BMP-2 enhances the migration and proliferation of hypoxia-induced VSMCs via actin cytoskeleton, CD44 and matrix metalloproteinase linkage. Exp Cell Res 368:248–257 Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee D-H et al (2012) Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev 33:378–455 Liu J, Qu W, Kadiiska MB (2009) Role of oxidative stress in cadmium toxicity and carcinogenesis. Toxicol Appl Pharmacol 238:209–214 Basatemur GL, Jørgensen HF, Clarke MC, Bennett MR, Mallat Z (2019) Vascular smooth muscle cells in atherosclerosis. Nat Rev Cardiol 16:727–744 Cao G, Xuan X, Hu J, Zhang R, Jin H, Dong H (2022) How vascular smooth muscle cell phenotype switching contributes to vascular disease. Cell Commun Signal 20:180 Chen R, McVey DG, Shen D, Huang X, Ye S (2023) Phenotypic switching of vascular smooth muscle cells in atherosclerosis. J Am Heart Assoc 12:e031121 Zhao L, Zhao L, Liu D, Huang F, Peng Q, Lu J et al (2025) Vascular smooth muscle cells: a therapeutic target in atherosclerosis. Rev Cardiovasc Med 26:28240 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8973731","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":605231542,"identity":"cad3c81f-9b81-4390-beb6-3b0051de6984","order_by":0,"name":"Brishna Khan","email":"","orcid":"","institution":"The aga khan university","correspondingAuthor":false,"prefix":"","firstName":"Brishna","middleName":"","lastName":"Khan","suffix":""},{"id":605231543,"identity":"0fb2986e-ece6-4759-ab73-06237cc86ce4","order_by":1,"name":"Shafaq Ramzan","email":"","orcid":"","institution":"The aga khan university","correspondingAuthor":false,"prefix":"","firstName":"Shafaq","middleName":"","lastName":"Ramzan","suffix":""},{"id":605231548,"identity":"1f3fc3db-120a-4b7e-bbc5-001913979daf","order_by":2,"name":"Mati-Ur-Rehman Rehman","email":"","orcid":"","institution":"The aga khan university","correspondingAuthor":false,"prefix":"","firstName":"Mati-Ur-Rehman","middleName":"","lastName":"Rehman","suffix":""},{"id":605231557,"identity":"ebe452fa-46ae-4314-9a5b-60fa5c259854","order_by":3,"name":"Anum Aziz","email":"","orcid":"","institution":"The aga khan university","correspondingAuthor":false,"prefix":"","firstName":"Anum","middleName":"","lastName":"Aziz","suffix":""},{"id":605231558,"identity":"69f76a8f-2c33-4c9c-aa8d-3eeefd93cc56","order_by":4,"name":"Satwat Hashmi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBCDBAYGHiBZwWAA4kngV8wM1gDVcoZkLYxtRGiRbz9/TOLnD4Y8/v6zRzc8nGdnbHCA+eBtHjxaDM4ks0n2JDAUS9zIS7uRuC3ZzOAAW7I1Xi0MyWw3eBIYEhtu8JgBtTDbGBzgMZPGp0W+/zHbzT9ALfPPnwFqmVMP1ML/Da8WhhvJbLdBtmw4kAPU0nAY6DAeNrxaDG48Nv8tkyaRuPEGUEvCsePGkofZjC3n4HVY4mPDNzY2ifOADrv5o6basO9488Mbb/A5DAKQI4KZsPJRMApGwSgYBQQAACvFTt8BnO9cAAAAAElFTkSuQmCC","orcid":"","institution":"The aga khan university","correspondingAuthor":true,"prefix":"","firstName":"Satwat","middleName":"","lastName":"Hashmi","suffix":""}],"badges":[],"createdAt":"2026-02-26 05:53:40","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8973731/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8973731/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104782164,"identity":"40ddcacf-fadb-4f3c-9450-47965cce4172","added_by":"auto","created_at":"2026-03-17 07:56:54","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":404415,"visible":true,"origin":"","legend":"\u003cp\u003eDose-response curves for CdSO4 treated HASMCs. (A, B) Live/Dead images were captured for HAMSCs treated with CdSO4 at increasing concentrations for 24 h and 48 h. Scale bar 150 um and images were captured at 10× magnification. (C) Figure shows cell viability after treatment with increasing concentrations of CdSO₄ for 24 h and 48 h, measured by CCK-8 (450 nm; blank subtracted. Bars show mean ± SD (n = 3). Viability is expressed as % relative to untreated control cells. The dotted horizontal line marks 50% viability and the dashed vertical line marks the IC10, indicating the highest non-toxic dose. P-values were calculated from blank- corrected OD values. (Statistical significance in figures is indicated by asterisks: p \u0026lt; 0.05, p \u0026lt; 0.01, p \u0026lt; 0.001, ns: not significant). n = 3 experiments per condition; 3–4 independent experiments\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8973731/v1/4dbf960d908af9ec6c7696b3.jpg"},{"id":104556043,"identity":"003f4b7c-7951-4d4a-98c7-fa9d1503ec87","added_by":"auto","created_at":"2026-03-13 09:12:27","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":91305,"visible":true,"origin":"","legend":"\u003cp\u003eFold change (log2) expression of a gene of interest relative to reference gene, relative to the expression in each sample following treatment with different doses of CdSO4. Data is presented as mean fold change relative to untreated controls. Individual data points are shown as dots (mean ± SD, n = 3). Statistical significance is indicated by asterisks: p \u0026lt; 0.05, p \u0026lt; 0.01, p \u0026lt; 0.001, ns: not significant\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8973731/v1/927167e09ed777f966f4f316.jpg"},{"id":104781516,"identity":"580625a5-84c0-44ce-82a5-5c4fd9239e9a","added_by":"auto","created_at":"2026-03-17 07:55:50","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":114440,"visible":true,"origin":"","legend":"\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Representative phase contrast images of HASMCs subjected to scratch wound assay at 0 h and 24 h under control condition and after treatment with 1 µM CdSO₄. Images captured at 4× magnification. (\u003cstrong\u003eB\u003c/strong\u003e) Cells exposed to CdSO₄ exhibited significantly greater wound closure compared with control, indicating increased migratory capacity. Data are presented as mean ± SD from independent experiments, with individual data points shown. *P \u0026lt; 0.05 versus control\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8973731/v1/6eda4ac5d1394f9b65d0edf5.jpg"},{"id":104556041,"identity":"fdf1f89b-9bf0-46b7-910e-4aa8c2bcdc6a","added_by":"auto","created_at":"2026-03-13 09:12:27","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":53251,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence staining of Ki67 in HASMCs. (\u003cstrong\u003eA\u003c/strong\u003e) Representative images of control and 1 µM CdSO₄-treated HASMCs after 24 h, stained with DAPI (blue, nuclei) and Ki-67 (red, proliferative marker). Merged images show nuclear colocalization of Ki-67 (magenta). Images were taken at 20× magnification. (\u003cstrong\u003eB\u003c/strong\u003e) Quantitative analysis of Ki-67 fluorescence intensity shows of Ki-67 MFI in control and CdSO₄ 1 µM treated HASMCs. Bars represent mean fluorescence intensity (MFI ± SD). A significant increase in MFI was observed following CdSO₄ exposure (p = 0.014). Quantification of corrected MFI confirmed higher Ki-67 expression in treated cells compared to controls (p=0.014)\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8973731/v1/3668ee724180c1c07ffc7805.jpg"},{"id":106957339,"identity":"c861ec8d-fa21-4e2d-96e3-549695c42d72","added_by":"auto","created_at":"2026-04-15 08:29:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1486171,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8973731/v1/dafe0296-c1dd-4ad8-a89b-74d3e8a48fd9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cadmium Sulphate Induces Pro-Atherogenic Phenotypic Switching in Human Aortic Smooth Muscle Cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAtherosclerosis is a chronic inflammatory disease and is the leading cause of global morbidity and mortality [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Endothelial dysfunction, immune cell infiltration, and oxidative stress disrupt the normal function of vascular smooth muscle cells (VSMCs), leading to lipid deposition and the development of atherosclerotic plaques inside the arterial wall. In response to pathological stimuli, VSMCs, which usually retain a contractile phenotype, may undergo phenotypic switching and develop synthetic, inflammatory, and osteogenic properties that contribute to vascular remodeling, development of plaque and calcification [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEnvironmental exposure to toxic heavy metals has become a significant but often overlooked risk factor for cardiovascular disease. Cadmium is a non-essential, highly persistent heavy metal frequently found in cigarette smoke, industrial emissions, contaminated food, and water sources [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Due to its long biological half-life and excretion in small amounts, cadmium accumulates in vascular tissues, where it causes endothelial dysfunction, inflammation and promotes oxidative stress [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Although, epidemiological data has linked cadmium exposure to a higher incidence of hypertension, coronary artery disease, and atherosclerosis, the underlying cellular mechanisms are not fully understood.\u003c/p\u003e \u003cp\u003eIncreasing evidence indicates that cadmium may have direct impact on VSMC behavior by changing cell viability, proliferation, and migration [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Experimental studies have shown that low-dose cadmium exposure can stimulate VSMC proliferation and migration activity, while higher concentrations can cause cytotoxicity, indicating a dose-dependent and biphasic cellular response [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Nonetheless, it is still unclear whether these cadmium-induced changes cause human VSMCs to switch to synthetic, inflammatory, or osteogenic phenotypes.\u003c/p\u003e \u003cp\u003eThe goal of this study is to systematically analyze changes in cell viability, proliferative activity, migratory behavior, and phenotypic marker expression in human aortic smooth muscle cells (HASMCs) to assess the effects of cadmium sulfate. This study aims to determine whether cadmium exposure induces phenotypic switching of HASMCs toward a synthetic and proatherogenic state by assessing cadmium-induced modulation of contractile, inflammatory, and osteogenic markers. Collectively, these findings may help clarify the pathogenic role of cadmium in cardiovascular disease and support the development of preventive and therapeutic strategies targeting environmentally driven vascular dysfunction.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Cell Lines, Culture Conditions\u003c/h2\u003e \u003cp\u003eHuman aortic smooth muscle cells (HASMCs) (ATCC, USA; PCS-100-012) were used as the primary experimental cell line in this study. Cells were cultured in Vascular Smooth Muscle Cell Growth Medium (ATCC Primary Cell Solutions\u0026trade;, PCS-100-030), supplemented with Vascular Smooth Muscle Cell Growth Kit PCS-100-042\u0026trade;. All experiments were conducted using cells between passages 3 and 8 to ensure phenotypic stability and reproducibility.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Cadmium-Induced Cytotoxicity Analysis in HASMCs:\u003c/h2\u003e \u003cp\u003eHASMCs were seeded at a density of 8,000 cells per well in 200 \u0026micro;L of culture media in 96-well plates, and they were incubated for 24 hours at 37\u0026deg;C with 5% CO2. Following a PBS wash, the cells were exposed to cadmium sulfate (2630\u0026ndash;4105, Sigma-Aldrich) at doses of 0.5, 1, 5, 10, 15, 25, and 50 \u0026micro;M for 24 hours. Wells with just media were utilized as blanks, while untreated cells were used as controls. Phase-contrast microscopy was used to evaluate cell morphology. The CCK-8 assay (Sigma-Aldrich; 96992) was used to measure cell viability in accordance with the manufacturer's instructions. A microplate reader (Bio-Rad iMarkTM, USA) was used to measure absorbance at 450 nm. Every experiment was carried out three times. Cell viability (%) was calculated using blank-corrected absorbance values as follows:\u003c/p\u003e\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAYwAAABPCAYAAAD4MvLkAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAABOISURBVHhe7d3PaxvH+wfwt773psjOKYRitC4UWhC0MglF7iFQrfE5reyQQ6DQZJeQUy0Z2TnFNshJHCipJYcWTA/dTZtCLzZWAg103dA0brBooYd6RQihJ8lO+g/M99Cd/cyOdqVdWf5VPS8QJDOzknZkzbOaXxtjjDEQQgghbfyfnEAIIYT4oYBBCCEkFAoYhBBCQqGAQQghJBQKGIQQQkKhgEEIISQUChiEEEJCoYBBCCEkFAoYhBBCQqGAQQghJBQKGIQQQkKhgEEIISQUChiEEEJCoYBBSIDV1VUMDQ1hfX1dziJH0Pr6OoaGhrC6uipnkZBitL05Ic10Xcf9+/exvLyMdDotZ5Mjan19HRcuXEAmk8Hi4qKcTdqggEGIZGpqCqVSCX/99Rf6+/vlbHLENRoNvPnmm9A0DbOzs3I2aYECBiGC9fV1DA8PY2VlBaOjo3I2+Y8wTRPj4+OwLIt+QUZAAYMQwcjICLa2trC1tSVnkf+YwcFBDA4OYm1tTc4iAWjQmxBHtVpFpVLBxMSEnNXW1NQUYrEYDZA7jkJ9TExMoFKpoFqtylkkAAUMQhzffvstAOD06dNyVkvVahVzc3Nycs86KvXBP+dKpSJnkQAUMAhx/PbbbwCAZDIpZ7WUz+eRzWYBAC9evJCze85RqQ/+Of/4449yFglAAYMQR6VSgaqqcnJLpmmi0Wjg8uXLAIDnz5/LRXrKUasPVVXpF0YEFDAIAVCr1eSkthqNBnRdx61bt+SsnnSU66OTz78XUcAgBMDff/8NADhz5oycFWhhYQGZTAbpdBonTpyQs3vOUawP/nnzz5+0RgGDkA5Uq1WUSiV3cDeRSAAAnj59KpXsDVQfvYECBiEdyOfzmJycdBtG7uXLl57/H5TBwUGYpikn+5qfn0csFgv9mJ+fl58idH2MjIz4Hg9n0WQsFpOTI9F1Hbquy8mkSyhgEBKRaZqoVCrI5/OehvSwGBkZgW3bcnKgXC4HxljoRy6X8xwftj50XQ8cYK7VahgeHpaTI5mfn0epVJKTSRdRwCAEcPvc202x5AO75XK5qSE9LNbW1qAoipy8J6LUx+LiYuAstEQiAcuy5ORIcrkcNE2Tk1vin/dRGXM5aBQwCBH63NtZWFhAX18fLl68KGf5TtHUdR2xWAymabpdJbVazXMlzruOeJeMmL++vg7TNJuu2k3TdLudeF6rmT78fcQCupQ6FbU+uJGREcRiMYyMjMhZLvE9Dw4OetJ1XXe70sQ8kXh8O2E//57HCCGMMcZUVWWtvhKWZTEArFgsylnMtm0GgAFg9XrdTdM0jTHGmKZpnn/z5ygWi0xRFM/xiqK45RRFcY9TFIUVi0X3fQDwPCc/jpc1DIMxxphhGO7r8dexbdst26mo9cGEOrYsi7F/f4a4x/PnE4/nALjnwZ+XH8fzmFTPiqK4rxMEAFNVVU4mAYK/HYT0mEKhwACwzc1NOYtZlsXi8TgDwOLxeFNDxBsxACybzTIWsnE2DMNt6MUGkznBRGzMVFV1G0nxOObzWmLA4I20+OB5neqkPph0Dkw6R/n8ReL5iEEhKK9dvTPG2ObmJkNAwCP+qEuKEMfHH38MAPjll1/kLKTTaWxvb4Mxhu3t7aYtscW+e97FlEgkUCwWoSiK270kGhkZwfj4uCetU626VLa2tmAYhuc9jo2NycUi6aQ+/LzxxhtykgfvposyiM8Hvn/99Vc5y4N/zkHjKqQZBQxCHMlkEqqq4vr163JWx/gMpGKx6M4C4n3v09PTMAxDPqQjfPzCL3AMDg4e2i06nj9/7vueASAWi2FmZgaMsUiD+JqmwbIsjI+PtxzXuX79OlRVjbx3WC/7zwSMRqMB0zQxNDTkGdSrVqvQdR19fX2e8rtRrVbR19cXafCw0WhgaWkJg4ODTVeafvh7bjQaQIvz8yu7H1ZXV7t2b+SlpaVQdbIfpqenYdt2V86tVqu5A93iVNQ7d+7AMIymq/KobNt2G8R79+4FzhA6c+YM8vm8W5YPpB8UcSZaPp/HZ5995smHM6ivKErH96pIp9PQNC1wTYZpmrBtG9PT03IWaUXuo9pPtm2zQqHAFEVx+ztVVWWGYbB6vc7K5bJ8SCDbtt0BMbFP0rIs9/m7xbZtFo/HI/V9Wpbl9pHL/b1+CoUCi8fjngFUv/PzK7vXCoWCpw98c3PT7SdXFMV3DIDTNM33/Mvl8q771bulW/Vp27Zn/ICfnzhwK/7tiw/DMDzfCd4vzz9/PobBj5cHvHlZXtfi8WLZgyDWCR9n4OMX4vsT60M8T56maZrnuc6dO+fJE89Z/Jur1+ssHo+zQqHgph2Eer3OisUii8fjcpaHbdssm82655JKpXy/Qyxi2U50rxWNiH8hVFVlKysrbvrm5qb7hYo6e4H/0ckNarvZL/uFv79OP8Cg8wuysrLS8WsFKZfLTV+0VCrlDmxms9nABkmcreOHXywcBnzWUbfrr1vkQW8SjuVcQIqD5vtNDBS8YQ/Cg1sqlWL1ep3V63U3IMh/m1HKdir4ne4hHizE2RMywzAoYEiCzi+Iqqodv5YfPhNHvPLmM0346/D3KP/K2NzcbPl5M+GXW7vZLftlZWWl61do3UIBIzrLslgqlfJcoIZlGEbbIBOmDHMuqviFUSqVatk28Ytn8TvBv4dy+xilbKeC3+ke4VFQPjE/Ua82gxrUXgwY5XJ5V6/lJ5vNNv3hyeck/585n7mqqqG6eFKpVKgvXS/jdYxD0L3UKzY3N1k8Hg/82+QXwVHbrHZtE+92lPFAI36nopTt1L4Pet+7dw87OztQVTVwdgQnT/3jg8Z8defS0pInfzf4ilD+4IOwfFpfzFkhywev/Qaf5+fn0dfXh1gshr6+Pui6HjgQbZqmW1Yut76+Hnqg3q/s1NQULl26BAAYHh5GzFlRK56fuMJW3HxOPieuVqvh7t27Tdt/v/baawCAf/75x5Muunr1Kqanp9Hf3y9nNRkaGoLp3ISH+Eun0+6U1a2tLTmb7IFkMomHDx96VuxzpmlifHwc5XK5qc3ajUajAdu2fVey8+/Sn3/+CUQsuxv7HjAePnwIRLzvAJxGsFqt4vHjx6jX68hkMrh06VLXZnvYtu1O3avX6+4MlnQ6DcMwoGkacrkcXr16BQDY2NjwHD8/P498Po+HDx+CMYbJyUmUSiXcu3fPUw4AvvnmG/z000+YnJyEoigolUpNWyQ8efIEOzs7nrQgctnZ2VkUi0UAgGVZYIxhbW0N5XIZAJBKpTyzT3K5HFRVRblcbtpYjuNz2t955x1PejKZRCqVwtdffw0AuH37NhRFcevPNE0MDAyEnhE0MDCAnZ0dPH78WM7y6MYOq4RE4Rc0eLDQNM13e5TdaNXAy+1nlLK7se8BQ97uOIxarYa5uTlcu3YN/f396O/vx7Vr1wBnGmQ3JBIJzMzMAAAePHjgyVteXnZfL5FI4O233/bkA8CrV68Qj8fdOd284eUBRpRMJrG4uIhcLoetrS2oqoqNjQ13Kmc6nQ51NY6IZS9evAhVVWHbtucKvtFoYGtrq+UfPJ/Hf+zYMTkLX375JV6+fImYs8Dq+++/B5zpxz/88INbF6az/1EsFsPU1JT0LP/iAemPP/6Qszx2u8MqIZ0QgwZfeKlpGhYXF+Wi/0n7HjA6wRvw48ePu1eMx48fB5xfBt0yNjYGRVE8QahWqyGRSLRtlGdnZ7G9ve1ZbxFEDjhXrlwBQjSS3VAsFrGzs4OFhQU37cGDB/j000895WStdnFNJpNYW1sDYwxPnjxxg2Y+n8cXX3wBOPU4Pj6OmZkZ1Ot1lEol36t+v4C01+RfI/To3UcYyWQSk5OTqFQqUBSlZ4IFDiJgvPfeewCAZ8+eyVmB+FW6fNXIH900MTEB27bdrq4bN274LizyMz8/j1OnTuHVq1e4f/++nB1oPxvJZDIJTdMwNzfnLuSanp7G2bNn5aK7MjU1hStXrriBlnfNjY2Nob+/H5lMBnfu3JGOOhjy3xM9evcRhmmayOfz7q91eUyjW/j4oB/5ToZRyu7GvgeMTz75BHAqPezA5uuvvw4E3Ki9W2MY3NmzZxGPx3Hz5s2W2y3IdF3HnTt38PjxY+RyuVDHyNrtq9MtPAAWCgWYpolMJtP2/UbpB+Vda6Ojo26a/Avl3Xff3dWvQxrDIAdhdXXV7YZaW1uDYRgolUp7EjT4L3W/PbF41z4fG4xSdjf2PWAkEgkUCgXs7Ozg6tWrcraLd+0AwOnTpwEA2Wy2qe/9999/d//fDf39/ZicnMTGxgay2SzOnTsnF/FVKpWQSqXadl35efToEeLxOD788EM5a08kEglomoa7d+9C1/WWYxccD2YvXryQszxqtRo+//xzzM7OetLlgPP06VPf/YEePXoE+Ayuy2gMg+y3arWK8+fPe8YsxsbG9jRoZLNZ7OzsoFqtummNRgOVSqVpK5goZTsmz7PdL3zZPl/pzecI1+t1dwGMuPiLl1cUhRUKBVYsFlkqlfKs5eBrD8QFYvV63d1OQF5MFoSvFZHXHHB+Cw/j8TiLx+PMMAy2srLibgMirl7m8+dVVXXfN3/P4mKier3uzp0W33PQ+fmVXVlZYXC2SDAMo2l+OF8kF3SOMr4AqN0aEPHcRPx4wzDc1/Z7Ll5v3Zgzvlu2cz+LdgsOydFQLpdZNpvtaG1S2HUYQfl+xLbJ7zvDhNflbV29XmeapvkucI1StlMHFjCY04Bms1nPEvlUKsXK5bJvg1F0bjbDy4kNJF/lKD7Yv52SnodfI+WnUCj4rgiVX4c3uIZhuOdRKBTchlyR9lYynBXs/PhsNtsUyOT3bFlW0+si4Pz4l4EvluPvx4+44jQMv4V7oqA641ZWVtzPL+g9HZaFe4azkjrKfmbk8LOc1d5R/8b4RWwrYcownzaAP1RV9f1ebAp7tSGgzeCilO3EgQYMcnD41U0U/FeCXzDvBv7Lo1tXQ53yW63eTpSNJXvBYa4P/rfv1ziT1vZ9DIMcDl999RUmJibk5JYSiQTK5bJnSm433bhxA4uLi20H4PdSo9HAhQsXoGla6EHCarWKubk5OblnHfb66O/vx/LyMubm5g7NtvpHBQWMHsIXzQ0NDeG7777raCotHyDv9uw00zTxwQcfdHVrhU48ePAAtm2HnkoNZ71JNpsFQkwK6AVHoT7S6TRSqZS7WJeEQwGjh2QyGQBwb0zTyYwuOIsUjx071pWbDMGZqnjy5MkDDxYAcPPmTaRSqdC/cvj08MuXLwPCivhedZTq46OPPkKlUgk9vZ9QwOgpi4uLYM49ljsNFtzo6KhnncVujI6Ohu7+2WsbGxsYGhqSk301Gg3ouo5bt27JWT3pqNXH+++/DwBt9y0j/0MBgxAH788eGBiQs3wtLCwgk8kgnU7jxIkTcnbPOar1sR9b8vxXUMAgpAPVahWlUskd3OVdWN3chuEoofroDRQwCOlAPp/H5ORk01hHJ7sx7ydd15tWJHdjm5Ww9TEyMuJ7PIR7z+yG3/mR7qGAQUhEpmmiUqkgn897GtL90mmDOD8/j1KpJCfvepuVsPWh6zoqlYqcDDhbygwPD8vJkQSdH+keChiEOPjAe6udlPnAbrlcbmpI90PQ1XkYuVyue3sKOaLUx+LiIlRVlZMBpwvLsiw5OZKo58fvEtlu3zLyPxQwCBGkUik8efJETnYtLCygr6/Pd8NGVVV9r6DFq25xx2Vd1327eXi3Cu8q4vdW0XUd+XwepVLJfS7exSNe1ddqtZZX+t3USX3A6ZqKSbcKlon1I95fJqh+ZOLxfn7++WcAwFtvvSVnkSDy0m9CehnfRM5vexK+ZYjffmR82xR56xRFUdztMVRVdfca0jTN/be4saO4Zxh/HTibNsrH8Q05xa8xfy7+/nkZTjx+tzqpD77PEa8T8Xj+fOLxHK+DKPUj1r0fRVFa7o1GmlHAIETA9xmSG1XLstzNJePxeFNDxBsxCLsJW5YVuF+X2GgyYWNN5tOoK4ri2yAypwEWG+xisdjUCAY1qLvRSX2wNu9XDBiyVnXgl4eAoM/x15LfN2mNuqQIEfB9hkqlkmclezqdxvb2Nhhj2N7eblpoKPbd821TXrx44dtdwrulxLUK3bp51rNnz5pmKvndd2S3OqkPP+3Om8+cinKzLT7w7XczIQj7hRUKhab3TVqjgEGIJJ1OwzAMnD9/3r2JVydOnjzp24fPG3S5QfMLLlENDAz43h745MmTctKh8Pz586YAx8ViMczMzIAxFinoaZoGy7IwPj7edJfO9fV1nDp1CplMpukmX6Q9ChiE+BgbG8PGxgaq1WrH01j51as8oA2nURsfH3fTl5eXceHCBff/QdqtQj979ixs23Zfk69eP0xX0uLtevP5vO9Gj6ZpunuedSKdTkPTNM9nt7S0hNu3b2N5edm9Yx6JSO6jIoR0jzj4K44lMGEAGMIArjioq2map4xhGG7fO5y7T8rHM6F/nj843rcvl99v4jnxcQb5vJg0DsLPVTxnuX7OnTvnyRPPl8YquiPG/v1gCCGEkJaoS4oQQkgoFDAIIYSEQgGDEEJIKBQwCCGEhEIBgxBCSCgUMAghhIRCAYMQQkgoFDAIIYSEQgGDEEJIKBQwCCGEhEIBgxBCSCgUMAghhIRCAYMQQkgo/w+rMjbvpifxZgAAAABJRU5ErkJggg==\" width=\"396\" height=\"79\"\u003e\u003c/p\u003e \u003cp\u003eTo identify sub-toxic and cytotoxic concentrations, IC₁₀ (ED\u003csub\u003e90\u003c/sub\u003e) and IC₂₀ values were calculated using 24-hour exposure data. An unpaired two-tailed t-test was used for statistical analysis, and the findings were presented as a percentage of viability in comparison to controls.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Gene Expression Analysis\u003c/h2\u003e \u003cp\u003eHASMCs were seeded in 6-well plates and allowed to adhere for 24 h. At 75\u0026ndash;80% confluence, cells were treated with cadmium sulfate for 24 h. Total RNA was extracted using the Quick-RNA\u0026trade; Miniprep Plus Kit (R1057, Zymo Research, USA), and cDNA was synthesized using the RevertAid cDNA Synthesis Kit (K1621, Thermo Scientific). Quantitative real-time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (K0221, Thermo Scientific) on a Bio-Rad CFX96 Touch\u0026trade; Real-Time PCR system. All reactions were run in triplicate, and relative gene expression was calculated using the 2⁻ΔΔCt method, with GAPDH used as the internal reference gene. The primers used in the study, along with their annealing temperatures, are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in qPCR experiments.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSense/antisense\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTemperature\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKLF4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKr\u0026uuml;ppel-like factor 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCAGCTTCACCTATCCGAT/\u003c/p\u003e \u003cp\u003eGGAATGTACACCGGGTCCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBMP2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBone Morphogenetic Protein 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTCCCCGTGACCAGACTTT/\u003c/p\u003e \u003cp\u003eGCTGTGTTCATCTTGGTGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCD68\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCluster of Differentiation 68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCTGCCACCACTAGTCAT/\u003c/p\u003e \u003cp\u003eTCTGAATCTGGGCTTGGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e62\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eACTA2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eActin alpha 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGATCCTGACTGAGCGTGG/\u003c/p\u003e \u003cp\u003eGTAGGTGGTTTCATGGATGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e62\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTAGLN\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTransgelin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACAGCCTGTACCCTGATGG/\u003c/p\u003e \u003cp\u003eCGGTAGGCCCATCATTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eALPL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAlkaline phosphatase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACTGAAATATGCCCTGGAGC/CCTGGGCATTGGTGTTGTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e62\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCD34\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHematopoietic progenitor cell antigen CD34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAATGAGGCCACAACAAAC/\u003c/p\u003e \u003cp\u003eTGGGAGATGTTGCAAGGCTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTCAACGGATTTGGTCGT/\u003c/p\u003e \u003cp\u003eTTGATTTTGGAGGGATCTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Scratch wound migration assay\u003c/h2\u003e \u003cp\u003eHASMC migration was assessed using a scratch wound assay. Cells were seeded into 6-well plates and grown to 75\u0026ndash;80% confluence, after which a linear scratch was created using a sterile 200-\u0026micro;L pipette tip. Wells were washed twice with prewarmed PBS to remove debris, and cells were incubated in medium containing 0.1% FBS to minimize proliferation. Control cells received low-serum medium alone, while treated cells received low-serum medium supplemented with CdSO₄. Cells were incubated for 24 h under standard culture conditions. Images were captured at 0 h and 24 h from three predefined, non-overlapping fields per well using a Nikon Eclipse 39 microscope (4\u0026times;). The same fields were relocated at 24 h by marking the underside of the plate.\u003c/p\u003e \u003cp\u003e \u003cb\u003eImage Analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWound areas were quantified using Fiji (ImageJ, NIH). Scratch margins were outlined using the polygon selection tool, and wound closure (%) was calculated as:\u003c/p\u003e\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAW8AAABGCAYAAAAD6BVeAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAABEWSURBVHhe7d3/axP3HwfwZz6/q1zjT0OG9PqLzNExU5WZCQr2og7ZcCNxigiDbZeNgrq1Ll2RwXQmAwf9oUmGBX+ZuTrHZKyx6aADc4zZhpKgQ8FekA32052x8w94f35Y3m/uLpc06ZeZ1NcDAs373rlekrvXXV7vL+djjDEQQgjpKP9zFxBCCGl/FLwJIaQDUfAmhJAORMGbEEI6EAVvQgjpQBS8CSGkA1HwJoSQDkTBmxBCOhAFb0II6UAUvAkhpANR8CaEkA5EwZsQQjoQBW9CCOlAFLwJIaQDUfAmhJAORMGbEEI6EAVvQgjpQBS8CVmBbDYLn8+HRCLhXtTx+vr64PP53MWkTVDwJmSZLMvCwMCAu3hdSKfTKBQK7mLSRih4E7JM4+PjCAQCAIBHjx65F3csy7Lw2WefIRwOAwDK5bK7CmkDFLwJWYZyuYxLly7h4sWL4vl6MTIyAlVV8eqrrwIA/v77b3cV0gYoeBOyDNFoFOfOnUN3d7d7UUfTdR2apuHMmTPuRaTNUPAmpEXZbBYLCwt47733AACyLLurdKzTp0/jq6++gt/vx4svvuheTNoIBW9CWsAbKUdHR+H3+wEAPT09mJ2ddVftOOl0GgDwwQcfAAC2bNkCAPjjjz8c9Uh7oOBNSAvGx8fR09ODQ4cOOcorlYrj+VoKhULw+XxNP3Rdd6+iBm+k/Oabb9yLsLi46C4i7YARQppiGAYDUPfhViwWmaIoDACTZZlNTk46lvNl8XjcUf4sqKpa8374w719k5OTLBwOi+WqqjqW2ymKwhRFcZTl8/m6nxlpHl15E9KkaDSKcDgMxpjjoSiKuyoA4OjRo9ixYwcYY3j//fdx+PBhR6+UqakpAMBrr71me9V/T9d1JJNJFItFx/vK5/PuqgCAEydO4OOPPwZjDJlMBslkEpqmuashnU57ppOCwSDi8Xjdz400h4I3IU3IZrPI5XKia6Dd/v37gWoQ5HRdh2EYotfG4OAgAOCXX34RdXgg37BhA3p6euDz+TyD4Fo7ffo0VFVFb2+vozwYDAIAZmZmHOWPHz8WyyKRCOCRWrEsC1euXIGqqo5y7tGjR9i/fz+Gh4fh8/nQ19cHy7Lc1UgDFLwJWYJlWThx4gQURanpGmhZFr7//nsAwD///CPKf/vtNwAQjZoAEAgEHEFudnYWsizj+vXruHPnDsLhMK5evSqW/xcSiQQKhQLeffdd9yJxImkUVHVdhyRJOHDggKP8o48+whdffIFNmzY5yrnp6WnMzMzg4MGDKBaLKBQKuH//vrsaaYCCNyENlMtlhEIhVCoV5HI50SODO378uBhGfv78+YaDdeyBHABu374NSZJw4cIF+P1+PHnyBDt27HDUWUvpdBpDQ0NA9erbvu26ruPYsWMAgEKhUPO+UQ3qp0+fxtjYmOOkls1mAaCmUZcrl8swDAMDAwMIBoN4+vQpAGDbtm3uqqQRdxKcELJy8Xi8pkFOURRH458syyyTyYjnkiTVNGq2K9M0WSAQcGw/L5dlmZmmyVj1c1AUhU1OTor3nslkmCzL4jWpVIoFAgHxnDSHrryboOs6QqHQimeOsywLmqahr69vxetqZ6VSyfNKbTl0XV+1df2Xtm/fDrhSDrlcTgx84VefO3fuBKrvs1KpYNeuXaJ+u7IsC6FQCGfPnhU5b258fByGYWDz5s3w+XwYGhpCLpfD4cOHRZ3bt2+jv79fPP/xxx8dz0lzVj14u/uY+qpTSnr1TbUHsEQiUXfZs6TrOq5du4ZcLude1LLFxUX8+eef63q2Nk3TcP36dTHQw7IsRKNR+Hw+dHV1NWyQ0zSt5nsPBoPYvXs3otGoo7zd7dq1C5Ik4fLly0A1RWHPDT948ACSJIl0g30gzPDwsPi7HY2MjKC/v18Ebl3Xxfc2ODjo6LHCe5UwxkSj7dzcnKNxdHZ2Fps2bYKmaU31SV9tlmUhkUigq6vLvchB13UxTa7P50MkEqmbJmul7rK5L8VXyjRN0QfU/VMok8mI/p3FYtGxjFX7xQJoy5+OXv1dl4P3cV2NdbWbYrFY853HYjHxMzqVSjEAzDAMRx1WfW04HHYXC/F4vGF/4nZULBaZLMsM1X7e9n0+Fos5+j8Xi0UmSRILBAKex0a74Meo++G1P/P9wb7cNE0GgOXzeVGP9zH3WsdaMk2TxeNxJkmSeB/18OOW74OGYTBZlpkkSSJFtJy6K1F/a1eAf8HuA5nZviivHXSpA/hZWq2daz0Hb6+BKJIkOd4rAJZKpRx1TNNkiqIsuWN7rZ88XzKZzJIn8WbqMMZYOBwWOXt+kqlHURRHnp7ZLkbdx3IrdVdi1dMmANDb24tAIIBCoYBSqeRY9sYbbwAArl+/7ijnZSdPnnQXkw6QTqdhGEZNDwOvYePuPsEjIyP4/PPPa3pjuIXD4XV78wPSnG3btkHTtLppNE3TcOzYMezdu9e9qIamaSL102jfK5fLyOVyNXl5ngLjXUXRYt2VWpPgDQBnz54FbJPdcH/99RcAIJlMOsoBYGJiwnHwl0olRCIRR97InhOz58h5uT13zvNw5XIZw8PD6Onpga7ryGazYlCEV37R/X+96tSj67rjtdFotGE/WY7nhru6uuCrDlpw54fd+eNQKCR2PnubAn/fuq6LslAoJNaRTqdFo6mmaejq6kJfX5/4P+l0Wnw+PT09Nd+hl6+//tpzxJwkSTXB2k7TNGzdulUM+mjk5ZdfhmEYzyQvStpDb28vfv31V88AzgN3KpWqaUhdiQcPHgAAtm7d6ijnAd/ehtVK3ZVas+B94MABSJIETdMcwevKlSuIx+OoVCqO4KRpmrhzB6oB9JVXXsG+ffvAGINhGDAMA6+//rroR8oYc7wG1QaTTCbjKHv69CkqlQoMw8CtW7dw7949XL16Faqq4uLFi47tKJVK2LdvH7q6umCaJgzDwPT0tGN99WSzWRw5ckQMHc7n80gmkzh+/Li7qoNlWaKXwcOHD2GaJvr6+nDs2DHHiWNkZASPHz+GaZp4+PAhuru78eTJE6A61DqVSom6qDb2GYbhKOOBtFAoYH5+HouLi44dfXh4GKVSCXfu3IFpmujv78eHH35YcyKx4z0nvPooq6qKiYkJcdIAgLfffhuoftY3b94UDVlL4bPc3bp1y73IwX7SaubBT2ykM3gFcB64VVUVjeWr5d69e+4iwX3B0krdFXPnUVYTz2/zvJJhGCwcDosJfuwNNuFw2JEHl2W5Jv/NX2fPJ/H+tPYGEK+8Mq9nz5ny9dnrKYpSk6vnOfyl8lWyLLNYLOYoCwQCjvV5bZuqqkySJPGc441dvIFPUZSa9dtze17rZtU8s/2zdjeocPzzsOeeeQOTO4dnV+//surr+X4g2/o1u/Pc9satevlvvi3uiY7I84k38vIJvtz7cyv4Orzw2OG1f7tf10rdlVqzK2/Y5gXmQ37Hx8dx8uRJdHd3IxwOI5fLoVwuiys33n2oVCrBMAxxGyaOv24lP503btwo/nYPdeb5qnfeecdR7p7zwYtencvi4MGDjvK5uTnMzc05ytw0TRP9fe0+/fRTAMCNGzcAAAMDA7h48SISiYTodjQ2NuZ4TSvcP+34vBu8j67P58PmzZsBoOYK3o4PBffi9/sxNjYGxhgWFhbEVf7ly5cdee6jR4+ir68P/55r/h256NYoL7mW3Ffq9Fj7RzN6e3tx7tw55HI5yLK8omOhE61p8OYNlzxIT09Pi5z2m2++CVQD+o0bN0SOHNU0Rz3ugL6antW9+rwa9QDgpZdecjw/dOgQ8vk8ZmZmIMsyotHoqvYd5SkVez9d+2O18LQXz3PzEx+fX+Ott94S+0w7cH8O9Fj7RzM0TcPQ0BAURYFhGDU58NVSb34WVPuo27VSd6XWNHjD1nAZjUYdjWI8J55MJvHtt9/WTGwDAPPz8+4iYcOGDe6iVdOogW0pXvlYXdeXDESNvlj7DhEMBjE1NYV8Po+5uTkEAoGmGkSbwf+P17Y2ynm3MqVpuVzG6OgoLly4IMrcV+78pLXckynlvNe/bDYrctxTU1Niatq1COB8f/SKR5VKxZHLbqXuSq158OZBOZfLORoS/H4/IpEIKpUK+vv7HT+Jg8EgZFnGxMRETSCZn5+HoigNUxn22d1awSfG4Q1srQgGg+JkZO8eaVkWrl27VpOisVNVtaYBF9VRd5IkiQY+e+NlMBjExMQEKpVKw9nYWnkfu3fvBqpd8uyvsywLd+/etdV0euGFF4DqNJ9LiUajNT9v3cGfjzbk6+V4qsyrYdQuGAzWXMk1evB5tUlnKJVKOHHiBFRVFftSJBJZswDOj213xwX+C/LUqVOirJW6K+ZOgq8FVVU9G7x4Q5fXwIvJyUmG6kAf3mCXSqWYJEmOhk2+DkVRWD6fZ/F4nMViMQaAhcNh0ZDJy+wDRHhDpL0BjDc4KIoi/i/vYL/UIBFeT5IkFovFWDweZ7IsOxpT+ShDe2OsYRhMkiQmSZKom8/nmSRJjol/FEVhqqqK7eLbah+xaN/OTCYj6vDtME1TbKdXw6C9cZG/B/t3UI8sy0s2JMZisbqfnyzLTFVV0ZDptS6+T9RbB1n/eCNlvcZJvm/XW+7FrE6m5T6W7OzrNU2TGYZR0xlhOXVX4j8J3vl8vmZUHed1kHL5fF70QOABz2tkJg/MPNjl83kmyzKLx+PMMAzRyssfSnV2N3sZbOexVColvkxFUcQOE4vF6n653OTkpHhtIBBwBO5G/9Oo9sTh5YFAoCZIhcNhx+fhXj+r7jh8uC/vmcJ39mKx2HAbOH7S4f/D6zN34yeleiYnJ2t6ytgVbbcM8zqpMNtQe/L8amb0ZDN1WLWeOzbw/c9rX7Uf2/yY8tpPWYt1l8vHmm0dIGQJPT09GB0drRlluVrWev2dplwuIxAIYOfOnZT6eQ6tec6bPD9++OEHnD9/3l28KjRNQ39/PwVum1gsVrenEln/KHiTVdPb24uzZ8+2NJ1AM0qlEu7evVvT0Pk803UdhUIBgUAACwsL7sXkOUBpE7LqSqUSfv/991UZplwqlXD//v1VnatiPeAppNHRUeRyOdBh/Pyh4E1Ih0kkEpiZmcHU1BRCoRAF7+cUpU0I6SDlchmXLl1CPB4HPKZ4IM8PCt6EdJBYLAZVVcUgNT4/jXvefLL+UfAmpEPouo7p6WmcOXPGvajhfEBkfaLgTUiHOHXqFCqVimPWx6GhIXc1wOPGHe4bO/ObltC8Lp2LgjchHYAHX9M0HfOy8Ny328jICMrlMkzTxE8//YShoSHH3DmDg4NQFAX79+93vI50DgrehLQ53kj55Zdf1sxpzif1cs/MmEwmMTAwAL/fj2AwCEVRcPPmTUedhYUFbN++XdxCb7UndCJri4I3IW0uGo2iUql49nW/du0a4JrGmM++aL/xyI4dO8Qt82C7dd3PP/+MsbExpFIpz/vKkvZFwZuQNhaJRJDL5cTfdolEQgTcZDLZ8O5S7psEzM7OQpIkfPLJJ+ju7sbi4iICgYCjDmlvFLwJaWOapon8tnu+98HBQbHs8ePH4s5Ezbh9+zYikYjoJz4/P4/+/n53NdLGKHgTss7wm4rYb0oyMzPjGNAzPT2NvXv3iucTExPYs2ePeE7aHwVvQtYZv98PRVEwOjoKy7JQKpWQy+XEPUIty4JhGCLI8wE+GzduxPDwcEt3XyLPDgVvQtah7777DgCwefNm7Nu3D5lMRqRV7ty5A1RngQSALVu2IBAI4MiRI9izZ09NjxbSnmhiKkII6UB05U0IIR2IgjchhHQgCt6EENKBKHgTQkgHouBNCCEdiII3IYR0oP8DhpWCXZ7Qd1kAAAAASUVORK5CYII=\" width=\"367\" height=\"70\"\u003e\u003c/p\u003e \u003cp\u003e Migration rate was calculated by dividing the percentage wound closure by 24 h. Three independent experiments were performed (n\u0026thinsp;=\u0026thinsp;3), with three fields analyzed per condition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Immunocytochemistry (ICC) for Ki-67\u003c/h2\u003e \u003cp\u003eImmunocytochemistry for Ki-67 was performed to evaluate proliferative activity in human aortic smooth muscle cells (HASMCs). Using conventional methods, cells were fixed, permeabilized, and blocked before being treated with rabbit anti-Ki-67 primary antibody (1:250 dilution) and Alexa Fluor\u0026trade; 647 donkey anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) secondary antibody (1:1000 dilution). DAPI was used to counterstain the nuclei. The pictures were taken at a magnification of 20x.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eImage Analysis\u003c/strong\u003e \u003cp\u003eQuantitative analysis of Ki-67 staining was performed using Fiji (ImageJ, NIH, USA). Regions of interest (ROIs) were manually selected within each well, and background subtraction was applied to calculate corrected mean fluorescence intensity (MFI) values in arbitrary units (a.u.). Corrected MFIs from control and treated groups were compared using an unpaired two-tailed t-test.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Data analysis and visualization\u003c/h2\u003e \u003cp\u003eAll experiments were conducted in 3 independent biological replicates, and results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) unless otherwise specified. Statistical analyses were performed using Microsoft Excel 2019 (Microsoft Corp., USA) and R version 4.2.2 (R Foundation for Statistical Computing, Austria). Excel was employed for descriptive statistics, basic significance testing, and preliminary plotting, while R (utilizing the tidyverse, drc and ggplot2 packages) was used for advanced statistical analyses and the generation of publication quality figures. Statistical significance was determined using an unpaired two-sample \u003cem\u003et\u003c/em\u003e-test, with \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":" \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Analysis of morphological changes of HASMCs In Vitro Model Exposed to CdSO4\u003c/h2\u003e \u003cp\u003eHASMC morphology was affected by CdSO₄ in a dose- and time-dependent manner. Control cells kept a typical spindle-shaped, elongated morphology and created a consistent monolayer at 24 hours. This morphology was mostly preserved in cells treated with 0.5\u0026ndash;1 \u0026micro;M, but there were a marked rounding and a decrease in cell density at 5 \u0026micro;M. Increasing concentrations caused increasing disruption: 15 \u0026micro;M induced noticeable rounding and early detachment, 25 \u0026micro;M resulted in significant loss of monolayer integrity with visible gaps, and 50 \u0026micro;M caused widespread detachment with floating rounded cells. These tendencies became more pronounced at 48 hours, showing a distinct dose-dependent cytomorphological response to CdSO₄ exposure, with moderate effects at 0.5\u0026ndash;1 \u0026micro;M, moderate disruption at 5\u0026ndash;15 \u0026micro;M, and significant detachment at 25\u0026ndash;50 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea \u0026amp; b).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1 Effect of CdSO₄ Exposure on HASMCs Viability\u003c/h2\u003e \u003cp\u003eThe viability of HASMCs exposed to increasing concentrations of CdSO₄ was assessed. Lower levels (0.5\u0026ndash;5 \u0026micro;M) did not reduce viability after 24 hours; instead, they caused a little increase in metabolic activity (112\u0026ndash;113% of control). Early cytotoxicity signals showed at 15 \u0026micro;M (106%), but the decline was more evident at 25 \u0026micro;M (94%). At 50 \u0026micro;M, the viability dropped greatly to 25%, indicating great toxicity. After 48 hours, CdSO4's cytotoxic effects became more apparent. Consistent with the biphasic tendency seen at 24 hours, viability only slightly fell (96\u0026ndash;97%) at 0.5\u0026ndash;1 \u0026micro;M, whereas 5 \u0026micro;M showed a little stimulatory impact (103%). Increasing doses led in marked cytotoxicity; viability declined to 86% at 15 \u0026micro;M, 42% at 25 \u0026micro;M, and 3% at 50 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eThe 1 \u0026micro;M concentration preserved the regular cell morphology and was noncytotoxic; the 15 \u0026micro;M concentration marked the beginning of cytotoxic stress without substantial cell death; and viability began to decline at the 25 \u0026micro;M concentration. These three concentrations were selected for every subsequent research based on these qualities. This range made it feasible to examine phenotypic responses at subtoxic, modest, and near-toxic exposure levels while avoiding doses leading to substantial cell detachment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2 qPCR Analysis of CdSO₄-Induced Phenotypic Switching\u003c/h2\u003e \u003cp\u003eFor 24 hours, cells were exposed to 1, 15, and 25 \u0026micro;M CdSO₄ to assess whether such exposure modifies the phenotype of HASMCs. qPCR was used to examine the expression of chosen gene markers\u0026mdash;including inflammatory (CD68), osteogenic (BMP2), and contractile (TAGLN, ACTA2) ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Using the ΔΔCt method, expression levels were computed relative to untreated controls; findings are displayed as mean fold changes. KLF4, ALPL, and CD34 were consistently undetectable across three biological replicates under all circumstances and were removed from subsequent study.\u003c/p\u003e \u003cp\u003eBMP2 expression was strongly upregulated in response to CdSO₄ treatment. The highest increase occurred at 1 \u0026micro;M (53.1\u0026thinsp;\u0026plusmn;\u0026thinsp;4.0-fold; p\u0026thinsp;=\u0026thinsp;5.3 \u0026times; 10⁻⁵). Significant elevations were also observed at 15 \u0026micro;M (30.8\u0026thinsp;\u0026plusmn;\u0026thinsp;6.6-fold; p\u0026thinsp;=\u0026thinsp;0.003) and 25 \u0026micro;M (22.7\u0026thinsp;\u0026plusmn;\u0026thinsp;7.2-fold; p\u0026thinsp;=\u0026thinsp;0.013), showing a strong but decreasing dose-dependent increase. These results indicate CdSO₄ induces an osteogenic phenotypic switch in HASMCs. CD68 expression was elevated at all CdSO₄ concentrations. At 1 \u0026micro;M, CD68 increased 5.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4-fold (p\u0026thinsp;=\u0026thinsp;0.0175), remained upregulated at 15 \u0026micro;M (3.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.92-fold; p\u0026thinsp;=\u0026thinsp;0.0204), and peaked at 25 \u0026micro;M (8.83\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1-fold; p\u0026thinsp;=\u0026thinsp;6.3 \u0026times; 10⁻⁴). These findings demonstrate a robust, dose-responsive inflammatory response following CdSO₄ exposure.\u003c/p\u003e \u003cp\u003eIn contrast, contractile markers TAGLN and ACTA2 were consistently downregulated in HASMCs exposed to CdSO₄ compared with controls. TAGLN expression decreased to 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13-fold at 1 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;0.0052), 0.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12-fold at 15 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;0.0017), and 0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10-fold at 25 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;7.7 \u0026times; 10⁻⁴). Similarly, ACTA2 expression declined to 0.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11-fold at 1 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;7.1 \u0026times; 10⁻⁴), 0.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09-fold at 15 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;2.4 \u0026times; 10⁻⁴), and 0.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09-fold at 25 \u0026micro;M (p\u0026thinsp;=\u0026thinsp;1.4 \u0026times; 10⁻⁴). A change from a contractile phenotype to one that is osteogenic and inflammatory is shown by upregulation of BMP2 and CD68 combined with downregulation of TAGLN and ACTA2.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Low-Dose CdSO₄ Promotes Migration and Proliferation of HASMCs\u003c/h2\u003e \u003cp\u003eA sub-toxic concentration of 1 \u0026micro;M CdSO₄ enhanced HASMC migration in the scratch-wound assay. Wound closure increased from 45.2\u0026thinsp;\u0026plusmn;\u0026thinsp;6.3% in controls to 60.1\u0026thinsp;\u0026plusmn;\u0026thinsp;6.0% (p\u0026thinsp;=\u0026thinsp;0.04), and the migration rate rose from 1.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26%/h to 2.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25%/h. At a non-cytotoxic dose, this result was seen; low-level cadmium exposure thus fosters HASMC motility. One characteristic of synthetic VSMCs is more migration, which could exacerbate neointimal development and vascular remodeling during early atherogenesis.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1 Quantitative Assessment of Cell Migration\u003c/h2\u003e \u003cp\u003eAt a non-cytotoxic dosage, this effect was seen, hence low-level cadmium exposure boosts HASMC motility. Synthetic VSMCs are distinguished by more migration, which might help to create neointima and shape blood vessels early on in atherosclerosis (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea \u0026amp; b).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eSummary statistics for scratch-wound migration of HASMCs after 24 h CdSO₄ exposure\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGroup\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003e% Wound closure\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003e(Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMigration Rate\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003e(% /h, mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ep value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eControl\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e45.2\u0026thinsp;\u0026plusmn;\u0026thinsp;6.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e1 \u0026micro;M CdSO₄\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e60.1\u0026thinsp;\u0026plusmn;\u0026thinsp;6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Ki-67 immunocytochemistry for proliferation analysis:\u003c/h2\u003e \u003cp\u003eSince wound closure can occur through a combination of cell migration and proliferation, Ki-67 immunocytochemistry was performed to evaluate the extent to which proliferative activity contributed. This was of particular interest as CCK-8 assay results also suggested proliferative changes following CdSO₄ exposure. Control cells exhibited little to no Ki-67 staining, consistent with low basal proliferative activity as the corrected MFI values for this group. The mean MFI in control HASMCs was 18.98\u0026thinsp;\u0026plusmn;\u0026thinsp;9.94, whereas cells treated with 1 \u0026micro;M CdSO₄ showed markedly higher intensity values (44.78\u0026thinsp;\u0026plusmn;\u0026thinsp;4.17, p\u0026thinsp;=\u0026thinsp;0.014) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea \u0026amp; b). These findings suggest that both proliferation and migration contributed to wound closure when HASMCs were exposed to a subtoxic dose of CdSO₄ (1 \u0026micro;M).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":" \u003cp\u003eThis study shows that cadmium sulfate directly causes human aortic smooth muscle cells (HASMCs) to undergo a pro-atherogenic phenotypic change. Exposure to CdSO4 caused a dose-dependent, biphasic response, with higher doses causing cytotoxicity and sub-toxic concentrations promotes cellular migration and proliferation. Cadmium exposure significantly increased the expression of osteogenic (BMP2) and inflammatory (CD68) genes while suppressing canonical contractile markers (ACTA2, TAGLN). This suggests a coordinated loss of contractile identity and acquisition of synthetic, inflammatory, and osteoblast-like features typical of VSMC phenotypic modulation during atherogenesis [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Despite the fact that epidemiological research has connected cadmium exposure to cardiovascular disease [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], these results establish phenotypic switching as a likely mechanism by which environmental cadmium contributes to vascular remodeling and the development of atherosclerotic disease and offer direct mechanistic evidence that VSMCs are a crucial cellular target of cadmium toxicity.\u003c/p\u003e \u003cp\u003eBuilding on this dose-dependent phenotypic modulation, our findings show that CdSO₄ causes a biphasic response in HASMCs that depends on exposure duration and concentration. Sub-toxic cadmium exposure (\u0026le;\u0026thinsp;5 \u0026micro;M) increased cellular survival and proliferative activity, which were previously linked to epigenetic modification of growth-related genes. This is consistent with hormetic effects observed in other cell types, such as hepatocytes, ovarian cells, and lymphocytes [\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In our model, the rise in viability was supported by increased Ki-67 expression, indicating enhanced proliferation rather than metabolic activity alone.\u003c/p\u003e \u003cp\u003eIn contrast, higher amounts of cadmium (\u0026ge;\u0026thinsp;15 \u0026micro;M) caused significant cytotoxicity, which led to morphological changes and a decrease in viability. This impact is consistent with earlier research demonstrating that cadmium causes oxidative stress, mitochondrial malfunction, calcium dysregulation, and activation of the intrinsic apoptotic pathway through BAX, BCL2, and caspase-3 [\u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These findings underscore the importance of dose selection when studying phenotypic switching, as high toxicity may confound interpretation of surviving cell behaviour.\u003c/p\u003e \u003cp\u003eLow-level cadmium exposure promotes a motile phenotype, as shown by the increase in HASMC migration at a sub-toxic concentration (1 \u0026micro;M). Atherogenesis and intimal thickening both involve VSMC migration as a critical step [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Previous research suggests that cadmium can activate signaling pathways like p38, MAPK, Akt, COX-2, and MMP2, which control extracellular matrix remodeling and cytoskeletal dynamics, even if the reactive oxygen species (ROS) were not directly measured in this study [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Comparable cadmium-responsive mechanisms have been identified in cancer and vascular cells, in which low-dose exposure increases proliferation and motility, frequently accompanied by oxidative stress-related signaling [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBMP2 upregulation at sub-toxic cadmium concentrations demonstrated phenotypic switching toward an osteogenic state. By activating SMAD/RUNX2 signaling to drive osteogenic gene transcription, BMP2 plays a critical role in controlling vascular calcification and plaque instability [\u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Calcified atherosclerotic lesions and experimental models of vascular calcification have consistently shown higher BMP2 expression, which promotes osteoblast-like features and loss of the contractile phenotype [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In addition to its function in calcification, BMP2 has been shown to stimulate VSMC migration during vascular remodeling by connecting osteogenic signaling with increased cellular motility via ERK1/2-dependent cytoskeletal reorganization and modulation of actin dynamics [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs demonstrated by increased CD68, a macrophage-like marker, exposure to CdSO₄ induced an inflammatory phenotype. It's interesting to note that CD68 expression exhibited a non-monotonic pattern, declining at intermediate concentrations before increasing once more at higher ones. This trend would indicate a transient stress-adaptive inhibition of protein synthesis that is subsequently overturned by pro-inflammatory signaling via the MAPK and NF-κB pathways [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The rise in CD68 expression raises the possibility that VSMCs will become more like macrophages, which could promote the production of foam cells and accelerates the development of atherosclerotic plaque. Studies on humans and animals have shown that throughout this process, VSMCs lose their contractile properties and acquire characteristics of macrophages, which can improve lipid uptake and promote lesion formation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eUltimately, cadmium exposure reduced the production of the contractile markers TAGLN and ACTA2, suggesting a transition away from the contractile phenotype. This aligns with research demonstrating that disruption of the myocardin-serum response factor (SRF) transcriptional program, which is a major regulator of smooth muscle contractile gene expression, is linked to downregulation of contractile markers and phenotypic switching in vascular smooth muscle cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe increased proliferative and migratory responses seen in HASMCs after sub-toxic CdSO4 treatment, in addition to phenotypic change, are biologically significant in relation to atherogenesis. When VSMCs change from a contractile to a synthetic phenotype, they show decreased expression of contractile markers while gaining more proliferative and migratory potential. These processes promote intimal thickening and neointima formation during the early stages of plaque development and, depending on the situation, either contribute to plaque stability or progression (38, 39). According to recent reviews, vascular remodeling and lesion development are largely dependent on the regulation of VSMC proliferation and migration, which are influenced by molecular and environmental cues that interfere with normal vascular homeostasis [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These results collectively support the hypothesis that CdSO₄-induced increases in HASMC migration and proliferation may have pathophysiological implications related to atherosclerosis.\u003c/p\u003e \u003cp\u003eCollectively, these findings indicate that cadmium induces dose-dependent phenotypic switching in HASMCs, promoting migratory, osteogenic, and inflammatory characteristics while suppressing contractile features. Although the precise upstream mediators remain to be fully defined, these data support a role for environmental cadmium exposure in vascular remodeling and atherogenesis and highlight pathways that may warrant further mechanistic investigation.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eVSMCs (vascular smooth muscle cells)\u003c/p\u003e\n\u003cp\u003eHASMCs (human aortic smooth muscle cells)\u003c/p\u003e\n\u003cp\u003eICC (immunocytochemistry)\u003c/p\u003e\n\u003cp\u003eROIs (Regions of interest)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCCK-8 (Cell Counting Kit-8)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eACTA2 (alpha-smooth muscle actin)\u003c/p\u003e\n\u003cp\u003eTAGLN (transgelin)\u003c/p\u003e\n\u003cp\u003eBMP2 (bone morphogenetic protein 2)\u003c/p\u003e\n\u003cp\u003eCD68 (cluster of differentiation 68)\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eSupported by the University Research Council, Aga Khan University, Karachi, Pakistan.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics Approval:\u003c/h2\u003e \u003cp\u003eThis study was approved by the Ethics Committee of The Aga Khan University, Karachi, Pakistan (Protocol No. 2024-7704-30610).\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eSupported by the University Research Council, Aga Khan University, Karachi, Pakistan.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eSH, SR and MUR designed the study. BK and SR performed the experiments. SR and BR wrote the manuscript and analyzed the data. All authors read and edited the manuscript. SH is the guarantor of this study.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eSR is joint first author\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChen W, Li Z, Zhao Y, Chen Y, Huang R (2023) Global and national burden of atherosclerosis from 1990 to 2019: trend analysis based on the Global Burden of Disease Study 2019. Chin Med J 136:2442\u0026ndash;2450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChong B, Jayabaskaran J, Jauhari SM, Chan SP, Goh R, Kueh MTW et al (2025) Global burden of cardiovascular diseases: projections from 2025 to 2050. Eur J Prev Cardiol 32:1001\u0026ndash;1015\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLibby P, Buring JE, Badimon L, Hansson GK, Deanfield J, Bittencourt MS et al (2019) Atherosclerosis. Nat Rev Dis Primers 5:56\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang H-Y, Chen A-Q, Zhang H, Gao X-F, Kong X-Q, Zhang J-J (2022) Vascular smooth muscle cells phenotypic switching in cardiovascular diseases. Cells 11(24):4060\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamas GA, Bhatnagar A, Jones MR, Mann KK, Nasir K, Tellez-Plaza M et al (2023) Contaminant metals as cardiovascular risk factors: a scientific statement from the American Heart Association. J Am Heart Association 12(13):e029852\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOzarde Y, Purandare D, Deshmukh S, Gadhave R (2025) Heavy metals and cardiovascular health: Uncovering links and health challenges. J Trace Elem Med Biol 127648\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWashington B, Williams S, Armstrong P, Mtshali C, Robinson JT, Myles EL (2006) Cadmium toxicity on arterioles vascular smooth muscle cells of spontaneously hypertensive rats. Int J Environ Res Public Health 3:323\u0026ndash;328\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Sun L, Wang X, Zhou Q (2023) Integrative analysis of HASMCs gene expression profile revealed the role of thrombin in the pathogenesis of atherosclerosis. BMC Cardiovasc Disord 23:191\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eProzialeck WC, Edwards JR, Nebert DW, Woods JM, Barchowsky A, Atchison WD (2008) The vascular system as a target of metal toxicity. Toxicol Sci 102:207\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTinkov AA, Filippini T, Ajsuvakova OP, Skalnaya MG, Aaseth J, Bj\u0026oslash;rklund G et al (2018) Cadmium and atherosclerosis: a review of toxicological mechanisms and a meta-analysis of epidemiologic studies. Environ Res 162:240\u0026ndash;260\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrootaert MO, Bennett MR (2021) Vascular smooth muscle cells in atherosclerosis: time for a re-assessment. Cardiovasc Res 117:2326\u0026ndash;2339\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOwens GK, Kumar MS, Wamhoff BR (2004) Molecular regulation of vascular smooth muscle cell differentiation in development and disease. Physiol Rev 84:767\u0026ndash;801\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBennett MR, Sinha S, Owens GK (2016) Vascular smooth muscle cells in atherosclerosis. Circ Res 118:692\u0026ndash;702\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTellez-Plaza M, Jones MR, Dominguez-Lucas A, Guallar E, Navas-Acien A (2013) Cadmium exposure and clinical cardiovascular disease: a systematic review. Curr Atheroscler Rep 15:356\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerzelloni P, Giuliano V, Wise LA, Urbano T, Baraldi C, Vinceti M, Filippini T (2024) Cadmium exposure and risk of hypertension: a systematic review and dose-response meta-analysis. Environ Res 263:120014\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHenson MC, Chedrese PJ (2004) Endocrine disruption by cadmium, a common environmental toxicant with paradoxical effects on reproduction. Exp Biol Med 229:383\u0026ndash;392\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang B, Ji K, Wang Y, Li Y, Tang Y, Gu J, Cai L (2015) Exposure to low dose cadmium enhances FL83B cells proliferation through down-regulation of caspase-8 by DNA hypermethylation. Toxicol Res 4:248\u0026ndash;259\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Ma L, Tang Y, Han J, Qi Y, Huang D (2021) Low-dose cadmium exposure facilitates cell proliferation by promoter hypermethylation of RASSF1A and DAPK1 genes. Environ Toxicol 36:2313\u0026ndash;2321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan D, Ye S, Pan Y, Bao Y, Chen H, Shao C (2013) Long-term cadmium exposure leads to the enhancement of lymphocyte proliferation via down-regulating p16 by DNA hypermethylation. Mutat Res Genet Toxicol Environ Mutagen 757:125\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiagioli M, Wa\u0026egrave;tjen W, Beyersmann D, Zoncu R, Cappellini C, Ragghianti M et al (2001) Cadmium-induced apoptosis in murine fibroblasts is suppressed by Bcl-2. Arch Toxicol 75:313\u0026ndash;320\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang T, Sun S, Gavrilović A, Li D, Tang R (2023) Selenium alleviates cadmium-induced oxidative stress, endoplasmic reticulum stress, and apoptosis in L8824 cells. Ecotoxicol Environ Saf 262:115337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan Y, Yi W, Fei Fei H, Jin Long Y, Shi Wen Z, Jian Hong G et al (2016) Cadmium activates reactive oxygen species-dependent AKT/mTOR and mitochondrial apoptotic pathways in neuronal cells. Biomed Environ Sci 29:117\u0026ndash;126\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahdavi S, Khodarahmi P, Roodbari N (2018) Effects of cadmium on Bcl-2/Bax expression ratio in rat cortex brain and hippocampus. Hum Exp Toxicol 37:321\u0026ndash;328\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Y, Cai Y, Yang F, Yang Y, Cui Z, Shi D, Bai R (2024) Vascular smooth muscle cell phenotypic switching in atherosclerosis. Heliyon 10:18\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaji S, Issa K, Eid A, Iratni R, Eid AH (2019) Cadmium induces migration of colon cancer cells: roles of reactive oxygen species, P38 and cyclooxygenase-2. Cell Physiol Biochem 52:1517\u0026ndash;1534\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai H, Pan T, Yang H, Wang H, Wang Y (2019) Cadmium induces A549 cell migration and invasion by activating ERK. Exp Ther Med 18:1793\u0026ndash;1799\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Pi H, Liao L, Tan M, Deng P, Yue Y et al (2021) Cadmium promotes breast cancer cell proliferation, migration and invasion by inhibiting ACSS2/ATG5-mediated autophagy. Environ Pollut 273:116504\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBostr\u0026ouml;m K, Watson K, Horn S, Wortham C, Herman I, Demer L (1993) Bone morphogenetic protein expression in human atherosclerotic lesions. J Clin Invest 91:1800\u0026ndash;1809\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai T, Sun D, Duan Y, Wen P, Dai C, Yang J, He W (2016) WNT/β-catenin signaling promotes VSMCs to osteogenic transdifferentiation and calcification through directly modulating Runx2 gene expression. Exp Cell Res 345:206\u0026ndash;217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurham AL, Speer MY, Scatena M, Giachelli CM, Shanahan CM (2018) Role of smooth muscle cells in vascular calcification: implications in atherosclerosis and arterial stiffness. Cardiovasc Res 114:590\u0026ndash;600\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiachelli CM (2009) The emerging role of phosphate in vascular calcification. Kidney Int 75:890\u0026ndash;897\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShanahan CM, Crouthamel MH, Kapustin A, Giachelli CM (2011) Arterial calcification in chronic kidney disease: key roles for calcium and phosphate. Circ Res 109:697\u0026ndash;711\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Yang M, Liu L-p, Lau WB, Gao H, Xin M-k et al (2014) BMP-2 overexpression augments vascular smooth muscle cell motility by upregulating Myosin Va via Erk signaling. Oxid Med Cell Longev 2014:294150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Fan Z, Wang F, Tian Z-h, Ma B, Dong B et al (2018) BMP-2 enhances the migration and proliferation of hypoxia-induced VSMCs via actin cytoskeleton, CD44 and matrix metalloproteinase linkage. Exp Cell Res 368:248\u0026ndash;257\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR Jr, Lee D-H et al (2012) Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev 33:378\u0026ndash;455\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Qu W, Kadiiska MB (2009) Role of oxidative stress in cadmium toxicity and carcinogenesis. Toxicol Appl Pharmacol 238:209\u0026ndash;214\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBasatemur GL, J\u0026oslash;rgensen HF, Clarke MC, Bennett MR, Mallat Z (2019) Vascular smooth muscle cells in atherosclerosis. Nat Rev Cardiol 16:727\u0026ndash;744\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao G, Xuan X, Hu J, Zhang R, Jin H, Dong H (2022) How vascular smooth muscle cell phenotype switching contributes to vascular disease. Cell Commun Signal 20:180\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen R, McVey DG, Shen D, Huang X, Ye S (2023) Phenotypic switching of vascular smooth muscle cells in atherosclerosis. J Am Heart Assoc 12:e031121\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao L, Zhao L, Liu D, Huang F, Peng Q, Lu J et al (2025) Vascular smooth muscle cells: a therapeutic target in atherosclerosis. Rev Cardiovasc Med 26:28240\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cadmium sulphate, Vascular smooth muscle cells, Phenotypic switching, Atherosclerosis","lastPublishedDoi":"10.21203/rs.3.rs-8973731/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8973731/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground \u0026amp; Objectives:\u003c/p\u003e \u003cp\u003eVascular smooth muscle cells (VSMCs) maintain vascular integrity but can transition from a quiescent, contractile phenotype to a synthetic, migratory, and proliferative state, a critical driver of atherosclerosis. Cadmium, a persistent and bioaccumulative environmental toxicant, common in cigarette smoke and industrial emissions, has been epidemiologically associated with coronary artery disease; however, its mechanistic effects on VSMC behavior remain unclear. This study investigated whether cadmium sulphate (CdSO₄) promotes phenotypic switching in human aortic smooth muscle cells (HASMCs) and examined associated molecular and functional consequences.\u003c/p\u003e \u003cp\u003eMethods:\u003c/p\u003e \u003cp\u003eHASMCs (ATCC) were cultured under standard conditions and exposed to graded concentrations of CdSO₄. Cytotoxicity and metabolic activity were assessed using the CCK-8 assay to determine sub-toxic exposure ranges. Based on viability profiling, three concentrations (1 \u0026micro;M, 15 \u0026micro;M, 25 \u0026micro;M) were selected for mechanistic analyses. Phenotypic switching was evaluated by quantitative polymerase chain reaction (qPCR) analysis of contractile markers (ACTA2, TAGLN), osteogenic marker (BMP2), and inflammatory marker (CD68). Functional alterations were assessed using the scratch wound migration assay and Ki-67 immunostaining to evaluate cellular proliferation.\u003c/p\u003e \u003cp\u003eResults:\u003c/p\u003e \u003cp\u003eCdSO₄ exposure induced significant phenotypic modulation in HASMCs characterized by upregulation of BMP2 and CD68, accompanied by marked downregulation of ACTA2 and TAGLN, indicating loss of contractile identity and acquisition of osteogenic and inflammatory features. Sub-toxic cadmium exposure significantly increased cell migration and proliferation, consistent with a synthetic, pro-atherogenic phenotype.\u003c/p\u003e \u003cp\u003eConclusions:\u003c/p\u003e \u003cp\u003eCdSO₄ promotes pro-atherogenic phenotypic switching and functional activation of HASMCs, providing mechanistic evidence linking cadmium exposure to vascular remodeling and atherosclerosis, and reinforce the importance of mitigating heavy metal exposure to prevent cardiovascular disease burden.\u003c/p\u003e","manuscriptTitle":"Cadmium Sulphate Induces Pro-Atherogenic Phenotypic Switching in Human Aortic Smooth Muscle Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-13 09:12:22","doi":"10.21203/rs.3.rs-8973731/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f1e3c186-6ed8-4eb7-be9a-8c8194806abc","owner":[],"postedDate":"March 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-15T08:28:12+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-13 09:12:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8973731","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8973731","identity":"rs-8973731","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0