Microbial education plays a crucial role in harnessing the beneficial properties of microbiota for infectious disease protection inCrassostrea gigas

24

Recently, the frequency and severity of marine diseases have increased in 25 association with global changes, and molluscs of economic interest are particularly concerned. 26 Among them, the Pacific oyster (Crassostrea gigas) production faces challenges from several 27 diseases such as the Pacific Oyster Mortality Syndrome (POMS) or vibriosis. Various strategies 28 such as genetic selection or immune priming have been developed to fight some of these 29 infectious diseases. The microbial education, which consist of exposing the host immune 30 system to beneficial microorganisms during early life stages is a promising approach against 31 diseases. This study explores the concept of microbial education using controlled and pathogen-32 free bacterial communities and assesses its protective effects against POMS and Vibrio 33 aestuarianus infections, highlighting potential applications in oyster production. 34

We demonstrate that it is possible to educate the oyster immune system by adding 35 microorganisms during the larval stage. Adding culture based bacterial mixes to larvae protects 36 only against the POMS disease while adding whole microbial communities from oyster donors 37 protects against both POMS and vibriosis . The efficiency of the immune protection depends 38 both on oyster origin and on the composition of the bacterial mixes used for exposure . No 39 preferential protection was observed when the oysters were stimulated with their sympatric 40 strains. We further show that the added bacteria were not maintained in the oyster microbiota 41 after the exposure , but this bacterial addition induced long term changes in the microbiota 42 composition and oyster immune gene expression. 43

Our study reveals successful immune system education of oysters by introducing 44 beneficial micro-organisms during the larval stage. We improved the long-term resistance of 45 oysters against critical diseases (POMS disease and Vibrio aestuarianus infections) 46 highlighting the potential of microbial education in aquaculture. 47 48 Key words: 49 Crassostrea gigas; Microbial education; Oyster holobiont; OsHV-1 µVar; Vibrio aestuarianus 50 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 3

51 The Pacific oyster Crassostrea gigas (also known as Magallana gigas ) stands as the most 52 widely cultivated oyster species in the world , underpinning a substantial proportion of the 53 aquaculture industry (Food and Agriculture Organisation 2022). However, the production of C. 54 gigas faces significant challenges due to recurring infectious diseases, inflicting high 55 mortalities each year (Friedman et al. 2005; Cotter et al. 2010; Pernet et al. 2012; Azéma et al. 56 2015). Two prevalent infections - the Pacific Oyster Mortality Syndrome (POMS) caused by 57 the Ostreid herpesvirus type 1 µVar iant (OsHV-1 µVar) and vibriosis initiated by Vibrio 58 aestuarianus infection - are primarily responsible for these alarming mortalities . POMS is a 59 complex and polymicrobial disease which preferentially affects younger oysters and can 60 decimate up to 100% of the spat in French farms (Segarra et al. 2010; Petton et al. 2021) . The 61 infection by OsHV -1 µVar marks a critical step in the progression of POMS, inducing an 62 immunocompromised state in oysters by altering haemocytes physiology (de Lorgeril et al. 63 2018; Petton et al. 2021) . This leads to a dysbiosis of oyster microbiota and results in 64 colonisation by opportunistic bacteria and death of the oyster (de Lorgeril et al. 2018; King et 65 al. 2019a; Petton et al. 2021) . On the other hand, V. aestuarianus is another harmful primary 66 pathogen with chronic mortality reaching a cumulative mortality rate up to 30%. This loss 67 induces important economic consequences since it preferentially infects market size oysters 68 which have been raised for several years (Azéma et al. 2017; Lupo et al. 2019). 69 Efforts to combat these infectious diseases have spawned various approaches based on the 70 increasing knowledge and resources available on oyster s. Genetic selection is a promising 71 avenue which aims at selecting pathogen -resistant oysters (Dégremont et al. 2015, 2020) . 72 However, this approach exhibits limitations such as the potential selection of trade -offs which 73 could counter select traits important for the commercial value of C. gigas . Moreover, t he 74 demonstration of the existence of immune priming in C. gigas has opened up a whole new field 75 of applications based on the use of viral mimics (Lafont et al. 2017, 2020; de Kantzow et al. 76 2023; Montagnani et al. 2024). However, this innovative approach only protects against POMS 77 infections (Green and Montagnani 2013; Lafont et al. 2017) . A diversity of studies on oyster -78 microbiota interactions have also opened a new field of investigations consisting in identifying 79 bacteria beneficial for their associated host during adverse conditions (King et al. 2019a; 80 Clerissi et al. 2020; Delisle et al. 2022; Fallet et al. 2022) . Research on disease prevention in 81 molluscs based on the use of probiotic s has been ongoing for decades but has yet to see 82 widespread applications in farms (Yeh et al. 2020; Takyi et al. 2023, 2024; Muñoz-Cerro et al. 83 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 4 2024). While several pre/probiotic -based methods to mitigate infectious diseases have 84 demonstrated success in shrimp hatcheries (Swain et al. 2009; Pham et al. 2014; Wen et al. 85 2014), their application in oyster farming, particularly in open-sea environments, faces distinct 86 challenges and limitations. Oysters, as filter -feeding organisms, often face complex microbial 87 interactions in their natural habitats (Lokmer et al. 2016) . Consequently, achieving and 88 maintaining a precise balance of beneficial microorganisms through probiotics addition can be 89 challenging. Additionally, the ir culture in open-sea present limitations in the implementation 90 of probiotics. 91 The concept of microbial education, consists in exposing the host immune system to beneficial 92 microorganisms during early development (Arrieta et al. 2014; Gensollen et al. 2016) . This is 93 because early life stages represent critical periods of growth and development where the host's 94 immune system is still maturing (Renz et al. 2017). This strategy offers significant advantages 95 on oysters, as it can confer a protective effect while allowing exposure in hatchery during the 96 larval phase in controlled environments (Dantan et al. 2024) . Numerous studies have shown 97 that a proper host-microbiota interaction during the early development plays an important role 98 in the long term host immune responses in a wide range of marine organisms (Chung et al. 99 2012; Galindo-Villegas et al. 2012; Abt and Artis 2013; Sommer and Bäckhed 2013) . In this 100 context, Fallet and colleagues (Fallet et al. 2022) explored the potential of using wild-101 microbiota to educate the immune system of C. gigas. Through a ten-day exposure of C. gigas 102 larvae to a whole microbiota from donor oysters, they induced a long -term beneficial effect . 103 The microbiota-exposed oysters exhibited enhanced resistance to OsHV -1 µVar, resulting in 104 improved survival rates compared to non -exposed counterparts. This study underscored the 105 crucial role of microbiota on oyster immune system education, suggesting potential applications 106 in commercial hatcheries. However, concerns regarding exposure to hazardous uncontrolled 107 microbial communities transferred from donor oysters necessitate a cautious approach as it 108 might contain primary or opportunistic pathogens. Indeed, prior to the recipient larvae exposure 109 performed in Fallet et al. study, the donor oysters were placed in farming area during a non -110 infectious period to allow oysters to capture the maximum diversity of field microorganisms. 111 Then, these donor oysters were placed in the rearing tanks during larval development where 112 they transmitted their highly diverse microbial community to the recipient larvae. Although the 113 donor oysters were considered healthy (Le Roux et al. 2016; Fleury et al. 2020) , the presence 114 of undetectable pathogens cannot entirely be excluded 115 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 5 Here, our study aimed to explore the feasibility of microbial education in oyster larvae while 116 considering and mitigating the risks associated with uncontrolled transfer of hazardous 117 microorganisms found in wild-microbiota. We investigated whether exposing oyster larvae to 118 a controlled, pathogen -free bacterial community from donor oysters that had always been 119 maintained in biosecured facilities could confer the protective effects against POMS and V. 120 aestuarianus infection. Additionally, we examined the feasibility of microbial education using 121 a reduced synthetic bacterial community composed of cultivable bacteria isolated from disease 122 resistant oysters. For this purpose, we developed and tested multi-strain bacterial mixes 123 originating from the same geographical areas as the recipient oyster populations used in this 124 study. Our comprehensive assays encompassed three distinct oyster populations from the 125 Atlantic Ocean (Brest bay, La Tremblade in Marennes-Oleron bay, and Arcachon bay) and one 126 from the Mediterranean Sea (Thau lagoon), enabling an in -depth exploration of the potential 127 differential effects of bacterial exposure to either sympatric or allopatric oyster populations. 128 129

130 Oyster sampling 131 Oysters were collected along the French Atlantic coast s, during two different sampling 132 campaigns (in February 2020 and November 2020) , while it was only in November 2020 for 133 the Mediterranean site due to covid restrictions arisen earlier in the year. For the Atlantic coast, 134 3 sites were selected: the Brest bay (Brittany, France; lat 48.3349572; long -4.3189134), La 135 Tremblade in Marennes-Oleron bay (Nouvelle-Aquitaine, France ; lat 45.8029675; long -136 1.1534223) and the Arcachon bay (Nouvelle-Aquitaine, France ; lat 44.6813750; long -137 1.1402178). For the Mediterranean coast, the selected site was the Thau lagoon (Occitanie, 138 France; lat 43.39404; long 3.58092) . For each site, 5 oysters (average weight = 2.5 g) were 139 randomly sampled. Hence, the sampled oysters were located on sites with a high density of 140 oysters (wild and farmed) and have therefore survived an annual infectious episode of POMS 141 allowing us to assume they were resistant to the disease but also in the window of 142 permissiveness for Vibrio aestuarianus infection (Azéma et al. 2016). Based on these facts, we 143 hypothesized that sampling bacteria from these disease -resistant oysters increases the 144 likelihood of isolating beneficial bacteria. 145 146 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 6 Isolation of cultivable bacteria from Crassostrea gigas 147 The five disease resistant oysters sampled on each site were carefully brushed and washed to 148 remove the sediments, epiphytes and epibionts present on the shell. The flesh of the animals 149 was then individually crushed with an Ultra-Turrax T25 mixer (5 x 5 sec) in 15 ml falcon tubes. 150 The homogenized tissues were then diluted at 1:10 , 1:100 and 1:1000 in sterile artificial 151 seawater. A hundred µL of each dilution were spread on two Marine Agar (MA) (Marine Agar 152 Difco 2216) plates and incubated at 15°C or 20°C. 153 After a minimum incubation period of 3 days, bacterial colonies were selected according to 154 their morphotypes . A maximum of different morphotypes were selected to maximise the 155 biodiversity in our sampling and isolated by streaking a colony on a new MA plate and purified 156 by two successive subculturing. Then, the pure cultures of individual bacteria were transferred 157 onto Marine Broth (MB) tube (Marine Broth Difco 2216) at 15°C or 20°C and under a constant 158 agitation. After 48h of growth, 500 µL of these cultures was used for cryopreservation in 35% 159 glycerol (V/V) and put into a -80 °C freezer. About 1 ml of the liquid culture was pelleted for 160 further DNA extraction. 161 162 DNA extraction and identification of the cultivable bacteria 163 DNA extraction of the bacterial strains isolated from oysters and cultivated on agar plates was 164 carried with the Wizard® Genomic DNA Purification Kit (Promega) according to the 165 manufacturer instructions. 16S rRNA gene sequencing was performed on these samples to 166 identify each bacterium from the collection. The PCR and 16S rRNA gene sequencing was 167 performed by the Genoscreen sequencing facilities (http://www.genoscreen.fr/fr/). Briefly, two 168 pairs of primers P8/PC535 (P8 5' -AGAGTTTGATCCTGGCTCAG; PC535 5' - 169 GTATTACCGCGGCTGCTGGCAC) and 338F/1040R (338F 5' -CTCCTACGGGAGGCAG; 170 1040R 5'-GACACGAGCTGACGACA) were used for the PCR to amplify the V1-V3 and V3-171 V5 of the 16S r RNA gene . PCR products were then purified with Sephadex -G50 gel (GE 172 Healthcare) before analysis into ABI 3730XL capillary sequencer. The resulting sequences 173 were then assembled by using the DNA baser sequence assembly software (v4) ( Heracle 174 BioSoft, www.DnaBaser.com) and then added in the E zbiocloud database (Yoon et al. 2017) 175 in order to identify the taxonomy of the isolated bacteria composing the collection. 176 177 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 7 Larval cytotoxic effect 178 Two days old larvae (D stage) were distributed in wells of a 6-well plate filled with three ml of 179 sterile seawater at a density of 10 larvae per ml and maintained at a temperature of 20°C and a 180 12:12 day:night photoperiod. Treatment (bacterial challenge with a single bacterial strain) and 181 control (only sterile seawater) was each conducted in duplicate. The bacteria were cultivated 182 from glycerol stock in 10 ml of Marine Broth (MB) for 24h at 20°C and then, 1 ml of each 183 bacterial culture was inoculated into 10 ml fresh MB media and incubated at 20°C under 184 constant agitation. After 48 hours of incubation, the OD600 was measured, and the right amount 185 of bacteria was collected before being centrifuged at 4000 rpm for 2 minutes and the supernatant 186 was discarded. The pellets were then resuspended in 10 ml sterile seawater. Larvae were 187 challenged by addition of a target concentration of 10 7 CFU/ml of each bacterial strain 188 (Multiplicity of infection = 10 6 bacteria per larvae) . Larval mortality was recorded 48h post 189 addition of bacteria by evaluation of active swimming and/or gut and cilia movement under 190 binocular microscope. 191 192 Multi-strain bacterial mixes preparation for interaction with oysters 193 Five multi-strain bacterial mixes were tested (Table 1): four site-specific multi-strain bacterial 194 mixes composed of bacteria isolated from oysters sampled at each geographical site (Brest mix, 195 La Tremblade mix, Arcachon mix and Thau mix ) and a multi -site bacterial composed of 196 bacteria isolated from oysters sampled on all the different sites. The bacteria were cultivated 197 from glycerol stock in 10 ml of Marine Broth (MB) for 24h at 20°C and then, 1 ml of each 198 bacterial culture was inoculated into 50 ml fresh MB media and incubated at 20°C under 199 constant agitation. After 48 hours of incubation, the OD 600 was measured, and a quantity of 200 3.108 CFU was collected and pooled into a same mix for each cultivated bacterium. The mixes 201 were then centrifuged at 4000 rpm for 2 minutes and the supernatant was discarded. The pellets 202 were then resuspended in 10 ml sterile seawater and added immediately to 30 L larval rearing 203 tanks to a final concentration of 104 CFU/ml for each bacterium. 204 205 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 8 Oyster reproduction 206 150 wild oysters were randomly sampled from each geographic site as described above (Brest 207 bay, La Tremblade in Marennes-Oleron bay, Arcachon bay, Thau lagoon) in order to generate 208 4 oyster populations (Brest, La Tremblade, Arcachon and Thau population s) accordingly to 209 commercial oyster hatchery practices. Briefly, oyster genitors were transferred into the Ifremer 210 hatchery facility in La Tremblade. To avoid eventual horizontal transmission of pathogens 211 among populations, each was placed in separate tanks of 250 L in a flow through system with 212 a water circulation of 500 L/h. Seawater temperature was gradually increased from 10 to 20°C 213 within one week and maintain to 20°C to favour the gametogenesis . Broodstock were fed ad 214 libitum with a mixture of phytoplankton ( Isochrysis galbana, Tetraselmis suecica, and 215 Skeletonema costatum ). After 2 months, oysters were shucked and sexed by microscopic 216 observation. Only fully mature oysters were used, representing between 20 to 23 genitors per 217 population (Supplementary File 1, Table S1). Spermatozoa and oocytes were collected by 218 stripping the gonad. For each population, sperm was collected individually for each male while 219 oocytes of all females were pooled. Eggs were sieved on a 20 µm and 100 µm screens to remove 220 small and large debris, respectively, the eggs being retained on the 20 µm screen. Then, the 221 pool of eggs was divided by the number of males, and each subgroup was fertilized by a male. 222 Fifteen minutes after fertilization, all subgroups were mixed, and all fertilized and unfertilized 223 eggs were placed in fourteen 30 L tanks at a density of 34 to 100 eggs per mL (Supplementary 224 File 1, Table S2). Thus, depending on the population, between one to three million eggs were 225 added into each 30 L conical tank. Tanks were in a batch system containing 26 °C filtered and 226 UV-treated seawater, supplemented with gentle air -bubbling. Larval farming density were 10 227 larvae per ml at day 2, and 3 larvae per ml at day 7. Seawater was changed three times per week, 228 and larvae were fed daily with Isochrysis galbana, supplemented with Skeletonema costatum 229 from day 7. 230 231 Exposure of oyster larvae with microorganisms 232 For each population, seven conditions were tested, each using two 30 L replicate tanks. Larvae 233 were either unexposed or exposed to microbiota from donor oysters (ME seawater D0-D14) or 234 to the five different multi-strains bacterial mixes at two different larval developmental window 235 (Brest D0-D14, Brest D7-D14, La Tremblade D0-D14, La Tremblade D7-D14, Arcachon D0-236 D14, Thau D0-D14 and Multi -site D0-D14, Multi-site D7-D14 (Figure 1). For ME seawater 237 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 9 D0-D14, larvae were exposed to the whole natural microbiota coming from healthy donor 238 oysters (Microorganism-Enriched seawater = ME seawater). This microorganism community 239 was introduced thanks to donor oysters of microbiota which were placed into the rearing tanks. 240 Oyster donors of microbiota were NSI ( Naissains Standardisés Ifremer , standardised Ifremer 241 spats) (Petton et al. 2013, 2015) which were always kept in controlled facilities using UV -242 treated seawater, strict biosecurity zoning and management procedures. The oysters were tested 243 negative for the three main pathogens (Vibrio coralliilyticus, OsHV-1 µVar and 244 Haplosporidium costale) of C. gigas from larvae to juveniles (Azéma et al. 2017; Dégremont 245 et al. 2021). The microorganisms were added to the larvae either 3 hours post-fertilization (pf) 246 and at each water change until day 14 pf or from day 7 pf to day 14 pf (Figure 1). The water 247 changes at day 14 was performed without addition of the bacterial mixes . In this sense, the 248 microbial exposure ended up at day 14. 249 Larval survival was determined by counting the larvae either at days 2, 7 and 18 for oysters 250 exposed from day 0 pf to day 14 pf or at day 18 for oysters exposed from day 7 pf to day 14 pf. 251 Fixation rate was determined at day 25 pf for all conditions. Larvae (Pools of 10000 -20000 252 individuals) were sampled either at days 7 pf or at day 14 pf , flash frozen in liquid nitrogen 253 and stored at -80°C for subsequent molecular analysis. After the rearing steps, only one replicate 254 was kept to perform the experimental infections. 255 All oyster populations were kept in controlled facilities of the La Tremblade hatchery using 256 UV-treated seawater until experimental infections by OsHV-1 µVar or V. aestuarianus. 257 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 10 258 Figure 1: Overall experimental design for larval microbial exposure and experimental 259 infections. 260 Multi-parental reproduction was performed for the four oyster populations and the larvae were 261 placed in 30 L t anks in a batch system containing 26°C filtered and UV -treated seawater, 262 supplemented with gentle air -bubbling. Three hours post-fertilisation (pf), larvae remained 263 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 11 unexposed (2 tanks) or were exposed in duplicate to microbiota from donor oysters (ME 264 seawater D0-D14) or to the five different multi -strains bacterial mixes (Brest D0-D14, La 265 Tremblade D0-D14, Arcachon D0-D14, Thau D0-D14 and Multi-site D0-D14). This 266 microorganism exposure was renewed three times per week and lasted for 14 days. In parallel, 267 exposure to three multi -strains bacterial mixes (Brest D7-D14, La Tremblade D7-D14 and 268 Multi-site D7-D14) was performed on older larvae between D7 and D14 pf. During the larval 269 stage, seawater and larvae were sampled at days 2, 7, 11, 14, 18 and 25 pf to perform growth 270 and mortality monitoring, or to perform molecular analysis. After the larval stage, spat grew in 271 our controlled facility. At day 213 pf (approximatively seven months old), a first set was used 272 to carry out an experimental infection to OsHV-1 µVar and at day 352 pf (approximatively one 273 year), a second set was used to perform a V. Aestuarianus experimental infection. 274 275 OsHV-1 µVar experimental infection by cohabitation 276 OsHV-1 µVar experimental infection was perform ed either on control or microorganisms 277 exposed oysters (seven-month-old, mean individual weight = 2.80 ± 0.69g). A randomized 278 complete block design composed of five 50 L tanks (replicates) filled with filtered and UV -279 treated seawater and maintained at 20°C with adequate aeration and no food supply. Each tank 280 contained 12 oysters of each population exposed to each condition (total: 420 oysters per tank) 281 (Supplementary File 2, Figure S1). A cohabitation protocol, adapted from (Schikorski et al. 282 2011) was used as described. This approach starts with the injection of 100 µL of OsHV-1 µVar 283 suspension (10 5 OsHV-1 µVar genomic units) into the adductor muscle of pathogen-free 284 oysters donors. This protocol allows for pathogen transmission through the natural infectious 285 route to oysters of interest (recipient oysters). The OsHV-1 µVar donor oyster pool was 286 composed of 25% of F15 family oysters, 25% of F14 family oysters which are POMS 287 susceptible oysters (de Lorgeril et al. 2018) and 50% of genetically diversified NSI oysters 288 (~50% of susceptibility). The ratio was 1 donor oyster for 1 recipient oyster. Immediately after 289 OsHV-1 µVar injection into donors (adductor muscle) , recipient and donor oysters were 290 uniformly distributed in each of the five experimental tanks. After 48 hours of cohabitation, all 291 donor oysters were removed from the tanks. 292 In each tank, one oyster of each population exposed to each condition was sampled just before 293 the beginning of the experimental infection (t=0h infection) and three hours post cohabitation 294 with OsHV -1 µVar donor oysters (t=3h infection) to perform molecular analysis on whole 295 tissue samples. The shell was removed, the whole flesh flash frozen into liquid nitrogen and 296 stored at -80°C until it was grounded in liquid nitrogen (Retsch MM400 mill) to a powder that 297 was then stored at -80°C until DNA and RNA extraction. 298 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 12 The mortality was recorded daily during eight days. Dead recipient oysters were removed daily 299 from the tanks. 300 During the mortality monitoring, 1 mL of water in each tank was sampled every day for the 301 detection and the quantification of OsHV-1 µVar. 302 303 Vibrio aestuarianus experimental infection by cohabitation 304 Vibrio aestuarianus experimental infection was performed either on control or microorganisms 305 exposed oysters (12 months old ; mean individual weight = 9.42 ± 1.29g) with a cohabitation 306 protocol previously describe d in (Azéma et al. 2017) . A randomized complete block design 307 composed of five 100L replicate tanks filled with filtered and UV -treated seawater and 308 maintained at 20°C with adequate aeration and without food were used. Each tank contained 309 10 oysters of each population exposed to each condition (total: 350 oysters per tank). The V. 310 aestuarianus 02/041 strain (Garnier et al. 2008) was grown in Zobell medium at 22°C for 24h 311 under agitation. The bacterial concentration was determined by spectrophotometry at 600nm 312 and adjusted to an optical density (OD 600) of 1 representing 5.108 bacteria per mL. V. 313 aestuarianus donor oysters were injected in the adductor muscle with 100µL of the V. 314 aestuarianus 02/041 suspension and were then equally distributed among the five tanks. The V. 315 aestuarianus donor oyster population was composed of an equi -number of the four oyster 316 populations produced for this project (Brest, La Tremblade, Arcachon and Thau population s). 317 Immediately after V. aestuarianus injection into donors, donor oysters were added to the five 318 tanks containing the recipient oysters. A ratio of 1 V. aestuarianus donor oyster for 1.5 recipient 319 oyster was used. After 48 hours of cohabitation, V. aestuarianus donor oysters were removed 320 from the tanks. 321 The mortality was recorded daily during 15 days, and all the dead oysters were removed from 322 the tanks. During the mortality monitoring, 1 mL of water in each tank was sampled every day 323 for the detection and the quantification of V. aestuarianus. 324 325 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 13 Statistical Analysis of oyster mortality 326 Oyster mortality rates were compared between the different microorganisms exposure set using 327 survival analysis performed on R (v 4.2.1) (R Core Team 2022) with the package survminer (v 328 0.4.9) (https://cran.r -project.org/web/packages/survminer/index.html). The Kaplan -Meier 329

was used to represent the cumulative survival rate and log -rank test to determine the 330 difference between conditions. A multivariate Cox proportional hazards regression model was 331 used to compute Hazard-Ratio (HR) with confidence intervals of 95%. 332 333 Oysters and water Genomic DNA extraction and sequencing 334 DNA extraction from larvae (pool of 10000 to 20000 individuals) collected during 335 microorganisms exposure was extracted with the DNA from the tissue Macherey -Nagel kit 336 according to the manufacturer’s protocol. Prior to 90 min of proteinase K lysis, an additional 337 mechanical lysis was performed by vortexing samples with zirconia/silica beads (BioSpec). 338 DNA from individual juvenile oyster tissues collected just before and during experimental 339 infection was extracted from oyster powder with the DNA from tissue Macherey -Nagel kit 340 according to the manufacturer’s protocol. Prior to 90 min of proteinase K lysis, an additional 341 12-min mechanical lysis (Retsch MM400 mill) was performed with zirconia/silica beads 342 (BioSpec). DNA extraction from water collected dur ing microorganisms exposure and 343 experimental infections was extracted with the DNA from tissue Macherey-Nagel tissue kit 344 following the manufacturer support protocol for genomic DNA and viral DNA from blood 345 sample. 346 DNA concentration and purity were checked with a Nanodrop ND-1000 spectrometer (Thermo 347 Scientific). 348 349 qPCR analysis 350 Detection and quantification of OsHV-1 µVar and V. aestuarianus was performed by real-time 351 quantitative PCR . All amplification reactions were performed on Roche LightCycler® 480 352 Real-Time thermocycler. Each reaction was carried out in triplicate in a total volume of 10 µL 353 containing the DNA sample (2.5 µL), 5 µL of Takyon ™ SYBER MasterMix blue dTTP 354 (Eurogentec, ref UF-NSMT-B0701) and 1 µL at 500 nM of each primers for OsHV -1 µVar 355 (OsHVDPFor5’-ATTGATGATGTGGATAATCTGTG and OsHVDPFor 356 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 14 5’-GGTAAATACCATTGGTCTTGTTCC) (Webb et al. 2007) and for V. aestuarianus 357 (DNAj-F 5′ -GTATGAAATTTTAACTGACCCACAA and DNAj -R 358 5′-CAATTTCTTTCGAACAACCAC) (Saulnier et al. 2009). qPCR cycling conditions were as 359 follows: 3 min at 95°C, followed by 45 cycles of amplification at 95°C for 10 s, 60°C for 20 s, 360 and 72°C for 30s. After these PCR cycles a melting temperature curve of the amplicon was 361 generated to verify the specificity of the amplification. The DNA polymerase catalytic subunit 362 amplification product cloned into the pCR4 -TOPO vector was used as a standard at 10 -fold 363 dilutions ranging from 10 3 to 10 10 copies/ml for OsHV-1 µVar quantification and genomic 364 DNA from V. aestuarianus ranging from 10 2 to 10 7 copies/ml for V. aestuarianus 365 quantification. Absolute quantification of OsHV-1 µVar or V. aestuarianus was calculated by 366 comparing the observed Cp values to standard curve. 367 368 16S rDNA library construction and sequencing 369 Library construction (with primers 341F 5 ’-CCTAYGGGRBGCASCAG and 806R 5 ’-370 GGACTACNNGGGTATCTAAT targeting he V3 -V4 region of the 16S rRNA gene ) 371 (Klindworth et al. 2013) and sequencing on a MiSeq v2 (2x250 bp) were performed by ADNid 372 (Montpellier, France). 373 374 RNA extraction and sequencing 375 RNA was extracted from oyster powder (individual) by using the Direct-Zol RNA miniprep kit 376 (Zymo Research) according to the manufacturer’s protocol. RNA concentration and purity were 377 checked using a Nanodrop DN-1000 spectrometer (Thermo Scientific), and their integrity was 378 analysed by capillary electrophoresis on a BioAnalyzer 2100 (Agilent). 379 380 RNAseq library construction and sequencing 381 RNA-Seq experiments were performed on 3 individuals per condition. RNA-Seq library 382 construction and sequencing were performed by the Bio -Environment Platform (University of 383 Perpignan, France) . Stranded libraries were constructed from 500 ng of total RNA using 384 NEBNext UltraII and sequenced on a NextSeq550 instrument (Illumina) in single-end reads of 385 75 bp. 386 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 15 Bioinformatic pipelines for 16S rRNA gene barcoding analysis 387 Previously published barcoding datasets (de Lorgeril et al. 2018; King et al. 2019b; Clerissi et 388 al. 2020, 2022; Fallet et al. 2022) from 687 POMS-resistant and 664 POMS -sensitive oysters 389 were re-analysed in this study in order to predict bacteria which were potentially associated 390 with oyster POMS resistant phenotypes. Datasets used for these analyses are in Supplementary 391 File 1, Table S3. These datasets were individually analysed under the Toulouse Galaxy instance 392 (https://vm-galaxy-prod.toulouse.inra.fr/) (Goecks et al. 2010) with the Find Rapidly OTU with 393 Galaxy Solution (FROGS) pipeline (Escudié et al. 2018) . In brief, paired reads were merged 394 using FLASH (Magoč and Salzberg 2011). After denoising and primer/ adapter removal with 395 cutadapt (Martin 2011), clustering was performed using SWARM (Mahé et al. 2014) , which 396 uses a novel clustering algorithm with a threshold (distance = 3) corresponding to the maximum 397 number of differences between two OTUs. Chimeras were removed using VSEARCH (Rognes 398 et al. 2016). We filtered out the data set for singletons and performed an affiliation using Blast 399 against the Silva 16S rDNA database (release 132) to produce an OTU and affiliation tables. In 400 order to identify bacterial taxa which were significantly overrepresented in the microbial 401 community associated to POMS resistant compared to POMS sensitive oysters, the “LDA 402 Effect Size” (LEfSe) method (Segata et al. 2011) was used with a normalized relative 403 abundance matrix. This method uses a Kruskal-Wallis followed by Wilcoxon tests (pval ≤ 0.05) 404 and then performs a linear discriminant analysis (LDA) and evaluate the effect size. The taxa 405 with a LDA score greater than 2 were considered as significantly enriched in POMS resistant 406 compared to sensitive oysters. 407 Sequencing data obtained on the samples from this study were processed with the SAMBA (v 408 3.0.2) workflow developed by the SeBiMER (Ifremer’s Bioinformatics Core Facility). Briefly, 409 Amplicon Sequence Variants (ASV) were constructed with DADA2 (Callahan et al. 2016) and 410 the QIIME2 dbOTU3 (v 2020.2) tools (Bolyen et al. 2019), then, contaminations were removed 411 with microDecon (v 1.0.2) (McKnight et al. 2019) . Taxonomic assignment of ASVs was 412 performed using a Bayesian classifier trained with the Silva database v.138 using the QIIME 413 feature classifier (Wang et al. 2007). Finally, community analysis and statistics were performed 414 on R (R version 4.2.1) (R Core Team 2022) using the packages phyloseq (v 1.40.0) (McMurdie 415 and Holmes 2013) and Vegan (v 2.6-4) (Oksanen et al. 2022). Unique and overlapping ASVs 416 of each sample group were plotted using the UpsetR package (v 1.4.0) (Conway et al. 2017) . 417 For beta-diversity, the ASVs counts were preliminary normalized with the “rarefy_even_depth” 418 function (rngseed = 711) from the package phyloseq (v 1.40.0)(McMurdie and Holmes 2013). 419 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 16 Principal Coordinates Analysis (PcoA) were computed to represent dissimilarities between the 420 samples using the Bray -Curtis distance matrix. Differences between groups were assessed by 421 statistical analyses (Permutational Multivariate Analysis of Variance) using the adonis2 422 function implemented in vegan (Oksanen et al. 2022). 423 In order to follow the long-term installation (or not) of each of the bacteria used in the multi -424 strain bacterial mixes in the oyster microbiota, 16S rRNA genes sequences obtained during the 425 identification of each of the bacteria composing the multi-strain bacterial mixes were used as a 426 query for a similarity BLASTn search against all the ASVs sequence from the dataset (Altschul 427 et al. 1990) . A mock community composed of equal amount s of DNA from the bacteria 428 composing the multi-strain bacterial mixes were also used as a positive control to validate our 429 search method. ASVs sequences with a percentage of identity higher than 99% were considered 430 present in the tested samples. 431 432 Bioinformatic pipeline for RNA-Seq analysis 433 All data treatments were carried out under a local galaxy instance ( http://bioinfo.univ-perp.fr) 434 (Goecks et al. 2010). Reads quality was checked with FastQC (Babraham Bioinformatics) with 435 default parameters (Galaxy Version 0.72). Adapters were removed using Trim Galore (Galaxy 436 Version 0.6.3) (Babraham Bioinformatics). Reads were mapped on C. gigas genome (assembly 437 cgigas_uk_roslin_v1) using RNA STAR (Galaxy Version 2.7.8a) (Supplementary File 3: 438 RNAseq Mapping result s) and HTSeq -count (Anders et al. 2015) was used to count the 439 number of reads overlapping annotated genes (mode Union) (Galaxy Version 0.9.1). The 440 differential gene expression levels were analysed with the DESeq2 R package (v 1.36.0) (Love 441 et al. 2014). Finally, Rank-based Gene Ontology Analysis (GO_MWU package) was performed 442 using adaptive clustering and a rank-based statistical test (Mann–Whitney U-test combined with 443 adaptive clustering) with the following parameters: largest = 0.5; smallest = 10; 444 clusterCutHeight = 0.25. The signed “-Log(adj pval)” (obtained from the DESeq2 analysis) was 445 used as an input for the GO_MWU analysis. The R and Perl scripts used can be downloaded 446 [https://github.com/z0on/GO_MWU] (Wright et al. 2015). 447 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 17

448 23 bacterial strains with potential beneficial effects were selected to generate the multi-449 strain bacterial mixes. 450 To isolate bacteria with potential beneficial effects against oyster infectious disease, we 451 hypothesised that bacteria should be isolated from disease resistant oysters. For this purpose, 452 wild oysters aged between 12 and 18 months were sampled closed to farming area s. Oysters 453 located in these areas are submitted to high pathogen pressure and have been shown to be 454 resistant to POMS disease (Gawra et al. 2023) . To maximise the biodiversity of the bacterial 455 collection, oysters were sampled from 4 geographical French sites at two different seasons. A 456 total of 334 bacteria were isolated (Supplementary File 1, Table S4); from which 166 bacteria 457 were obtained from the February 2020 sampling campaign, and 168 bacteria from the 458 November 2020 sampling campaign. This corresponded to 97, 144, 56, and 67 bacteria isolated 459 from Brest, La Tremblade, Arcachon, and Thau sites, respectively. They were named according 460 to the sampling site (“ARG” for Brest bay, “LTB” for La Tremblade in Marennes Oleron bay, 461 “ARC” for Arcachon bay and “THAU” for Thau lagoon) followed by the number of the isolate. 462 The 16S rRNA gene sequence was obtained for 293 strains. The identified bacteria were divided 463 into the following phyla: Proteobacteria (62.8%), Firmicutes (15.3%), Bacteroidetes (12.3%) 464 and Actinobacteria (9.6%) (Figure 2). The three major genera were Vibrio, Bacillus and 465 Shewanella (Figure 2). The majority of the isolated species were found in all sites. 466 467 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 18 468 Figure 2: 293 strains were identified in the bacterial collection sampled from POMS-469 resistant oysters. 470 Phylogenetic tree of the 293 identified bacteria composing the collection of bacteria isolated 471 from POMS -resistant oyster s sampled in the Brest bay (pink), La Tremblade in Marennes-472 Oleron bay (yellow), the Arcachon bay (brown) and the Thau lagoon (grey) based on the V1-473 V5 loop alignment of bacterial 16S rDNA by a Maximum likelihood method with the Tamura-474 Nei parameter model in MEGA X (301 sequences) and 1000 bootstrap replicates. The collection 475 is composed by 62.8% of Proteobacteria (different shades of blue), 15.3% of Firmicutes 476 (orange), 12.3% of Bacteroidetes (green) and 9.6% of Actinobacteria (salmon). 477 478 In parallel, in silico correlation analysis was performed to predict bacteria preferentially 479 associated with resistant or sensitive oysters. This L efSE analysis (Segata et al. 2011) was 480 performed based on previously published 16S rRNA genes barcoding datasets which describes 481 the bacterial part of the bacterial microbiota community isolated from 687 POMS-resistant and 482 664 POMS-sensitive oysters (Supplementary File 1, Table S3). Based on this analysis, 118 483 bacterial genera were shown as preferentially associated with POMS -resistant oysters 484 (Supplementary File 1, Table S5). By combining the data obtained from this predictive in 485 silico analysis and data from the scientific literature about bacteria shown to be beneficial in an 486 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 19 aquaculture context (Rengpipat et al. 2000; Zhang et al. 2009; Kesarcodi -Watson et al. 2012; 487 Touraki et al. 2012; Sun et al. 2013; Guzmán-Villanueva et al. 2014; Yan et al. 2014; Reda and 488 Selim 2015; Tan et al. 2016; Chauhan et al. 2017; Makled et al. 2017; Lv et al. 2019) , we 489 selected 12, 17, 10 and 8 bacteria for the Brest , La Tremblade, Arcachon and Thau site s 490 respectively (Table 1). These bacterial strains were then tested for their cytotoxic effects on 2 491 days old larvae. The most cytotoxic bacteria were discarded. Based on these results, we kept 492 five, seven, five and five site -specific bacteria to produce the Brest, La Tremblade, Arcachon 493 and Thau multi -strain bacterial mix es respectively (Table 1). A fifth multi -site bacterial mix 494 was produced from bacteria isolated from oysters sampled on all sites. For this purpose, seven 495 different bacteria were chosen because they display ed the least cytotoxic effects on larvae 496 (Table 1). 497 In summary, we collected bacteria from disease -resistant oysters. We then combined our 498 findings with existing literature and utilized in silico predictive analysis. This allowed us to 499 create four site-specific and one multi -site multi-strain bacterial mixes, all of which have the 500 potential to benefit oyster health. 501 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 20 Table 1: Composition of the 5 multi -strain bacterial mixes produced according to their 502 predictive beneficial properties. 503 504 Environment Collection of bacteria Nb. of genera selected for cytotoxic assay on larvae Nb. of bacteria selected after cytotoxical assay Multi-strain bacterial mixes Nb. of bacteria in the collection Nb. of genera Names Strains Brest 97 40 12 5 Brest Mix Shewanella sp. ARG21 Marinibacterium sp. ARG39 Shewanella sp. ARG89 Shewanella sp. ARG96 Shewanella sp. ARG129 La Tremblade 144 45 17 8 La Tremblade Mix Halomonas sp. LTB66 Neptunomonas sp. LTB74 Psychrobacter sp. LTB83 Paracoccus sp. LTB95 Halomonas sp. LTB102 Cobetia sp. LTB109 Sulfitobacter sp. LTB127 Arcachon 56 26 10 5 Arcachon Mix Shewanella sp. ARC21 Bacillus sp. ARC34 Colwellia sp. ARC55 Neptunomonas sp. ARC59 Tenacibaculum sp. ARC64 Thau 67 18 8 5 Thau Mix Shewanella sp. THAU5 Paracoccus sp. THAU19 Ruegeria sp. THAU28 Shewanella sp. THAU34 Paracoccus sp. THAU46 Multi-site Mix Marinibacterium sp. ARG39 Shewanella sp. ARG89 Halomonas sp. LTB57 Cobetia sp. LTB109 Neptunomonas sp. ARC59 Paracoccus sp. THAU19 Paracoccus sp. THAU46 505 506 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 21 Microorganisms exposure during larval rearing induces long term protection against 507 POMS and Vibriosis which relies on bacterial mix composition and oyster origin. 508 The multi-strain bacterial mixes were added to four oyster populations during the larval rearing. 509 The four populations were the sympatric oysters from which the bacteria were isolated ( i.e., 510 Brest, La Tremblade, Arcachon and Thau). An exposure with a whole microbiota community 511 coming from healthy hatchery donor oysters was also performed (ME seawater D0-D14). This 512 oysters were shown to be devoid of the three main pathogens (V. coralliilyticus, OsHV-1 µVar 513 and Haplosporidium costale ) of C. gigas from larvae to juveniles (Azéma et al. 2017; 514 Dégremont et al. 2021) . Oyster’s larvae were exposed to bacterial mixes either from blastula 515 (3h post-fertilization (pf)) to pediveliger stage (14 days pf) (D0 to D14) or from veliger stage 516 (seven days pf) to pediveliger stage (14 days pf) (D7 to D14) (Figure 1). Overall, these 517 microorganisms exposures during larval rearing stages displayed from moderate to strong effect 518 on larval survival. These effects rely on oyster origins and, also, on the bacterial content of the 519 microorganism exposure (Supplementary File 4 Effect of bacterial mixes on oyster larvae 520 and Supplementary File 2, Figure S2). 521 522 Subsequently, each oyster population (exposed and control) were challenged with OsHV -1 523 µVar infection during juvenile stages or V. aestuarianus during adult stages. The success of the 524 experimental infection was verified by quantifying the viral or Vibrio DNA concentration in 525 the sea water of the experimental tanks (Supplementary File 1, Table S6 and Table S7). 526 In response to OsHV -1 µVar infection, a significant reduction of the mortality risk of 21% 527 (Log-rank test: pval = 0.038), 25% (Log-rank test: pval = 0.009), and 28% (Log-rank test: pval 528 = 0.008) was observed in the oysters (all populations combined) exposed to the Arcachon D0-529 D14, La Tremblade D7-D14 and D0-D14 ME seawater mixes, respectively (Figure 3). We 530 observed that the mortality start ed 3 days after the POMS disease induction, and differences 531 between the control and exposed sample s appeared as soon as mortality start ed for oysters 532 exposed to the Arcachon D0-D14, La Tremblade D7-D14 and, ME seawater D0-D14 oysters 533 (Supplementary File 2, Figure S3). 534 In response to vibriosis, a significant reduction of the mortality risk of 28% (Log-rank test: pval 535 = 0.006) was observed for the ME seawater D0 -D14 exposed oysters ( Figure 4) 536 (Supplementary File 2, Figure S4). Other exposures did not lead to reduction of mortality. 537 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 22 For both Vibriosis and viral infection, the beneficial effect in response to each of the mixes 538 depended on the oyster origin ( Supplementary File 2, Figure S 3). Oysters originating from 539 Arcachon showed the best reduction in mortality in response to both infections regardless of 540 the bacterial exposure conditions during the larval stages. The effect of the microorganisms 541 exposure was intermediate on oysters from La Tremblade and less pronounced on oysters from 542 Brest and Thau (Supplementary File 2, Figure S3). 543 In summary, larval exposure to bacterial mixes or Microorganism -Enriched seawater (ME 544 seawater) conferred a beneficial effect on the survival of the oysters against the POMS disease 545 in juvenile oysters while only Microorganism-Enriched seawater (ME seawater) conferred a 546 beneficial effect against Vibriosis. No preferential beneficial effect was nevertheless observed 547 when the oysters were exposed to their sympatric compared to allopatric strains. 548 549 Figure 3: Bacterial mixes and ME -seawater exposure during larval rearing reduce the 550 mortality risk induced by POMS 551 Forest plot representing the Hazard -Ratio value of mortality risk during the OsHV -1 µVar 552 experimental infection for oysters ( all populations co mbined) exposed to microorganisms 553 compared to control oysters. The numbers in to brackets under the different conditions 554 correspond to the number of oysters used during the experimental infection. The Hazard-Ratio 555 value is indicated to the right of the conditions, except for the control condition, which is 556 indicated as reference. The p-value of the log rank test is indicated on the right -hand side of 557 each row. 558 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 23 559 Figure 4: ME-seawater exposure during oyster larval rearing can reduce the mortality 560 risk induced by V. aestuarianus. 561 Forest plot representing the Hazard -Ratio value of mortality risk during the V. aestuarianus 562 experimental infection for oysters (All populations confounded) exposed to microorganisms 563 compared to control oysters. The numbers in to brackets under the different conditions 564 correspond to the number of oysters used during the experimental infection. The Hazard-Ratio 565 value is indicated to the right of the conditions, except for the control condition, which is 566 indicated as reference. The p-value is indicated on the right-hand side of each row. 567 568 Microorganism exposure during larval rearing induce d long term c hanges of the 569 microbiota composition. 570 To test the immediate and long -term effect of the microorganism exposure on the oyster 571 microbiota composition, we analysed the bacterial communities by 16S rRNA gene sequencing 572 during the larval stage after seven days of exposure and during the juvenile stage seven months 573 after the exposure . We focused our study on the three condition s of bacterial exposure that 574 conferred significant increase on the survival of oyster s during OsHV -1 µVar and V. 575 aestuarianus experimental infection. 576 Sequencing of the V3 -V4 hypervariable region of the 16S r RNA gene resulted in a total of 577 10,868,202 clusters. After quality check (deleting primers and low-quality sequences, merging, 578 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 24 and removing chimeras) and ASV clustering, 5,322,399 reads (49%) with an average of 35,962 579 reads per sample were retained for downstream analyses. 580 A higher species richness was observed seven days after the exposure for ME-seawater exposed 581 larvae but not after exposure to bacterial mixes (Figure 5 A,B). This difference was not 582 maintained at juvenile stage (Figure 5 C). Dissimilarity analysis, based on the Bray -Curtis 583 index, showed that the larvae microbiota composition differed between conditions after seven 584 days of microorganism exposure, whatever the condition (Table 2). This difference remained 585 statistically significant at juvenile stage for ME seawater D0-D14 and La Tremblade D7-D14 586 conditions (Table 2). 587 We additionally checked for the presence of the added bacteria, during the larval stage, after 588 seven days of exposure with the last addition of bacteria done 48 hours before sampling, and at 589 juvenile stage seven months post -exposure. Two bacterial strains out of the 5 added in larvae 590 exposed to Arcachon D0-D14 were retrieved and represented 3.3 to 25.9 % of the total bacterial 591 community (Supplementary File 2, Figure S5A). ASVs associated with the added bacteria of 592 the La Tremblade D7-D14 ranged from 0.09 to 0.96 % in the corresponding larvae samples 593 (Supplementary File 2, Figure S5C). None of the ASVs corresponding to bacteria used for 594 the exposure could be detected at the juvenile stages seven months post-exposure 595 (Supplementary File 2, Figure S5B,D). Furthermore, either for larvae or juvenile oysters, 596 bacterial strains did not show a preference for implantation in their sympatric host population 597 (Supplementary File 2, Figure S5 ). Using this pipeline of detection, we were able to detect 598 these ASVs on a mock control contain ing an artificial mix of bacteria in the same proportion 599 except for Paracococcus sp. LTB95 and Psychrobacter sp. LTB83 (Supplementary File 2, 600 Figure S6). This indicated that the lack of detection of the ASVs in exposed oyster is due to an 601 absence of the bacteria rather than a technical shortcoming in our detection pipeline, except for 602 Paracococcus sp. LTB95 and Psychrobacter sp. LTB83. 603 In summary, a few proportions of the different bacteria that were added during the larval rearing 604 were detected in the oyster microbiota 48h after the last addition of bacteria, and none of them 605 were maintained on a long-term basis. Despite this lack of bacterial colonization, the overall 606 composition of the microbiota was modified in response to the bacterial exposure and these 607 changes remained up to the juvenile stages. 608 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 25 609 Figure 5: The richness of oyster microbiota is transiently increased after larval exposure 610 to Microorganism-Enriched seawater. 611 The alpha-diversity indexes (observed species richness) of larvae microbiota after seven days 612 of exposure (A,B), or juvenile microbiota seven month s after the exposure (C) are indicated. 613 For larval stages (A) and (B), analys es were performed on all oyster population s confounded 614 which represent eight pools of 10000 -20000 larvae sampled in eight independent tanks for 615 exposure to ME D0-D14 and Arcachon D0-D14 (A) and on four pools of 10000-20000 larvae 616 sampled in four independent tanks for exposure to La Tremblade D7 -D14 (B). For juvenile 617 stages (C), analyses were performed on all oyster population confounded which represent 68 618 individuals sampled in five independent tanks. Significant changes are indicated by their p -619 value and "ns" stands for “not significant”. 620 621 Table 2: Long -lasting modifications in C. gigas microbiota composition occurred 622 following microorganisms exposure. 623 Permanova (adonis2) on the Bray-Curtiss dissimilarity matrix showing the effects of microbial 624 exposure on microbiota community compared to control condition for larvae after seven days 625 of microbial exposure and for juveniles seven months after the microbial exposure. For larvae, 626 analyses were performed on all oyster populations confounded which represent eight pools of 627 10000-20000 larvae sampled in eight independent tanks for exposure to ME D0 -D14 and 628 Arcachon D0-D14 and on four pools of 10000-20000 larvae sampled in four independent tanks 629 for exposure to La Tremblade D7 -D14. For juvenile stages, analys es were performed on all 630 oyster population confounded which represent 6 8 individuals sampled in five independent 631 tanks. 632 633 Larvae (after 7 days of exposure) Juvenile (7 months) Conditions (Compared to control) Dum Sq R² F p Dum Sq R² F p ME D0-D14 0.75 0.18 4.46 0.001 0.19 0.04 1.45 0.026 Arcachon D0-D14 0.85 0.19 3.30 0.001 0.08 0.02 0.75 0.908 La Tremblade D7-D14 0.43 0.29 2.98 0.036 0.17 0.04 1.55 0.033 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 26 Microorganisms exposure during larval rearing induced long-term changes in oyster 634 immunity. 635 The long-term impact of the microorganisms exposure on oyster gene expression was analysed 636 by RNA-seq on juvenile oysters before and during POMS challenge. In total, RNA sequencing 637 produces between 15.1 and 36.6 million reads per sample (mean number of reads = 26 millions). 638 Among these reads, 67.28% to 77.52% were mapped on C. gigas reference genome (assembly 639 cgigas_uk_roslin_v1) (Supplementary File 3: RNAseq Mapping result). 640 For each of the four oyster population s, the number of differentially expressed genes ( DEGs) 641 in oysters exposed to bacterial mixes or to ME seawater compared to control oysters, was higher 642 before the infection than 3h after the beginning of the infection except for the condition where 643 Brest oysters were exposed to ME seawater (Figure 6). Furthermore, each oyster population 644 displayed a specific transcriptomic response, which strongly varied according to the 645 microorganism exposure. (Figure 7). 646 647 648 Figure 6: Long-lasting changes in gene expression was observed in juvenile oysters seven 649 months after larval exposure. 650 Histogram of differentially expressed genes (DEGs) in oysters exposed to Arcachon D0-D14, 651 La Tremblade D7-D14 or ME seawater D0-D14 compared to control oysters for the four oyster 652 populations (Brest, Arcachon, La Tremblade and Thau) prior to OsHV-1 µVar infection (green) 653 and 3h post infection (blue). n=3 individuals per condition. 654 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 27 655 Figure 7: Specific gene expression profiles were observed in response to each 656 microorganism exposure. 657 Heatmap of differentially expressed genes (DEGs) in oysters exposed to Arcachon D0-D14, La 658 Tremblade D7-D14 or ME seawater D0-D14 compared to control oysters for the four oyster 659 populations (Brest, Arcachon, La Tremblade and Thau) (A) prior to OsHV -1 µVar infection 660 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 28 and (B) 3h post OsHV-1 µVar infection. The intensity of DEG ratios is represented by the Log2 661 Fold Changes (Log2FC) for over expressed DEGs (in red) and under expressed DEGs (in blue). 662 n=3 individuals per condition. 663 664 To identify which biological processes were affected by the microbial exposure, we conducted 665 a Rang -Based Gene Ontology Analysis ( GO_MWU) (Wright et al. 2015) . The range of 666 biological process enriched in DEGs (microorganisms exposed vs control) before and during 667 the onset of the POMS disease included many GO terms such as, metabolism, RNA and DNA 668 process, protein processing, signal transduction, transport, and immune functions. We then 669 focused on the enriched immune functions in oysters exposed to microorganisms compared to 670 the control oysters ( Figure 8). The most significantly enriched functions related to immunity 671 across all oyster populations and all treatments were general functions of immunity (defence 672 response, immune system process), functions related to the response to organisms (response to 673 bacterium, response to virus), a function related to the positive regulation of response to 674 stimulus and a function related to G-protein signalling pathway (Figure 8). As the oysters from 675 Arcachon showed the greatest reduction in mortality risk in the face of viral infection and V. 676 aestuarianus, with all the microbial exposures, we then analysed, for these oysters only, the 677 individual DEGs for the main enriched functions linked to immunity described in (Figure 8). 678 This analysis revealed that before the infection (t=0), gene coding for Pattern Recognition 679 Receptor (PRRs) (C -type lectins, C1q domain containing protein), innate immune pathways 680 (toll-interleukin receptor (TIR), Complement pathway), interaction with bacteria (Bactericidal 681 permeability-increasing protein) and antiviral pathways (RNA and DNA Helicases, RNA -682 dependent RNA polymerase) were found to be over-represented in microbial exposed oysters 683 compared to control oysters (Figure 9) (Supplementary File 5 List of DEGs). 684 In summary, long-lasting changes in gene expression were observed in juvenile oysters seven 685 months after they ha d been exposed to bacterial mixes or Microorganisms Enriched seawater 686 during larval stages. The long-lasting transcriptional responsiveness was found to be influenced 687 by the host's origin , was specific to the type of treatment and significantly impacts the host 688 immune response. 689 690 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 29 691 Figure 8: GO term enrichment analysis revealed important immune pathways modified 692 in response to the microorganism exposure. 693 Dot plot showing the overrepresented GO terms (FDR <0.1) of biological process (BP) related 694 to immune function identified using GO_MWU for the four oyster populations (Brest, 695 Arcachon, La Tremblade and Thau) exposed to Arcachon D0-D14, La Tremblade D7-D14 or 696 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 30 ME seawater D0-D14 compared to control oysters at t=0 and t=3h OsHV-1 µVar infection. The 697 dot size is proportional to the number of differentially expressed genes (DEG) in the biological 698 process compared to the control condition, and the colour of the dot shows the significance. 699 700 701 702 703 Figure 9: Detailed immune -related gene expression revealed key genes modified in 704 Arcachon oysters in response to microorganism exposure. 705 Transcriptomic response of immune related genes for oysters of the Arcachon population 706 exposed to Arcachon D0 -D14, La Tremblade D7 -D14 or ME seawater D0-D14 compared to 707 control condition before OsHV-1 µVar experimental infection. Heatmap of DEGs associated 708 with immune processes. Only DEGs found under at least two conditions of exposure to micro-709 organisms were shown. The intensity of DEG ratios is expressed in Log2 Fold changes 710 (Log2FC) for over expressed DEGs (in red) and under expressed DEGs (in blue). 711 712 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 31

713 OsHV-1 µVar, a threatening pathogen for oyster production, has spread not only in Europe 714 (Segarra et al. 2010; Petton et al. 2021) but also to the United States (Friedman et al. 2005) , 715 Japan (Shimahara et al. 2012) , Australia (Paul-Pont et al. 2013) , China (Bai et al. 2015) and 716 New-Zealand (Delisle et al. 2022). On the other hand, the pathogenic bacterium V. aestuarianus 717 has been observed to spread across Europe (Mesnil et al. 2022) . Innovative research and 718 concerted efforts are currently being explored for safeguarding C. gigas and ensuring the 719 sustainability of oyster farming on a global scale (Green and Montagnani 2013; Dégremont et 720 al. 2015, 2020; Lafont et al. 2017). One promising avenue of research involves education of the 721 oyster immune system through proper setting of the microbiota during early life. Similar to the 722 way early microbial colonization impacts human health (Gensollen et al. 2016; Renz et al. 723 2017), introducing specific microorganisms to oyster larvae can potentially educate their innate 724 immune systems and improve disease resistance (Galindo-Villegas et al. 2012; Fallet et al. 725 2022). The immune system in oysters is set up early during the development since the existence 726 of a primitive immune system has been detected in the trochophore larva (Tirapé et al. 2007; 727 Liu et al. 2015). This microbial education plan is a promising strategy as it is easy to implement, 728 not costly and, can be performed on numerous animals (several hundred million of larvae) at 729 the same time by bath or on their diet. However, a challenge arises in the form of current 730 hatchery practices, which aim to minimize the introduction of both non -pathogenic and 731 pathogenic microorganisms into larval tanks (Bourne et al. 1989; Helm et al. 2004; Eljaddi et 732 al. 2021; Cordier et al. 2021) . Mortality issues, particularly during larval rearing, have led to 733 the use of antibiotics in hatcheries. Therefore, finding a balance between educating the immune 734 system and addressing concerns about uncontrolled microbiota transfer is crucial. Here, our 735 study explored the feasibility of microbial education in oyster larvae while considering and 736 mitigating the risks associated with uncontrolled transfer of hazardous microorganisms. 737 For this purpose, we investigated the long-term protection conferred by a larval exposure to a 738 controlled non-pathogenic whole microbiota transferred from donor oysters. The donor oysters 739 used in this study were always kept in biosecured facilities. In this way, the oysters were shown 740 to be devoid of the three main pathogens of C. gigas from larvae to juveniles (Azéma et al. 741 2017; Dégremont et al. 2021) . In parallel, we performed the same a ssay using a reduced , 742 synthetic bacterial community composed of cultivable bacteria. The cultivable bacteria were 743 isolated from POMS-resistant oysters and selected according to their predictive beneficial effect 744 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 32 on POMS disease based on robust correlation analysis . The microbial exposures w ere 745 performed on 4 different oyster populations each exposed to either a sympatric or allopatric 746 multi-strain bacterial mixes. We showed that larval exposure to a whole microbiota from donor 747 oysters provided protection against both the POMS disease and V. aestuarianus infection. In a 748 different way, larvae exposed to multi-strains bacterial mixes showed improved survival against 749 OsHV-1 µVar but no protection against V. aestuarianus infection. The host origin was 750 identified as a critical factor for the protection conferred and no preferential effect was observed 751 when sympatric multi -strains mixes were used. This work demonstrates the potential of 752 leveraging the oyster microbiota to enhance long -term disease resistance in oyster s and sheds 753 light on the importance of considering the host origin in such protective mechanisms. 754 755 Targeting early developmental stages as a strategic window for probiotic application to induce 756 long-term protection has been proposed and explored in various animal models such as 757 mammals or humans (see review by Hashemi et al. 2016), but also those relevant to livestock 758 production (Wang et al. 2022; Villumsen et al. 2023) . Introducing beneficial microorganisms 759 during these stages can influence both the host's microbiota composition and immune system 760 development, potentially leading to long-term beneficial immunomodulation. Our results are in 761 line with these findings since we observe d a shift in both the transcr iptional pattern and 762 microbiota composition of oysters exposed to beneficial microorganisms compared to their 763 non-exposed counterparts , even seven months after the exposure. The long-lasting 764 transcriptional responsiveness was found to be influenced by the host's origin and was specific 765 to the type of microbial treatment administered. A significant portion of the differentially 766 expressed genes in exposed oysters were associated with immune functions, with a particular 767 emphasis on pattern recognition receptors (PRRs). Intriguingly, the observed difference in 768 phenotype between oysters stimulated with the whole microbiota and those stimulated with 769 multi-strain bacterial mixes could not be fully explained through a thorough analysis of the 770 differentially expressed genes. This suggests that additional factors or intricate interactions 771 within the oyster's immune system and microbiota may contribute to the differential response. 772 Furthermore, when the oysters were challenged with OsHV-1 µVar three hours after exposure, 773 changes in the transcriptional pattern were still evident in oysters exposed to beneficial 774 microorganisms compared to their non -exposed counterparts, albeit to a lesser extent than 775 before the infectious challenge . This indicates a dynamic interplay between the immune 776 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 33 response against the virus and the prior microbial stimulation, with the virus potentially exerting 777 a more pronounced effect on the transcriptional response. 778 Our findings further indicates that exposure to either bacterial mixes or whole microbiota, leads 779 to changes in the microbiota composition. This was observed during the exposure but also on a 780 long-term basis as previously observed in other studies (Padeniya et al. 2022; Villumsen et al. 781 2023; Takyi et al. 2024) . Interestingly, the bacteria added as part of the bacterial mixes were 782 not detected using the employed method. This suggests that the added bacteria did not 783 effectively integrate the oyster microbiota, even shortly after the start of the exposure. Similar 784 studies indicate that administered bacteria fail to establish and only persist temporarily in the 785 microbiota of exposed animals. For instance, the Aeromonas sp. strain administered to oyster 786 larvae was undetectable 72 hours after addition (Gibson et al. 1998) . Similarly, exposing the 787 European abalone (Haliotis tuberculata) to the Pseudoalteromonas sp. hCg-6 exogenous strain 788 resulted in a transient establishment of the probiotic strain in the haemolymph rather than a 789 sustained interaction (Offret et al. 2018) . Additionally, Arctic Char ( Salvelinus alpinus ) 790 exposed to various probiotic strains did not show detectable levels of the administered strains 791 four weeks after probiotics administration (Knobloch et al. 2022) . The change in microbiota 792 composition observed on long term basis might thus be linked to ongoing interactions between 793 the microbiota and the immune system, leading to a continuous reshaping of both elements and 794 explaining also the observed long-term transcriptional changes. 795 796

797 Our study successfully investigated methods which aimed at exposing oysters to specific 798 beneficial microorganisms during larval rearing to educate their immune system. We took into 799 account the potential risks associated to this microbial exposure while ensuring that the oysters' 800 innate immune system was primed for improved disease resistance. We demonstrated the 801 potential of leveraging this microbial education to enhance disease resistance to two major 802 oyster pathogens, OsHV-1 µVar and V. aestuarianus, which are current critical threat for oyster 803 farming worldwide. Additionally, our findings emphasize the potential of using controlled 804 whole microbiota transfers as the best strategy to safeguard oyster health in aquaculture settings. 805 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 34 Additional optimizations will be required to identify the most effective settings for enhancing 806 the beneficial impact of microbial education. The timing, duration of exposure, and rearing 807 conditions are essential factors for the practical application of this approach in aquaculture 808 environments. Exploring combinations with other strategies, such as selecting oysters with 809 genetic backgrounds that are more receptive to microbial education, is another avenue that 810 certainly deserves further investigation. 811 812 813 List of abbreviations 814 ASV: Amplicon Sequence Variants 815 CFU: Colony‑forming unit 816 DEG: Differentially expressed gene 817 HR: Hazard-Ratio 818 LEfSe: Linear discriminant analysis (LDA) Effect Size 819 MB: Marine Broth 820 NSI: Naissains Standardisés Ifremer or standardised Ifremer spats 821 OsHV-1 µVar: Ostreid Herpes Virus 1 µVar 822 OTU: Operational Taxonomic Unit 823 pf: post-fertilization 824 POMS: Pacific Oyster Mortality Syndrome 825 RNA‑Seq: Sequencing of the polyadenylated ribonucleic acids 826 827 Competing interests 828 The authors declare that they have no competing interests. 829 830 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 35 Acknowledgments 831 The authors warmly thank the staff of the Ifremer stations of Argenton, La Tremblade and 832 Arcachon for their help and hospitality during the various oyster sampling campaigns. We are 833 grateful to Leo Duperret , Emily Kunselman , Nicole Faury, Cyrielle Lecadet and Delphine 834 Tourbiez for their help during the oyster experimental infections and Abdellah Benabdelmouna 835 and Christophe Ledu for their help during the larval rearing. We are grateful to Jean -François 836 Allienne, Margot Doberva and Michèle Laudié from the Bio -Environment platform (UPVD, 837 Région Occitanie, CPER 2007 -2013 Technoviv, CPER 2015 -2020 Technoviv2) for technical 838 support in library preparation and sequencing . We are grateful to the BIO2MAR platform 839 (http://bio2mar.obs-banyuls.fr) for access to instrumentation. 840 841 Authors' contributions 842 LDa, LDé, BM, BP, EM, GC and JVD contributed to oysters sampling. LDa, PC, RL and LI 843 contributed to bacteria collection. LDa, PC, LDé, BM, BP, MM, EM, JVD, ET and CC 844 performed oyster experiments. LDa, PC, JFA, CG, OR, JVD, ET and CC prepared samples and 845 performed DNA and RNA extraction on oysters samples for analyses. LDa, MAT, JFA, OR 846 and JP performed qPCR analyses. LDa, ET and CC performed microbiota analyses. LDa, JVD, 847 ET and CC performed RNAseq analyses. LDa, LDé, BM, MAT, BP, MM, YG, JVD, ET and 848 CC conceptualized and designed the experiments. LDa, LDé, BM, MAT, BP, YG, JVD, ET 849 and CC wrote the original draft. LDa, YG, JVD, ET and CC involved in funds acquisition. All 850 authors read and approved the final manuscript. 851 852 Funding 853 The present study was supported by the Ifremer project GT -huitre and by the Fond Européen 854 pour les Affaires Maritimes et la Pêche (FEAMP, GESTINNOV project 855 n°PFEA470020FA1000007), the project “Microval” of the Bonus Qualité Recherche program 856 of the University of Perpignan, the project “gigantimic 1” from the federation de recherche of 857 the university of Perpignan, the project “gigantimic 2” from the kim food and health foundation 858 of MUSE and the project ANR DECICOMP (ANR-19-CE20-0004). This study is set within 859 the framework of the "Laboratoires d'Excellences (LABEX)": TULIP (ANR‐10‐LABX‐41) and 860 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 36 “CeMEB” (ANR-10-LABX-04-01). Luc Dantan is a recipient of a PhD grant from the Region 861 Occitanie (Probiomic project) and the University of Perpignan Via Domitia graduate school 862 ED305. 863 864 Availability of data and materials 865 Raw sequence data for RNA-seq and 16S sequencing for metabarcoding analysis have been 866 made available through the SRA database (BioProject accession number PRJNA1078733). 867 R script for survival, DEseq2 and microbiota analyses are available by using the following link: 868 https://zenodo.org/records/11200726. 869 870 Ethical approval 871 The animal (oyster Crassostrea gigas) testing followed all european regulations concerning 872 animal experimentation. The authors declare that the use of genetic resources fulfill the French 873 and EU regulations on the Nagoya Protocol on Access and Benefit-Sharing (French legislation 874 2019-486). 875 876

877 Abt MC, Artis D (2013) The dynamic influence of commensal bacteria on the immune response 878 to pathogens. Curr Opin Microbiol 16:4–9. doi: 10.1016/j.mib.2012.12.002 879 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search 880 tool. J Mol Biol 215:403–410. doi: 10.1016/S0022-2836(05)80360-2 881 Anders S, Pyl PT, Huber W (2015) HTSeq-A Python framework to work with high-throughput 882 sequencing data. Bioinformatics 31:166–169. doi: 10.1093/bioinformatics/btu638 883 Arrieta MC, Stiemsma LT, Amenyogbe N, Brown E, Finlay B (2014) The intestinal 884 microbiome in early life: Health and disease. Front Immunol. doi: 885 10.3389/fimmu.2014.00427 886 Azéma P, Travers M -A, De Lorgeril J, Tourbiez D, Dégremont L (2015) Can selection for 887 resistance to OsHV -1 infection modify susceptibility to Vibrio aestuarianus infection in 888 Crassostrea gigas? First insights from experimental challenges using primary and 889 successive exposures. Vet Res. doi: 10.1186/s13567-015-0282-0 890 Azéma P, Travers M-A, Benabdelmouna A, Dégremont L (2016) Single or dual experimental 891 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 37 infections with Vibrio aestuarianus and OsHV-1 in diploid and triploid Crassostrea gigas 892 at the spat, juvenile and adult stages. J Invertebr Pathol 139:92 –101. doi: 893 10.1016/j.jip.2016.08.002 894 Azéma P, Lamy JB, Boudry P, Renault T, Travers M -A, Dégremont L (2017) Genetic 895 parameters of resistance to Vibrio aestuarianus, and OsHV -1 infections in the Pacific 896 oyster, Crassostrea gigas, at three different life stages. Genet Sel Evol 49:1 –16. doi: 897 10.1186/s12711-017-0297-2 898 Bai C, Wang C, Xia J, Sun H, Zhang S, Huang J (2015) Emerging and endemic types of Ostreid 899 herpesvirus 1 were detected in bivalves in China. J Invertebr Pathol 124:98 –106. doi: 900 10.1016/j.jip.2014.11.007 901 Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm 902 EJ, Arumugam M, Asnicar F, Bai Y, Bisanz JE, Bittinger K, Brejnrod A, Brislawn CJ, 903 Brown CT, Callahan BJ, Caraballo-Rodríguez AM, Chase J, Cope EK, Da Silva R, Diener 904 C, Dorrestein PC, Douglas GM, Durall DM, Duvallet C, Edwardson CF, Ernst M, Estaki 905 M, Fouquier J, Gauglitz JM, Gibbons SM, Gibson DL, Gonzalez A, Gorlick K, Guo J, 906 Hillmann B, Holmes S, Holste H, Huttenhower C, Huttley GA, Janssen S, Jarmusch AK, 907 Jiang L, Kaehler BD, Kang K Bin, Keefe CR, Keim P, Kelley ST, Knights D, Koester I, 908 Kosciolek T, Kreps J, Langille MGI, Lee J, Ley R, Liu YX, Loftfield E, Lozupone C, 909 Maher M, Marotz C, Martin BD, McDonald D, McIver LJ, Melnik A V., Metcalf JL, 910 Morgan SC, Morton JT, Naimey AT, Navas -Molina JA, Nothias LF, Orchanian SB, 911 Pearson T, Peoples SL, Petras D, Preuss ML, Pruesse E, Rasmussen LB, Rivers A, 912 Robeson MS, Rosenthal P, Segata N, Shaffer M, Shiffer A, Sinha R, Song SJ, Spear JR, 913 Swafford AD, Thompson LR, Torres PJ, Trinh P, Tripathi A, Turnbaugh PJ, Ul-Hasan S, 914 van der Hooft JJJ, Vargas F, Vázquez-Baeza Y, Vogtmann E, von Hippel M, Walters W, 915 Wan Y, Wang M, Warren J, Weber KC, Williamson CHD, Willis AD, Xu ZZ, Zaneveld 916 JR, Zhang Y, Zhu Q, Knight R, Caporaso JG (2019) Reproducible, interactive, scalable 917 and extensible microbiome data science using QIIME 2. Nat Biotechnol 37:852–857. doi: 918 10.1038/s41587-019-0209-9 919 Bourne N, Hodgson CA, Whyte JNC (1989) A Manual for Scallop Culture in British Columbia. 920 Canadian Technical Report of Fisheries and Aquatic Sciences No. 1694. 921 Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP (2016) DADA2: 922 High-resolution sample inference from Illumina amplicon data. Nat Methods 13:581–583. 923 doi: 10.1038/nmeth.3869 924 Chauhan R, Choudhuri A, Abraham J (2017) Evaluation of antimicrobial, cytotoxicity, and 925 dyeing properties of prodigiosin produced by Serratia marcescens strain JAR8. Asian J 926 Pharm Clin Res 10:279–283. doi: 10.22159/ajpcr.2017.v10i8.18173 927 Chung H, Pamp SJ, Hill JA, Surana NK, Edelman SM, Troy EB, Reading NC, Villablanca EJ, 928 Wang S, Mora JR, Umesaki Y, Mathis D, Benoist C, Relman DA, Kasper DL (2012) Gut 929 immune maturation depends on colonization with a host -specific microbiota. Cell 930 149:1578–1593. doi: 10.1016/j.cell.2012.04.037 931 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 38 Clerissi C, de Lorgeril J, Petton B, Lucasson A, Escoubas J-M, Gueguen Y, Dégremont L, Mitta 932 G, Toulza E (2020) Microbiota Composition and Evenness Predict Survival Rate of 933 Oysters Confronted to Pacific Oyster Mortality Syndrome. Front Microbiol 11:1–11. doi: 934 10.3389/fmicb.2020.00311 935 Clerissi C, Luo X, Lucasson A, Mortaza S, de Lorgeril J, Toulza E, Petton B, Escoubas J -M, 936 Degrémont L, Gueguen Y, Destoumieux -Garzón D, Jacq A, Mitta G (2022) A core of 937 functional complementary bacteria infects oysters in Pacific Oyster Mortality Syndrome. 938 Anim Microbiome. doi: 10.1186/s42523-023-00246-8 939 Conway JR, Lex A, Gehlenborg N (2017) UpSetR: An R package for the visualization of 940 intersecting sets and their properties. Bioinformatics 33:2938 –2940. doi: 941 10.1093/bioinformatics/btx364 942 Cordier C, Voulgaris A, Stavrakakis C, Sauvade P, Coelho F, Moulin P (2021) Ultrafiltration 943 for environmental safety in shellfish production: A case of bloom emergence. Water Sci 944 Eng 14:46–53. doi: 10.1016/j.wse.2021.03.003 945 Cotter E, Malham SK, O’Keeffe S, Lynch SA, Latchford JW, King JW, Beaumont AR, Culloty 946 SC (2010) Summer mortality of the Pacific oyster, Crassostrea gigas, in the Irish Sea: The 947 influence of growth, biochemistry and gametogenesis. Aquaculture 303:8 –21. doi: 948 10.1016/J.AQUACULTURE.2010.02.030 949 Dantan L, Toulza E, Petton B, Montagnani C, Degremont L, Morga B, Fleury Y, Mitta G, 950 Gueguen Y, Vidal -Dupiol J, Cosseau C (2024) Microbial education for marine 951 invertebrate disease prevention in aquaculture. Rev Aquac 1–15. doi: 10.1111/raq.12893 952 de Kantzow M, Hick PM, Whittington RJ (2023) Immune Priming of Pacific Oysters 953 (Crassostrea gigas ) to Induce Resistance to Ostreid herpesvirus 1: Comparison of 954 Infectious and Inactivated OsHV -1 with Poly I:C. Viruses 15:1943. doi: 955 10.3390/v15091943 956 de Lorgeril J, Lucasson A, Petton B, Toulza E, Montagnani C, Clerissi C, Vidal -Dupiol J, 957 Chaparro C, Galinier R, Escoubas J -M, Haffner P, Dégremont L, Charrière GM, Lafont 958 M, Delort A, Vergnes A, Chiarello M, Faury N, Rubio T, Leroy MA, Pérignon A, Régler 959 D, Morga B, Alunno-Bruscia M, Boudry P, Le Roux F, Destoumieux-Garzón D, Gueguen 960 Y, Mitta G (2018) Immune -suppression by OsHV -1 viral infection causes fatal 961 bacteraemia in Pacific oysters. Nat Commun. doi: 10.1038/s41467-018-06659-3 962 Dégremont L, Garcia C, Allen SK (2015) Genetic improvement for disease resistance in 963 oysters: A review. J Invertebr Pathol 131:226–241. doi: 10.1016/j.jip.2015.05.010 964 Dégremont L, Azéma P, Maurouard E, Travers M -A (2020) Enhancing resistance to Vibrio 965 aestuarianus in Crassostrea gigas by selection. Aquaculture. doi: 966 10.1016/j.aquaculture.2020.735429 967 Dégremont L, Morga B, Maurouard E, Travers M-A (2021) Susceptibility variation to the main 968 pathogens of Crassostrea gigas at the larval, spat and juvenile stages using unselected and 969 selected oysters to OsHV -1 and/or V. aestuarianus. J Invertebr Pathol 183:107601. doi: 970 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 39 10.1016/j.jip.2021.107601 971 Delisle L, Laroche O, Hilton Z, Burguin J-F, Rolton A, Berry J, Pochon X, Boudry P, Vignier 972 J (2022) Understanding the Dynamic of POMS Infection and the Role of Microbiota 973 Composition in the Survival of Pacific Oysters, Crassostrea gigas. Microbiol Spectr. doi: 974 10.1128/spectrum.01959-22 975 Eljaddi T, Ragueneau S, Cordier C, Lange A, Rabiller M, Stavrakakis C, Moulin P (2021) 976 Ultrafiltration to secure shellfish industrial activities: Culture of microalgae and oyster 977 fertilization. Aquac Eng. doi: 10.1016/j.aquaeng.2021.102204 978 Escudié F, Auer L, Bernard M, Mariadassou M, Cauquil L, Vidal K, Maman S, Hernandez -979 Raquet G, Combes S, Pascal G (2018) FROGS: Find, Rapidly, OTUs with Galaxy 980 Solution. Bioinformatics 34:1287–1294. doi: 10.1093/bioinformatics/btx791 981 Fallet M, Montagnani C, Petton B, Dantan L, de Lorgeril J, Comarmond S, Chaparro C, Toulza 982 E, Boitard S, Escoubas J-M, Vergnes A, Le Grand J, Bulla I, Gueguen Y, Vidal-Dupiol J, 983 Grunau C, Mitta G, Cosseau C (2022) Early life microbial exposures shape the Crassostrea 984 gigas immune system for lifelong and intergenerational disease protection. Microbiome. 985 doi: 10.1186/s40168-022-01280-5 986 Fleury E, Barbier P, Petton B, Normand J, Thomas Y, Pouvreau S, Daigle G, Pernet F (2020) 987 Latitudinal drivers of oyster mortality: deciphering host, pathogen and environmental risk 988 factors. Sci Rep. doi: 10.1038/s41598-020-64086-1 989 Food and Agriculture Organisation (2022) The State of World Fisheries and Aquaculture 2022. 990 State World Fish Aquac 2022. doi: 10.4060/cc0461en 991 Friedman CS, Estes RM, Stokes NA, Burge CA, Hargove JS, Barber BJ, Elston RA, Burreson 992 EM, Reece KS (2005) Herpes virus in juvenile Pacific oysters Crassostrea gigas from 993 Tomales Bay, California, coincides with summer mortality episodes. Dis Aquat Organ 994 63:33–41. doi: 10.3354/dao063033 995 Galindo-Villegas J, Garciá-Moreno D, De Oliveira S, Meseguer J, Mulero V (2012) Regulation 996 of immunity and disease resistance by commensal microbes and chromatin modifications 997 during zebrafish development. Proc Natl Acad Sci U S A. doi: 10.1073/pnas.1209920109 998 Garnier M, Labreuche Y, Nicolas JL (2008) Molecular and phenotypic characterization of 999 Vibrio aestuarianus subsp. francensis subsp. nov., a pathogen of the oyster Crassostrea 1000 gigas. Syst Appl Microbiol 31:358–365. doi: 10.1016/j.syapm.2008.06.003 1001 Gawra J, Valdivieso A, Roux F, Laporte M, de Lorgeril J, Gueguen Y, Saccas M, Escoubas J -1002 M, Montagnani C, Destoumieux -Garzón D, Lagarde F, Leroy MA, Haffner P, Petton B, 1003 Cosseau C, Morga B, Degrémont L, Mitta G, Grunau C, Vidal-Dupiol J (2023) Epigenetic 1004 variations are more substantial than genetic variations in rapid adaptation of oyster to 1005 Pacific oyster mortality syndrome. Sci Adv. doi: 10.1126/sciadv.adh8990 1006 Gensollen T, Iyer SS, Kasper DL, Blumberg RS (2016) How colonization by microbiota in 1007 early life shapes the immune system. Science (80 - ) 352:539 –544. doi: 1008 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 40 10.1126/science.aad9378 1009 Gibson LF, Woodworth J, George AM (1998) Probiotic activity of Aeromonas media on the 1010 Pacific oyster, Crassostrea gigas, when challenged with Vibrio tubiashii. Aquaculture 1011 169:111–120. doi: 10.1016/S0044-8486(98)00369-X 1012 Goecks J, Nekrutenko A, Taylor J, Afgan E, Ananda G, Baker D, Blankenberg D, Chakrabarty 1013 R, Coraor N, Goecks J, Von Kuster G, Lazarus R, Li K, Taylor J, Vincent K (2010) 1014 Galaxy: a comprehensive approach for supporting accessible, reproducible, and 1015 transparent computational research in the life sciences. Genome Biol. doi: 10.1186/gb -1016 2010-11-8-r86 1017 Green TJ, Montagnani C (2013) Poly I: C induces a protective antiviral immune response in 1018 the Pacific oyster (Crassostrea gigas) against subsequent challenge with Ostreid 1019 herpesvirus (OsHV -1 μvar). Fish Shellfish Immunol 35:382–388. doi: 1020 10.1016/j.fsi.2013.04.051 1021 Guzmán-Villanueva LT, Tovar -Ramírez D, Gisbert E, Cordero H, Guardiola FA, Cuesta A, 1022 Meseguer J, Ascencio -Valle F, Esteban MA (2014) Dietary administration of β-1,3/1,6-1023 glucan and probiotic strain Shewanella putrefaciens , single or combined, on gilthead 1024 seabream growth, immune responses and gene expression. Fish Shellfish Immunol 39:34–1025 41. doi: 10.1016/j.fsi.2014.04.024 1026 Hashemi A, Villa CR, Comelli EM (2016) Probiotics in early life: A preventative and treatment 1027 approach. Food Funct. 7:1752–1768. 1028 Helm MM, Bourne N, Lovatelli A (2004) Hatchery culture of bivalves. A practical manual. 1029 FAO Fish Tech Pap 471:203. 1030 Kesarcodi-Watson A, Miner P, Nicolas JL, Robert R (2012) Protective effect of four potential 1031 probiotics against pathogen -challenge of the larvae of three bivalves: Pacific oyster 1032 (Crassostrea gigas), flat oyster (Ostrea edulis) and scallop (Pecten maximus). Aquaculture 1033 344–349:29–34. doi: 10.1016/j.aquaculture.2012.02.029 1034 King WL, Jenkins C, Go J, Siboni N, Seymour JR, Labbate M (2019a) Characterisation of the 1035 Pacific Oyster Microbiome During a Summer Mortality Event. Microb Ecol 77:502–512. 1036 doi: 10.1007/s00248-018-1226-9 1037 King WL, Siboni N, Williams NLR, Kahlke T, Nguyen KV, Jenkins C, Dove M, O’Connor W, 1038 Seymour JR, Labbate M (2019b) Variability in the composition of pacific oyster 1039 microbiomes across oyster families exhibiting different levels of susceptibility to OsHV -1040 1 μvar disease. Front Microbiol 10:1–12. doi: 10.3389/fmicb.2019.00473 1041 Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, Glöckner FO (2013) 1042 Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next -1043 generation sequencing -based diversity studies. Nucleic Acids Res. doi: 1044 10.1093/nar/gks808 1045 Knobloch S, Skírnisdóttir S, Dubois M, Kolypczuk L, Leroi F, Leeper A, Passerini D, 1046 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 41 Marteinsson V (2022) Impact of Putative Probiotics on Growth, Behavior, and the Gut 1047 Microbiome of Farmed Arctic Char (Salvelinus alpinus). Front Microbiol 13:912473. doi: 1048 10.3389/fmicb.2022.912473 1049 Lafont M, Petton B, Vergnes A, Pauletto M, Segarra A, Gourbal B, Montagnani C (2017) Long-1050 lasting antiviral innate immune priming in the Lophotrochozoan Pacific oyster, 1051 Crassostrea gigas. Sci Rep. doi: 10.1038/s41598-017-13564-0 1052 Lafont M, Vergnes A, Vidal-Dupiol J, De Lorgeril J, Gueguen Y, Haffner P, Petton B, Chaparro 1053 C, Barrachina C, Destoumieux -Garzón D, Mitta G, Gourbal B, Montagnani C (2020) A 1054 sustained immune response supports long -term antiviral immune priming in the pacific 1055 oyster, Crassostrea gigas. MBio. doi: 10.1128/mBio.02777-19 1056 Le Roux F, Wegner KM, Polz MF (2016) Oysters and Vibrios as a Model for Disease Dynamics 1057 in Wild Animals. Trends Microbiol 24:568–580. doi: 10.1016/j.tim.2016.03.006 1058 Liu Z, Zhou Z, Wang L, Song X, Chen H, Wang W, Liu R, Wang M, Wang H, Song L (2015) 1059 The enkephalinergic nervous system and its immunomodulation on the developing 1060 immune system during the ontogenesis of oyster Crassostrea gigas . Fish Shellfish 1061 Immunol 45:250–259. doi: 10.1016/j.fsi.2015.03.041 1062 Lokmer A, Kuenzel S, Baines JF, Wegner KM (2016) The role of tissue-specific microbiota in 1063 initial establishment success of Pacific oysters. Environ Microbiol 18:970 –987. doi: 1064 10.1111/1462-2920.13163 1065 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for 1066 RNA-seq data with DESeq2. Genome Biol 15:1–21. doi: 10.1186/s13059-014-0550-8 1067 Lupo C, Travers M-A, Tourbiez D, Barthélémy CF, Beaunée G, Ezanno P (2019) Modeling the 1068 transmission of Vibrio aestuarianus in pacific oysters using experimental infection data. 1069 Front Vet Sci. doi: 10.3389/fvets.2019.00142 1070 Lv N, Pan L, Zhang J, Li Y, Zhang M (2019) A novel micro -organism for removing excess 1071 ammonia-N in seawater ponds and the effect of Cobetia amphilecti on the growth and 1072 immune parameters of Litopenaeus vannamei . J World Aquac Soc 50:448 –459. doi: 1073 10.1111/jwas.12561 1074 Magoč T, Salzberg SL (2011) FLASH: Fast length adjustment of short reads to improve 1075 genome assemblies. Bioinformatics 27:2957–2963. doi: 10.1093/bioinformatics/btr507 1076 Mahé F, Rognes T, Quince C, de Vargas C, Dunthorn M (2014) Swarm: Robust and fast 1077 clustering method for amplicon-based studies. PeerJ 2014:e593. doi: 10.7717/peerj.593 1078 Makled SO, Hamdan AM, El-Sayed AFM, Hafez EE (2017) Evaluation of marine psychrophile, 1079 Psychrobacter namhaensis SO89, as a probiotic in Nile tilapia ( Oreochromis niloticus) 1080 diets. Fish Shellfish Immunol 61:194–200. doi: 10.1016/j.fsi.2017.01.001 1081 Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. 1082 EMBnet.journal 17:10. doi: 10.14806/ej.17.1.200 1083 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 42 McKnight DT, Huerlimann R, Bower DS, Schwarzkopf L, Alford RA, Zenger KR (2019) 1084 microDecon: A highly accurate read -subtraction tool for the post -sequencing removal of 1085 contamination in metabarcoding studies. Environ DNA 1:14–25. doi: 10.1002/edn3.11 1086 McMurdie PJ, Holmes S (2013) Phyloseq: An R Package for Reproducible Interactive Analysis 1087 and Graphics of Microbiome Census Data. PLoS One. doi: 10.1371/journal.pone.0061217 1088 Mesnil A, Jacquot M, Garcia C, Tourbiez D, Canier L, Dégremont L, Cheslett D, Geary M, 1089 Vetri A, Roque A, Furones D, Garden A, Orozova P, Arzul I, Sicard M, Destoumieux -1090 Garzón D, Travers M -A (2022) Emergence and clonal expansion of Vibrio aestuarianus 1091 lineages pathogenic for oystersin Europe. Mol Ecol 32:2896 –2883. doi: 1092 10.1111/mec.16910 1093 Montagnani C, Morga B, Novoa B, Gourbal B, Saco A, Rey M, Bourhis M, Riera F, Vignal E, 1094 Corporeau C, Charrière GM, Travers M -A, Degrémont L, Gueguen Y, Cosseau C, 1095 Figueras A (2024) Trained immunity: perspectives for disease control strategy in marine 1096 mollusc aquaculture. Rev Aquac 1–34. doi: 10.1111/raq.12906 1097 Muñoz-Cerro K, González R, Mercado A, Lira G, Rojas R, Yáñez C, Cuadros F, Oyanedel D, 1098 Brokordt K, Schmitt P (2024) Scallop larvae resistant to a pathogenic Vibrio harbor host-1099 associated bacteria with probiotic potential. Aquaculture. doi: 1100 10.1016/j.aquaculture.2023.740217 1101 Offret C, Rochard V, Laguerre H, Mounier J, Huchette S, Brillet B, Le Chevalier P, Fleury Y 1102 (2018) Protective Efficacy of a Pseudoalteromonas Strain in European Abalone, Haliotis 1103 tuberculata, Infected with Vibrio harveyi ORM4. Probiotics Antimicrob Proteins 11:239–1104 247. doi: 10.1007/s12602-018-9389-8 1105 Oksanen J, Simpson GL, Blanchet FG, Kindt R, Legendre P, Minchin PR, O’Hara RB, Solymos 1106 P, Stevens MHH, Szoecs E, Wagner H, Barbour M, Bedward M, Bolker B, Borcard D, 1107 Carvalho G, Chirico M, Caceres M De, Durand S, Evangelista HBA, FitzJohn R, Friendly 1108 M, Furneaux B, Hannigan G, Hill MO, Lahti L, McGlinn D, Ouellette M -H, Cunha ER, 1109 Smith T, Stier A, Braak CJF Ter, Weedon J (2022) vegan: Community Ecology Package 1110 version 2.6-2. The Comprehensive R Archive Network 1111 Padeniya U, Larson ET, Septriani S, Pataueg A, Kafui AR, Hasan E, Mmaduakonam OS, Kim 1112 G Do, Kiddane AT, Brown CL (2022) Probiotic Treatment Enhances Pre -feeding Larval 1113 Development and Early Survival in Zebrafish Danio rerio. J Aquat Anim Health 34:3–11. 1114 doi: 10.1002/aah.10148 1115 Paul-Pont I, Dhand NK, Whittington RJ (2013) Spatial distribution of mortality in Pacific 1116 oysters Crassostrea gigas: Reflection on mechanisms of OsHV-1 transmission. Dis Aquat 1117 Organ 105:127–138. doi: 10.3354/dao02615 1118 Pernet F, Barret J, Le Gall P, Corporeau C, Dégremont L, Lagarde F, Pépin JF, Keck N (2012) 1119 Mass mortalities of Pacific oysters Crassostrea gigas reflect infectious diseases and vary 1120 with farming practices in the Mediterranean Thau lagoon, France. Aquac Environ Interact 1121 2:215–237. doi: 10.3354/aei00041 1122 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 43 Petton B, Pernet F, Robert R, Boudry P (2013) Temperature influence on pathogen transmission 1123 and subsequent mortalities in juvenile pacific oysters Crassostrea gigas. Aquac Environ 1124 Interact 3:257–273. doi: 10.3354/aei00070 1125 Petton B, Boudry P, Alunno -Bruscia M, Pernet F (2015) Factors influencing disease -induced 1126 mortality of Pacific oysters Crassostrea gigas. Aquac Environ Interact 6:205 –222. doi: 1127 10.3354/aei00125 1128 Petton B, Destoumieux -Garzón D, Pernet F, Toulza E, de Lorgeril J, Degrémont L, Mitta G 1129 (2021) The Pacific Oyster Mortality Syndrome, a Polymicrobial and Multifactorial 1130 Disease: State of Knowledge and Future Directions. Front Immunol. doi: 1131 10.3389/fimmu.2021.630343 1132 Pham D, Ansquer D, Chevalier A, Dauga C, Peyramale A, Wabete N, Labreuche Y (2014) 1133 Selection and characterization of potential probiotic bacteria for Litopenaeus stylirostris 1134 shrimp hatcheries in New Caledonia. Aquaculture 432:475 –482. doi: 1135 10.1016/j.aquaculture.2014.04.031 1136 R Core Team (2022) A language and environment for statistical computing. R Found Stat 1137 Comput 10:11–18. 1138 Reda RM, Selim KM (2015) Evaluation of Bacillus amyloliquefaciens on the growth 1139 performance, intestinal morphology, hematology and body composition of Nile tilapia, 1140 Oreochromis niloticus. Aquac Int 23:203–217. doi: 10.1007/s10499-014-9809-z 1141 Rengpipat S, Rukpratanporn S, Piyatiratitivorakul S, Menasaveta P (2000) Immunity 1142 enhancement in black tiger shrimp (Penaeus monodon) by a probiont bacterium (Bacillus 1143 S11). Aquaculture 191:271–288. doi: 10.1016/S0044-8486(00)00440-3 1144 Renz H, Holt PG, Inouye M, Logan AC, Prescott SL, Sly PD (2017) An exposome perspective: 1145 Early-life events and immune development in a changing world. J Allergy Clin Immunol 1146 140:24–40. doi: 10.1016/j.jaci.2017.05.015 1147 Rognes T, Flouri T, Nichols B, Quince C, Mahé F (2016) VSEARCH: A versatile open source 1148 tool for metagenomics. PeerJ. doi: 10.7717/peerj.2584 1149 Saulnier D, De Decker S, Haffner P (2009) Real -time PCR assay for rapid detection and 1150 quantification of Vibrio aestuarianus in oyster and seawater: A useful tool for 1151 epidemiologic studies. J Microbiol Methods 77:191 –197. doi: 1152 10.1016/j.mimet.2009.01.021 1153 Schikorski D, Faury N, Pepin J -F, Saulnier D, Tourbiez D, Renault T (2011) Experimental 1154 ostreid herpesvirus 1 infection of the Pacific oyster Crassostrea gigas: Kinetics of virus 1155 DNA detection by q -PCR in seawater and in oyster samples. Virus Res 155:28 –34. doi: 1156 10.1016/j.virusres.2010.07.031 1157 Segarra A, Pépin JF, Arzul I, Morga B, Faury N, Renault T (2010) Detection and description 1158 of a particular Ostreid herpesvirus 1 genotype associated with massive mortality outbreaks 1159 of Pacific oysters, Crassostrea gigas , in France in 2008. Virus Res 153:92 –99. doi: 1160 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 44 10.1016/J.VIRUSRES.2010.07.011 1161 Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower C (2011) 1162 Metagenomic biomarker discovery and explanation. Genome Biol 12:R60. doi: 1163 10.1186/gb-2011-12-6-r60 1164 Shimahara Y, Kurita J, Kiryu I, Nishioka T, Yuasa K, Kawana M, Kamaishi T, Oseko N (2012) 1165 Surveillance of Type 1 Ostreid Herpesvirus (OsHV -1) Variants in Japan. Fish Pathol 1166 47:129–136. doi: 10.3147/jsfp.47.129 1167 Sommer F, Bäckhed F (2013) The gut microbiota-masters of host development and physiology. 1168 Nat Rev Microbiol 11:227–238. doi: 10.1038/nrmicro2974 1169 Sun YZ, Yang HL, Huang KP, Ye JD, Zhang CX (2013) Application of autochthonous Bacillus 1170 bioencapsulated in copepod to grouper Epinephelus coioides larvae. Aquaculture 392 –1171 395:44–50. doi: 10.1016/j.aquaculture.2013.01.037 1172 Swain SM, Singh C, Arul V (2009) Inhibitory activity of probiotics Streptococcus phocae PI80 1173 and Enterococcus faecium MC13 against Vibriosis in shrimp Penaeus monodon. World J 1174 Microbiol Biotechnol 25:697–703. doi: 10.1007/s11274-008-9939-4 1175 Takyi E, LaPorte J, Sohn S, Stevick RJ, Witkop EM, Gregg LS, Chesler‐Poole A, Small J, 1176 White MM, Giray C, Rowley DC, Nelson DR, Gomez‐Chiarri M (2023) Development and 1177 evaluation of a formulation of probiont Phaeobacter inhibens S4 for the management of 1178 vibriosis in bivalve hatcheries. Aquac Fish Fish 3:256–267. doi: 10.1002/aff2.112 1179 Takyi E, Stevick RJ, Witkop EM, Gregg L, Chesler‐Poole A, Small JM, White MM, Hudson 1180 R, Giray C, Rowley DC, Nelson DR, Gomez -Chiarri M (2024) Probiotic treatment 1181 modulates the bacterial microbiome of larval eastern oysters, Crassostrea virginica, in 1182 hatcheries. Aquaculture. doi: 10.1016/j.aquaculture.2024.740624 1183 Tan LTH, Chan KG, Lee LH, Goh BH (2016) Streptomyces bacteria as potential probiotics in 1184 aquaculture. Front Microbiol 7:1–8. doi: 10.3389/fmicb.2016.00079 1185 Tirapé A, Bacque C, Brizard R, Vandenbulcke F, Boulo V (2007) Expression of immune -1186 related genes in the oyster Crassostrea gigas during ontogenesis. Dev Comp Immunol 1187 31:859–873. doi: 10.1016/j.dci.2007.01.005 1188 Touraki M, Karamanlidou G, Karavida P, Chrysi K (2012) Evaluation of the probiotics Bacillus 1189 subtilis and Lactobacillus plantarum bioencapsulated in Artemia nauplii against vibriosis 1190 in European sea bass larvae ( Dicentrarchus labrax, L.). World J Microbiol Biotechnol 1191 28:2425–2433. doi: 10.1007/s11274-012-1052-z 1192 Villumsen KR, Sandvang D, Vestergård G, Olsen MSR, Juul J, Dencker M, Kudsk J, Poulsen 1193 LL (2023) Effects of a novel, non -invasive pre-hatch application of probiotic for broilers 1194 on development of cecum microbiota and production performance. Anim Microbiome. 1195 doi: 10.1186/s42523-023-00263-7 1196 Wang G, Wang X, Ma Y, Cai S, Yang L, Fan Y, Zeng X, Qiao S (2022) Lactobacillus reuteri 1197 improves the development and maturation of fecal microbiota in piglets through mother -1198 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint 45 to-infant microbe and metabolite vertical transmission. Microbiome. doi: 10.1186/s40168-1199 022-01336-6 1200 Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naïve Bayesian classifier for rapid 1201 assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 1202 73:5261–5267. doi: 10.1128/AEM.00062-07 1203 Webb SC, Fidler A, Renault T (2007) Primers for PCR-based detection of ostreid herpes virus-1204 1 (OsHV-1): Application in a survey of New Zealand molluscs. Aquaculture 272:126 –1205 139. doi: 10.1016/j.aquaculture.2007.07.224 1206 Wen C, Xue M, Liang H, Zhou S (2014) Evaluating the potential of marine Bacteriovorax sp. 1207 DA5 as a biocontrol agent against vibriosis in Litopenaeus vannamei larvae. Vet Microbiol 1208 173:84–91. doi: 10.1016/j.vetmic.2014.07.022 1209 Wright RM, Aglyamova G V, Meyer E, Matz M V (2015) Gene expression associated with 1210 white syndromes in a reef building coral, Acropora hyacinthus . BMC Genomics. doi: 1211 10.1186/s12864-015-1540-2 1212 Yan F jun, Tian X li, Dong S lin, Fang Z heng, Yang G (2014) Growth performance, immune 1213 response, and disease resistance against Vibrio splendidus infection in juvenile sea 1214 cucumber Apostichopus japonicus fed a supplementary diet of the potential probiotic 1215 Paracoccus marcusii DB11. Aquaculture 420 –421:105–111. doi: 1216 10.1016/j.aquaculture.2013.10.045 1217 Yeh H, Skubel SA, Patel H, Cai Shi D, Bushek D, Chikindas ML (2020) From Farm to Fingers: 1218 an Exploration of Probiotics for Oysters, from Production to Human Consumption. 1219 Probiotics Antimicrob Proteins. doi: 10.1007/s12602-019-09629-3 1220 Yoon SH, Ha SM, Kwon S, Lim J, Kim Y, Seo H, Chun J (2017) Introducing EzBioCloud: A 1221 taxonomically united database of 16S rRNA gene sequences and whole -genome 1222 assemblies. Int J Syst Evol Microbiol 67:1613–1617. doi: 10.1099/ijsem.0.001755 1223 Zhang L, Mai K, Tan B, Ai Q, Qi C, Xu W, Zhang W, Liufu Z, Wang X, Ma H (2009) Effects 1224 of dietary administration of probiotic Halomonas sp. B12 on the intestinal microflora, 1225 immunological parameters, and midgut histological structure of shrimp, Fenneropenaeus 1226 chinensis. J World Aquac Soc 40:58–66. doi: 10.1111/j.1749-7345.2008.00235.x 1227 1228 .CC-BY 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted May 17, 2024. ; https://doi.org/10.1101/2024.05.17.594303doi: bioRxiv preprint