Characterization and in Silico analysis of outer membrane proteins in halophilic and halotolerant bacteria which isolated from Qarun Lake solar salterns

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-03 · read from full text

The study isolated 17 halophilic and halotolerant bacterial strains from solar saltern ponds of Qarun Lake, Fayoum, Egypt, sampling waters across different NaCl concentrations and using culture-based, biochemical (including Gram stain, motility, catalase), and salt-tolerance assays to classify the isolates. 16S rDNA sequencing and phylogenetic analysis grouped the strains into four clusters, with Firmicutes as the dominant phylum, and draft genome analysis plus in silico prediction of outer membrane proteins (OMPs) identified genes potentially related to adhesion, secretion, enzymatic activity, and membrane transport. A stated limitation is that some predicted protein functions remained uncharacterized, and the work is presented as a preprint that has not been peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract This study included the isolation and characterization of halophilic and halotolerant bacteria from the solar salterns of Qarun Lake, Fayoum, Egypt. A total of seventeen bacterial strains were isolated, of which fifteen were identified as halophilic and two as halotolerant, based on their salt growth requirements. Phylogenetic analysis revealed that the isolates clustered into four distinct groups, with members of the phylum Firmicutes representing the dominant group (47.06%). Biochemical characterization indicated that 52.94% of the isolates were Gram-negative, and all exhibited motility and catalase activity. Salt tolerance assays confirmed that two isolates could grow without added salt, while the remaining strains required salt for growth, supporting their classification as halotolerant and halophilic, respectively. Notably, 70.59% of the isolates were classified as extremely halophilic. Based on 16S rDNA sequence analysis, the closest related strains were identified from GenBank, and the functional potential of their outer membrane proteins (OMPs) was predicted. Draft genome analysis of 88.24% of the isolates revealed the presence of genes encoding various functional proteins, including those involved in adhesion, secretion, enzymatic activity, and membrane transport, although some protein functions remain uncharacterized. This study contributes to the understanding of halophilic microbial diversity in Egyptian hypersaline environments and provides insights into their potential functional roles. Future research will aim to explore their biotechnological applications and ecological significance.
Full text 151,450 characters · extracted from preprint-html · click to expand
Characterization and in Silico analysis of outer membrane proteins in halophilic and halotolerant bacteria which isolated from Qarun Lake solar salterns | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Characterization and in Silico analysis of outer membrane proteins in halophilic and halotolerant bacteria which isolated from Qarun Lake solar salterns Ahmed Ahmed Abdelmonaem Mousa, Ahmed Fouad Roumia, Adel Elsayed Elbeltagy This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7308332/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study included the isolation and characterization of halophilic and halotolerant bacteria from the solar salterns of Qarun Lake, Fayoum, Egypt. A total of seventeen bacterial strains were isolated, of which fifteen were identified as halophilic and two as halotolerant, based on their salt growth requirements. Phylogenetic analysis revealed that the isolates clustered into four distinct groups, with members of the phylum Firmicutes representing the dominant group (47.06%). Biochemical characterization indicated that 52.94% of the isolates were Gram-negative, and all exhibited motility and catalase activity. Salt tolerance assays confirmed that two isolates could grow without added salt, while the remaining strains required salt for growth, supporting their classification as halotolerant and halophilic, respectively. Notably, 70.59% of the isolates were classified as extremely halophilic. Based on 16S rDNA sequence analysis, the closest related strains were identified from GenBank, and the functional potential of their outer membrane proteins (OMPs) was predicted. Draft genome analysis of 88.24% of the isolates revealed the presence of genes encoding various functional proteins, including those involved in adhesion, secretion, enzymatic activity, and membrane transport, although some protein functions remain uncharacterized. This study contributes to the understanding of halophilic microbial diversity in Egyptian hypersaline environments and provides insights into their potential functional roles. Future research will aim to explore their biotechnological applications and ecological significance. Biological sciences/Computational biology and bioinformatics Biological sciences/Microbiology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Hypersaline ecosystems are habitats found in terrestrial lakes and deep-sea basins with salt concentrations exceeding three times that of seawater. They are divided into thalassohaline and athalassohaline waters ‎ [1]. Solar salterns, either naturally occurring or man-made, are common in arid and semi-arid regions [‎2] . Qarun Lake, located in northern Fayoum Governorate, is saline, turbid, and has no surface outflow 3 . The area features a multi-pond system used for salt and mineral production. Halophiles are salt-loving microorganisms found across all three domains of life: Archaea, Bacteria, and Eukarya [‎3]. Historically used for salt and fermentation, these microbes are now known for producing antibiotics, enzymes, pigments, ectoine, polysaccharides, biosurfactants, and bioplastics. They also have applications in mining and nanotechnology [‎4] . The applications of halophilic microorganisms include: ( 1 ) traditional processes like solar salt production and fermentation that have existed for centuries, often without knowledge of the microorganisms involved, ( 2 ) utilizing the salt tolerance and enzymes of halophiles in high-salt environments, ( 3 ) exploiting compounds like ectoine that help withstand high salinity, and ( 4 ) industrial uses of compounds found in both halophiles and non-halophiles, with halophiles sometimes offering distinct advantages [‎5] . Bioinformatics serves as an essential computerized framework in molecular biology, providing valuable tools for analyzing and interpreting biological data [‎6] . It plays a significant role in genomics, facilitating genome sequencing, gene identification, phylogenetic analysis, and the detection of transcription factor binding sites, while also offering analytical capabilities for microarray data [‎7] . In proteomics, bioinformatics enhances the study of protein structures and identifies sites of protein-protein interactions [‎8] . The techniques utilized range from data extraction and visualization to noise reduction and clustering methods that highlight genes with similar behavior. This study aims to isolate, identify, and predict the outer membrane proteins (OMP) activity of a halophilic and halotolerant bacterial community found in the solar saltern ponds of Qarun Lake, Egypt, utilizing bioinformatics tools. Materials and methods Isolation and purification of halophilic bacteria from solar salterns water Collection sites In September 2019, water samples were collected from Local Company for Salts and Minerals at Qarun Lake in Fayoum. Four solar saltern ponds with varying salt (NaCl) concentrations were sampled, measuring 4.0%, 8.2%, 17.2%, and 24.2% NaCl, as determined using a rafractometer. Ten liters of water were collected from each pond in sterile plastic jars and placed in ice packs for transport to the Biotechnology Laboratory in the Botany Department at the Faculty of Agriculture, Menoufia University. The collected water samples were filtered to remove impurities, and their salt concentrations were analyzed using a rafractometer. The pH was measured with a pH meter before further use. Nutrient agar medium (NA) was sterilized by autoclaving at 15 lbs. pressure (121°C) for 20 minutes and was employed for bacterial isolation. To isolate bacteria from each pond, 100 µL of water samples from each concentration were spread or streaked onto nutrient agar plates. The plates were then incubated at 30°C for 7 to 30 days [‎9]. At the higher salt concentrations (17.2% and 24.2%), no colonies appeared on the nutrient agar plates. Consequently, a 100 µL water sample from these high-salinity ponds was added to 200 mL of nutrient broth medium (NB) for enrichment, which was then shaken for 72 hours at 130 rpm at room temperature (28°C). Cultural, morphological and physiological characterization of the isolates Bacterial colonies began to appear after 7 to 30 days. Colonies exhibiting distinct morphological characteristics were selected and purified by sub-culturing three times on NA medium supplemented with pond water at different salt concentrations. Pure colonies were then transferred to slant agar for further use. Each sample was assigned an isolate designation based on its collection site (QSLA for Qarun Salt Lake Local), with each isolate receiving a unique number. The morphological characteristics of the isolated colonies were examined, including shape, pigmentation, elevation, and optical properties. Additionally, cellular morphology was assessed through shape, Gram staining, and endospore formation [‎10]. Motility was tested using the hanging drop method [‎11] , and catalase activity was evaluated [‎12] . The bacterial isolates were also screened for halotolerance using NA medium supplemented with varying levels of NaCl (0%, 7%, 12.5%, 20%, and 22%). The plates were incubated for 7 days at 30°C, and growth was recorded [‎13]. Molecular identification of the isolates and phylogeny DNA extraction and polymerase chain reaction (PCR) Genomic DNA was extracted from bacterial cells cultured aerobically in nutrient broth [‎14] . The extracted DNA was subsequently visualized under ultraviolet light following staining with ethidium bromide [‎15] and was preserved at -20°C until use [‎16] . For the amplification of nearly full-length 16S rRNA gene sequences, bacterial primers 27F and 1492R ( Table, 1 ) were employed using a model PTC-100 thermal cycler (MJ Research Inc., USA). The PCR reaction mixture consisted of a total volume of 40 µl and included: 0.25 µl of genescript Taq polymerase, 1.0 µl (5 pmol) of the 27F forward primer, 1.0 µl (5 pmol) of the 1492R reverse primer, 1 µl of template DNA, 2.5 µl of dNTPs mix (2.5 mM), 4.0 µl of 10x PCR buffer (genescript), and 30.25 µl of PCR-grade water. The PCR cycling conditions comprised an initial enzyme activation step at 94°C for 5 minutes, followed by 35 cycles that included a denaturation step at 94°C for 45 seconds, a primer annealing step at 53°C for 60 seconds, and a chain elongation step at 72°C for 2 minutes. A final extension was carried out at 72°C for 5 minutes [‎17] . The presence of amplified products was verified by applying 7 µl of the PCR product onto a 1% agarose gel in 1X TAE buffer containing ethidium bromide. Visualization was accomplished using a Gel Documentation System (Bio-Rad Laboratories) [‎15] . The PCR products were then purified according to the QIAquick PCR Purification Kit protocol (Qiagen) and sent for sequencing. 16S rRNA sequencing Sequencing was performed by Colors Laboratories, located at El-Etihad Square, Maadi, Cairo, Egypt, utilizing the universal bacterial primers 27F and 1492R as specified in Table 1 , in accordance with the laboratory's protocols. The resultant sequences were edited to remove all gaps using the Complete Deletion option with the CHROMAS PRO software, version 1.5. Table (1), Primers used for PCR 16s rRNA sequencing analysis [‎18]. Primer name Orientation Priming site Sequence (5´- 3´) 27F Forward 8–27 AGAGTTTGATCCTGGCTCAG 1492R Reverse 1492–1513 GGTTACCTTGTTACGACTT Evolutionary relationships of Taxa The 16S rRNA gene sequences were compared with those published in the GenBank databases utilizing the Basic Local Alignment Search Tool (BLAST), accessible through the National Center for Biotechnology Information (NCBI) website ( http://www.ncbi.nih.gov ). The alignment was conducted using CLUSTAL W version 1.6 software [‎19] . The evolutionary history was inferred employing the Neighbor-Joining method [‎20] . This analysis incorporated a total of 48 nucleotide sequences. All ambiguous positions were eliminated for each sequence pair through the pairwise deletion option, resulting in a final dataset comprising 1,619 positions. The evolutionary analyses were performed using MEGA X software [‎21]. Bioinformatics and predicting the existence of bioactive compounds The 16S rDNA sequences of the isolated strains were subjected to a search for homologous bacteria against the GenBank database utilizing BlastN [‎19]. The highest hits obtained from the BlastN search facilitated the download of non-redundant proteomes from UniProt (version 2021_04) [‎22] . Following this, the OMPdb pHMMs library was downloaded [‎23] and processed against the retrieved proteomes using the hmmscan tool from HMMER (version 3.3.2) [‎24] (Fig. 1) . Results and discussion Isolation and purification of halophilic bacteria from solar salterns water Halophilic and halo-tolerant bacteria were successfully isolated from water samples taken from four distinct ponds with varying salt concentrations. These ponds, part of Qarun Lake, are utilized by a local company for salt production. In total, we isolated 17 halophilic bacterial strains on nutrient agar (NA) medium, which was expertly prepared using saline water from the respective ponds rather than distilled water. The distribution of the isolated bacteria is impressive: two strains (11.76%) were obtained from the first pond (salinity 4%), five strains (29.41%) from the second pond (salinity 8.2%), seven strains (41.18%) from the third pond (salinity 17.2%), and three strains (17.65%) from the fourth pond (salinity 24.2%) (Fig. 2 & Table, 3) . This clearly demonstrates the rich diversity of halophilic bacteria present in these environments. Subsequent to the isolation process, the isolates underwent purification through several streaking techniques on nutrient agar (NA) plates, resulting in pure isolates designated as QSLA1 to QSLA17, which were utilized for further studies. The successful isolation of 361 halobacterial strains was reported from three basins of Lake Meyghan [‎1] , each featuring different salinities: the green brine with approximately 50 g/L salinity, the red brine at approximately 180 g/L salinity, and white brine near 300 g/L salinity. In the low salinity pond, the majority of isolates were identified as bacteria, with 31 out of 35 yielding bacterial strains. The predominant group among these was Proteobacteria, which included 20 Gammaproteobacteria (e.g., Idiomarina sp. and Halomonas sp.) and 3 Alphaproteobacteria. Additionally, the phyla represented included Actinobacteria (3), Bacteroidetes (4), and Firmicutes (1). From the medium-salinity pond, a total of 16 bacteria were isolated, of these, 9 belonged to the Firmicutes (for example, Bacillus sp. and Thalassobacillus sp.), along with 5 Gammaproteobacteria and 2 Actinobacteria. It is noteworthy that Bacteroidetes and Alphaproteobacteria were not among the isolates from the medium-salinity pond. In the highest salinity pond, 10 bacterial isolates were obtained, comprising 6 Gammaproteobacteria, 3 Firmicutes, and 1 Alphaproteobacteria. Cultural, morphological and physiological characterization of the isolates The morphological, colonial, and biochemical characterizations, which are vital for the partial identification of microorganisms, were comprehensively conducted [‎25] . Colony morphology All colonies exhibited a shiny appearance. Among the isolates, 14 colonies were characterized by a round shape, while 3 exhibited irregular shapes. Specifically, four colonies displayed lobate edges, eight colonies had ragged edges, and five colonies were characterized by entire edges. Thirteen of the colonies appeared translucent, whereas four were opaque. In terms of elevation, eleven colonies were flat, while six colonies were raised. The size of the colonies varied, with six being pinpoint, nine classified as small, and two categorized as large. Regarding coloration, five colonies were creamy, five were yellow, three were white, two were orange, one was brown, and one was pink upon nutrient agar medium containing 12.5% NaCl (Table, 2). Cell characteristics The examination of simple and Gram-stained cells derived from pure colonies, conducted with a light microscope [‎26] , indicated that all isolates exhibited a rod shape. The results of the Gram staining revealed that, out of 17 isolates, 9 (52.94%) were classified as Gram-negative, 6 (35.29%) as Gram-positive, and 2 (11.76%) as Gram-variable (Fig. 3) . All strains demonstrated motility when evaluated using the hanging drop method. Additionally, the process of pasteurizing pure cultures indicated that ten isolates (58.8%) were capable of forming spores. Furthermore, all isolates were confirmed as catalase producers when subjected to hydrogen peroxide (H₂O₂) testing (Table, 3) . Ghozlan et al. (2006) moderately halophilic bacteria were isolated from solar salterns, coastal salt marshes, and salt lakes located in Alexandria, Egypt. The findings revealed that among the isolates, 76 were classified as Gram-negative, while 14 were classified as Gram-positive [‎27] . Salinity tolerance assay In the assessment of halo-tolerance, the isolates exhibited varying degrees of tolerance to different concentrations of NaCl: 0%, 7%, 12.5%, 20%, and 22%. All isolates successfully grew in nutrient agar (NA) medium at a salt concentration of 12.5% NaCl. However, growth at a concentration of 20% NaCl was limited to nine isolates (52.94%), specifically QSLA1, QSLA2, QSLA4, QSLA6, QSLA8, QSLA9, QSLA10, QSLA11, and QSLA13. Thirteen isolates (76.47%) demonstrated growth in NA medium with a 7% NaCl concentration. When subjected to a NaCl concentration of 22%, only three isolates (17.65%) - QSLA2, QSLA11, and QSLA13 - showed viability. In contrast, two isolates (11.76%), QSLA15 and QSLA17, were capable of growth in NA medium with no NaCl (0% NaCl) present (Fig. 4 and Table 4) . Table (4), Salinity tolerance assay of isolates on NA plates with different NaCl concentrations. Isolates NaCl concentration (%) Zero 7 12.5 20 22 QSLA1 – + + + – QSLA2 – + + + + QSLA3 – + + – – QSLA4 – – + + – QSLA5 – + + – – QSLA6 – + + + – QSLA7 – + + – – QSLA8 – – + + – QSLA9 – – + + – QSLA10 – + + + – QSLA11 – + + + + QSLA12 – + + – – QSLA13 – + + + + QSLA14 – – + – – QSLA15 + + + – – QSLA16 – + + – – QSLA17 + + + – – Table (5): The blasted isolates and the nearest neighbors in the GenBank database and their % relatedness. Isolate Organism Closest strains in Genebank Identity (%) QSLA1 Halomonas Halomonas sp. RS-17 91.26 QSLA2 Halomonas Halomonas sp. strain LR2-3 96.43 QSLA3 Halomonas Halomonas sp. GQ30 97.33 QSLA4 Halobacillus Halobacillus sp. CNJ 812 PL04 96.45 QSLA5 Salinivibrio Salinivibrio sp. IB872 98.12 QSLA6 Salinivibrio Salinivibrio sp. ML288 95.24 QSLA7 Salinivibrio Salinivibrio sp. pr6 94.00 QSLA8 Bacteriodetes bacterium Bacteriodetes bacterium strain HT31.1 94.20 QSLA9 Thalassobacillus Thalassobacillus sp. strain JSM1684092 97.41 QSLA10 Oceanobacillus Oceanobacillus oncorhynchi strain E 98.11 QSLA11 Aliifodinibius Aliifodinibius sp. strain ZC14-2 91.48 QSLA12 Bacillus Bacillus sp. JSM 102029 82.35 QSLA13 Bacillus Bacillus strain AS4.2 86.98 QSLA14 Lentibacillus Lentibacillus sp.strain BCHS25 87.66 QSLA15 Virgibacillus Virgibacillus halodenitrificans strain yt08 87.21 QSLA16 Uncultured bacterium (Sphingomonas) Uncultured bacterium clone QAMU23. (Sphingomonas sp. LE-239) 80.15 (79.9) QSLA17 Bacillus Bacillus sp.strain6 74.05 Table (6) Accession numbers of submitted isolates sequences deposited in GenBank (NCBI). Isolate Organism Strain in Genebank Accession number QSLA1 Halomonas Halomonas sp. strain QSLA1 OP442496 QSLA2 Halomonas Halomonas sp. strain QSLA2 OP442497 QSLA3 Halomonas Halomonas sp. strain QSLA3 OP442498 QSLA4 Halobacillus Halobacillus sp. strain QSLA4 OP442514 QSLA5 Salinivibrio Salinivibrio sp. strain QSLA5 OP442934 QSLA8 Bacteroidetes bacterium Bacteroidetes bacterium strain QSLA8 OP442518 QSLA9 Thalassobacillus Thalassobacillus sp. strain QSLA9 OP442526 QSLA10 Oceanobacillus Oceanobacillus oncorhynchi strain QSLA10 OP443586 QSLA11 Aliifodinibius Aliifodinibius sp. strain QSLA11 OP494267 QSLA14 Lentibacillus Lentibacillus sp. strain QSLA14 OP443587 QSLA15 Virgibacillus Virgibacillus halodenitrificans strain QSLA15 OP442600 Table (7) Summary of identified bacterial ctrains with Corresponding BLASTN hits, proteome information, and outer membrane protein annotations Strain BlastN Highest hit Proteomes No. Proteins No. Outer membrane proteins QSLA1 Halomonas sp. 12 45471 534 QSLA2 Halomonas sp. 1 2875 480 QSLA3 Halomonas sp. 3 10096 614 QSLA4 Halobacillus sp. 17 67629 659 QSLA5,6 Salinivibrio sp. 7 21763 335 QSLA7 Salinivibrio sp. 1 3161 197 QSLA9 Thalassobacilus sp. 1 4309 0 QSLA10 Oceanobacillus oncorhynchi 1 4386 0 QSLA12,13 Bacillus sp. 52 215838 5956 QSLA14 Lentibacillus sp. 2 7359 0 QSLA15 Virgibacillus sp. 3 10829 0 QSLA16 Uncultured bacterium 82 281521 933 QSLA17 Bacillus sp. 1 2134 0 Halotolerant organisms are capable of growth in the absence of salt while exhibiting tolerance to varying concentrations of salt, specifically between 0% and 5% NaCl [‎28] . They are classified as extremely halotolerant when their tolerance extends above 15% (2.5 M) NaCl [‎29] . In contrast, slight halophiles, which are typically marine bacteria, exhibit optimal growth at salt concentrations ranging from 0.2 to 0.5 M NaCl (1–3% NaCl). Moderate halophiles thrive in environments with 0.5 to 2.5 M NaCl (3–15% NaCl), while extreme halophiles are most successful in medium containing 2.5 to 5.2 M (saturated) NaCl (15–30% NaCl) [‎30] . This study identified two isolates, QSLA15 and QSLA17, which account for 11.7% of the total isolates, as halotolerant, as they demonstrated the ability to grow in both the absence and presence of NaCl. Conversely, the remaining 15 isolates (88.23%) were unable to grow in the absence of NaCl and instead thrived optimally in medium with salt concentrations ranging from 7–22% NaCl. Among these isolates, six (35.29%) - namely QSLA3, QSLA5, QSLA7, QSLA12, QSLA14, and QSLA16 - were able to grow in NA medium containing 7% and 12.5% NaCl, categorizing them as moderately halophilic. The remaining nine isolates (52.94%), specifically QSLA1, QSLA2, QSLA4, QSLA6, QSLA8, QSLA9, QSLA10, QSLA11, and QSLA13, were classified as extremely halophilic, as they thrived in NA medium with a 20% NaCl concentration (Fig. 4) . Notably, strains QSLA8 and QSLA16 were isolated from a saline water pond with a salt concentration of 24.2%. While QSLA8 could grow in NA medium prepared with distilled water and 20% NaCl, QSLA16 could not. Furthermore, both strains were incapable of growth in NA medium prepared with distilled water and 22% NaCl. It was indicated that the NaCl requirement of these organisms has been well documented, and sodium chloride cannot be substituted with other salts. Additionally, potassium is essential for optimal growth and pigmentation, and magnesium is also a critical factor. In instances where magnesium is present at lower concentrations, the organisms tend to adopt a spherical shape but revert to their typical rod morphology when returned to media with the original magnesium concentration [‎31] . An addition of 10 ppm of Fe 2+ significantly enhances cell yield, while small amounts of manganese (0.05 ppm) can stimulate growth and pigmentation. It follows that the inability of isolate QSLA16 to grow on NA medium utilizing distilled water and high NaCl concentrations (20%) may be attributed to the deficiency of other essential elements such as potassium, magnesium, iron, and manganese, all of which are vital for optimal growth conditions [‎32] . Bacteria from hypersaline environments, such as solar salterns, are well adapted to high salt concentration [‎33]. Isolates from saline regions in Karnataka thrived in salt concentrations from 5–25% [‎34] . Forty-six halobacterial strains were isolated from Sambhar Lake, all of which were tolerant to 10% NaCl, and forty-four to 15%. Out of ten selected cultures, three tolerated up to 25% salt [‎35] . Twenty-eight moderately halophilic bacteria were isolated from salterns in Tamil Nadu, Kerala, and Goa, India. Most isolates grew well on halophilic medium with 5% NaCl, with twenty-one showing heavy growth at 10–15% salt. The maximum tolerable salt concentration (MTSC) results indicated that one isolate grew optimally at 5% NaCl (slight halophiles), four tolerated 10%, seventeen grew at 15%, and six thrived at 20% NaCl, with some being halo-tolerant [‎36] . Molecular identification of the isolates In addition to the morphological and biochemical characterization of the isolates, sequencing and analysis of the 16S rDNA gene were conducted. The resulting sequences were compared with those available in the NCBI BLAST database. The analysis of the 16S rRNA gene revealed the following relationships among the isolates: QSLA1 exhibited the closest similarity (91.26%) to Halomonas sp. strain RS-17. QSLA2 demonstrated 96.6% similarity to Halomonas sp. strain LR2-3. QSLA3 was identified as Halomonas sp. GQ30, showing 97.33% similarity. QSLA4 displayed 96.45% similarity to Halobacillus sp. CNJ 812 PL04. QSLA5 shared 98.12% similarity with Salinivibrio sp. IB872. QSLA6 exhibited 95.24% similarity to Salinivibrio sp. ML288. QSLA7 had a similarity of 94% to Salinivibrio sp. pr6. QSLA8 was identified as a Bacteroidetes bacterium strain HT31.1, with 94.69% similarity. QSLA9 shared the highest similarity (97.41%) with Thalassobacillus sp. strain JSM1684092. QSLA10 showed 98.11% similarity to Oceanobacillus oncorhynchi strain E. QSLA11 exhibited 92.11% similarity to Aliifodinibius sp. strain ZC14-2. QSLA12 was most closely related to Bacillus sp. JSM 102029, with an 82.35% similarity. QSLA13 was identified as Bacillus strain AS4.2, showing 86.98% similarity. QSLA14 displayed 87.66% similarity to Lentibacillus sp. strain BCHS25. QSLA15 exhibited 87.21% similarity to Virgibacillus halodenitrificans strain yt08. QSLA16 was identified as an uncultured bacterium clone QAMU23 and/or Sphingomonas sp. LE-239, with similarities of 80.15% and 79.9%, respectively. QSLA17 was most closely related to Bacillus sp. strain 6, showing 74.05% similarity (Table 5) . Twenty-eight moderately halophilic bacteria were isolated from three salterns situated in Tamil Nadu, Kerala, and Goa, India. Among these isolates, nine demonstrated 97–99% similarity to the genus Bacillus, while one isolate exhibited a similarity of 98% to Oceanobacillus . Furthermore, twelve isolates showed 96–99% similarity to the genus Staphylococcus, two isolates were classified as Pseudomonas with 98% similarity, one isolate was closely associated with the genus Enterobacter at 98% similarity, and three isolates were related to Enterobacter , Ochrabactrum , and Stenotrophomonas , with similarities of 98%, 98%, and 96%, respectively [‎36] . In a parallel study, 74 halophilic bacteria were successfully isolated from Sebkha and Chott saline lake ecosystems, situated in arid and semi-arid ecoclimatic zones of Algeria. Out of these, 16 isolates were identified as being closely related to Halomonas , 18 to Bacillus , 7 to Oceanobacillus , 5 to Virgibacillus , 10 to Halobacillus , and 2 to Thalassobacillus . Notably, one isolate exhibited a 99–100% similarity to Lentibacillus [‎37]. Sequence deposition in GenBank (NCBI) of isolated halophilic bacteria In the current study, eleven sequences from the isolated halophilic bacteria were deposited in the NCBI GenBank, accompanied by their respective accession numbers as detailed in Table 6. The remaining six isolates, which presented low or no similarity to existing sequences in GenBank, were excluded from deposition in the database. Previous investigations have also reported similar bacterial communities in solar salterns and other saline environments. 231 moderately halophilic bacteria and 49 extremely halophilic microorganisms were isolated from various regions of the Howz Soltan playa, a hypersaline lake within the central desert zone of Iran [‎29] . These isolates were identified as belonging to genera such as Salicola , Halovibrio , Halomonas , Bacillus , Oceanobacillus , Thalassobacillus , Virgibacillus , Gracilibacillus , Halobacillus , Piscibacillus , and Salinicoccus . Additionally, species from the genera were isolated Halobacillus , Halomonas , Thalassobacillus , Brevibacterium , and Bacillus from the saline mine soil in Karak, Pakistan [‎38] . Phylogenetic affiliation of bacterial isolates The sequences obtained from the isolated bacterial strains were aligned using the Clustal W program and subsequently compared with sequences available in GenBank. The resulting data were utilized to construct a phylogenetic tree. The findings of the sequencing analysis, along with the closest phylogenetic affiliations of the bacterial isolates, are presented in Table 5 . Our investigation yielded phylogenetically diverse halophilic bacteria, comprising both Gram-negative (G-) and Gram-positive (G+) strains, sourced from four ponds characterized by varying salt concentrations within Qarun Lake. The sequences of these isolates were classified into four principal groups: 8 strains (47.06% of the total isolates) were categorized under Firmicutes, 6 strains (35.29% of the total isolates) under Gammaproteobacteria, 1 strain (5.88% of the total isolates) under Alphaproteobacteria, and 2 strains (11.76% of the total isolates) under the Bacteroidetes group (Figs. 5 and 6) . The Firmicutes group is comprised of three families: Bacillaceae, Planococcaceae, and Staphylococcaceae. Notably, all eight strains are classified within the Bacillaceae family, which includes six distinct genera: Bacillus , Halobacillus , Lentibacillus , Oceanobacillus , Thalassobacillus , and Virgibacillus . The Gammaproteobacteria contains several groups of significant medical and scientific importance, including the families Halomonadaceae, Vibrionaceae, and Pseudomonadaceae. The Alphaproteobacteria encompasses various families, such as Sphingomonadaceae. The phylogenetic relationships of the isolated strains are depicted separately in Fig. 6 . The alignment of our isolates with these recognized halophilic bacteria in GenBank further substantiates the halophilic characteristics of the strains examined. The analysis indicates that Firmicutes constitutes the predominant group, encompassing various Gram-positive genera, particularly Bacillus , which comprises 37.5% of the total. This is followed by Halobacillus , Oceanobacillus , Thalassobacillus , Lentibacillus , and Virgibacillus , each representing 12.5%. The class Gamma-proteo-bacteria is represented by two families: Halomonadaceae and Vibrionaceae. Within these, 50% of the strains are affiliated with the genus Halomonas , while the other 50% correspond to Salinivibrio . Furthermore, the groups Alphaproteobacteria and Bacteroidetes are represented by the genera Sphingomonas (family Sphingomonadaceae) and an unspecified Bacteroidetes bacterium, respectively. Similar bacterial communities associated with saline environments have been observed, where in both γ-Proteobacteria and Firmicutes emerge as the dominant groups among the total isolates 37 . Moderate halophilic strains were identified from solar salterns, with phylogenetic analysis revealing affiliations with five genera: Bacillus , Halobacillus , Planococcus , Salinicoccus , and Halomonas [‎39] . Performing taxonomic analyses on moderately halophilic bacteria isolated from hypersaline environments, such as solar salterns and salt lakes in Alexandria, Egypt, indicated that 85% of the overall isolates were Gram-negative, predominantly belonging to γ-Proteobacteria. Among these, five genera were identified: Pseudoalteromonas , Flavobacterium , Chromohalobacter , Halomonas , and Salegentibacter . Conversely, 15% of the isolates were Gram-positive, classified under the genera Halobacillus , Salinicoccus , Staphylococcus , and Tetragenococcus [‎27] . In addition, several salt lakes in Romania, exhibiting salinities exceeding 70 g/L, were found to host bacteria across three phyla: Firmicutes, Proteobacteria, and Actinobacteria. Within the phylum Firmicutes, the genera Bacillus , Virgibacillus , Salinococcus , Marinococcus , Halobacillus , Planococcus , Thalassobacillus , and Salimicrobium were documented. In the phylum Proteobacteria, Halomonas emerged as the most representative genus, with Vibrio , Idiomarina , and Psychrobacter also identified. In the Actinobacteria phylum, Nocardiopsis was noted as the predominant genus [‎40]. An aerobic, Gram-negative, yellow-pigmented strain, referenced as KMM 3882, was isolated from the marine bivalve Anadara broughtoni , collected from Peter the Great Bay in the Sea of Japan. Strain KMM 3882 exhibited significant inhibitory activity against several Gram-positive microorganisms. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain KMM 3882 shares the highest similarity (97.3%) with Sphingomonas dokdonensis DS-4, further similarities ranging from 96.5–96.7% were observed with Sphingomonas pituitosa DSM 13101, Sphingomonas azotifigens NBRC 15497, Sphingomonas asaccharolytica NBRC 15499, Sphingomonas trueperi DSM 7225, and Sphingomonas panni DSM 15761. Consequently, it has been classified as a novel species within the genus Sphingomonas , proposed under the name Sphingomonas molluscorum sp. nov. [‎41]. Sphingomonas japonica sp. nov. represents a novel halo-bacterial strain that was isolated from a marine crustacean specimen sourced from the Sea of Japan [‎42]. The strain underwent a comprehensive polyphasic study. Comparative analysis of the 16S rRNA gene sequences positioned this novel strain within the genus Sphingomonas , demonstrating 96.1% similarity to S. trueperi , Sphingomonas dokdonensis DS-4, and S . azotifigens NBRC LMG 2142. In the current study, we successfully isolated halo-bacteria from various phyla, including Firmicutes, Gammaproteobacteria, Bacteroidetes, and Alphaproteobacteria. In contrast, the conducted research did not yield members from the Bacteroidetes phylum in the sediment of saline lake ecosystems known as “Sebkhas and Chotts” [‎37]. Prior investigations identified strains from genera such as Salinicoccus, Staphylococcus, Planococcus*, Pseudomonas, Chromohalobacter , and Nocardiopsis . However, in the present study, no strains from these genera were isolated. The variances noted in this investigation compared to previous reports may be ascribed to differences in culture conditions, media composition, and the techniques employed for isolation [‎43] . Bioinformatics and predicting the existence of bioactive compounds Based on the analyzed 16S rDNA sequences, we identified the complete genome of the closest strains for each isolate from GenBank and subsequently predicted the outer membrane proteins (OMPs). The draft genomes of QSLA1, QSLA2, QSLA3, QSLA4, QSLA5, QSLA7, and QSLA12 encode a diverse array of proteins, the functions of most of which are well-established, including adhesion, secretory proteins, enzymes, non-specific channels, receptors, specific channels, and structural proteins. Additionally, certain predicted proteins exhibit unknown functions. It is noteworthy that bioinformatics analysis suggested that the genome of QSLA16 encodes approximately 933 proteins, all of which are associated with biogenesis and secretion, as illustrated in the accompanying heatmap (Fig. 7 and Tables 7 & 8 ) . Adhesion molecules, which are cell surface proteins, facilitate interactions between cells or between cells and the extracellular matrix (ECM ) [‎44] . Secretory proteins play a crucial role in the synthesis, folding, and transport of various cellular proteins [‎45] . Non-specific channel proteins permit the diffusion of sugars, sugar phosphates, nucleotides, amino acids, and polyethylene glycols, provided that their molecular weights are less than 600. In contrast, specific channels enable the diffusion of solutes with molecular weights exceeding 600 [‎46] . Receptor proteins represent a specialized class that binds to specific ligand molecules (Boll et al., 1995), while structural proteins are essential for maintaining the cellular shape and architecture of organisms [‎47] . Table 8 presents the predicted functional annotation of proteins encoded by the outer membrane of the isolated bacterial strains, based on analysis using the OMPdb database. The proteins were classified into functional categories, including adhesion, secretory proteins, enzymes, non-specific and specific channels, receptors, structural proteins, and proteins of unknown function. The distribution of functional proteins varied notably among the strains. For example, strain QSLA12 exhibited the highest number of receptor proteins (4348) and secretory proteins (492), while QSLA16 showed a dominant presence of proteins categorized under unknown function (933), with no other predicted categories identified. Strains such as QSLA3 and QSLA4 displayed a broad range of functional classes, indicating a potentially versatile membrane protein profile. Notably, strains QSLA5, QSLA6 and QSLA7 showed limited functional diversity, with a higher representation of secretory and structural proteins. These findings highlight the functional heterogeneity of outer membrane proteins across different isolates and point to their potential roles in microbial adaptation, environmental interaction, and possible biotechnological applications. Bioinformatics has been employed to assess bioactive peptides in proteins [‎48] . It was demonstrated that applying bioinformatics predictions to determine the functions of bioactive peptides achieved an average accuracy exceeding 95%. This method identified 11 functional categories of putative bioactive peptides, which are anticipated to be experimentally characterized and are expected to have applications in pharmaceuticals and cosmetics [‎49] . Bioinformatics tools were utilized to examine the taxonomic composition and functional diversity of halophilic microbial communities in the El-Rawda solar saltern in North Sinai, Egypt. The EggNOG functional inference classified the genera into two primary categories: Information Storage and Processing (categories 1209.2083 and 3164) encompassing translation, ribosome structure and biogenesis, and processes such as transcription, replication, recombination, and repair. The second category, Cellular Processes and Signaling (categories 1428.9884 and 3793), included defense mechanisms, intracellular trafficking, secretion, vesicular transport, signal transduction mechanisms, post-translational modification, protein turnover, chaperone functions, cell motility, as well as cell wall and membrane biogenesis, along with cell cycle control, cell division, and chromosome partitioning. Additionally, metabolism was categorized into two areas: brine (2470.2212) and sediment (8358), which included lipid transport and metabolism, inorganic acid transport and metabolism, carbohydrate transport, nucleic acid transport, amino acid transport, the biosynthesis and catabolism of secondary metabolites, and energy production and conversion [‎51] . In a study evaluating the antimicrobial activity of QSLA1, QSLA2, and QSLA3 isolates against highly aggressive plant pathogens, the results showed that QSLA1 isolate possessed antifungal activity against Fusarium oxysporium and Alternaria solani , as well as antibacterial activity against Ralstonia solanacearum . In contrast, QSLA2 and QSLA3 isolates exhibited antibacterial activity against Ralstonia solanacearum but did not show antifungal activity against the pathogenic fungi used in the study [‎50] . The presence of the genes encoding for NRPs in the two isolates QSLA16 and QSLA17 was examined using PCR technique. It was revealed that QSLA16 and QSLA17 contain surfactin and fengycin genes while mycosubtilin gene was detected only in QSLA17 isolate. HPLC results showed that isolate QSLA16 produced surfactin and fengycins, with concentrations of 98 mg/l and 45 mg/l, respectively, while isolate QSLA17 produced surfactin, fengycins and iturin, with concentrations of 112 mg/l, 38 mg/l and 67 mg/l, respectively. Therefore, QSLA16 showed antibacterial activity against salmonella typhi, Acinetobacter baumanni (Figure, 8 and Table, 4) and Staphylococcus aureus but it had no effect on Escherichia coli , Klebsiella pneumonia and Proteus mirabilis ‎[52]. According to the bioinformatics analysis the antimicrobial activity of QSLA1, QSLA2, QSLA3, and QSLA16 isolates against phytopathogens and human pathogens in the previous studies might be caused by the activity of outer membrane proteins of the isolates. Conclusion This study demonstrates the successful isolation and characterization of 16 halophilic and halotolerant bacterial strains from the saline environment of Lake Qarun. The isolates were identified based on their cultural characteristics, Gram staining, and spore-forming ability, and further confirmed through genetic analysis and phylogenetic tree construction. The predicted outer membrane proteins of these isolates show potential for various applications in agriculture, industry, medicine, and food production. Future studies can explore the use of these bacterial strains as bio fertilizers, biocontrol agents, and sources of novel enzymes and bioactive compounds, contributing to sustainable development and innovation in various fields. Declarations Funding details: If the paper is accepted the publishing will be funded according to the Open Access Agreement for Egypt between Springer Nature and Science, Technology& Innovation Funding Authority (STDF) in cooperation with Egyptian Knowledge Bank (EKB). Data availability: sequence data that support the findings of this study have been deposited in NCBI with the primary accession codes OP442496, OP442497, OP442498, OP442514, OP442934, OP442518, OP442526, OP443586, OP494267, OP443587, and OP442600 References Naghoni, A. et al. Microbial diversity in the hypersaline Lake Meyghan, Iran. Sci Rep 7 , 11522 (2017). Ventosa, A. & Arahal, D. R. Physico-Chemical Characteristics of Hypersaline Environments and Their Biodiversity - Ventosa A. Encyclopedia of Life Support Systems (EOLSS). Extremophiles, Vol. II (2011). Edbeib, M. F., Wahab, R. A. & Huyop, F. Halophiles: biology, adaptation, and their role in decontamination of hypersaline environments. World J Microbiol Biotechnol 32 , 135 (2016). Vigneshwari, Arjunan, G., .P, M., Natesan, V. & P.K, S. Review on halophilic microbes and their applications. 10 , 23–36 (2022). Oren, A. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. Saline Systems 4 , 2 (2008). Dahiya, B. P. Bioinformatics impacts on medicine, microbial genome and agriculture. J Pharmacogn Phytochem 6 , 1938–1942 (2017). Batley, J. & Edwards, D. The application of genomics and bioinformatics to accelerate crop improvement in a changing climate. Current Opinion in Plant Biology 30 , 78–81 (2016). Kushwaha, U. K. S. Role of Bioinformatics in Crop Improvement. Global Journal of Science Frontier Research 17 , 13–23 (2017). Benito, J. M., Lovrich, G. A., Siñeriz, F. & Abate, C. M. Isolation and Molecular Characterization of Seawater Bacteria. in Environmental Microbiology (eds. Walker, J. M., Spencer, J. F. T. & Ragout De Spencer, A. L.) 3–9 (Humana Press, Totowa, NJ, 2004). doi:10.1385/1-59259-765-3:003. Hucker, G. J. & Conn, H. J. Methods Of Gram Staining. (1923). Goszczynska, T. Introduction to Practical Phytobacteriology; A Manual for Phytobacteriology . (2000). Whittenbury, R. HYDROGEN PEROXIDE FORMATION AND CATALASE ACTIVITY IN THE LACTIC ACID BACTERIA. J Gen Microbiol 35 , 13–26 (1964). Ramadoss, D., Lakkineni, V. K., Bose, P., Ali, S. & Annapurna, K. Mitigation of salt stress in wheat seedlings by halotolerant bacteria isolated from saline habitats. SpringerPlus 2 , 6 (2013). Broderick, N. A., Raffa, K. F., Goodman, R. M. & Handelsman, J. Census of the Bacterial Community of the Gypsy Moth Larval Midgut by Using Culturing and Culture-Independent Methods. Appl Environ Microbiol 70 , 293–300 (2004). Sambrook, J. Molecular Cloning: A Laboratory Manual . (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Mwirichia, R., Cousin, S., Muigai, A. W., Boga, H. I. & Stackebrandt, E. Bacterial diversity in the haloalkaline Lake Elmenteita, Kenya. Curr Microbiol 62 , 209–221 (2011). Roux, K. H. Optimization and troubleshooting in PCR. Cold Spring Harb Protoc 2009 , pdb.ip66 (2009). Van der Lelie, D. et al. Use of single-point genome signature tags as a universal tagging method for microbial genome surveys. Appl Environ Microbiol 72 , 2092–2101 (2006). Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Research 25 , 3389–402 (1997). Saitou, N. & Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4 , 406–425 (1987). Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35 , 1547–1549 (2018). The UniProt Consortium. UniProt: the Universal Protein Knowledgebase in 2025. Nucleic Acids Research gkae1010 (2024) doi:10.1093/nar/gkae1010. Roumia, A. F. et al. OMPdb: A Global Hub of Beta-Barrel Outer Membrane Proteins. Front. Bioinform. 0 , (2021). Eddy, S. R. Profile hidden Markov models. Bioinformatics (Oxford, England) 14 , 755–63 (1998). Suthar, M. P., Hajoori, M. A., Chaudhari, R. R. & Desai, S. A. Isolation, Screening & Characterization of Potent Biosurfactant producing Bacteria from Oil Contami-nated Site. Bioscience Discovery 8 , 375–381 (2017). Hopwood, D. A. Phase-contrast observations on Streptomyces coelicolor. J Gen Microbiol 22 , 295–302 (1960). Ghozlan, H., Deif, H., Kandil, R. A. & Sabry, S. Biodiversity of moderately halophilic bacteria in hypersaline habitats in Egypt. J Gen Appl Microbiol 52 , 63–72 (2006). Ventosa, A. & Nieto, J. J. Biotechnological applications and potentialities of halophilic microorganisms. World J Microbiol Biotechnol 11 , 85–94 (1995). Halophiles: Biodiversity and Sustainable Exploitation . (Springer, Cham, 2015). Mohamedin, A., Elsayed, A., Abdalla, A. & EL-Dohlab, S. Characterization of Some Extremely Halophilic Bacteria Isolated from Salt Marshes of Gamasa Egypt. Journal of Plant Production 9 , 521–529 (2018). Gibbons, N. E. Chapter VIII Isolation, Growth and Requirements of Halophilic Bacteria. in Methods in Microbiology (eds. Norris, J. R. & Ribbons, D. W.) vol. 3 169–183 (Academic Press, 1969). Sehgal, S. N. & Gibbons, N. E. Effect of some metal ions on the growth of Halobacterium cutirubrum. Can J Microbiol 6 , 165–169 (1960). Trabelsi, D., Mengoni, A., Elarbi Aouani, M., Mhamdi, R. & Bazzicalupo, M. Genetic diversity and salt tolerance of bacterial communities from two Tunisian soils. Ann. Microbiol. 59 , 25–32 (2009). Yaradoddi, J. CULTURABLE DIVERSITY OF EXTREMELY HALOPHILIC BACTERIA FROM WEST COAST OF KARNATAKA, INDIA. International Journal of Biology, Pharmacy and Allied Sciences 2 , 391–405 (2013). Paul, S. et al. Isolation and Characterization of Salt Tolerant Bacteria from Sambhar Lake for Plant Growth Promoting Activities. (2015). Rathakrishnan, D. & Gopalan, A. K. Isolation and characterization of halophilic isolates from Indian salterns and their screening for production of hydrolytic enzymes. Environmental Challenges 6 , 100426 (2022). Menasria, T. et al. Culturable halophilic bacteria inhabiting Algerian saline ecosystems: A source of promising features and potentialities. World J Microbiol Biotechnol 35 , 132 (2019). Roohi, A., Ahmed, I., Iqbal, M. & Jamil, M. Preliminary isolation and characterization of halotolerant and halophilic bacteria from salt mines of Karak, Pakistan. Pakistan Journal of Botany 44 , 365–370 (2012). Chen, L. et al. Phylogenetic analysis and screening of antimicrobial and cytotoxic activities of moderately halophilic bacteria isolated from the Weihai Solar Saltern (China). World J Microbiol Biotechnol 26 , 879–888 (2010). Ruginescu, R. et al. Bioprospecting for Novel Halophilic and Halotolerant Sources of Hydrolytic Enzymes in Brackish, Saline and Hypersaline Lakes of Romania. Microorganisms 8 , 1903 (2020). Romanenko, L. A. et al. Sphingomonas molluscorum sp. nov., a novel marine isolate with antimicrobial activity. Int J Syst Evol Microbiol 57 , 358–363 (2007). Romanenko, L. A., Tanaka, N., Frolova, G. M. & Mikhailov, V. V. Sphingomonas japonica sp. nov., isolated from the marine crustacean Paralithodes camtschatica. Int J Syst Evol Microbiol 59 , 1179–1182 (2009). Menasria, T. et al. Diversity and bioprospecting of extremely halophilic archaea isolated from Algerian arid and semi-arid wetland ecosystems for halophilic-active hydrolytic enzymes. Microbiological Research 207 , 289–298 (2018). Ren, G., Roberts, A. I. & Shi, Y. Adhesion molecules: key players in Mesenchymal stem cell-mediated immunosuppression. Cell Adh Migr 5 , 20–22 (2011). Barlowe, C. K. & Miller, E. A. Secretory protein biogenesis and traffic in the early secretory pathway. Genetics 193 , 383–410 (2013). Nikaido, H., Luckey, M. & Rosenberg, E. Y. Nonspecific and specific diffusion channels in the outer membrane of Escherichia coli. J Supramol Struct 13 , 305–313 (1980). Numata, K. How to define and study structural proteins as biopolymer materials. Polym J 52 , 1043–1056 (2020). Phetchthumrongchai, T. et al. Properties of Protein Hydrolysates and Bioinformatics Prediction of Peptides Derived from Thermal and Enzymatic Process of Skipjack Tuna (Katsuwonus pelamis) Roe. Fishes 7 , 255 (2022). Tachapuripunya, V., Roytrakul, S., Chumnanpuen, P. & E-Kobon, T. Unveiling Putative Functions of Mucus Proteins and Their Tryptic Peptides in Seven Gastropod Species Using Comparative Proteomics and Machine Learning-Based Bioinformatics Predictions. Molecules 26 , 3475 (2021). Mousa, A. A. A., Mahmoud, W. H., Elsaied, H. E. & Elbeltagy, A. E. Halomonas sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against Fusarium wilt under saline environments. Preprint at https://doi.org/10.21203/rs.3.rs-5653815/v1 (2025). Elshafey, N. et al. Phylogeny and functional diversity of halophilic microbial communities from a thalasso environment. Saudi Journal of Biological Sciences 30 , 103841 (2023). Abd-Elmonaem, A. A., Mahmoud, Wafaa H., Elsaied, H. & Elbeltagy, A. E. Efficiency of non-ribosomal lipopeptides (nrps) produced by salt tolerant bacteria against some pathogenic bacteria . Menoufia J. Agric. Biotechnology , Volume 8 Issue 1: 1 – 18 (2023). Table 2,3 and 8 Table 2,3 and 8 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table238.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7308332","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":496508308,"identity":"7e6707e1-54ee-4ee2-8896-1a6cbd2cdc40","order_by":0,"name":"Ahmed Ahmed Abdelmonaem Mousa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABPUlEQVRIie2RPUvDQBjHnxDQJSVrSjD5BMITCjfqV0kp6JJApUvBwU5mMG1nseBXMBTqmtKhy+l8EtFMdclQFwk1Be+w1uEsdRTMD+6FB37P/14ASkr+IgYf2udWSdfVNorZ3aqouK7SXyo7xrcCmxX96qKeZjCy7GAya+eLJ9gPuuM0bh6AvushzBdyyOPd0BlAUkN6RB66vRYQet/AGBtQDTNULntyDPNHpgZJ/QZcwiqhC4R5xJyjCsg8VCuhZNjMv30XynX/5e1kKZTnjBgxnsGhUJaygjxFFUqHN1e1XKRoQpkAGlyBXFIc5g+rA+R3YVnL3Ou4GqFejd9lqhl01hx3O5JiMT+aZ+3EsvvH0WtWuBaZUieNi1NLDxpRmhc/PjQ/3mpVzr/+aPVZMa9sQe65KaWkpKTkH/EBxkV0hQ+bTvIAAAAASUVORK5CYII=","orcid":"","institution":"Menoufia University","correspondingAuthor":true,"prefix":"","firstName":"Ahmed","middleName":"Ahmed Abdelmonaem","lastName":"Mousa","suffix":""},{"id":496508309,"identity":"a89f4d39-0d4b-4fd6-890b-5c47995fe7dd","order_by":1,"name":"Ahmed Fouad Roumia","email":"","orcid":"","institution":"Menoufia University","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"Fouad","lastName":"Roumia","suffix":""},{"id":496508310,"identity":"19fb9be3-4767-4a2f-a613-4adc5d80b5f6","order_by":2,"name":"Adel Elsayed Elbeltagy","email":"","orcid":"","institution":"Menoufia University","correspondingAuthor":false,"prefix":"","firstName":"Adel","middleName":"Elsayed","lastName":"Elbeltagy","suffix":""}],"badges":[],"createdAt":"2025-08-06 09:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7308332/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7308332/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88517863,"identity":"988f3403-a6b8-4f20-aa04-d0b5b0c3b361","added_by":"auto","created_at":"2025-08-07 09:17:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":141836,"visible":true,"origin":"","legend":"\u003cp\u003eWorkflow diagram summarizing the bioinformatics steps used in the in-silico analysis of the isolated microbial strains.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/0c3a0c51b5b3e3b601ae2e46.png"},{"id":88517611,"identity":"71cc28fb-763a-48fc-a129-b46f5bc16266","added_by":"auto","created_at":"2025-08-07 09:09:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":56810,"visible":true,"origin":"","legend":"\u003cp\u003ePercentages of the isolated bacteria from each pond.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/f7b11be770e88678d3e5f213.png"},{"id":88517612,"identity":"2d464110-211b-4366-ba8c-54a1054c7370","added_by":"auto","created_at":"2025-08-07 09:09:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":42390,"visible":true,"origin":"","legend":"\u003cp\u003ePercentage of isolates for gram staining result.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/93b2e46f358e26bfc7d92cf6.png"},{"id":88517610,"identity":"c5c470f1-446f-4ac6-9629-28c8f687a37a","added_by":"auto","created_at":"2025-08-07 09:09:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":36687,"visible":true,"origin":"","legend":"\u003cp\u003ePercentage of salinity tolerance of the isolates\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/eac08689c10ad3a59a837f80.png"},{"id":88517617,"identity":"50621bb3-d8d2-42f5-9036-bff4ec8298b8","added_by":"auto","created_at":"2025-08-07 09:09:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":45412,"visible":true,"origin":"","legend":"\u003cp\u003edistribution percentage of isolates among various classes of bacteria\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/17e96b3f4701df4125e9d56e.png"},{"id":88517628,"identity":"ed1c2652-c0e4-4af0-91d2-043e00a98775","added_by":"auto","created_at":"2025-08-07 09:09:05","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3507001,"visible":true,"origin":"","legend":"\u003cp\u003ea phylogenetic tree constructed through neighbor-joining analysis based on the 16S rDNA sequences of the isolates, as well as closely related sequences deposited in GenBank\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/b846ac6a22582e5b3475dddd.png"},{"id":88517629,"identity":"de4e5b7e-8e8e-41b4-98a9-ca64cb9e05c0","added_by":"auto","created_at":"2025-08-07 09:09:05","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":352300,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap illustrating the functional annotation of proteins identified across the isolated microbial strains.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/e8ec44863588944ced8c655b.png"},{"id":90779207,"identity":"84f0dcda-c465-4754-8d01-61f9e3c0a0ad","added_by":"auto","created_at":"2025-09-08 04:16:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5522612,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/7a7c4ba3-f1a8-405b-8d3e-ed6966ccc520.pdf"},{"id":88517861,"identity":"5ff5898f-35b8-4edd-b30e-d779095a2f99","added_by":"auto","created_at":"2025-08-07 09:17:04","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":52412,"visible":true,"origin":"","legend":"","description":"","filename":"Table238.docx","url":"https://assets-eu.researchsquare.com/files/rs-7308332/v1/eb9642f02d856c24265aa69e.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization and in Silico analysis of outer membrane proteins in halophilic and halotolerant bacteria which isolated from Qarun Lake solar salterns","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHypersaline ecosystems are habitats found in terrestrial lakes and deep-sea basins with salt concentrations exceeding three times that of seawater. They are divided into thalassohaline and athalassohaline waters\u003cb\u003e\u0026lrm; [1].\u003c/b\u003e Solar salterns, either naturally occurring or man-made, are common in arid and semi-arid regions \u003cb\u003e[\u0026lrm;2]\u003c/b\u003e. Qarun Lake, located in northern Fayoum Governorate, is saline, turbid, and has no surface outflow \u003csup\u003e3\u003c/sup\u003e. The area features a multi-pond system used for salt and mineral production.\u003c/p\u003e\u003cp\u003eHalophiles are salt-loving microorganisms found across all three domains of life: Archaea, Bacteria, and Eukarya \u003cb\u003e[\u0026lrm;3].\u003c/b\u003e Historically used for salt and fermentation, these microbes are now known for producing antibiotics, enzymes, pigments, ectoine, polysaccharides, biosurfactants, and bioplastics. They also have applications in mining and nanotechnology \u003cb\u003e[\u0026lrm;4]\u003c/b\u003e. The applications of halophilic microorganisms include: (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e) traditional processes like solar salt production and fermentation that have existed for centuries, often without knowledge of the microorganisms involved, (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) utilizing the salt tolerance and enzymes of halophiles in high-salt environments, (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) exploiting compounds like ectoine that help withstand high salinity, and (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) industrial uses of compounds found in both halophiles and non-halophiles, with halophiles sometimes offering distinct advantages \u003cb\u003e[\u0026lrm;5]\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eBioinformatics serves as an essential computerized framework in molecular biology, providing valuable tools for analyzing and interpreting biological data \u003cb\u003e[\u0026lrm;6]\u003c/b\u003e. It plays a significant role in genomics, facilitating genome sequencing, gene identification, phylogenetic analysis, and the detection of transcription factor binding sites, while also offering analytical capabilities for microarray data \u003cb\u003e[\u0026lrm;7]\u003c/b\u003e. In proteomics, bioinformatics enhances the study of protein structures and identifies sites of protein-protein interactions \u003cb\u003e[\u0026lrm;8]\u003c/b\u003e. The techniques utilized range from data extraction and visualization to noise reduction and clustering methods that highlight genes with similar behavior.\u003c/p\u003e\u003cp\u003eThis study aims to isolate, identify, and predict the outer membrane proteins (OMP) activity of a halophilic and halotolerant bacterial community found in the solar saltern ponds of Qarun Lake, Egypt, utilizing bioinformatics tools.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eIsolation and purification of halophilic bacteria from solar salterns water\u003c/h2\u003e\u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\u003ch2\u003eCollection sites\u003c/h2\u003e\u003cp\u003eIn September 2019, water samples were collected from Local Company for Salts and Minerals at Qarun Lake in Fayoum. Four solar saltern ponds with varying salt (NaCl) concentrations were sampled, measuring 4.0%, 8.2%, 17.2%, and 24.2% NaCl, as determined using a rafractometer. Ten liters of water were collected from each pond in sterile plastic jars and placed in ice packs for transport to the Biotechnology Laboratory in the Botany Department at the Faculty of Agriculture, Menoufia University. The collected water samples were filtered to remove impurities, and their salt concentrations were analyzed using a rafractometer. The pH was measured with a pH meter before further use.\u003c/p\u003e\u003cp\u003eNutrient agar medium (NA) was sterilized by autoclaving at 15 lbs. pressure (121\u0026deg;C) for 20 minutes and was employed for bacterial isolation. To isolate bacteria from each pond, 100 \u0026micro;L of water samples from each concentration were spread or streaked onto nutrient agar plates. The plates were then incubated at 30\u0026deg;C for 7 to 30 days \u003cb\u003e[\u0026lrm;9].\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAt the higher salt concentrations (17.2% and 24.2%), no colonies appeared on the nutrient agar plates. Consequently, a 100 \u0026micro;L water sample from these high-salinity ponds was added to 200 mL of nutrient broth medium (NB) for enrichment, which was then shaken for 72 hours at 130 rpm at room temperature (28\u0026deg;C).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eCultural, morphological and physiological characterization of the isolates\u003c/h3\u003e\n\u003cp\u003eBacterial colonies began to appear after 7 to 30 days. Colonies exhibiting distinct morphological characteristics were selected and purified by sub-culturing three times on NA medium supplemented with pond water at different salt concentrations. Pure colonies were then transferred to slant agar for further use. Each sample was assigned an isolate designation based on its collection site (QSLA for Qarun Salt Lake Local), with each isolate receiving a unique number.\u003c/p\u003e\u003cp\u003eThe morphological characteristics of the isolated colonies were examined, including shape, pigmentation, elevation, and optical properties. Additionally, cellular morphology was assessed through shape, Gram staining, and endospore formation \u003cb\u003e[\u0026lrm;10].\u003c/b\u003e Motility was tested using the hanging drop method \u003cb\u003e[\u0026lrm;11]\u003c/b\u003e, and catalase activity was evaluated \u003cb\u003e[\u0026lrm;12]\u003c/b\u003e. The bacterial isolates were also screened for halotolerance using NA medium supplemented with varying levels of NaCl (0%, 7%, 12.5%, 20%, and 22%). The plates were incubated for 7 days at 30\u0026deg;C, and growth was recorded \u003cb\u003e[\u0026lrm;13].\u003c/b\u003e\u003c/p\u003e\n\u003ch3\u003eMolecular identification of the isolates and phylogeny\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003eDNA extraction and polymerase chain reaction (PCR)\u003c/h2\u003e\u003cp\u003eGenomic DNA was extracted from bacterial cells cultured aerobically in nutrient broth \u003cb\u003e[\u0026lrm;14]\u003c/b\u003e. The extracted DNA was subsequently visualized under ultraviolet light following staining with ethidium bromide \u003cb\u003e[\u0026lrm;15]\u003c/b\u003e and was preserved at -20\u0026deg;C until use \u003cb\u003e[\u0026lrm;16]\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eFor the amplification of nearly full-length 16S rRNA gene sequences, bacterial primers 27F and 1492R (\u003cb\u003eTable, 1\u003c/b\u003e) were employed using a model PTC-100 thermal cycler (MJ Research Inc., USA). The PCR reaction mixture consisted of a total volume of 40 \u0026micro;l and included: 0.25 \u0026micro;l of genescript Taq polymerase, 1.0 \u0026micro;l (5 pmol) of the 27F forward primer, 1.0 \u0026micro;l (5 pmol) of the 1492R reverse primer, 1 \u0026micro;l of template DNA, 2.5 \u0026micro;l of dNTPs mix (2.5 mM), 4.0 \u0026micro;l of 10x PCR buffer (genescript), and 30.25 \u0026micro;l of PCR-grade water.\u003c/p\u003e\u003cp\u003eThe PCR cycling conditions comprised an initial enzyme activation step at 94\u0026deg;C for 5 minutes, followed by 35 cycles that included a denaturation step at 94\u0026deg;C for 45 seconds, a primer annealing step at 53\u0026deg;C for 60 seconds, and a chain elongation step at 72\u0026deg;C for 2 minutes. A final extension was carried out at 72\u0026deg;C for 5 minutes \u003cb\u003e[\u0026lrm;17]\u003c/b\u003e. The presence of amplified products was verified by applying 7 \u0026micro;l of the PCR product onto a 1% agarose gel in 1X TAE buffer containing ethidium bromide. Visualization was accomplished using a Gel Documentation System (Bio-Rad Laboratories) \u003cb\u003e[\u0026lrm;15]\u003c/b\u003e. The PCR products were then purified according to the QIAquick PCR Purification Kit protocol (Qiagen) and sent for sequencing.\u003c/p\u003e\u003cp\u003e\u003cb\u003e16S rRNA sequencing\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSequencing was performed by Colors Laboratories, located at El-Etihad Square, Maadi, Cairo, Egypt, utilizing the universal bacterial primers 27F and 1492R as specified in \u003cb\u003eTable\u0026nbsp;1\u003c/b\u003e, in accordance with the laboratory's protocols. The resultant sequences were edited to remove all gaps using the Complete Deletion option with the CHROMAS PRO software, version 1.5.\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;(1), Primers used for PCR 16s rRNA sequencing analysis \u003cb\u003e[\u0026lrm;18].\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOrientation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePriming site\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSequence (5\u0026acute;- 3\u0026acute;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e27F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8\u0026ndash;27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAGAGTTTGATCCTGGCTCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1492R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eReverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1492\u0026ndash;1513\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGGTTACCTTGTTACGACTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eEvolutionary relationships of Taxa\u003c/h2\u003e\u003cp\u003eThe 16S rRNA gene sequences were compared with those published in the GenBank databases utilizing the Basic Local Alignment Search Tool (BLAST), accessible through the National Center for Biotechnology Information (NCBI) website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nih.gov\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The alignment was conducted using CLUSTAL W version 1.6 software \u003cb\u003e[\u0026lrm;19]\u003c/b\u003e. The evolutionary history was inferred employing the Neighbor-Joining method \u003cb\u003e[\u0026lrm;20]\u003c/b\u003e. This analysis incorporated a total of 48 nucleotide sequences. All ambiguous positions were eliminated for each sequence pair through the pairwise deletion option, resulting in a final dataset comprising 1,619 positions. The evolutionary analyses were performed using MEGA X software \u003cb\u003e[\u0026lrm;21].\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eBioinformatics and predicting the existence of bioactive compounds\u003c/h3\u003e\n\u003cp\u003eThe 16S rDNA sequences of the isolated strains were subjected to a search for homologous bacteria against the GenBank database utilizing BlastN \u003cb\u003e[\u0026lrm;19].\u003c/b\u003e The highest hits obtained from the BlastN search facilitated the download of non-redundant proteomes from UniProt (version 2021_04) \u003cb\u003e[\u0026lrm;22]\u003c/b\u003e. Following this, the OMPdb pHMMs library was downloaded \u003cb\u003e[\u0026lrm;23]\u003c/b\u003e and processed against the retrieved proteomes using the hmmscan tool from HMMER (version 3.3.2) \u003cb\u003e[\u0026lrm;24] (Fig.\u0026nbsp;1)\u003c/b\u003e.\u003c/p\u003e"},{"header":"Results and discussion","content":"\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003eIsolation and purification of halophilic bacteria from solar salterns water\u003c/h2\u003e\n \u003cp\u003eHalophilic and halo-tolerant bacteria were successfully isolated from water samples taken from four distinct ponds with varying salt concentrations. These ponds, part of Qarun Lake, are utilized by a local company for salt production. In total, we isolated 17 halophilic bacterial strains on nutrient agar (NA) medium, which was expertly prepared using saline water from the respective ponds rather than distilled water.\u003c/p\u003e\n \u003cp\u003eThe distribution of the isolated bacteria is impressive: two strains (11.76%) were obtained from the first pond (salinity 4%), five strains (29.41%) from the second pond (salinity 8.2%), seven strains (41.18%) from the third pond (salinity 17.2%), and three strains (17.65%) from the fourth pond (salinity 24.2%) \u003cstrong\u003e(Fig.\u0026nbsp;2 \u0026amp; Table, 3)\u003c/strong\u003e. This clearly demonstrates the rich diversity of halophilic bacteria present in these environments.\u003c/p\u003e\n \u003cp\u003eSubsequent to the isolation process, the isolates underwent purification through several streaking techniques on nutrient agar (NA) plates, resulting in pure isolates designated as QSLA1 to QSLA17, which were utilized for further studies.\u003c/p\u003e\n \u003cp\u003eThe successful isolation of 361 halobacterial strains was reported from three basins of Lake Meyghan \u003cstrong\u003e[\u0026lrm;1]\u003c/strong\u003e, each featuring different salinities: the green brine with approximately 50 g/L salinity, the red brine at approximately 180 g/L salinity, and white brine near 300 g/L salinity. In the low salinity pond, the majority of isolates were identified as bacteria, with 31 out of 35 yielding bacterial strains. The predominant group among these was Proteobacteria, which included 20 Gammaproteobacteria (e.g., \u003cem\u003eIdiomarina\u003c/em\u003e sp. and \u003cem\u003eHalomonas\u003c/em\u003e sp.) and 3 Alphaproteobacteria. Additionally, the phyla represented included Actinobacteria (3), Bacteroidetes (4), and Firmicutes (1). From the medium-salinity pond, a total of 16 bacteria were isolated, of these, 9 belonged to the Firmicutes (for example, \u003cem\u003eBacillus\u003c/em\u003e sp. and \u003cem\u003eThalassobacillus\u003c/em\u003e sp.), along with 5 Gammaproteobacteria and 2 Actinobacteria. It is noteworthy that Bacteroidetes and Alphaproteobacteria were not among the isolates from the medium-salinity pond. In the highest salinity pond, 10 bacterial isolates were obtained, comprising 6 Gammaproteobacteria, 3 Firmicutes, and 1 Alphaproteobacteria.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003eCultural, morphological and physiological characterization of the isolates\u003c/h2\u003e\n \u003cp\u003eThe morphological, colonial, and biochemical characterizations, which are vital for the partial identification of microorganisms, were comprehensively conducted \u003cstrong\u003e[\u0026lrm;25]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003eColony morphology\u003c/h2\u003e\n \u003cp\u003eAll colonies exhibited a shiny appearance. Among the isolates, 14 colonies were characterized by a round shape, while 3 exhibited irregular shapes. Specifically, four colonies displayed lobate edges, eight colonies had ragged edges, and five colonies were characterized by entire edges. Thirteen of the colonies appeared translucent, whereas four were opaque. In terms of elevation, eleven colonies were flat, while six colonies were raised. The size of the colonies varied, with six being pinpoint, nine classified as small, and two categorized as large. Regarding coloration, five colonies were creamy, five were yellow, three were white, two were orange, one was brown, and one was pink upon nutrient agar medium containing 12.5% NaCl (Table, 2).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003eCell characteristics\u003c/h2\u003e\n \u003cp\u003eThe examination of simple and Gram-stained cells derived from pure colonies, conducted with a light microscope \u003cstrong\u003e[\u0026lrm;26]\u003c/strong\u003e, indicated that all isolates exhibited a rod shape. The results of the Gram staining revealed that, out of 17 isolates, 9 (52.94%) were classified as Gram-negative, 6 (35.29%) as Gram-positive, and 2 (11.76%) as Gram-variable \u003cstrong\u003e(Fig.\u0026nbsp;3)\u003c/strong\u003e. All strains demonstrated motility when evaluated using the hanging drop method. Additionally, the process of pasteurizing pure cultures indicated that ten isolates (58.8%) were capable of forming spores. Furthermore, all isolates were confirmed as catalase producers when subjected to hydrogen peroxide (H₂O₂) testing \u003cstrong\u003e(Table, 3)\u003c/strong\u003e.\u003c/p\u003e\n \u003cdiv\u003e\u003cstrong\u003eGhozlan et al. (2006)\u003c/strong\u003e moderately halophilic bacteria were isolated from solar salterns, coastal salt marshes, and salt lakes located in Alexandria, Egypt. The findings revealed that among the isolates, 76 were classified as Gram-negative, while 14 were classified as Gram-positive \u003cstrong\u003e[\u0026lrm;27]\u003c/strong\u003e.\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003eSalinity tolerance assay\u003c/h2\u003e\n \u003cp\u003eIn the assessment of halo-tolerance, the isolates exhibited varying degrees of tolerance to different concentrations of NaCl: 0%, 7%, 12.5%, 20%, and 22%. All isolates successfully grew in nutrient agar (NA) medium at a salt concentration of 12.5% NaCl. However, growth at a concentration of 20% NaCl was limited to nine isolates (52.94%), specifically QSLA1, QSLA2, QSLA4, QSLA6, QSLA8, QSLA9, QSLA10, QSLA11, and QSLA13. Thirteen isolates (76.47%) demonstrated growth in NA medium with a 7% NaCl concentration.\u003c/p\u003e\n \u003cp\u003eWhen subjected to a NaCl concentration of 22%, only three isolates (17.65%) - QSLA2, QSLA11, and QSLA13 - showed viability. In contrast, two isolates (11.76%), QSLA15 and QSLA17, were capable of growth in NA medium with no NaCl (0% NaCl) present \u003cstrong\u003e(Fig.\u0026nbsp;4 and Table\u0026nbsp;4)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eTable (4), Salinity tolerance assay of isolates on NA plates with different NaCl concentrations.\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"548\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eIsolates\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"5\"\u003e\n \u003cp\u003eNaCl concentration (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eZero\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e12.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eTable (5): The blasted isolates and the nearest neighbors in the GenBank database and their % relatedness.\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"642\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIsolate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eOrganism\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eClosest strains\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ein Genebank\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIdentity (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. RS-17\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e91.26\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. strain LR2-3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e96.43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. GQ30\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e97.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalobacillus sp. CNJ 812 PL04\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e96.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio sp. IB872\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e98.12\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio sp. ML288\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e95.24\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio sp. pr6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e94.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacteriodetes bacterium\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacteriodetes bacterium strain HT31.1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e94.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eThalassobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eThalassobacillus sp. strain JSM1684092\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e97.41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eOceanobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eOceanobacillus oncorhynchi strain E\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e98.11\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eAliifodinibius\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eAliifodinibius sp. strain ZC14-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e91.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus sp. JSM 102029\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e82.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus strain AS4.2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e86.98\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eLentibacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eLentibacillus sp.strain BCHS25\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e87.66\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eVirgibacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eVirgibacillus halodenitrificans strain yt08\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e87.21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eUncultured bacterium\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e(Sphingomonas)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eUncultured bacterium clone QAMU23. (Sphingomonas sp. LE-239)\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e80.15 (79.9)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus sp.strain6\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e74.05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003eTable (6) Accession numbers of submitted isolates sequences deposited in GenBank (NCBI).\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"602\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eIsolate\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eOrganism\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eStrain\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ein Genebank\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eAccession number\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. strain QSLA1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442496\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. strain QSLA2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442497\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas sp. strain QSLA3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442498\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalobacillus sp. strain QSLA4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442514\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio sp. strain QSLA5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442934\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacteroidetes bacterium\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacteroidetes bacterium strain QSLA8\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442518\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eThalassobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eThalassobacillus sp. strain QSLA9\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442526\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eOceanobacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eOceanobacillus oncorhynchi strain QSLA10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP443586\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eAliifodinibius\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eAliifodinibius sp. strain QSLA11\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP494267\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eLentibacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eLentibacillus sp. strain QSLA14\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP443587\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eVirgibacillus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eVirgibacillus halodenitrificans strain QSLA15\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOP442600\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eTable (7) Summary of identified bacterial ctrains with Corresponding BLASTN hits, proteome information, and outer membrane protein annotations\u003c/p\u003e\n \u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"630\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eStrain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBlastN Highest hit\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteomes No.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eProteins No.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eOuter membrane proteins\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u003c/em\u003e sp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e45471\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e534\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2875\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e480\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalomonas\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10096\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e614\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eHalobacillus\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e67629\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e659\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA5,6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e21763\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e335\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eSalinivibrio\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3161\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e197\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eThalassobacilus\u003c/em\u003e sp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4309\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eOceanobacillus oncorhynchi\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e4386\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA12,13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e215838\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e5956\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eLentibacillus\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e7359\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eVirgibacillus\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e10829\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eUncultured bacterium\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e281521\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e933\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eQSLA17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cem\u003eBacillus\u0026nbsp;\u003c/em\u003esp.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e2134\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eHalotolerant organisms are capable of growth in the absence of salt while exhibiting tolerance to varying concentrations of salt, specifically between 0% and 5% NaCl \u003cstrong\u003e[\u0026lrm;28]\u003c/strong\u003e. They are classified as extremely halotolerant when their tolerance extends above 15% (2.5 M) NaCl \u003cstrong\u003e[\u0026lrm;29]\u003c/strong\u003e. In contrast, slight halophiles, which are typically marine bacteria, exhibit optimal growth at salt concentrations ranging from 0.2 to 0.5 M NaCl (1\u0026ndash;3% NaCl). Moderate halophiles thrive in environments with 0.5 to 2.5 M NaCl (3\u0026ndash;15% NaCl), while extreme halophiles are most successful in medium containing 2.5 to 5.2 M (saturated) NaCl (15\u0026ndash;30% NaCl) \u003cstrong\u003e[\u0026lrm;30]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eThis study identified two isolates, QSLA15 and QSLA17, which account for 11.7% of the total isolates, as halotolerant, as they demonstrated the ability to grow in both the absence and presence of NaCl. Conversely, the remaining 15 isolates (88.23%) were unable to grow in the absence of NaCl and instead thrived optimally in medium with salt concentrations ranging from 7\u0026ndash;22% NaCl. Among these isolates, six (35.29%) - namely QSLA3, QSLA5, QSLA7, QSLA12, QSLA14, and QSLA16 - were able to grow in NA medium containing 7% and 12.5% NaCl, categorizing them as moderately halophilic. The remaining nine isolates (52.94%), specifically QSLA1, QSLA2, QSLA4, QSLA6, QSLA8, QSLA9, QSLA10, QSLA11, and QSLA13, were classified as extremely halophilic, as they thrived in NA medium with a 20% NaCl concentration \u003cstrong\u003e(Fig.\u0026nbsp;4)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eNotably, strains QSLA8 and QSLA16 were isolated from a saline water pond with a salt concentration of 24.2%. While QSLA8 could grow in NA medium prepared with distilled water and 20% NaCl, QSLA16 could not. Furthermore, both strains were incapable of growth in NA medium prepared with distilled water and 22% NaCl.\u003c/p\u003e\n \u003cp\u003eIt was indicated that the NaCl requirement of these organisms has been well documented, and sodium chloride cannot be substituted with other salts. Additionally, potassium is essential for optimal growth and pigmentation, and magnesium is also a critical factor. In instances where magnesium is present at lower concentrations, the organisms tend to adopt a spherical shape but revert to their typical rod morphology when returned to media with the original magnesium concentration \u003cstrong\u003e[\u0026lrm;31]\u003c/strong\u003e. An addition of 10 ppm of Fe\u003csup\u003e2+\u003c/sup\u003e significantly enhances cell yield, while small amounts of manganese (0.05 ppm) can stimulate growth and pigmentation. It follows that the inability of isolate QSLA16 to grow on NA medium utilizing distilled water and high NaCl concentrations (20%) may be attributed to the deficiency of other essential elements such as potassium, magnesium, iron, and manganese, all of which are vital for optimal growth conditions \u003cstrong\u003e[\u0026lrm;32]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eBacteria from hypersaline environments, such as solar salterns, are well adapted to high salt concentration \u003cstrong\u003e[\u0026lrm;33].\u003c/strong\u003e Isolates from saline regions in Karnataka thrived in salt concentrations from 5\u0026ndash;25% \u003cstrong\u003e[\u0026lrm;34]\u003c/strong\u003e. Forty-six halobacterial strains were isolated from Sambhar Lake, all of which were tolerant to 10% NaCl, and forty-four to 15%. Out of ten selected cultures, three tolerated up to 25% salt \u003cstrong\u003e[\u0026lrm;35]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eTwenty-eight moderately halophilic bacteria were isolated from salterns in Tamil Nadu, Kerala, and Goa, India. Most isolates grew well on halophilic medium with 5% NaCl, with twenty-one showing heavy growth at 10\u0026ndash;15% salt. The maximum tolerable salt concentration (MTSC) results indicated that one isolate grew optimally at 5% NaCl (slight halophiles), four tolerated 10%, seventeen grew at 15%, and six thrived at 20% NaCl, with some being halo-tolerant \u003cstrong\u003e[\u0026lrm;36]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\"\u003e\n \u003ch2\u003eMolecular identification of the isolates\u003c/h2\u003e\n \u003cp\u003eIn addition to the morphological and biochemical characterization of the isolates, sequencing and analysis of the 16S rDNA gene were conducted. The resulting sequences were compared with those available in the NCBI BLAST database. The analysis of the 16S rRNA gene revealed the following relationships among the isolates: QSLA1 exhibited the closest similarity (91.26%) to \u003cem\u003eHalomonas\u003c/em\u003e sp. strain RS-17. QSLA2 demonstrated 96.6% similarity to \u003cem\u003eHalomonas\u003c/em\u003e sp. strain LR2-3. QSLA3 was identified as \u003cem\u003eHalomonas\u003c/em\u003e sp. GQ30, showing 97.33% similarity. QSLA4 displayed 96.45% similarity to \u003cem\u003eHalobacillus\u003c/em\u003e sp. CNJ 812 PL04. QSLA5 shared 98.12% similarity with \u003cem\u003eSalinivibrio\u003c/em\u003e sp. IB872. QSLA6 exhibited 95.24% similarity to \u003cem\u003eSalinivibrio\u003c/em\u003e sp. ML288. QSLA7 had a similarity of 94% to \u003cem\u003eSalinivibrio\u003c/em\u003e sp. pr6. QSLA8 was identified as a \u003cem\u003eBacteroidetes bacterium\u003c/em\u003e strain HT31.1, with 94.69% similarity. QSLA9 shared the highest similarity (97.41%) with \u003cem\u003eThalassobacillus\u003c/em\u003e sp. strain JSM1684092. QSLA10 showed 98.11% similarity to \u003cem\u003eOceanobacillus oncorhynchi\u003c/em\u003e strain E. QSLA11 exhibited 92.11% similarity to \u003cem\u003eAliifodinibius\u003c/em\u003e sp. strain ZC14-2. QSLA12 was most closely related to \u003cem\u003eBacillus\u003c/em\u003e sp. JSM 102029, with an 82.35% similarity. QSLA13 was identified as \u003cem\u003eBacillus\u003c/em\u003e strain AS4.2, showing 86.98% similarity. QSLA14 displayed 87.66% similarity to \u003cem\u003eLentibacillus\u003c/em\u003e sp. strain BCHS25. QSLA15 exhibited 87.21% similarity to \u003cem\u003eVirgibacillus halodenitrificans\u003c/em\u003e strain yt08. QSLA16 was identified as an \u003cem\u003euncultured bacterium\u003c/em\u003e clone QAMU23 and/or \u003cem\u003eSphingomonas\u003c/em\u003e sp. LE-239, with similarities of 80.15% and 79.9%, respectively. QSLA17 was most closely related to \u003cem\u003eBacillus\u003c/em\u003e sp. strain 6, showing 74.05% similarity \u003cstrong\u003e(Table\u0026nbsp;5)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eTwenty-eight moderately halophilic bacteria were isolated from three salterns situated in Tamil Nadu, Kerala, and Goa, India. Among these isolates, nine demonstrated 97\u0026ndash;99% similarity to the genus Bacillus, while one isolate exhibited a similarity of 98% to \u003cem\u003eOceanobacillus\u003c/em\u003e. Furthermore, twelve isolates showed 96\u0026ndash;99% similarity to the genus Staphylococcus, two isolates were classified as Pseudomonas with 98% similarity, one isolate was closely associated with the genus \u003cem\u003eEnterobacter\u003c/em\u003e at 98% similarity, and three isolates were related to \u003cem\u003eEnterobacter\u003c/em\u003e, \u003cem\u003eOchrabactrum\u003c/em\u003e, and \u003cem\u003eStenotrophomonas\u003c/em\u003e, with similarities of 98%, 98%, and 96%, respectively \u003cstrong\u003e[\u0026lrm;36]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eIn a parallel study, 74 halophilic bacteria were successfully isolated from Sebkha and Chott saline lake ecosystems, situated in arid and semi-arid ecoclimatic zones of Algeria. Out of these, 16 isolates were identified as being closely related to \u003cem\u003eHalomonas\u003c/em\u003e, 18 to \u003cem\u003eBacillus\u003c/em\u003e, 7 to \u003cem\u003eOceanobacillus\u003c/em\u003e, 5 to \u003cem\u003eVirgibacillus\u003c/em\u003e, 10 to \u003cem\u003eHalobacillus\u003c/em\u003e, and 2 to \u003cem\u003eThalassobacillus\u003c/em\u003e. Notably, one isolate exhibited a 99\u0026ndash;100% similarity to \u003cem\u003eLentibacillus\u003c/em\u003e \u003cstrong\u003e[\u0026lrm;37].\u003c/strong\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\"\u003e\n \u003ch2\u003eSequence deposition in GenBank (NCBI) of isolated halophilic bacteria\u003c/h2\u003e\n \u003cp\u003eIn the current study, eleven sequences from the isolated halophilic bacteria were deposited in the NCBI GenBank, accompanied by their respective accession numbers as detailed in Table\u0026nbsp;6. The remaining six isolates, which presented low or no similarity to existing sequences in GenBank, were excluded from deposition in the database.\u003c/p\u003e\n \u003cp\u003ePrevious investigations have also reported similar bacterial communities in solar salterns and other saline environments. 231 moderately halophilic bacteria and 49 extremely halophilic microorganisms were isolated from various regions of the Howz Soltan playa, a hypersaline lake within the central desert zone of Iran \u003cstrong\u003e[\u0026lrm;29]\u003c/strong\u003e. These isolates were identified as belonging to genera such as \u003cem\u003eSalicola\u003c/em\u003e, \u003cem\u003eHalovibrio\u003c/em\u003e, \u003cem\u003eHalomonas\u003c/em\u003e, \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eOceanobacillus\u003c/em\u003e, \u003cem\u003eThalassobacillus\u003c/em\u003e, \u003cem\u003eVirgibacillus\u003c/em\u003e, \u003cem\u003eGracilibacillus\u003c/em\u003e, \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003ePiscibacillus\u003c/em\u003e, and \u003cem\u003eSalinicoccus\u003c/em\u003e. Additionally, species from the genera were isolated \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003eHalomonas\u003c/em\u003e, \u003cem\u003eThalassobacillus\u003c/em\u003e, \u003cem\u003eBrevibacterium\u003c/em\u003e, and \u003cem\u003eBacillus\u003c/em\u003e from the saline mine soil in Karak, Pakistan \u003cstrong\u003e[\u0026lrm;38]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\"\u003e\n \u003ch2\u003ePhylogenetic affiliation of bacterial isolates\u003c/h2\u003e\n \u003cp\u003eThe sequences obtained from the isolated bacterial strains were aligned using the Clustal W program and subsequently compared with sequences available in GenBank. The resulting data were utilized to construct a phylogenetic tree. The findings of the sequencing analysis, along with the closest phylogenetic affiliations of the bacterial isolates, are presented in \u003cstrong\u003eTable\u0026nbsp;5\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eOur investigation yielded phylogenetically diverse halophilic bacteria, comprising both Gram-negative (G-) and Gram-positive (G+) strains, sourced from four ponds characterized by varying salt concentrations within Qarun Lake. The sequences of these isolates were classified into four principal groups: 8 strains (47.06% of the total isolates) were categorized under Firmicutes, 6 strains (35.29% of the total isolates) under Gammaproteobacteria, 1 strain (5.88% of the total isolates) under Alphaproteobacteria, and 2 strains (11.76% of the total isolates) under the Bacteroidetes group \u003cstrong\u003e(Figs.\u0026nbsp;5 and 6)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eThe Firmicutes group is comprised of three families: Bacillaceae, Planococcaceae, and Staphylococcaceae. Notably, all eight strains are classified within the Bacillaceae family, which includes six distinct genera: \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003eLentibacillus\u003c/em\u003e, \u003cem\u003eOceanobacillus\u003c/em\u003e, \u003cem\u003eThalassobacillus\u003c/em\u003e, and \u003cem\u003eVirgibacillus\u003c/em\u003e. The Gammaproteobacteria contains several groups of significant medical and scientific importance, including the families Halomonadaceae, Vibrionaceae, and Pseudomonadaceae. The Alphaproteobacteria encompasses various families, such as Sphingomonadaceae. The phylogenetic relationships of the isolated strains are depicted separately in \u003cstrong\u003eFig.\u0026nbsp;6\u003c/strong\u003e. The alignment of our isolates with these recognized halophilic bacteria in GenBank further substantiates the halophilic characteristics of the strains examined.\u003c/p\u003e\n \u003cp\u003eThe analysis indicates that Firmicutes constitutes the predominant group, encompassing various Gram-positive genera, particularly \u003cem\u003eBacillus\u003c/em\u003e, which comprises 37.5% of the total. This is followed by \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003eOceanobacillus\u003c/em\u003e, \u003cem\u003eThalassobacillus\u003c/em\u003e, \u003cem\u003eLentibacillus\u003c/em\u003e, and \u003cem\u003eVirgibacillus\u003c/em\u003e, each representing 12.5%. The class Gamma-proteo-bacteria is represented by two families: Halomonadaceae and Vibrionaceae. Within these, 50% of the strains are affiliated with the genus \u003cem\u003eHalomonas\u003c/em\u003e, while the other 50% correspond to \u003cem\u003eSalinivibrio\u003c/em\u003e. Furthermore, the groups Alphaproteobacteria and Bacteroidetes are represented by the genera \u003cem\u003eSphingomonas\u003c/em\u003e (family Sphingomonadaceae) and an unspecified Bacteroidetes bacterium, respectively.\u003c/p\u003e\n \u003cp\u003eSimilar bacterial communities associated with saline environments have been observed, where in both \u0026gamma;-Proteobacteria and Firmicutes emerge as the dominant groups among the total isolates \u003csup\u003e37\u003c/sup\u003e. Moderate halophilic strains were identified from solar salterns, with phylogenetic analysis revealing affiliations with five genera: \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003ePlanococcus\u003c/em\u003e, \u003cem\u003eSalinicoccus\u003c/em\u003e, and \u003cem\u003eHalomonas\u003c/em\u003e \u003cstrong\u003e[\u0026lrm;39]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003ePerforming taxonomic analyses on moderately halophilic bacteria isolated from hypersaline environments, such as solar salterns and salt lakes in Alexandria, Egypt, indicated that 85% of the overall isolates were Gram-negative, predominantly belonging to \u0026gamma;-Proteobacteria. Among these, five genera were identified: \u003cem\u003ePseudoalteromonas\u003c/em\u003e, \u003cem\u003eFlavobacterium\u003c/em\u003e, \u003cem\u003eChromohalobacter\u003c/em\u003e, \u003cem\u003eHalomonas\u003c/em\u003e, and \u003cem\u003eSalegentibacter\u003c/em\u003e. Conversely, 15% of the isolates were Gram-positive, classified under the genera \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003eSalinicoccus\u003c/em\u003e, \u003cem\u003eStaphylococcus\u003c/em\u003e, and \u003cem\u003eTetragenococcus\u003c/em\u003e \u003cstrong\u003e[\u0026lrm;27]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eIn addition, several salt lakes in Romania, exhibiting salinities exceeding 70 g/L, were found to host bacteria across three phyla: Firmicutes, Proteobacteria, and Actinobacteria. Within the phylum Firmicutes, the genera \u003cem\u003eBacillus\u003c/em\u003e, \u003cem\u003eVirgibacillus\u003c/em\u003e, \u003cem\u003eSalinococcus\u003c/em\u003e, \u003cem\u003eMarinococcus\u003c/em\u003e, \u003cem\u003eHalobacillus\u003c/em\u003e, \u003cem\u003ePlanococcus\u003c/em\u003e, \u003cem\u003eThalassobacillus\u003c/em\u003e, and \u003cem\u003eSalimicrobium\u003c/em\u003e were documented. In the phylum Proteobacteria, \u003cem\u003eHalomonas\u003c/em\u003e emerged as the most representative genus, with \u003cem\u003eVibrio\u003c/em\u003e, \u003cem\u003eIdiomarina\u003c/em\u003e, and \u003cem\u003ePsychrobacter\u003c/em\u003e also identified. In the Actinobacteria phylum, \u003cem\u003eNocardiopsis\u003c/em\u003e was noted as the predominant genus \u003cstrong\u003e[\u0026lrm;40].\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eAn aerobic, Gram-negative, yellow-pigmented strain, referenced as KMM 3882, was isolated from the marine bivalve \u003cem\u003eAnadara broughtoni\u003c/em\u003e, collected from Peter the Great Bay in the Sea of Japan. Strain KMM 3882 exhibited significant inhibitory activity against several Gram-positive microorganisms. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain KMM 3882 shares the highest similarity (97.3%) with \u003cem\u003eSphingomonas dokdonensis\u003c/em\u003e DS-4, further similarities ranging from 96.5\u0026ndash;96.7% were observed with \u003cem\u003eSphingomonas pituitosa\u003c/em\u003e DSM 13101, \u003cem\u003eSphingomonas azotifigens\u003c/em\u003e NBRC 15497, \u003cem\u003eSphingomonas asaccharolytica\u003c/em\u003e NBRC 15499, \u003cem\u003eSphingomonas trueperi\u003c/em\u003e DSM 7225, and \u003cem\u003eSphingomonas panni\u003c/em\u003e DSM 15761. Consequently, it has been classified as a novel species within the genus \u003cem\u003eSphingomonas\u003c/em\u003e, proposed under the name \u003cem\u003eSphingomonas molluscorum\u003c/em\u003e sp. nov. \u003cstrong\u003e[\u0026lrm;41].\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eSphingomonas japonica\u003c/em\u003e sp. nov. represents a novel halo-bacterial strain that was isolated from a marine crustacean specimen sourced from the Sea of Japan \u003cstrong\u003e[\u0026lrm;42].\u003c/strong\u003e The strain underwent a comprehensive polyphasic study. Comparative analysis of the 16S rRNA gene sequences positioned this novel strain within the genus \u003cem\u003eSphingomonas\u003c/em\u003e, demonstrating 96.1% similarity to \u003cem\u003eS. trueperi\u003c/em\u003e, \u003cem\u003eSphingomonas dokdonensis\u003c/em\u003e DS-4, and \u003cem\u003eS\u003c/em\u003e. \u003cem\u003eazotifigens\u003c/em\u003e NBRC LMG 2142.\u003c/p\u003e\n \u003cp\u003eIn the current study, we successfully isolated halo-bacteria from various phyla, including Firmicutes, Gammaproteobacteria, Bacteroidetes, and Alphaproteobacteria. In contrast, the conducted research did not yield members from the Bacteroidetes phylum in the sediment of saline lake ecosystems known as \u0026ldquo;Sebkhas and Chotts\u0026rdquo; \u003cstrong\u003e[\u0026lrm;37].\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003ePrior investigations identified strains from genera such as \u003cem\u003eSalinicoccus, Staphylococcus, Planococcus*, Pseudomonas, Chromohalobacter\u003c/em\u003e, and \u003cem\u003eNocardiopsis\u003c/em\u003e. However, in the present study, no strains from these genera were isolated. The variances noted in this investigation compared to previous reports may be ascribed to differences in culture conditions, media composition, and the techniques employed for isolation \u003cstrong\u003e[\u0026lrm;43]\u003c/strong\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\"\u003e\n \u003ch2\u003eBioinformatics and predicting the existence of bioactive compounds\u003c/h2\u003e\n \u003cp\u003eBased on the analyzed 16S rDNA sequences, we identified the complete genome of the closest strains for each isolate from GenBank and subsequently predicted the outer membrane proteins (OMPs). The draft genomes of QSLA1, QSLA2, QSLA3, QSLA4, QSLA5, QSLA7, and QSLA12 encode a diverse array of proteins, the functions of most of which are well-established, including adhesion, secretory proteins, enzymes, non-specific channels, receptors, specific channels, and structural proteins. Additionally, certain predicted proteins exhibit unknown functions. It is noteworthy that bioinformatics analysis suggested that the genome of QSLA16 encodes approximately 933 proteins, all of which are associated with biogenesis and secretion, as illustrated in the accompanying heatmap \u003cstrong\u003e(Fig.\u0026nbsp;7 and\u003c/strong\u003e Tables 7 \u0026amp; 8\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eAdhesion molecules, which are cell surface proteins, facilitate interactions between cells or between cells and the extracellular matrix (ECM\u003cstrong\u003e) [\u0026lrm;44]\u003c/strong\u003e. Secretory proteins play a crucial role in the synthesis, folding, and transport of various cellular proteins \u003cstrong\u003e[\u0026lrm;45]\u003c/strong\u003e. Non-specific channel proteins permit the diffusion of sugars, sugar phosphates, nucleotides, amino acids, and polyethylene glycols, provided that their molecular weights are less than 600. In contrast, specific channels enable the diffusion of solutes with molecular weights exceeding 600 \u003cstrong\u003e[\u0026lrm;46]\u003c/strong\u003e. Receptor proteins represent a specialized class that binds to specific ligand molecules (Boll et al., 1995), while structural proteins are essential for maintaining the cellular shape and architecture of organisms \u003cstrong\u003e[\u0026lrm;47]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eTable 8 presents the predicted functional annotation of proteins encoded by the outer membrane of the isolated bacterial strains, based on analysis using the OMPdb database. The proteins were classified into functional categories, including adhesion, secretory proteins, enzymes, non-specific and specific channels, receptors, structural proteins, and proteins of unknown function. The distribution of functional proteins varied notably among the strains. For example, strain QSLA12 exhibited the highest number of receptor proteins (4348) and secretory proteins (492), while QSLA16 showed a dominant presence of proteins categorized under unknown function (933), with no other predicted categories identified. Strains such as QSLA3 and QSLA4 displayed a broad range of functional classes, indicating a potentially versatile membrane protein profile. Notably, strains QSLA5, QSLA6 and QSLA7 showed limited functional diversity, with a higher representation of secretory and structural proteins. These findings highlight the functional heterogeneity of outer membrane proteins across different isolates and point to their potential roles in microbial adaptation, environmental interaction, and possible biotechnological applications.\u003c/p\u003e\n \u003cp\u003eBioinformatics has been employed to assess bioactive peptides in proteins \u003cstrong\u003e[\u0026lrm;48]\u003c/strong\u003e. It was demonstrated that applying bioinformatics predictions to determine the functions of bioactive peptides achieved an average accuracy exceeding 95%. This method identified 11 functional categories of putative bioactive peptides, which are anticipated to be experimentally characterized and are expected to have applications in pharmaceuticals and cosmetics \u003cstrong\u003e[\u0026lrm;49]\u003c/strong\u003e. Bioinformatics tools were utilized to examine the taxonomic composition and functional diversity of halophilic microbial communities in the El-Rawda solar saltern in North Sinai, Egypt. The EggNOG functional inference classified the genera into two primary categories: Information Storage and Processing (categories 1209.2083 and 3164) encompassing translation, ribosome structure and biogenesis, and processes such as transcription, replication, recombination, and repair. The second category, Cellular Processes and Signaling (categories 1428.9884 and 3793), included defense mechanisms, intracellular trafficking, secretion, vesicular transport, signal transduction mechanisms, post-translational modification, protein turnover, chaperone functions, cell motility, as well as cell wall and membrane biogenesis, along with cell cycle control, cell division, and chromosome partitioning. Additionally, metabolism was categorized into two areas: brine (2470.2212) and sediment (8358), which included lipid transport and metabolism, inorganic acid transport and metabolism, carbohydrate transport, nucleic acid transport, amino acid transport, the biosynthesis and catabolism of secondary metabolites, and energy production and conversion \u003cstrong\u003e[\u0026lrm;51]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eIn a study evaluating the antimicrobial activity of QSLA1, QSLA2, and QSLA3 isolates against highly aggressive plant pathogens, the results showed that QSLA1 isolate possessed antifungal activity against \u003cem\u003eFusarium oxysporium\u003c/em\u003e and \u003cem\u003eAlternaria solani\u003c/em\u003e, as well as antibacterial activity against \u003cem\u003eRalstonia solanacearum\u003c/em\u003e. In contrast, QSLA2 and QSLA3 isolates exhibited antibacterial activity against \u003cem\u003eRalstonia solanacearum\u003c/em\u003e but did not show antifungal activity against the pathogenic fungi used in the study \u003cstrong\u003e[\u0026lrm;50]\u003c/strong\u003e.\u003c/p\u003e\n \u003cp\u003eThe presence of the genes encoding for NRPs in the two isolates QSLA16 and QSLA17 was examined using PCR technique. It was revealed that QSLA16 and QSLA17 contain surfactin and fengycin genes while mycosubtilin gene was detected only in QSLA17 isolate. HPLC results showed that isolate QSLA16 produced surfactin and fengycins, with concentrations of 98 mg/l and 45 mg/l, respectively, while isolate QSLA17 produced surfactin, fengycins and iturin, with concentrations of 112 mg/l, 38 mg/l and 67 mg/l, respectively. Therefore, QSLA16 showed antibacterial activity against \u003cem\u003esalmonella typhi, Acinetobacter baumanni\u003c/em\u003e (Figure, 8 and Table, 4) and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e but it had no effect on \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eKlebsiella pneumonia\u003c/em\u003e and \u003cem\u003eProteus mirabilis\u003c/em\u003e \u003cstrong\u003e\u0026lrm;[52].\u003c/strong\u003e According to the bioinformatics analysis the antimicrobial activity of QSLA1, QSLA2, QSLA3, and QSLA16 isolates against phytopathogens and human pathogens in the previous studies might be caused by the activity of outer membrane proteins of the isolates.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates the successful isolation and characterization of 16 halophilic and halotolerant bacterial strains from the saline environment of Lake Qarun. The isolates were identified based on their cultural characteristics, Gram staining, and spore-forming ability, and further confirmed through genetic analysis and phylogenetic tree construction. The predicted outer membrane proteins of these isolates show potential for various applications in agriculture, industry, medicine, and food production. Future studies can explore the use of these bacterial strains as bio fertilizers, biocontrol agents, and sources of novel enzymes and bioactive compounds, contributing to sustainable development and innovation in various fields.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding details:\u003c/strong\u003e If the paper is accepted the publishing will be funded according to the Open Access Agreement for Egypt between Springer Nature and Science, Technology\u0026amp; Innovation Funding Authority (STDF) in cooperation with Egyptian Knowledge Bank (EKB).\u003c/p\u003e\n\u003cp\u003eData availability: sequence data that support the findings of this study have been deposited in NCBI with the primary accession codes OP442496, OP442497, OP442498, OP442514, OP442934, OP442518, OP442526, OP443586, OP494267, OP443587, and OP442600\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNaghoni, A. \u003cem\u003eet al.\u003c/em\u003e Microbial diversity in the hypersaline Lake Meyghan, Iran. \u003cem\u003eSci Rep\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 11522 (2017).\u003c/li\u003e\n\u003cli\u003eVentosa, A. \u0026amp; Arahal, D. R. Physico-Chemical Characteristics of Hypersaline Environments and Their Biodiversity - Ventosa A. \u003cem\u003eEncyclopedia of Life Support Systems (EOLSS). Extremophiles, Vol. II\u003c/em\u003e (2011).\u003c/li\u003e\n\u003cli\u003eEdbeib, M. F., Wahab, R. A. \u0026amp; Huyop, F. Halophiles: biology, adaptation, and their role in decontamination of hypersaline environments. \u003cem\u003eWorld J Microbiol Biotechnol\u003c/em\u003e\u003cstrong\u003e32\u003c/strong\u003e, 135 (2016).\u003c/li\u003e\n\u003cli\u003eVigneshwari, Arjunan, G., .P, M., Natesan, V. \u0026amp; P.K, S. Review on halophilic microbes and their applications. \u003cstrong\u003e10\u003c/strong\u003e, 23\u0026ndash;36 (2022).\u003c/li\u003e\n\u003cli\u003eOren, A. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. \u003cem\u003eSaline Systems\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 2 (2008).\u003c/li\u003e\n\u003cli\u003eDahiya, B. P. Bioinformatics impacts on medicine, microbial genome and agriculture. \u003cem\u003eJ Pharmacogn Phytochem\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 1938\u0026ndash;1942 (2017).\u003c/li\u003e\n\u003cli\u003eBatley, J. \u0026amp; Edwards, D. The application of genomics and bioinformatics to accelerate crop improvement in a changing climate. \u003cem\u003eCurrent Opinion in Plant Biology\u003c/em\u003e\u003cstrong\u003e30\u003c/strong\u003e, 78\u0026ndash;81 (2016).\u003c/li\u003e\n\u003cli\u003eKushwaha, U. K. S. Role of Bioinformatics in Crop Improvement. \u003cem\u003eGlobal Journal of Science Frontier Research\u003c/em\u003e\u003cstrong\u003e17\u003c/strong\u003e, 13\u0026ndash;23 (2017).\u003c/li\u003e\n\u003cli\u003eBenito, J. M., Lovrich, G. A., Si\u0026ntilde;eriz, F. \u0026amp; Abate, C. M. Isolation and Molecular Characterization of Seawater Bacteria. in \u003cem\u003eEnvironmental Microbiology\u003c/em\u003e (eds. Walker, J. M., Spencer, J. F. T. \u0026amp; Ragout De Spencer, A. L.) 3\u0026ndash;9 (Humana Press, Totowa, NJ, 2004). doi:10.1385/1-59259-765-3:003.\u003c/li\u003e\n\u003cli\u003eHucker, G. J. \u0026amp; Conn, H. J. Methods Of Gram Staining. (1923).\u003c/li\u003e\n\u003cli\u003eGoszczynska, T. \u003cem\u003eIntroduction to Practical Phytobacteriology; A Manual for Phytobacteriology\u003c/em\u003e. (2000).\u003c/li\u003e\n\u003cli\u003eWhittenbury, R. HYDROGEN PEROXIDE FORMATION AND CATALASE ACTIVITY IN THE LACTIC ACID BACTERIA. \u003cem\u003eJ Gen Microbiol\u003c/em\u003e\u003cstrong\u003e35\u003c/strong\u003e, 13\u0026ndash;26 (1964).\u003c/li\u003e\n\u003cli\u003eRamadoss, D., Lakkineni, V. K., Bose, P., Ali, S. \u0026amp; Annapurna, K. Mitigation of salt stress in wheat seedlings by halotolerant bacteria isolated from saline habitats. \u003cem\u003eSpringerPlus\u003c/em\u003e\u003cstrong\u003e2\u003c/strong\u003e, 6 (2013).\u003c/li\u003e\n\u003cli\u003eBroderick, N. A., Raffa, K. F., Goodman, R. M. \u0026amp; Handelsman, J. Census of the Bacterial Community of the Gypsy Moth Larval Midgut by Using Culturing and Culture-Independent Methods. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e\u003cstrong\u003e70\u003c/strong\u003e, 293\u0026ndash;300 (2004).\u003c/li\u003e\n\u003cli\u003eSambrook, J. \u003cem\u003eMolecular Cloning: A Laboratory Manual\u003c/em\u003e. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).\u003c/li\u003e\n\u003cli\u003eMwirichia, R., Cousin, S., Muigai, A. W., Boga, H. I. \u0026amp; Stackebrandt, E. Bacterial diversity in the haloalkaline Lake Elmenteita, Kenya. \u003cem\u003eCurr Microbiol\u003c/em\u003e\u003cstrong\u003e62\u003c/strong\u003e, 209\u0026ndash;221 (2011).\u003c/li\u003e\n\u003cli\u003eRoux, K. H. Optimization and troubleshooting in PCR. \u003cem\u003eCold Spring Harb Protoc\u003c/em\u003e\u003cstrong\u003e2009\u003c/strong\u003e, pdb.ip66 (2009).\u003c/li\u003e\n\u003cli\u003eVan der Lelie, D. \u003cem\u003eet al.\u003c/em\u003e Use of single-point genome signature tags as a universal tagging method for microbial genome surveys. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e\u003cstrong\u003e72\u003c/strong\u003e, 2092\u0026ndash;2101 (2006).\u003c/li\u003e\n\u003cli\u003eAltschul, S. F. \u003cem\u003eet al.\u003c/em\u003e Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. \u003cem\u003eNucleic Acids Research\u003c/em\u003e\u003cstrong\u003e25\u003c/strong\u003e, 3389\u0026ndash;402 (1997).\u003c/li\u003e\n\u003cli\u003eSaitou, N. \u0026amp; Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. \u003cem\u003eMol Biol Evol\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 406\u0026ndash;425 (1987).\u003c/li\u003e\n\u003cli\u003eKumar, S., Stecher, G., Li, M., Knyaz, C. \u0026amp; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. \u003cem\u003eMol Biol Evol\u003c/em\u003e\u003cstrong\u003e35\u003c/strong\u003e, 1547\u0026ndash;1549 (2018).\u003c/li\u003e\n\u003cli\u003eThe UniProt Consortium. UniProt: the Universal Protein Knowledgebase in 2025. \u003cem\u003eNucleic Acids Research\u003c/em\u003e gkae1010 (2024) doi:10.1093/nar/gkae1010.\u003c/li\u003e\n\u003cli\u003eRoumia, A. F. \u003cem\u003eet al.\u003c/em\u003e OMPdb: A Global Hub of Beta-Barrel Outer Membrane Proteins. \u003cem\u003eFront. Bioinform.\u003c/em\u003e\u003cstrong\u003e0\u003c/strong\u003e, (2021).\u003c/li\u003e\n\u003cli\u003eEddy, S. R. Profile hidden Markov models. \u003cem\u003eBioinformatics (Oxford, England)\u003c/em\u003e\u003cstrong\u003e14\u003c/strong\u003e, 755\u0026ndash;63 (1998).\u003c/li\u003e\n\u003cli\u003eSuthar, M. P., Hajoori, M. A., Chaudhari, R. R. \u0026amp; Desai, S. A. Isolation, Screening \u0026amp; Characterization of Potent Biosurfactant producing Bacteria from Oil Contami-nated Site. \u003cem\u003eBioscience Discovery\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 375\u0026ndash;381 (2017).\u003c/li\u003e\n\u003cli\u003eHopwood, D. A. Phase-contrast observations on Streptomyces coelicolor. \u003cem\u003eJ Gen Microbiol\u003c/em\u003e\u003cstrong\u003e22\u003c/strong\u003e, 295\u0026ndash;302 (1960).\u003c/li\u003e\n\u003cli\u003eGhozlan, H., Deif, H., Kandil, R. A. \u0026amp; Sabry, S. Biodiversity of moderately halophilic bacteria in hypersaline habitats in Egypt. \u003cem\u003eJ Gen Appl Microbiol\u003c/em\u003e\u003cstrong\u003e52\u003c/strong\u003e, 63\u0026ndash;72 (2006).\u003c/li\u003e\n\u003cli\u003eVentosa, A. \u0026amp; Nieto, J. J. Biotechnological applications and potentialities of halophilic microorganisms. \u003cem\u003eWorld J Microbiol Biotechnol\u003c/em\u003e\u003cstrong\u003e11\u003c/strong\u003e, 85\u0026ndash;94 (1995).\u003c/li\u003e\n\u003cli\u003e\u003cem\u003eHalophiles: Biodiversity and Sustainable Exploitation\u003c/em\u003e. (Springer, Cham, 2015).\u003c/li\u003e\n\u003cli\u003eMohamedin, A., Elsayed, A., Abdalla, A. \u0026amp; EL-Dohlab, S. Characterization of Some Extremely Halophilic Bacteria Isolated from Salt Marshes of Gamasa Egypt. \u003cem\u003eJournal of Plant Production\u003c/em\u003e\u003cstrong\u003e9\u003c/strong\u003e, 521\u0026ndash;529 (2018).\u003c/li\u003e\n\u003cli\u003eGibbons, N. E. Chapter VIII Isolation, Growth and Requirements of Halophilic Bacteria. in \u003cem\u003eMethods in Microbiology\u003c/em\u003e (eds. Norris, J. R. \u0026amp; Ribbons, D. W.) vol. 3 169\u0026ndash;183 (Academic Press, 1969).\u003c/li\u003e\n\u003cli\u003eSehgal, S. N. \u0026amp; Gibbons, N. E. Effect of some metal ions on the growth of Halobacterium cutirubrum. \u003cem\u003eCan J Microbiol\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 165\u0026ndash;169 (1960).\u003c/li\u003e\n\u003cli\u003eTrabelsi, D., Mengoni, A., Elarbi Aouani, M., Mhamdi, R. \u0026amp; Bazzicalupo, M. Genetic diversity and salt tolerance of bacterial communities from two Tunisian soils. \u003cem\u003eAnn. Microbiol.\u003c/em\u003e\u003cstrong\u003e59\u003c/strong\u003e, 25\u0026ndash;32 (2009).\u003c/li\u003e\n\u003cli\u003eYaradoddi, J. CULTURABLE DIVERSITY OF EXTREMELY HALOPHILIC BACTERIA FROM WEST COAST OF KARNATAKA, INDIA. \u003cem\u003eInternational Journal of Biology, Pharmacy and Allied Sciences\u003c/em\u003e\u003cstrong\u003e2\u003c/strong\u003e, 391\u0026ndash;405 (2013).\u003c/li\u003e\n\u003cli\u003ePaul, S. \u003cem\u003eet al.\u003c/em\u003e Isolation and Characterization of Salt Tolerant Bacteria from Sambhar Lake for Plant Growth Promoting Activities. (2015).\u003c/li\u003e\n\u003cli\u003eRathakrishnan, D. \u0026amp; Gopalan, A. K. Isolation and characterization of halophilic isolates from Indian salterns and their screening for production of hydrolytic enzymes. \u003cem\u003eEnvironmental Challenges\u003c/em\u003e\u003cstrong\u003e6\u003c/strong\u003e, 100426 (2022).\u003c/li\u003e\n\u003cli\u003eMenasria, T. \u003cem\u003eet al.\u003c/em\u003e Culturable halophilic bacteria inhabiting Algerian saline ecosystems: A source of promising features and potentialities. \u003cem\u003eWorld J Microbiol Biotechnol\u003c/em\u003e\u003cstrong\u003e35\u003c/strong\u003e, 132 (2019).\u003c/li\u003e\n\u003cli\u003eRoohi, A., Ahmed, I., Iqbal, M. \u0026amp; Jamil, M. Preliminary isolation and characterization of halotolerant and halophilic bacteria from salt mines of Karak, Pakistan. \u003cem\u003ePakistan Journal of Botany\u003c/em\u003e\u003cstrong\u003e44\u003c/strong\u003e, 365\u0026ndash;370 (2012).\u003c/li\u003e\n\u003cli\u003eChen, L. \u003cem\u003eet al.\u003c/em\u003e Phylogenetic analysis and screening of antimicrobial and cytotoxic activities of moderately halophilic bacteria isolated from the Weihai Solar Saltern (China). \u003cem\u003eWorld J Microbiol Biotechnol\u003c/em\u003e\u003cstrong\u003e26\u003c/strong\u003e, 879\u0026ndash;888 (2010).\u003c/li\u003e\n\u003cli\u003eRuginescu, R. \u003cem\u003eet al.\u003c/em\u003e Bioprospecting for Novel Halophilic and Halotolerant Sources of Hydrolytic Enzymes in Brackish, Saline and Hypersaline Lakes of Romania. \u003cem\u003eMicroorganisms\u003c/em\u003e\u003cstrong\u003e8\u003c/strong\u003e, 1903 (2020).\u003c/li\u003e\n\u003cli\u003eRomanenko, L. A. \u003cem\u003eet al.\u003c/em\u003e Sphingomonas molluscorum sp. nov., a novel marine isolate with antimicrobial activity. \u003cem\u003eInt J Syst Evol Microbiol\u003c/em\u003e\u003cstrong\u003e57\u003c/strong\u003e, 358\u0026ndash;363 (2007).\u003c/li\u003e\n\u003cli\u003eRomanenko, L. A., Tanaka, N., Frolova, G. M. \u0026amp; Mikhailov, V. V. Sphingomonas japonica sp. nov., isolated from the marine crustacean Paralithodes camtschatica. \u003cem\u003eInt J Syst Evol Microbiol\u003c/em\u003e\u003cstrong\u003e59\u003c/strong\u003e, 1179\u0026ndash;1182 (2009).\u003c/li\u003e\n\u003cli\u003eMenasria, T. \u003cem\u003eet al.\u003c/em\u003e Diversity and bioprospecting of extremely halophilic archaea isolated from Algerian arid and semi-arid wetland ecosystems for halophilic-active hydrolytic enzymes. \u003cem\u003eMicrobiological Research\u003c/em\u003e\u003cstrong\u003e207\u003c/strong\u003e, 289\u0026ndash;298 (2018).\u003c/li\u003e\n\u003cli\u003eRen, G., Roberts, A. I. \u0026amp; Shi, Y. Adhesion molecules: key players in Mesenchymal stem cell-mediated immunosuppression. \u003cem\u003eCell Adh Migr\u003c/em\u003e\u003cstrong\u003e5\u003c/strong\u003e, 20\u0026ndash;22 (2011).\u003c/li\u003e\n\u003cli\u003eBarlowe, C. K. \u0026amp; Miller, E. A. Secretory protein biogenesis and traffic in the early secretory pathway. \u003cem\u003eGenetics\u003c/em\u003e\u003cstrong\u003e193\u003c/strong\u003e, 383\u0026ndash;410 (2013).\u003c/li\u003e\n\u003cli\u003eNikaido, H., Luckey, M. \u0026amp; Rosenberg, E. Y. Nonspecific and specific diffusion channels in the outer membrane of Escherichia coli. \u003cem\u003eJ Supramol Struct\u003c/em\u003e\u003cstrong\u003e13\u003c/strong\u003e, 305\u0026ndash;313 (1980).\u003c/li\u003e\n\u003cli\u003eNumata, K. How to define and study structural proteins as biopolymer materials. \u003cem\u003ePolym J\u003c/em\u003e\u003cstrong\u003e52\u003c/strong\u003e, 1043\u0026ndash;1056 (2020).\u003c/li\u003e\n\u003cli\u003ePhetchthumrongchai, T. \u003cem\u003eet al.\u003c/em\u003e Properties of Protein Hydrolysates and Bioinformatics Prediction of Peptides Derived from Thermal and Enzymatic Process of Skipjack Tuna (Katsuwonus pelamis) Roe. \u003cem\u003eFishes\u003c/em\u003e\u003cstrong\u003e7\u003c/strong\u003e, 255 (2022).\u003c/li\u003e\n\u003cli\u003eTachapuripunya, V., Roytrakul, S., Chumnanpuen, P. \u0026amp; E-Kobon, T. Unveiling Putative Functions of Mucus Proteins and Their Tryptic Peptides in Seven Gastropod Species Using Comparative Proteomics and Machine Learning-Based Bioinformatics Predictions. \u003cem\u003eMolecules\u003c/em\u003e\u003cstrong\u003e26\u003c/strong\u003e, 3475 (2021).\u003c/li\u003e\n\u003cli\u003eMousa, A. A. A., Mahmoud, W. H., Elsaied, H. E. \u0026amp; Elbeltagy, A. E. \u003cem\u003eHalomonas\u003c/em\u003e sp. for sustainable agriculture: a potential halo-bio-fertilizer for tomato plants with bio-control activity against \u003cem\u003eFusarium\u003c/em\u003e wilt under saline environments. Preprint at https://doi.org/10.21203/rs.3.rs-5653815/v1 (2025).\u003c/li\u003e\n\u003cli\u003eElshafey, N. \u003cem\u003eet al.\u003c/em\u003e Phylogeny and functional diversity of halophilic microbial communities from a thalasso environment. \u003cem\u003eSaudi Journal of Biological Sciences\u003c/em\u003e\u003cstrong\u003e30\u003c/strong\u003e, 103841 (2023).\u003c/li\u003e\n\u003cli\u003eAbd-Elmonaem, A. A., Mahmoud, Wafaa H., Elsaied, H. \u0026amp; Elbeltagy, A. E. Efficiency of non-ribosomal lipopeptides (nrps) produced by salt tolerant bacteria against some pathogenic bacteria\u003cstrong\u003e.\u003c/strong\u003e\u003cem\u003eMenoufia J. Agric. Biotechnology\u003c/em\u003e, Volume \u003cstrong\u003e8\u003c/strong\u003e Issue 1: 1 \u0026ndash; 18 (2023).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 2,3 and 8","content":"\u003cp\u003eTable 2,3 and 8 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7308332/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7308332/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study included the isolation and characterization of halophilic and halotolerant bacteria from the solar salterns of Qarun Lake, Fayoum, Egypt. A total of seventeen bacterial strains were isolated, of which fifteen were identified as halophilic and two as halotolerant, based on their salt growth requirements. Phylogenetic analysis revealed that the isolates clustered into four distinct groups, with members of the phylum Firmicutes representing the dominant group (47.06%). Biochemical characterization indicated that 52.94% of the isolates were Gram-negative, and all exhibited motility and catalase activity. Salt tolerance assays confirmed that two isolates could grow without added salt, while the remaining strains required salt for growth, supporting their classification as halotolerant and halophilic, respectively. Notably, 70.59% of the isolates were classified as extremely halophilic. Based on 16S rDNA sequence analysis, the closest related strains were identified from GenBank, and the functional potential of their outer membrane proteins (OMPs) was predicted. Draft genome analysis of 88.24% of the isolates revealed the presence of genes encoding various functional proteins, including those involved in adhesion, secretion, enzymatic activity, and membrane transport, although some protein functions remain uncharacterized. This study contributes to the understanding of halophilic microbial diversity in Egyptian hypersaline environments and provides insights into their potential functional roles. Future research will aim to explore their biotechnological applications and ecological significance.\u003c/p\u003e","manuscriptTitle":"Characterization and in Silico analysis of outer membrane proteins in halophilic and halotolerant bacteria which isolated from Qarun Lake solar salterns","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-07 09:08:47","doi":"10.21203/rs.3.rs-7308332/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d8559db-c2b7-4c29-ba06-984231360ed0","owner":[],"postedDate":"August 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52738503,"name":"Biological sciences/Computational biology and bioinformatics"},{"id":52738504,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2025-09-08T04:08:41+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-07 09:08:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7308332","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7308332","identity":"rs-7308332","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0