Search for the elusive haplotype of the APOE polymorphism associated with Alzheimer’s disease

Search for the elusive haplotype of the APOE polymorphism associated with Alzheimer’s disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Search for the elusive haplotype of the APOE polymorphism associated with Alzheimer’s disease Asma Naseer Cheema, Elizabeth Lawrence, Narges Zafari, Kang-Hsien Fan, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4902566/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 May, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract The common APOE2/E3/E4 polymorphism is determined by two-site haplotypes: C112R and R158C. Due to strong linkage disequilibrium between the two sites, three of the four expected haplotypes/alleles ( E2, E3, E4 ) have been observed. Compared to the most common haplotype of E3 (C112 – R158), the E4 (R112 – R158) and E2 (C112 – C158) haplotypes are determined by a single-point mutation at codons 112 and 158, respectively. The fourth haplotype ( E5 ) having mutations at both sites (R112–C158) has been reported only as an incidental finding in three kindreds. To our knowledge, no systematic search has been done to determine its distribution in the general population. The objective of this study was to search for the elusive haplotype in 355 APOE 2/4 subjects derived from 14,819 genotyped subjects. A DNA fragment of 177bp from APOE 2/4 subjects was subcloned into competent bacterial cells to construct the phased haplotype clones followed by Sanger sequencing. We also used Whole-genome sequencing and RFLP assay to search for the fourth haplotype. All three strategies confirmed that the E4 and E2 alleles are present on opposite chromosomes, with no example having both alleles on the same chromosome, suggesting E5 might have minimum effect, if any, on disease risk. Biological sciences/Biological techniques Biological sciences/Genetics Biological sciences/Molecular biology APOE haplotype Cloning Sequencing Restriction-fragment length polymorphism (RFLP) Genotyping Figures Figure 1 Figure 2 Figure 3 Introduction The common APOE2/E3/E4 polymorphism is determined by two-site haplotypes at codon 112 [cysteine (C) > arginine (R)] and codon 158 (R > C), resulting in six genotypes. Due to strong linkage disequilibrium (LD) between the two sites, three of the four expected haplotypes or alleles ( E2, E3 , and E4 ) have been observed and extensively studied in relation to the risk of Alzheimer’s disease (AD) risk [ 1 , 2 ] . Compared to the most common haplotype of E3 (C112 – R158), the mutant E4 (R112 – R158) and E2 (C112 – C158) haplotypes are determined by single-point mutations: T > C transition at codon 112 ( T GC to C GC for E4 ) and C > T transition at codon158 ( C GC to T GC for E2). The fourth haplotype, which we denote here as APOE5 and explained later, having amino acid substitutions at both positions (R112 – C158) has been reported only as an incidental finding in three kindreds [ 3 – 5 ] . Genetically determined structural variation in APOE was originally described using two-dimensional gel electrophoresis or isoelectric focusing (IEF) from ultracentrifuged and delipidated plasma [ 6 – 8 ] . which was subsequently simplified for APOE genotyping directly from plasma without prior ultracentrifugation and dilapidation for large-scale population screening [ 9 ] .Gel electrophoresis that separates plasma APOE isoforms based on their size, charge, or isoelectric point differences, can also enable the identification of new APOE allelic isoforms is not possible to determine using the current TaqMan assays as they are specific for detecting genomic variations at codons 112 and 158 only. Individuals with the APOE 2/4 genotypes are double heterozygotes at codons 112 and 158 and due to strong LD between the two sites, it is always assumed that the alleles for E4 (R112) and E2 (C158) are present on opposite chromosomes. Since TaqMan assays do not reveal the two-site haplotype phases, it is possible that some of the APOE 2/4 individuals may carry the APOE5 haplotype where both alleles (R112 and C158) are present on the same haplotype and inherited from a single parent. This could only be accomplished unequivocally by either subcloning followed by single-strand sequencing or next-generation whole-genomic sequencing (WGS). To our knowledge, no such systematic effort has been made to determine the haplotype phases and the occurrence of the APOE5 haplotype in the general population. The objective of this study was to search for the elusive APOE5 haplotype by using combination of subcloning, WGS or restriction fragment length polymorphism (RFLP) assays in a large number of APOE 2/4 subjects and determine its potential association with AD. Methods This study was approved by the University of Pittsburg institutional Review Board and informed consent was obtained from all the subjects prior to their participation in the study. All the experimental protocols were reviewed and approved by Department of Human Genetics, School of Public Health University of Pittsburgh and were performed in accordance with the approved guidelines and regulations of the dpartemnt. APOE genotype data on 14,819 subjects (mean age = 72.7 years; female = 56.6%; Table 1 ) derived from multiple studies [ 10 – 13 ] was used in this study. All subjects previously classified as APOE 2/4 were re-genotyped by TaqMan assays for the two APOE SNPs: rs429358 ( E4 ) and rs7412 ( E2 ) to confirm the APOE 2/4 genotype. For subcloning, A 177 bp product with single deoxyadenosine (A) overhang on 3’ end was PCR amplified from genomic DNA (0.5-1.0 µg) using primers [5’GCGGACATGGAGGACGTG-3’; 5’GGCCTGGTACACTGCCAG-3’] [ 14 ] . and confirmed by running on agarose gel with 1X TBE buffer. The PCR product was purified using QIAGEN purification kit and ligated into 4kb PCR™ II-TOPO linearized vector with single 3’ deoxythymidine(T) residue and Ampicillin resistance ORF (bases 2173–3033), then transformed into chemically competent bacterial cells ( E. coli DH5αTM -T1 R) ) to construct the phased haplotype clones of 177 bp derived from the maternal or paternal chromosome. The clones were cultured on Luria-Bertani (LB) agar containing ampicillin to get multiple copies of the constructed clone. To differentiate the bacterial colonies from the successful clone constructs, 40mg/ml X-gal was spread onto the plates before culturing the clone. To create a stock of each colony, the colonies with successful constructs were incubated separately overnight at 37°C into 3mL LB broth containing ampicillin. DNA was isolated from the cultured colony cells using Biolab miniprep plasmid DNA kit followed by sequencing with M13 forward and reverse primers. The sequencher (v5.4.6) software was used to analyze the inserted phased haplotype. Table 1 A. Demographic and APOE Genotype/Allele data in study participants Total Sample (N = 14819) AD Cases (N = 3280) Controls (N = 11535) P-value between cases and controls Mean age ± SD 72.7 ± 14.2 72.1 ± 9.8 72.9 ± 15.2 4.94E-04 Female, N (%) 8142 (56.6) 2000 (61.0) 6141 (55.4) 1.20E-08 White/Black/ Others (%) 86.8/12.7/0.5 93.4/6.3/0.3 84.8/14.6/0.6 1.36E-36 APOE Genotype N (%) 1.95E-238 2/2 88 (0.6) 8(0.2) 80 (0.7) 2/3 1557 (10.5) 163(5.0) 1394(12.1) 2/4 355 (2.4) 88(2.7) 267(2.3) 3/3 8254 (55.7) 1280(39.0) 6973(60.5) 3/4 3948 (26.6) 1415(43.1) 2531(21.9) 4/4 617 (4.2) 326(10.0) 290(2.5) APOE Allele Frequency (%) 7.08E-254 E2 7.1 4.1 7.9 E3 74.2 63.1 77.5 E4 18.7 32.8 14.6 Table 1 B. Odds ratios (ORs) for APOE Genotypes using APOE 3/3 as reference APOE Genotype ORs (95% confidence interval) P-Value 2/2 0.73 (0.32–1.45) 0.41 2/3 0.65(0.54–0.77) 1.64E-06 2/4 2.01(1.55–2.58) 8.92E-08 3/4 3.26(2.97–3.58) 2.72E-137 4/4 6.87(5.70–8.30) 4.50E-90 We also employed an RFLP assay, utilizing two different enzymes to discern the APOE5 haplotype (Murrell et al., 2006). We amplified a 221 bp PCR product using forward (5’CTGTCCAAGGAGCTGCAG 3’) and reverse (5’ GCCCCGGCCTGGTACACTGCCAG 3’) primers followed by overnight digestion at 37°C with a 3:2 ratio of smartcut enzymes Afl III (for codon 112 digestion) and Hae II (for codon 158 digestion). The samples were loaded onto a 3.5% metaphor GEL using 1XTBE buffer alongside a 50 bp ladder. The Afl III enzyme cleaves at codon112 only in the presence of nucleotide T GC (C112), while the Hae II enzyme cleaves only if there is nucleotide C GC (R158) at codon158. Whereas the cutting sites at both positions would be abolished in the E5 haplotype ( C GC/R112 and T GC/C158). Results Demographic characteristics of the subjects: Demographics information along with the APOE genotype/allele frequencies in the total sample and sample stratified by case-control are provided in Table 1 . Of 14,819 individuals four subject lacked case control status. As expected, the frequency of APOE4 carriers (2/4, 3/4, and 4/4 genotypes) was higher in AD cases than in controls, the difference of which is also reflected in the APOE4 allele frequency (32.8% vs 14.6%). Likewise, the frequency of APOE2 carriers (2/2 and 2/3 genotypes) was lower in AD cases than in controls, as also reflected in the APOE2 allele frequency difference (4.1% vs 7.9%). Although the 2/4 genotype carries opposite protective and risk alleles, it was a risk factor for AD (odds ratio (OR) = 2.01, p = 8.92E-08), which was similar to the OR of 2.6 reported earlier in more than 17,000 cases and controls [ 15 ] . Since the E2 and E4 alleles in the 2/4 genotype are assumed to be inherited from both parents on different haplotypes, it would be intriguing to investigate the effect of the elusive E5 haplotype on AD risk where both alleles are inherited from a single parent. Of the 355 subjects with the 2/4 genotype (see Table 1 ), DNA was not available from 15 controls and thus we proceeded with the 340 samples (17% Black) for the search for the elusive haplotype via subcloning, WGS or RFLP assays. Subcloning: Results from subcloning followed by sequencing are depicted in Fig. 1 . The plasmid DNA sequence from each clone revealed the presence of the following combination of nucleotide bases corresponding to the 1st base of codon 112 and 1st base of codon 158: T – T for the E2 haplotype or C – C for the E4 haplotype (Fig. 1 ). In no instance, the C – T combination corresponding to the E5 haplotype was observed. Identical results were obtained with WGS (results not shown). RFLP: The RFLP results are shown in Fig. 2 . The full-length gel image of the RFLP assay is provided in the supplementary data(Supplementary fig). In the RFLP analysis of the 221 bp PCR amplified fragment followed by double enzyme digestion, the tested samples with the APOE 2/4 genotype gave the expected diagnostic bands of 168 bp and 198 bp (Fig. 2 ). No sample revealed the expected uncut band of 221 bp corresponding to the E5 haplotype due to loss of restriction sites at codon 112 and codon 158. It is noteworthy that in some samples with the 2/4 genotype, we visualized a faint band at position 221 bp, which was due to incomplete digestion (Fig. 2 ) as we confirmed it upon sequencing. One study also reported such an undigested band in their one subject with the 2/4 genotype and suggested it to be due to the formation of heterodimers during amplification [ 4 ] . However, we think this vague band is most likely due to incomplete digestion rather than being heterodimers because this band was observed only in few 2/4 subjects. This cautionary note may be helpful for those seeking to detect the E5 haplotype using the RFLP assay alone. Discussion Previously, the E5 haplotype has been reported in only 5 subjects from three unrelated kindreds. The first case was found in an autistic Italian child and his unaffected mother while investigating the potential association of APOE alleles with primary autism in trios [ 3 ] . The authors named this haplotype as E3r because it possesses reverse arrangement of the cysteine and arginine residues at codons 112 and 158 (R112 - C158) compared to the common E3 haplotype (C112 - R158). The second case was reported in a 70-year-old healthy Yoruban female with normal lipid profile and in her 34-year-old son from Ibadan, Nigeria and this was named as E1Y [ 4 ] to differentiate it from the previously rare E1 isoform (Asp127 – Cys158) [ 16 ] . The third unrelated case of E5 was observed in a 77-year-old Caucasian patient with motor neuron disease but with normal cognition and lipid profile [ 5 ] . This haplotype was not inherited by his two children. We name this elusive haplotype as APOE5 because its earlier designation as E3r or E1Y is confusing and gives the misleading impression that this may not be part of the APOE2/E3/E4 polymorphism. The original nomenclature of three APOE isoforms was based on their structure and isoelectric focusing (IEF) point differences on gel electrophoresis where IEF point of E2 isoform was more acidic and the IEF point of E4 was more basic compared to the common E3 isoform [ 6 ] . The E1 isoform (G127D, R158C) differs from E2 at amino acid position 127 where glycine is replaced with aspartic acid, causing one negative charge difference from E2 [ 16 ] . Thus, the genetic determinant of E1 is a point mutation at codon 127 and its designation represents its relative IEF position to E2 on gel electrophoresis. This situation is like a rare APOE4Pittsburgh variant (L28P, C112R) which differs from E4 at amino acid position 28 where leucine is replaced with proline [ 17 ] . Most importantly, E1 and APOE4Pittsburgh do not correspond to the elusive E5 haplotype of the common APOE polymorphism determined by variation at codons 112 and 158. On the other hand, E5 is a part of the well-known APOE polymorphism due to point mutations at both codons. The most likely explanation for the observation of four two-site APOE haplotypes, E2, E3, E4 , and E5 , is due to intragenic crossover between the nucleotide sequence of codons 112 and 158 (Fig. 3 ). The ultra rarity of the E5 haplotype may be explained due to the small distance of only 138 nucleotides between the E4 and E2 mutant sites that may prevent frequent recombination between the two sites. An alternative explanation may be that the E2 mutation arose recently on the E4 haplotype after the split of human races, like the example of the APOE4Pittsburgh mutation that occurred on the E4 background [ 17 ] . However, the observation of E5 haplotype in one African kindred along with two kindreds of European descent belies this hypothesis. Although E3 is considered as the parent haplotype or allele in humans because of its common occurrence followed by E4 and E2, E4 has been postulated as the ancestral allele because all the great apes code for arginine with the identical codon sequence (CGC) at positions 112 and 158 corresponding to the human E4 haplotype [ 18 ] . Accordingly, it has been hypothesized that human E3 evolved from primate E4 by a C to T point mutation coding for cysteine at codon 112 ( T CG) and then E2 evolved from E3 by a C to T transition coding for cysteine at codon 158 ( T CG). As above, we hypothesize that the E5 haplotype was formed most likely due to crossover between the E4 and E2 haplotypes (Fig. 3 ). In conclusion, we have performed a systematic and focused search to identify the elusive E5 haplotype in the general population by cloning and sequencing a large number of subjects heterozygous for the APOE 2/4 genotype but found no such example. For this reason, we could not examine its role in AD risk. Our data suggests that the occurrence of E5 is extremely rare, and it might have a minimum effect, if any, on disease risk. Declarations Supplementary data Supplementary figure Additional information The authors declare no conflict of interest. Acknowledgements The study was supported in part by NIH grants R01 AG064877 and P30 AG066468 Funding Sources NIH grants R01 AG064877 and P30 AG066468 Author Contributions Conceptualization, Funding acquisition, Supervision: M. Ilyas Kamboh; Data curation: Asma Naseer Cheema, Elizabeth Lawrence, Narges Zafari, Kang-Hsien Fan, Ruyu Shi, Muaaz Aslam, Vibha Acharya, Alayna Jean Holderman, Annie Bedison, Eleanor Feingold Formal analysis: M. Ilyas Kamboh, Asma Naseer Cheema, Ruyu Shi , Kang-Hsien Fan; Methodology and Investigation: Asma Naseer Cheema, Elizabeth Lawrence, Narges Zafari, Kang-Hsien Fan; Writing – original draft: Asma Naseer Cheema Writing – review and editing: M. Ilyas Kamboh , Asma Naseer Cheema; Ruyu Shi, Muhammad Muaaz Aslam, Vibha Acharya Data Availability Sequencing data has been submitted to the National Institute on Aging Genetics of Alzheimer’s Disease Data Storage Site (NIAGADS) and is available at https://dss.niagads.org/studies/sa000012/. The principal investigator (corresponding author) of the study may be contacted if someone needs to acquire the data. References Bellenguez, C. et al. New insights into the genetic etiology of Alzheimer’s disease and related dementias. Nat. Genet. 54 , 412–436 (2022). Kamboh, M. I. Genomics and functional genomics of Alzheimer’s disease. Neurotherapeutics . 19 , 152–172 (2022). Persico, A. M. et al. Enhanced APO*E2 transmission rates in families with autistic probands. Psychiat Genet. 14 , 73–82 (2004). Murrell, J. R. et al. The fourth apolipoprotein E haplotype found in the Yoruba of Ibadan. Am. J. Med. Genet. B141 , 426–427 (2006). Seripa, D. et al. The missing APOE allele. Ann. Hum. Genet. 71 , 496–500 (2007). Zannis, V. I., Breslow, J. L. & Apolipoprotein, E. Mol. Cell. Bioch 42 , 3–20 (1982). Menzel, H., Kladetzky, R. & Assmann, G. One-step screening method for the polymorphism of apolipoproteins AI, A-II, and A-IV. J. Lipid Res. 23 , 915–922 (1982). Ehnholm, C., Lukka, M., Kuusi, T., Nikkilä, E. & Utermann, G. Apolipoprotein E polymorphism in the Finnish population: gene frequencies and relation to lipoprotein concentrations. J. Lipid Res. 27 , 227–235 (1986). Kamboh, M. I., Ferrell, R. E. & Kottke, B. Genetic studies of human apolipoproteins. V. A novel rapid procedure to screen apolipoprotein E polymorphism. J. Lipid Res. 29 , 1535–1543 (1988). Kamboh, M. I. et al. Genome-wide association study of Alzheimer's disease. Transl Psychiat . 2 , 117. 10.1038/tp.2012.45 (2012). Pirim, D. et al. Apolipoprotein E-C1-C4-C2 gene cluster region and inter-individual variation in plasma lipoprotein levels: a comprehensive genetic association study in two ethnic groups. PloS One . 14 , 0214060. 10.1371/journal.pone.0214060 (2019). Harper, J. D. et al. Genome-wide association study of incident dementia in a community-based sample of older subjects. J. Alzheimers Dis. 88 , 787–798 (2022). Fan, K. H. et al. Investigation of the independent role of a rare APOE variant (L28P; APOE* 4Pittsburgh ) in late-onset Alzheimer disease. Neurobiol. Aging . 122 , 107–111 (2023). Kamboh, M. I., Aston, C. E. & Hamman, R. F. The relationship of APOE polymorphism and cholesterol levels in normoglycemic and diabetic subjects in a biethnic population from the San Luis Valley, Colorado. Atherosclerosis . 112 , 145–159 (1995). Genin, E. et al. APOE and Alzheimer disease: a major gene with semi-dominant inheritance. Mol. Psychiat . 16 , 903–907 (2011). Weisgraber, K. H. et al. A novel electrophoretic variant of human apolipoprotein E. Identification and characterization of apolipoprotein E1. J. Clin. Invest. 73 , 1024–1033 (1984). Kamboh, M. I. et al. A novel mutation in the apolipoprotein E gene ( APOE*4Pittsburgh ) is associated with the risk of late-onset Alzheimer's disease. Neurosci. Lett. 263 , 129–132 (1999). Finch, C. E. & Sapolsky, R. M. The evolution of Alzheimer disease, the reproductive schedule, and apoE isoforms☆. Neurobiol. Aging . 20 , 407–428 (1999). Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigureScientificreports.pdf Cite Share Download PDF Status: Published Journal Publication published 15 May, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 05 Mar, 2025 Reviews received at journal 20 Feb, 2025 Reviewers agreed at journal 06 Feb, 2025 Reviews received at journal 06 Nov, 2024 Reviewers agreed at journal 06 Nov, 2024 Reviewers invited by journal 29 Aug, 2024 Editor assigned by journal 29 Aug, 2024 Editor invited by journal 29 Aug, 2024 Submission checks completed at journal 27 Aug, 2024 First submitted to journal 12 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4902566","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":349266338,"identity":"9821f533-0c4b-4e30-81c3-0cf710e18f4c","order_by":0,"name":"Asma Naseer Cheema","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Asma","middleName":"Naseer","lastName":"Cheema","suffix":""},{"id":349266339,"identity":"83a1c4a8-0a80-433d-a763-728376caca2c","order_by":1,"name":"Elizabeth Lawrence","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Elizabeth","middleName":"","lastName":"Lawrence","suffix":""},{"id":349266340,"identity":"947dc869-4312-4107-806a-0740edd83890","order_by":2,"name":"Narges Zafari","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Narges","middleName":"","lastName":"Zafari","suffix":""},{"id":349266341,"identity":"812147b1-4755-43b7-87d4-ef1ca6175780","order_by":3,"name":"Kang-Hsien Fan","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Kang-Hsien","middleName":"","lastName":"Fan","suffix":""},{"id":349266342,"identity":"d2134dd0-fad4-4d34-af57-1a87b1d66d2c","order_by":4,"name":"Ruyu Shi","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Ruyu","middleName":"","lastName":"Shi","suffix":""},{"id":349266343,"identity":"1ef4c87b-d28f-4c6f-8916-3040aaf1f0fa","order_by":5,"name":"Muhammad Muaaz Aslam","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Muaaz","lastName":"Aslam","suffix":""},{"id":349266344,"identity":"46105800-48e8-4571-b406-2ce45bdc52e2","order_by":6,"name":"Vibha Acharya","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Vibha","middleName":"","lastName":"Acharya","suffix":""},{"id":349266345,"identity":"76766faa-dd3f-4623-8de2-991975872d36","order_by":7,"name":"Alayna Jean Holderman","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Alayna","middleName":"Jean","lastName":"Holderman","suffix":""},{"id":349266346,"identity":"58880c41-0278-413d-8ac1-fa6a775aa23e","order_by":8,"name":"Annie Bedison","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Annie","middleName":"","lastName":"Bedison","suffix":""},{"id":349266347,"identity":"f97cc3b1-f227-4104-8d38-8b6ce328dc51","order_by":9,"name":"Eleanor Feingold","email":"","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":false,"prefix":"","firstName":"Eleanor","middleName":"","lastName":"Feingold","suffix":""},{"id":349266348,"identity":"e9c9e00a-bba2-4133-aada-acedf5a3d6fa","order_by":10,"name":"M. Ilyas Kamboh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsUlEQVRIiWNgGAWjYBACCQYGNgbGBhsgCQJsxGtJY2BjYyZNy2EgRawWyfbTaQ8+7jifxyfff4DhQ9lhwlqkeXK3G848c7sY5DDGGeeI0CLHkLtNmrftdmIbUAszbxsxWvjfgrScg2j5S4wWaQmwLQcgWhiJ0SI54y3QL23JQL8kGxzsOZdOWIvE+dxtDz622eXJNx98+OBHmTVhLTCQACIOEK8epmUUjIJRMApGAVYAAKTsNqY7a4WBAAAAAElFTkSuQmCC","orcid":"","institution":"University of Pittsburgh","correspondingAuthor":true,"prefix":"","firstName":"M.","middleName":"Ilyas","lastName":"Kamboh","suffix":""}],"badges":[],"createdAt":"2024-08-12 19:23:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4902566/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4902566/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-01263-0","type":"published","date":"2025-05-15T15:57:06+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":65327790,"identity":"e93d8cb6-fabd-4560-b46f-988391964f69","added_by":"auto","created_at":"2024-09-26 06:30:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":93775,"visible":true,"origin":"","legend":"\u003cp\u003eThe sequencing results of plasmid DNA derived from two separate clones of the same sample having the \u003cem\u003eAPOE \u003c/em\u003e2/4 genotype (double heterozygotes at codon 112 and codon 158). The sequences of maternal and paternal clones were aligned at the first base of codon 112 and the first base of codon 158 in Exon 4 of the \u003cem\u003eAPOE \u003c/em\u003egene: Top corresponds to the E2 haplotype (T-T); Bottom corresponds to the E4 haplotype (C-C).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4902566/v1/37750854cf3fdb81882d15b9.png"},{"id":65327007,"identity":"4db38b44-85bb-4af5-9d05-7182e0cec875","added_by":"auto","created_at":"2024-09-26 06:22:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":136350,"visible":true,"origin":"","legend":"\u003cp\u003eRestriction enzyme digestion (\u003cem\u003eHae\u003c/em\u003eII and \u003cem\u003eAfl\u003c/em\u003eIII) patterns of 221 bp long PCR product for six \u003cem\u003eAPOE\u003c/em\u003e genotypes (2/2, 2/3, 2/4, 3/3, 3/4, 4/4). The major diagnostic bands (bp) for each genotype are as follows: \u003cem\u003eAPOE \u003c/em\u003e2/2: 168; \u003cem\u003eAPOE\u003c/em\u003e 2/3: 168 and 145; \u003cem\u003eAPOE\u003c/em\u003e 2/4: 198 and 168); \u003cem\u003eAPOE\u003c/em\u003e3/3: 145; \u003cem\u003eAPOE\u003c/em\u003e 3/4: 168 and 145; \u003cem\u003eAPOE\u003c/em\u003e 4/4: 198. The undigested band of 221 bp is indicated by arrows.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4902566/v1/8b3e2a7ab215130c20ce1ca2.png"},{"id":65327006,"identity":"3f25ed71-0bfa-4d52-9f86-7ee70ee2c44d","added_by":"auto","created_at":"2024-09-26 06:22:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":44143,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of potential crossover between two \u003cem\u003eAPOE \u003c/em\u003epolymorphic sites represented by amino acid changes from cysteine (C) to arginine (R) at codon 112 (C112 \u0026gt; R112) and from arginine (R) to cysteine (C) at codon 158 (R158 \u0026gt; C158) that lead to the formation of four expected two-site haplotypes.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4902566/v1/786e74a58c687aca297fd28c.png"},{"id":83067805,"identity":"f5293314-ef95-4258-aff5-81fdecf18840","added_by":"auto","created_at":"2025-05-19 16:06:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1003061,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4902566/v1/53d69c0a-7bd4-4a99-9f93-6724cdc39d18.pdf"},{"id":65327009,"identity":"15acd364-748d-4d4f-8555-713cbe64f910","added_by":"auto","created_at":"2024-09-26 06:22:17","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":992589,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureScientificreports.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4902566/v1/5b8f928351d81ff031967e91.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Search for the elusive haplotype of the APOE polymorphism associated with Alzheimer’s disease","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe common \u003cem\u003eAPOE2/E3/E4\u003c/em\u003e polymorphism is determined by two-site haplotypes at codon 112 [cysteine (C)\u0026thinsp;\u0026gt;\u0026thinsp;arginine (R)] and codon 158 (R\u0026thinsp;\u0026gt;\u0026thinsp;C), resulting in six genotypes. Due to strong linkage disequilibrium (LD) between the two sites, three of the four expected haplotypes or alleles (\u003cem\u003eE2, E3\u003c/em\u003e, and \u003cem\u003eE4\u003c/em\u003e) have been observed and extensively studied in relation to the risk of Alzheimer\u0026rsquo;s disease (AD) risk \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Compared to the most common haplotype of \u003cem\u003eE3\u003c/em\u003e (C112 \u0026ndash; R158), the mutant \u003cem\u003eE4\u003c/em\u003e (R112 \u0026ndash; R158) and \u003cem\u003eE2\u003c/em\u003e (C112 \u0026ndash; C158) haplotypes are determined by single-point mutations: T\u0026thinsp;\u0026gt;\u0026thinsp;C transition at codon 112 (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eGC to \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC\u003c/span\u003eGC for \u003cem\u003eE4\u003c/em\u003e) and C\u0026thinsp;\u0026gt;\u0026thinsp;T transition at codon158 (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC\u003c/span\u003eGC to \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eGC for E2). The fourth haplotype, which we denote here as \u003cem\u003eAPOE5\u003c/em\u003e and explained later, having amino acid substitutions at both positions (R112 \u0026ndash; C158) has been reported only as an incidental finding in three kindreds \u003csup\u003e[\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Genetically determined structural variation in \u003cem\u003eAPOE\u003c/em\u003e was originally described using two-dimensional gel electrophoresis or isoelectric focusing (IEF) from ultracentrifuged and delipidated plasma \u003csup\u003e[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. which was subsequently simplified for \u003cem\u003eAPOE\u003c/em\u003e genotyping directly from plasma without prior ultracentrifugation and dilapidation for large-scale population screening \u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e.Gel electrophoresis that separates plasma \u003cem\u003eAPOE\u003c/em\u003e isoforms based on their size, charge, or isoelectric point differences, can also enable the identification of new \u003cem\u003eAPOE\u003c/em\u003e allelic isoforms is not possible to determine using the current TaqMan assays as they are specific for detecting genomic variations at codons 112 and 158 only.\u003c/p\u003e \u003cp\u003eIndividuals with the \u003cem\u003eAPOE\u003c/em\u003e 2/4 genotypes are double heterozygotes at codons 112 and 158 and due to strong LD between the two sites, it is always assumed that the alleles for \u003cem\u003eE4\u003c/em\u003e (R112) and \u003cem\u003eE2\u003c/em\u003e (C158) are present on opposite chromosomes. Since TaqMan assays do not reveal the two-site haplotype phases, it is possible that some of the \u003cem\u003eAPOE\u003c/em\u003e 2/4 individuals may carry the \u003cem\u003eAPOE5\u003c/em\u003e haplotype where both alleles (R112 and C158) are present on the same haplotype and inherited from a single parent. This could only be accomplished unequivocally by either subcloning followed by single-strand sequencing or next-generation whole-genomic sequencing (WGS). To our knowledge, no such systematic effort has been made to determine the haplotype phases and the occurrence of the \u003cem\u003eAPOE5\u003c/em\u003e haplotype in the general population. The objective of this study was to search for the elusive \u003cem\u003eAPOE5\u003c/em\u003e haplotype by using combination of subcloning, WGS or restriction fragment length polymorphism (RFLP) assays in a large number of \u003cem\u003eAPOE\u003c/em\u003e 2/4 subjects and determine its potential association with AD.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eThis study was approved by the University of Pittsburg institutional Review Board and informed consent was obtained from all the subjects prior to their participation in the study. All the experimental protocols were reviewed and approved by Department of Human Genetics, School of Public Health University of Pittsburgh and were performed in accordance with the approved guidelines and regulations of the dpartemnt. \u003cem\u003eAPOE\u003c/em\u003e genotype data on 14,819 subjects (mean age\u0026thinsp;=\u0026thinsp;72.7 years; female\u0026thinsp;=\u0026thinsp;56.6%; Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e) derived from multiple studies \u003csup\u003e[\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e was used in this study. All subjects previously classified as \u003cem\u003eAPOE\u003c/em\u003e 2/4 were re-genotyped by TaqMan assays for the two \u003cem\u003eAPOE\u003c/em\u003e SNPs: rs429358 (\u003cem\u003eE4\u003c/em\u003e) and rs7412 (\u003cem\u003eE2\u003c/em\u003e) to confirm the \u003cem\u003eAPOE\u003c/em\u003e 2/4 genotype. For subcloning, A 177 bp product with single deoxyadenosine (A) overhang on 3\u0026rsquo; end was PCR amplified from genomic DNA (0.5-1.0 \u0026micro;g) using primers [5\u0026rsquo;GCGGACATGGAGGACGTG-3\u0026rsquo;; 5\u0026rsquo;GGCCTGGTACACTGCCAG-3\u0026rsquo;] \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. and confirmed by running on agarose gel with 1X TBE buffer. The PCR product was purified using QIAGEN purification kit and ligated into 4kb PCR\u0026trade; II-TOPO linearized vector with single 3\u0026rsquo; deoxythymidine(T) residue and Ampicillin resistance ORF (bases 2173\u0026ndash;3033), then transformed into chemically competent bacterial cells (\u003cem\u003eE. coli\u003c/em\u003e DH5αTM -T1\u003csup\u003eR)\u003c/sup\u003e) to construct the phased haplotype clones of 177 bp derived from the maternal or paternal chromosome. The clones were cultured on Luria-Bertani (LB) agar containing ampicillin to get multiple copies of the constructed clone. To differentiate the bacterial colonies from the successful clone constructs, 40mg/ml X-gal was spread onto the plates before culturing the clone. To create a stock of each colony, the colonies with successful constructs were incubated separately overnight at 37\u0026deg;C into 3mL LB broth containing ampicillin. DNA was isolated from the cultured colony cells using Biolab miniprep plasmid DNA kit followed by sequencing with M13 forward and reverse primers. The sequencher (v5.4.6) software was used to analyze the inserted phased haplotype.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eA. Demographic and \u003cem\u003eAPOE\u003c/em\u003e Genotype/Allele data in study participants\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal Sample\u003c/p\u003e \u003cp\u003e(N\u0026thinsp;=\u0026thinsp;14819)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAD Cases\u003c/p\u003e \u003cp\u003e(N\u0026thinsp;=\u0026thinsp;3280)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eControls\u003c/p\u003e \u003cp\u003e(N\u0026thinsp;=\u0026thinsp;11535)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP-value between\u003c/p\u003e \u003cp\u003ecases and controls\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMean age \u0026plusmn; SD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72.7\u0026thinsp;\u0026plusmn;\u0026thinsp;14.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72.1\u0026thinsp;\u0026plusmn;\u0026thinsp;9.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e72.9\u0026thinsp;\u0026plusmn;\u0026thinsp;15.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4.94E-04\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale, N (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8142 (56.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2000 (61.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6141 (55.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.20E-08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWhite/Black/\u003c/p\u003e \u003cp\u003eOthers (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e86.8/12.7/0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93.4/6.3/0.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e84.8/14.6/0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.36E-36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPOE\u003c/em\u003e Genotype\u003c/p\u003e \u003cp\u003eN (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.95E-238\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e88 (0.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8(0.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80 (0.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"5\" rowspan=\"6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1557 (10.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e163(5.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1394(12.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e355 (2.4)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e88(2.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e267(2.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3/3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8254 (55.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1280(39.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6973(60.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3948 (26.6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1415(43.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2531(21.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e617 (4.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e326(10.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e290(2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPOE\u003c/em\u003e Allele Frequency (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.08E-254\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e74.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e77.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eB. Odds ratios (ORs) for \u003cem\u003eAPOE\u003c/em\u003e Genotypes using \u003cem\u003eAPOE\u003c/em\u003e 3/3 as reference\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAPOE\u003c/em\u003e Genotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eORs (95% confidence interval)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP-Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.73 (0.32\u0026ndash;1.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.65(0.54\u0026ndash;0.77)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.64E-06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.01(1.55\u0026ndash;2.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.92E-08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3.26(2.97\u0026ndash;3.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.72E-137\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e6.87(5.70\u0026ndash;8.30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.50E-90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eWe also employed an RFLP assay, utilizing two different enzymes to discern the \u003cem\u003eAPOE5\u003c/em\u003e haplotype (Murrell et al., 2006). We amplified a 221 bp PCR product using forward (5\u0026rsquo;CTGTCCAAGGAGCTGCAG 3\u0026rsquo;) and reverse (5\u0026rsquo; GCCCCGGCCTGGTACACTGCCAG 3\u0026rsquo;) primers followed by overnight digestion at 37\u0026deg;C with a 3:2 ratio of smartcut enzymes \u003cem\u003eAfl\u003c/em\u003eIII (for codon 112 digestion) and \u003cem\u003eHae\u003c/em\u003eII (for codon 158 digestion). The samples were loaded onto a 3.5% metaphor GEL using 1XTBE buffer alongside a 50 bp ladder. The \u003cem\u003eAfl\u003c/em\u003eIII enzyme cleaves at codon112 only in the presence of nucleotide \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eGC (C112), while the \u003cem\u003eHae\u003c/em\u003eII enzyme cleaves only if there is nucleotide \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC\u003c/span\u003eGC (R158) at codon158. Whereas the cutting sites at both positions would be abolished in the \u003cem\u003eE5\u003c/em\u003e haplotype (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC\u003c/span\u003eGC/R112 and \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eGC/C158).\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDemographic characteristics of the subjects:\u003c/h2\u003e \u003cp\u003eDemographics information along with the \u003cem\u003eAPOE\u003c/em\u003e genotype/allele frequencies in the total sample and sample stratified by case-control are provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Of 14,819 individuals four subject lacked case control status. As expected, the frequency of \u003cem\u003eAPOE4\u003c/em\u003e carriers (2/4, 3/4, and 4/4 genotypes) was higher in AD cases than in controls, the difference of which is also reflected in the \u003cem\u003eAPOE4\u003c/em\u003e allele frequency (32.8% vs 14.6%). Likewise, the frequency of \u003cem\u003eAPOE2\u003c/em\u003e carriers (2/2 and 2/3 genotypes) was lower in AD cases than in controls, as also reflected in the \u003cem\u003eAPOE2\u003c/em\u003e allele frequency difference (4.1% vs 7.9%). Although the 2/4 genotype carries opposite protective and risk alleles, it was a risk factor for AD (odds ratio (OR)\u0026thinsp;=\u0026thinsp;2.01, p\u0026thinsp;=\u0026thinsp;8.92E-08), which was similar to the OR of 2.6 reported earlier in more than 17,000 cases and controls \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Since the \u003cem\u003eE2\u003c/em\u003e and \u003cem\u003eE4\u003c/em\u003e alleles in the 2/4 genotype are assumed to be inherited from both parents on different haplotypes, it would be intriguing to investigate the effect of the elusive \u003cem\u003eE5\u003c/em\u003e haplotype on AD risk where both alleles are inherited from a single parent. Of the 355 subjects with the 2/4 genotype (see Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e), DNA was not available from 15 controls and thus we proceeded with the 340 samples (17% Black) for the search for the elusive haplotype via subcloning, WGS or RFLP assays.\u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003eSubcloning:\u003c/h2\u003e \u003cp\u003eResults from subcloning followed by sequencing are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The plasmid DNA sequence from each clone revealed the presence of the following combination of nucleotide bases corresponding to the 1st base of codon 112 and 1st base of codon 158: T \u0026ndash; T for the \u003cem\u003eE2\u003c/em\u003e haplotype or C \u0026ndash; C for the \u003cem\u003eE4\u003c/em\u003e haplotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In no instance, the C \u0026ndash; T combination corresponding to the \u003cem\u003eE5\u003c/em\u003e haplotype was observed. Identical results were obtained with WGS (results not shown).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRFLP:\u003c/h2\u003e \u003cp\u003eThe RFLP results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The full-length gel image of the RFLP assay is provided in the supplementary data(Supplementary fig). In the RFLP analysis of the 221 bp PCR amplified fragment followed by double enzyme digestion, the tested samples with the \u003cem\u003eAPOE\u003c/em\u003e 2/4 genotype gave the expected diagnostic bands of 168 bp and 198 bp (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). No sample revealed the expected uncut band of 221 bp corresponding to the \u003cem\u003eE5\u003c/em\u003e haplotype due to loss of restriction sites at codon 112 and codon 158. It is noteworthy that in some samples with the 2/4 genotype, we visualized a faint band at position 221 bp, which was due to incomplete digestion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) as we confirmed it upon sequencing. One study also reported such an undigested band in their one subject with the 2/4 genotype and suggested it to be due to the formation of heterodimers during amplification \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. However, we think this vague band is most likely due to incomplete digestion rather than being heterodimers because this band was observed only in few 2/4 subjects. This cautionary note may be helpful for those seeking to detect the \u003cem\u003eE5\u003c/em\u003e haplotype using the RFLP assay alone.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePreviously, the \u003cem\u003eE5\u003c/em\u003e haplotype has been reported in only 5 subjects from three unrelated kindreds. The first case was found in an autistic Italian child and his unaffected mother while investigating the potential association of \u003cem\u003eAPOE\u003c/em\u003e alleles with primary autism in trios \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. The authors named this haplotype as \u003cem\u003eE3r\u003c/em\u003e because it possesses reverse arrangement of the cysteine and arginine residues at codons 112 and 158 (R112 - C158) compared to the common \u003cem\u003eE3\u003c/em\u003e haplotype (C112 - R158). The second case was reported in a 70-year-old healthy Yoruban female with normal lipid profile and in her 34-year-old son from Ibadan, Nigeria and this was named as \u003cem\u003eE1Y\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e to differentiate it from the previously rare E1 isoform (Asp127 \u0026ndash; Cys158)\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. The third unrelated case of \u003cem\u003eE5\u003c/em\u003e was observed in a 77-year-old Caucasian patient with motor neuron disease but with normal cognition and lipid profile \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. This haplotype was not inherited by his two children.\u003c/p\u003e \u003cp\u003eWe name this elusive haplotype as \u003cem\u003eAPOE5\u003c/em\u003e because its earlier designation as \u003cem\u003eE3r\u003c/em\u003e or \u003cem\u003eE1Y\u003c/em\u003e is confusing and gives the misleading impression that this may not be part of the \u003cem\u003eAPOE2/E3/E4\u003c/em\u003e polymorphism. The original nomenclature of three \u003cem\u003eAPOE\u003c/em\u003e isoforms was based on their structure and isoelectric focusing (IEF) point differences on gel electrophoresis where IEF point of \u003cem\u003eE2\u003c/em\u003e isoform was more acidic and the IEF point of \u003cem\u003eE4\u003c/em\u003e was more basic compared to the common \u003cem\u003eE3\u003c/em\u003e isoform \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. The \u003cem\u003eE1\u003c/em\u003e isoform (G127D, R158C) differs from \u003cem\u003eE2\u003c/em\u003e at amino acid position 127 where glycine is replaced with aspartic acid, causing one negative charge difference from \u003cem\u003eE2\u003c/em\u003e \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Thus, the genetic determinant of \u003cem\u003eE1\u003c/em\u003e is a point mutation at codon 127 and its designation represents its relative IEF position to \u003cem\u003eE2\u003c/em\u003e on gel electrophoresis. This situation is like a rare \u003cem\u003eAPOE4Pittsburgh\u003c/em\u003e variant (L28P, C112R) which differs from \u003cem\u003eE4\u003c/em\u003e at amino acid position 28 where leucine is replaced with proline \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Most importantly, \u003cem\u003eE1\u003c/em\u003e and \u003cem\u003eAPOE4Pittsburgh\u003c/em\u003e do not correspond to the elusive \u003cem\u003eE5\u003c/em\u003e haplotype of the common \u003cem\u003eAPOE\u003c/em\u003e polymorphism determined by variation at codons 112 and 158. On the other hand, \u003cem\u003eE5\u003c/em\u003e is a part of the well-known \u003cem\u003eAPOE\u003c/em\u003e polymorphism due to point mutations at both codons.\u003c/p\u003e \u003cp\u003eThe most likely explanation for the observation of four two-site \u003cem\u003eAPOE\u003c/em\u003e haplotypes, \u003cem\u003eE2, E3, E4\u003c/em\u003e, and \u003cem\u003eE5\u003c/em\u003e, is due to intragenic crossover between the nucleotide sequence of codons 112 and 158 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The ultra rarity of the \u003cem\u003eE5\u003c/em\u003e haplotype may be explained due to the small distance of only 138 nucleotides between the \u003cem\u003eE4\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e mutant sites that may prevent frequent recombination between the two sites. An alternative explanation may be that the \u003cem\u003eE2\u003c/em\u003e mutation arose recently on the \u003cem\u003eE4\u003c/em\u003e haplotype after the split of human races, like the example of the \u003cem\u003eAPOE4Pittsburgh\u003c/em\u003e mutation that occurred on the \u003cem\u003eE4\u003c/em\u003e background \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. However, the observation of \u003cem\u003eE5\u003c/em\u003e haplotype in one African kindred along with two kindreds of European descent belies this hypothesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003eE3\u003c/em\u003e is considered as the parent haplotype or allele in humans because of its common occurrence followed by \u003cem\u003eE4\u003c/em\u003e and \u003cem\u003eE2, E4\u003c/em\u003e has been postulated as the ancestral allele because all the great apes code for arginine with the identical codon sequence (CGC) at positions 112 and 158 corresponding to the human \u003cem\u003eE4\u003c/em\u003e haplotype \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Accordingly, it has been hypothesized that human \u003cem\u003eE3\u003c/em\u003e evolved from primate \u003cem\u003eE4\u003c/em\u003e by a C to T point mutation coding for cysteine at codon 112 (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eCG) and then \u003cem\u003eE2\u003c/em\u003e evolved from \u003cem\u003eE3\u003c/em\u003e by a C to T transition coding for cysteine at codon 158 (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eT\u003c/span\u003eCG). As above, we hypothesize that the \u003cem\u003eE5\u003c/em\u003e haplotype was formed most likely due to crossover between the \u003cem\u003eE4\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e haplotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, we have performed a systematic and focused search to identify the elusive \u003cem\u003eE5\u003c/em\u003e haplotype in the general population by cloning and sequencing a large number of subjects heterozygous for the \u003cem\u003eAPOE\u003c/em\u003e 2/4 genotype but found no such example. For this reason, we could not examine its role in AD risk. Our data suggests that the occurrence of \u003cem\u003eE5\u003c/em\u003e is extremely rare, and it might have a minimum effect, if any, on disease risk.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementary figure\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was supported in part by NIH grants R01 AG064877 and P30 AG066468\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Sources\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNIH grants R01 AG064877 and P30 AG066468\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConceptualization, Funding acquisition, Supervision:\u0026nbsp;\u003c/strong\u003eM. Ilyas Kamboh; \u003cstrong\u003eData curation:\u0026nbsp;\u003c/strong\u003eAsma Naseer Cheema, Elizabeth Lawrence, Narges Zafari, Kang-Hsien Fan, Ruyu Shi, Muaaz Aslam, Vibha Acharya, Alayna Jean Holderman, Annie Bedison, Eleanor Feingold \u003cstrong\u003eFormal analysis:\u0026nbsp;\u003c/strong\u003eM. Ilyas Kamboh, Asma Naseer Cheema, Ruyu Shi , Kang-Hsien Fan; \u003cstrong\u003eMethodology and Investigation:\u0026nbsp;\u003c/strong\u003eAsma Naseer Cheema, Elizabeth Lawrence, Narges Zafari, Kang-Hsien Fan; \u003cstrong\u003eWriting \u0026ndash; original draft:\u0026nbsp;\u003c/strong\u003eAsma Naseer Cheema \u003cstrong\u003eWriting \u0026ndash; review and editing:\u0026nbsp;\u003c/strong\u003eM. Ilyas Kamboh , Asma Naseer Cheema; Ruyu Shi, Muhammad Muaaz Aslam, Vibha Acharya\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability \u0026nbsp;\u003c/strong\u003eSequencing data has been submitted to the National Institute on Aging Genetics of Alzheimer\u0026rsquo;s Disease Data Storage Site (NIAGADS) and is available at https://dss.niagads.org/studies/sa000012/. The principal investigator (corresponding author) of the study may be contacted if someone needs to acquire the data.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBellenguez, C. et al. New insights into the genetic etiology of Alzheimer\u0026rsquo;s disease and related dementias. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 412\u0026ndash;436 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamboh, M. I. Genomics and functional genomics of Alzheimer\u0026rsquo;s disease. \u003cem\u003eNeurotherapeutics\u003c/em\u003e. \u003cb\u003e19\u003c/b\u003e, 152\u0026ndash;172 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePersico, A. M. et al. Enhanced APO*E2 transmission rates in families with autistic probands. \u003cem\u003ePsychiat Genet.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 73\u0026ndash;82 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurrell, J. R. et al. The fourth apolipoprotein E haplotype found in the Yoruba of Ibadan. Am. \u003cem\u003eJ. Med. Genet.\u003c/em\u003e \u003cb\u003eB141\u003c/b\u003e, 426\u0026ndash;427 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeripa, D. et al. The missing APOE allele. \u003cem\u003eAnn. Hum. Genet.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e, 496\u0026ndash;500 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZannis, V. I., Breslow, J. L. \u0026amp; Apolipoprotein, E. \u003cem\u003eMol. Cell. Bioch\u003c/em\u003e \u003cb\u003e42\u003c/b\u003e, 3\u0026ndash;20 (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenzel, H., Kladetzky, R. \u0026amp; Assmann, G. One-step screening method for the polymorphism of apolipoproteins AI, A-II, and A-IV. \u003cem\u003eJ. Lipid Res.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 915\u0026ndash;922 (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEhnholm, C., Lukka, M., Kuusi, T., Nikkil\u0026auml;, E. \u0026amp; Utermann, G. Apolipoprotein E polymorphism in the Finnish population: gene frequencies and relation to lipoprotein concentrations. \u003cem\u003eJ. Lipid Res.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 227\u0026ndash;235 (1986).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamboh, M. I., Ferrell, R. E. \u0026amp; Kottke, B. Genetic studies of human apolipoproteins. V. A novel rapid procedure to screen apolipoprotein E polymorphism. \u003cem\u003eJ. Lipid Res.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 1535\u0026ndash;1543 (1988).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamboh, M. I. et al. Genome-wide association study of Alzheimer's disease. \u003cem\u003eTransl Psychiat\u003c/em\u003e. \u003cb\u003e2\u003c/b\u003e, 117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/tp.2012.45\u003c/span\u003e\u003cspan address=\"10.1038/tp.2012.45\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePirim, D. et al. Apolipoprotein E-C1-C4-C2 gene cluster region and inter-individual variation in plasma lipoprotein levels: a comprehensive genetic association study in two ethnic groups. \u003cem\u003ePloS One\u003c/em\u003e. \u003cb\u003e14\u003c/b\u003e, 0214060. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0214060\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0214060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarper, J. D. et al. Genome-wide association study of incident dementia in a community-based sample of older subjects. \u003cem\u003eJ. Alzheimers Dis.\u003c/em\u003e \u003cb\u003e88\u003c/b\u003e, 787\u0026ndash;798 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan, K. H. et al. Investigation of the independent role of a rare APOE variant (L28P; \u003cem\u003eAPOE* 4Pittsburgh\u003c/em\u003e) in late-onset Alzheimer disease. \u003cem\u003eNeurobiol. Aging\u003c/em\u003e. \u003cb\u003e122\u003c/b\u003e, 107\u0026ndash;111 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamboh, M. I., Aston, C. E. \u0026amp; Hamman, R. F. The relationship of APOE polymorphism and cholesterol levels in normoglycemic and diabetic subjects in a biethnic population from the San Luis Valley, Colorado. \u003cem\u003eAtherosclerosis\u003c/em\u003e. \u003cb\u003e112\u003c/b\u003e, 145\u0026ndash;159 (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGenin, E. et al. APOE and Alzheimer disease: a major gene with semi-dominant inheritance. \u003cem\u003eMol. Psychiat\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e, 903\u0026ndash;907 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeisgraber, K. H. et al. A novel electrophoretic variant of human apolipoprotein E. Identification and characterization of apolipoprotein E1. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cb\u003e73\u003c/b\u003e, 1024\u0026ndash;1033 (1984).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamboh, M. I. et al. A novel mutation in the apolipoprotein E gene (\u003cem\u003eAPOE*4Pittsburgh\u003c/em\u003e) is associated with the risk of late-onset Alzheimer's disease. \u003cem\u003eNeurosci. Lett.\u003c/em\u003e \u003cb\u003e263\u003c/b\u003e, 129\u0026ndash;132 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFinch, C. E. \u0026amp; Sapolsky, R. M. The evolution of Alzheimer disease, the reproductive schedule, and apoE isoforms☆. \u003cem\u003eNeurobiol. Aging\u003c/em\u003e. \u003cb\u003e20\u003c/b\u003e, 407\u0026ndash;428 (1999).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"APOE haplotype, Cloning, Sequencing, Restriction-fragment length polymorphism (RFLP), Genotyping","lastPublishedDoi":"10.21203/rs.3.rs-4902566/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4902566/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe common \u003cem\u003eAPOE2/E3/E4\u003c/em\u003e polymorphism is determined by two-site haplotypes: C112R and R158C. Due to strong linkage disequilibrium between the two sites, three of the four expected haplotypes/alleles (\u003cem\u003eE2, E3, E4\u003c/em\u003e) have been observed. Compared to the most common haplotype of \u003cem\u003eE3\u003c/em\u003e (C112 \u0026ndash; R158), the \u003cem\u003eE4\u003c/em\u003e (R112 \u0026ndash; R158) and \u003cem\u003eE2\u003c/em\u003e (C112 \u0026ndash; C158) haplotypes are determined by a single-point mutation at codons 112 and 158, respectively. The fourth haplotype (\u003cem\u003eE5\u003c/em\u003e) having mutations at both sites (R112\u0026ndash;C158) has been reported only as an incidental finding in three kindreds. To our knowledge, no systematic search has been done to determine its distribution in the general population. The objective of this study was to search for the elusive haplotype in 355 \u003cem\u003eAPOE\u003c/em\u003e 2/4 subjects derived from 14,819 genotyped subjects. A DNA fragment of 177bp from \u003cem\u003eAPOE\u003c/em\u003e 2/4 subjects was subcloned into competent bacterial cells to construct the phased haplotype clones followed by Sanger sequencing. We also used Whole-genome sequencing and RFLP assay to search for the fourth haplotype. All three strategies confirmed that the \u003cem\u003eE4\u003c/em\u003e and \u003cem\u003eE2\u003c/em\u003e alleles are present on opposite chromosomes, with no example having both alleles on the same chromosome, suggesting \u003cem\u003eE5\u003c/em\u003e might have minimum effect, if any, on disease risk.\u003c/p\u003e","manuscriptTitle":"Search for the elusive haplotype of the APOE polymorphism associated with Alzheimer’s disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-26 06:22:12","doi":"10.21203/rs.3.rs-4902566/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-03-05T06:23:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-02-20T17:50:37+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"56340310237907302512711475776032157898","date":"2025-02-06T07:04:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-06T22:03:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"179703705509715171455184831714020063808","date":"2024-11-06T15:22:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-08-29T17:26:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-29T17:24:47+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-08-29T17:20:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-27T10:28:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-08-12T19:21:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0cc614a2-fc4c-498b-bb0e-874588789d11","owner":[],"postedDate":"September 26th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":37068384,"name":"Biological sciences/Biological techniques"},{"id":37068385,"name":"Biological sciences/Genetics"},{"id":37068386,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2025-05-19T16:01:08+00:00","versionOfRecord":{"articleIdentity":"rs-4902566","link":"https://doi.org/10.1038/s41598-025-01263-0","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-05-15 15:57:06","publishedOnDateReadable":"May 15th, 2025"},"versionCreatedAt":"2024-09-26 06:22:12","video":"","vorDoi":"10.1038/s41598-025-01263-0","vorDoiUrl":"https://doi.org/10.1038/s41598-025-01263-0","workflowStages":[]},"version":"v1","identity":"rs-4902566","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4902566","identity":"rs-4902566","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}