Epigoitrin ameliorates acute liver injury in mice via regulation of the TLR4/NF-κB signaling pathway

Epigoitrin ameliorates acute liver injury in mice via regulation of the TLR4/NF-κB signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Epigoitrin ameliorates acute liver injury in mice via regulation of the TLR4/NF-κB signaling pathway Mingli Zhuge, Hongjing Liu, Lang Qin, Guiqiu Wang, Xueping Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6462699/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Acute liver injury (ALI), frequently triggered by drugs, toxins, or viral infections, is closely associated with the aberrant activation of the TLR4/NF-κB signaling pathway. Epigoitrin (EPG), a major bioactive component derived from Isatis indigotica root, exhibits anti-inflammatory, antioxidant properties, and potential NF-κB inhibitory effects. However, the specific mechanisms underlying its therapeutic action in ALI remain to be elucidated. Objective To investigate the protective effects and underlying mechanisms of EPG against carbon tetrachloride (CCl 4 )-induced ALI in mice. Methods Kunming mice were randomly divided into five groups: normal control group, model group, bifendate group, high-dose EPG group, and low-dose EPG group. The treatment groups received corresponding doses of the drugs, while the normal control and model groups were given an equal volume of distilled water via intragastric gavage once daily for 7 consecutive days. One hour after the final administration, all groups except the normal control group were intraperitoneally injected with 0.2% CCl₄-olive oil solution to induce liver injury. Sixteen hours post-injection, blood samples were collected to measure serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Liver tissues were harvested to assess interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) using enzyme-linked immunosorbent assay (ELISA). Hematoxylin and eosin (H&E) staining was performed to observe histopathological changes in the liver. The effects on the Toll-like receptor 4/nuclear factor-κB (TLR4/NF-κB) signaling pathway were evaluated by quantitative real-time PCR and Western blot analysis. Results EPG significantly reduced serum liver function markers (ALT and AST) and levels of pro-inflammatory cytokines, including interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), in mice ( P <0.05). Histopathological examination demonstrated that EPG effectively ameliorated CCl₄-induced hepatocellular necrosis. Furthermore, qPCR and Western blot (WB) analyses revealed that EPG markedly suppressed the TLR4/NF-κB signaling pathway ( P <0.05). Conclusion EPG exerts a protective effect against CCl₄-induced ALI in mice, and its mechanism may involve the suppression of the TLR4/NF-κB signaling pathway. Biological sciences/Drug discovery Health sciences/Molecular medicine TLR4 NF-κB Epigoitrin Isatis indigotica root Acute liver injury Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction ALI is commonly triggered by drug abuse, chemical toxins, viral infections, and other factors. It directly induces hepatocellular necrosis and hepatic inflammatory responses, and may indirectly lead to cholestasis, jaundice, coagulation disorders, hepatic encephalopathy, and multi-organ failure. Persistent hepatic inflammation further increases the risk of carcinogenesis [ 1 , 2 ] . The pathogenesis of ALI is closely associated with aberrant activation of the Toll-like receptor 4 (TLR4)/nuclear factor-kappa B (NF-κB) signaling pathway [ 3 , 4 ] . Upon exposure to toxic agents such as CCl₄, damaged hepatocytes release damage-associated molecular patterns (DAMPs, e.g., HMGB1 and S100 proteins) [ 5 ] , which activate TLR4 on hepatocyte membranes, initiating MyD88-dependent signaling. This cascade facilitates phosphorylation and degradation of the IκBα inhibitor by the IKK complex, leading to nuclear translocation of the NF-κB p65/p50 dimer. Consequently, transcription of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-1β is upregulated, amplifying the inflammatory cascade [ 6 , 7 ] . Furthermore, sustained NF-κB activation promotes excessive reactive oxygen species (ROS) production, exacerbating mitochondrial dysfunction and hepatocyte apoptosis/necrosis, thereby establishing a vicious cycle of "inflammation-oxidative stress-cell death" [ 8 , 9 ] . Current studies confirm that targeted inhibition of this pathway (e.g., TLR4 antagonist TAK-242 [ 10 ] , NF-κB inhibitor BAY11-7082 [ 11 ] ) significantly alleviates experimental ALI [ 12 , 13 ] . Isatis indigotica root, a traditional Chinese herb, is renowned for its heat-clearing and detoxifying effects [ 14 ] . Modern pharmacological studies reveal its anti-inflammatory properties [ 15 , 16 ] . EPG (Fig. 1 ), a major bioactive component of Isatidis Radix, exhibits antiviral, anti-inflammatory, and antioxidant activities. EPG exerts its pharmacological effects partly through NF-κB inhibition [ 17 ] . Notably, a mixture of Isatidis Radix, Forsythia suspensa, and gypsum has been shown to suppress IL-6 and TNF-α expression via the TLR4/NF-κB pathway. However, the therapeutic effects of EPG on ALI remain poorly investigated. This study employs a classical CCl₄-induced ALI murine model to validate EPG’s hepatoprotective efficacy and elucidate its underlying mechanisms, aiming to expand the pharmacological profile of EPG and provide insights for ALI treatment strategies. Materials and Methods Animal Experiments This study was conducted in compliance with the ARRIVE guidelines 2.0. All experimental procedures were approved by the Ethics Committee of Guangxi Medical University (Approval No. 2023-SW017-01) and were carried out in accordance with relevant guidelines and regulations. Specific pathogen-free (SPF) Kunming (KM) mice (half male and female, 20–25 g) were purchased from the Experimental Animal Center of Guangxi Medical University (Animal Production License No. SCXK-Gui 2020-0003; Animal Use License No. SCXK-Gui 2020-0004). Mice were housed in the Functional Laboratory of Guangxi Health Science College under controlled conditions: temperature 21 ± 4°C, relative humidity 55–60%, and a 12-hour light/dark cycle. All mice had free access to food and water and were acclimatized for 1 week prior to experimentation. The mice were randomly devided into 5 groups by using a random number table ( n = 10/group). Control group: No treatment. Model group: CCl₄-induced liver injury. Bifendate group: Treated with bifendate (positive control). EPG-H group: High-dose EPG (0.2 mg/kg). EPG-L group: Low-dose EPG (0.1 mg/kg). EPG (purity 98%, Batch No. CQBGYC20240313; Shaanxi Chengqian Biotechnology Co., Ltd.) and bifendate pills (Batch No. 19J220522; Wanbangde Pharmaceutical Group Co., Ltd.) were dissolved in saline. All treatments were administered by oral gavage once daily for 7 consecutive days. The Control and Model groups received equivalent volumes of saline. One hour after the final administration, the Model, Bifendate, EPG-H, and EPG-L groups received a single intraperitoneal injection of 0.2% CCl₄ in olive oil (10 mL/kg) to induce acute liver injury. The Control group remained untreated. Mice were fasted (with water ad libitum) for 16 hours post-modeling and then euthanized via intraperitoneal injection of pentobarbital sodium (100 mg/kg), with cessation of breathing and heartbeat as the criterion for death. Collected each mice’s liver, each one was divided into two parts: the right lobe was snap-frozen at -80°C for subsequent analysis, and the left lobe was fixed in 4% paraformaldehyde. Liver Function Assessment Serum supernatant from each group of mice was collected. Serum ALTand AST levels were measured using a fully automated biochemical analyzer (Chemray 800; Shenzhen Rayto Life and Analytical Sciences Co., Ltd.) following the manufacturer’s instructions for the ALT assay kit (Cat. No. S03030, Batch No. 20240430) and AST assay kit (Cat. No. S03040, Batch No. 20240428) from the same manufacturer. Hematoxylin and Eosin (H&E) Staining Liver tissues fixed in 4% paraformaldehyde were processed through paraffin embedding and sectioned into 4-µm-thick slices. The sections were stained with hematoxylin and eosin (H&E) following standard protocols. Histopathological alterations in liver tissues were examined under a light microscope, and the severity of hepatocellular injury was compared across experimental groups. Determine the levels of IL-1β, IL-6, and TNF-α by ELISA ELISA was employed to determine the levels of IL-1β, IL-6, and TNF-α. Briefly, mouse liver tissues were homogenized in phosphate-buffered saline (PBS), centrifuged at 3000 rpm for 20 minutes, and the supernatants were collected. The levels of cytokines were measured using IL-1β, IL-6, and TNF-α ELISA kits (Shanghai Youxuan Biotechnology Co., Ltd., Catalog numbers YX-091203M, YX-091206M, and YX-201407M, respectively) and a microplate reader (BioTek, ELx808) according to the manufacturer's instructions. Real-time quantitative PCR (RT-qPCR) Liver tissues were thoroughly ground into a homogenate with RNA stabilization solution under low-temperature conditions. Total RNA was extracted from liver tissues using the Total RNA Extraction Kit (Servicebio, Cat. G3640-50T). RNA concentration was measured with a NanoDrop 2000 Ultramicro Spectrophotometer (Thermo Fisher, Model: ND-2000). Subsequently, cDNA was synthesized using the Reverse Transcription Kit (Vazyme, Cat. R223-01). Reaction mixtures were prepared according to the Fluorescent Quantitative Detection Kit (Vazyme, Cat. Q131-02), with m-GAPDH as the internal reference gene (primers listed in Table 1 ). RT-qPCR analysis was performed on a Real-time PCR System (Applied Biosystems, USA, Model: ABI 7500), with three independent experimental replicates. The 2 −ΔΔCt method was employed for data analysis. Table 1 Primers Gene Primers(5'-3') Product length m-TLR4 F:CCTGACACCAGGAAGCTTGA R:CTTCAAGGGGTTGAAGCTCAGA 142 bp m-NF-KB p65 F:CAAGTACCTGCGCACTCCG R:TTAGGATCCATCTGCGCTCG 120 bp m-GAPDH F:GCATCTTCTTGTGCAGTGCC R:TACGGCCAAATCCGTTCACA 74 bp Western Blotting (WB) Liver tissues were homogenized under low-temperature conditions and lysed with RIPA lysis buffer on ice, followed by centrifugation to collect the supernatant. Total protein was extracted from liver tissues using the BCA Protein Assay Kit (Henan Dinghan Biotechnology Co., Ltd., Cat. HC0801) for quantitative analysis. Proteins were separated by SDS-PAGE gel electrophoresis (Henan Dinghan Biotechnology Co., Ltd., Cat. HC0824) and transferred onto a PVDF membrane. After blocking, the membrane was incubated overnight at 4°C with primary antibodies, including Phospho-NF-κB p65 (Cell Signaling Technology, Cat. 3033T), TLR4 Monoclonal Antibody (Wuhan Sanying, Cat.66350-1-Ig), and β-actin (Wuhan Sanying, Cat.81115-1-RR). The next day, the membrane was incubated with an HRP-conjugated goat anti-mouse secondary antibody (Henan Dinghan Biotechnology Co., Ltd., Cat. HR0601) at 37°C for 1 hour. Protein bands were visualized using ECL ultrasensitive chemiluminescent substrate (Henan Dinghan Biotechnology Co., Ltd., Cat.HR0802) and imaged with a Bio-Rad imaging system. Experiments were repeated three times. Results were analyzed using ImageJ software. Statistical Analysis Experimental data are presented as the mean ± standard deviation ( x̄ ± s ). Statistical comparisons were performed using SPSS statistical software. A value of P < 0.05 was considered statistically significant. Results Liver Biochemical Parameters The liver biochemical parameters of the mice are shown in Fig. 2 . The ALT and AST levels were significantly increased in the model group, indicating liver injury. After intervention with high-dose and low-dose EPG, both ALT and AST levels were significantly decreased ( P < 0.05). Histopathological Changes in Liver Tissue As shown in Fig. 3 , the liver tissue of mice in the normal group exhibited normal morphology, with hepatocytes arranged radially around the central vein in an orderly manner and no inflammatory cell infiltration. In contrast, the liver tissue of mice in the model group showed significant swelling and necrosis of hepatocytes, as well as pronounced inflammatory cell infiltration. In the EPG and bifendate groups, the inflammatory infiltration in the liver tissue was reduced, and the swelling and necrosis of hepatocytes were also alleviated, indicating an improvement in the inflammatory response. Levels of IL-1β, IL-6, and TNF-α As shown in Fig. 4 , the levels of IL-1β, IL-6, and TNF-α in the liver tissue of mice in the model group were significantly increased, indicating the occurrence of an inflammatory response. In contrast, the levels of these cytokines were significantly decreased in the normal group, as well as in the bifendate and EPG groups ( P < 0.05), suggesting an alleviation of the inflammatory response. Gene Expression of TLR4 and NF-κB p65 As shown in Fig. 5 , the gene expression levels of TLR4 and NF-κB p65 were significantly increased in the model group compared to the normal group ( P < 0.05). In the EPG high-dose group, the gene expression levels of TLR4 and NF-κB p65 were significantly decreased, suggesting that EPG has an inhibitory effect on the TLR4 and NF-κB p65 related signaling pathways. Protein Expression of TLR4 and NF-κB p65 As shown in Fig. 6 , the protein expression levels of TLR4 and NF-κB p65 were significantly increased in the model group compared to the normal group ( P < 0.05). In the EPG high-dose group, the protein expression levels of TLR4 and NF-κB p65 were significantly decreased, suggesting that EPG has an inhibitory effect on the TLR4 and NF-κB p65 related signaling pathways. Discussion This study reveals that EPG can ameliorate ALI, potentially through inhibiting the TLR4/NF-κB signaling pathway. Experimental results demonstrate that following EPG intervention, serum levels of ALT and AST, as well as hepatic levels of inflammatory cytokines IL-1β, IL-6, and TNF-α, are significantly reduced. Additionally, there is a marked alleviation of inflammatory infiltration in liver tissues, with comprehensive indicators suggesting an improvement in liver inflammation. Further mechanistic investigations reveal that the expression of TLR4, NF-κB p65 genes, and their corresponding proteins is notably downregulated. The reduction in the release of downstream inflammatory cytokines IL-1β, IL-6, and TNF-α also collectively substantiates the inhibition of the TLR4/NF-κB signaling pathway. The mechanism of action is schematically presented in Fig. 7. This finding aligns closely with the modern pharmacological interpretation of the traditional "heat-clearing and detoxifying" efficacy of Isatis indigotica root [ 18 , 19 ] , suggesting that its hepatoprotective effects may be closely associated with the suppression of excessive activation of the innate immune system. The liver is a vital organ for metabolism and detoxification in the human body, yet various factors such as drugs, alcohol, and viruses can trigger liver damage [ 20 , 21 ] , leading to elevated liver function indicators ALT and AST [ 22 , 23 ] . The overexpression of inflammatory cytokines like IL-1β, IL-6, and TNF-α exacerbates hepatocyte damage and death [ 24 , 25 ] . The TLR4 and NF-κB p65 signaling pathways are crucial in inflammatory responses, and their aberrant activation results in the massive production of inflammatory cytokines [ 26 , 27 ] . By inhibiting these signaling pathways, EPG reduces the generation and release of inflammatory cytokines, thereby mitigating liver inflammatory injury and preserving normal hepatocyte function. Despite clarifying the key role of the TLR4/NF-κB pathway in this study, certain limitations remain. Exploring the synergistic effects of EPG with other TLR4 inhibitors (such as Eritoran [ 28 ] , CRX-526 [ 29 ] ) and NF-κB inhibitors (such as Infliximab [ 30 ] ,Thalidomide [ 31 ] ) may provide more convincing evidence and represents a future research direction. Furthermore, future studies should employ gene knockout models to further verify pathway targeting. From a broader perspective, the TLR4/NF-κB signaling pathway is implicated in various diseases, including inflammatory disorders, autoimmune diseases [ 32 , 33 ] , and neurodegenerative diseases [ 34 , 35 ] . The mechanism by which EPG alleviates inflammation through inhibiting this pathway not only offers novel insights into the treatment of acute liver injury but also provides potential strategies for managing other inflammation-related conditions. Moreover, as a natural product, EPG boasts advantages such as widespread availability. and high safety. While its application in ALI holds promising prospects, it currently remains in the experimental research phase. Future studies should further investigate its clinical efficacy and safety to offer more effective therapeutic options for patients with ALI. Conclusion This study found that EPG achieved a protective effect against liver injury by inhibiting the liver function indicators ALT and AST as well as the inflammatory cytokines IL-1β, IL-6, and TNF-α. The mechanism of action may be related to its inhibition of the TLR4/NF-κB p65 signaling pathway. Abbreviations ALI Acute liver injury EPG Epigoitrin TLR4 Toll-like receptor 4 NF-Κb Nuclear factor-κB CCl₄ Carbon tetrachloride ALT Alanine aminotransferase AST Aspartate aminotransferase IL-1β Interleukin-1β IL-6 Interleukin-6 TNF-α Tumor necrosis factor-α ELISA Enzyme-linked immunosorbent assay H&E Hematoxylin and eosin q-PCR Quantitative real-time PCR WB Western blot Declarations Acknowledgements Not applicable. Author contributions Mingli Zhuge contributed to the main execution of experiments. Xueping Liu contributed to the study concept and design experiments, interpretation of data, acquisition of data, statistical analysis, writing of the manuscript and provided the research funds. Hongjing Liu, Lang Qin, Guiqiu Wang, assisted in the execution of experiments and contributed to the study concept and provided critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript. Funding This study was supported by the 2024 Guangxi Middle-aged and Young University Teachers' Research Fundamental Capacity Enhancement Project (No. 2024KY1432) and Self-funded Research Project of Guangxi Zhuang Autonomous Region Administration of Traditional Chinese Medicine (No. GXZYA20230247). Ethics approval and consent to participate The animal study protocol was approved by the Ethics Committee of Guangxi Medical University (Approval No. 2023-SW017-01). As mandated by China Animal Protection and Use Committee regulations, every effort was made to guarantee the comfort and welfare of the animals throughout the studies. All animal procedures were conducted in accordance with ARRIVE guidelines and NIH animal care standards. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Author details 1 Liuzhou Maternity and Child Healthcare Hospital, Liuzhou 545001 China, People’s Republic of China 2 Basic Medical Sciences Department, Guangxi Health Science College, Nanning 530021, People’s Republic of China Data availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Alkandahri MY, Pamungkas BT, Oktoba Z, et al. Hepatoprotective effect of kaempferol: A review of the dietary sources, bioavailability, mechanisms of action, and safety. Adv Pharmacol Pharm Sci (2023) 2023:1–16. doi: 10.1155/2023/1387665 Yang W, Wang Y, Zhang C, et al. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022;13:865689. Published 2022 Apr 4. doi:10.3389/fphar.2022.865689 Ma Y, Li W, Yao Q, et al. Harmine ameliorates CCl4-induced acute liver injury through suppression of autophagy and inflammation. Int Immunopharmacol. 2024;129:111538. doi:10.1016/j.intimp.2024.111538 Liu Y, Liu N, Liu Y, et al. Ginsenoside Rb1 Reduces D-GalN/LPS-induced Acute Liver Injury by Regulating TLR4/NF-κB Signaling and NLRP3 Inflammasome. J Clin Transl Hepatol. 2022;10(3):474-485. doi:10.14218/JCTH.2021.00072 Amin AR, Islam AB. Genomic analysis and differential expression of HMG and S100A family in human arthritis: upregulated expression of chemokines, IL-8 and nitric oxide by HMGB1. DNA Cell Biol. 2014;33(8):550-565. doi:10.1089/dna.2013.2198 Wang Z, Sun P, Zhao T, et al. E Se tea extract ameliorates CCl4 induced liver fibrosis via regulating Nrf2/NF-κB/TGF-β1/Smad pathway. Phytomedicine. 2023;115:154854. doi:10.1016/j.phymed.2023.154854 Liu S, Wang H, Liu S, et al. Fermented Ginsenosides Alleviate Acute Liver Injury Induced by CCl4 in Mice by Regulating the AKT/mTOR Signaling Pathway. J Med Food. 2024;27(10):961-970. doi:10.1089/jmf.2023.k.0322 An Y, Zhang H, Wang C, et al. Activation of ROS/MAPKs/NF-κB/NLRP3 and inhibition of efferocytosis in osteoclast-mediated diabetic osteoporosis. FASEB J. 2019;33(11):12515-12527. doi:10.1096/fj.201802805RR Morgan MJ, Liu ZG. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011;21(1):103-115. doi:10.1038/cr.2010.178 Matsunaga N, Tsuchimori N, Matsumoto T, Ii M. TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Mol Pharmacol. 2011;79(1):34-41. doi:10.1124/mol.110.068064 Wang F, Li YM, Li RY, Yang YE, Wei M, Ha C. U0126 and BAY11-7082 Inhibit the Progression of Endometriosis in a Rat Model by Suppressing the MEK/ERK/NF-κB Pathway. Womens Health Rep (New Rochelle). 2023;4(1):65-77. Published 2023 Feb 6. doi:10.1089/whr.2021.0151 Zhou Q, He DX, Deng YL, et al. MiR-124-3p targeting PDE4B attenuates LPS-induced ALI through the TLR4/NF-κB signaling pathway. Int Immunopharmacol. 2022;105:108540. doi:10.1016/j.intimp.2022.108540 Feng J, Shen C, Tian S, et al. Total flavonoids from the aerial parts of Tetrastigma hemsleyanum prevent LPS-induced ALI by modulating the TLR4/NF-κB pathway in mice. Fitoterapia. 2024;178:106175. doi:10.1016/j.fitote.2024.106175 Commission C. P. Pharmacopoeia of the People’s Republic of China . Beijing, China: China Medical Science Press; 2019. Ren L, Li Q, Li H, et al. Polysaccharide extract from Isatidis Radix inhibits multiple inflammasomes activation and alleviate gouty arthritis. Phytother Res. 2022;36(8):3295-3312. doi:10.1002/ptr.7514 Fan Z, Cai L, Wang Y, Zhu Q, Wang S, Chen B. The Acidic Fraction of Isatidis Radix Regulates Inflammatory Response in LPS-Stimulated RAW264.7 Macrophages through MAPKs and NF-κB Pathway. Evid Based Complement Alternat Med. 2021;2021:8879862. Published 2021 Mar 9. doi:10.1155/2021/8879862 Chen H, Jie C, Tang LP, et al. New insights into the effects and mechanism of a classic traditional Chinese medicinal formula on influenza prevention. Phytomedicine. 2017;27:52-62. doi:10.1016/j.phymed.2017.02.004 Deng JL, Tao YL, He YQ, Chen WS. Zhongguo Zhong Yao Za Zhi. 2021;46(8):2029-2036. doi:10.19540/j.cnki.cjcmm.20201230.601 Chen J, Zhu Z, Gao T, et al. Isatidis Radix and Isatidis Folium: A systematic review on ethnopharmacology, phytochemistry and pharmacology. J Ethnopharmacol. 2022;283:114648. doi:10.1016/j.jep.2021.114648 Neuman MG, Seitz HK, Teschke R, et al. Molecular, Viral and Clinical Features of Alcohol- and Non-Alcohol-Induced Liver Injury. Curr Issues Mol Biol. 2022;44(3):1294-1315. Published 2022 Mar 16. doi:10.3390/cimb44030087 Neuman MG, Seitz HK, Teschke R, et al. Molecular, Viral and Clinical Features of Alcohol- and Non-Alcohol-Induced Liver Injury. Curr Issues Mol Biol. 2022;44(3):1294-1315. Published 2022 Mar 16. doi:10.3390/cimb44030087 Amernia B, Moosavy SH, Banookh F, Zoghi G. FIB-4, APRI, and AST/ALT ratio compared to FibroScan for the assessment of hepatic fibrosis in patients with non-alcoholic fatty liver disease in Bandar Abbas, Iran. BMC Gastroenterol. 2021;21(1):453. Published 2021 Dec 3. doi:10.1186/s12876-021-02038-3 Chinnappan R, Mir TA, Alsalameh S, et al. Aptasensors Are Conjectured as Promising ALT and AST Diagnostic Tools for the Early Diagnosis of Acute Liver Injury. Life (Basel). 2023;13(6):1273. Published 2023 May 29. doi:10.3390/life13061273 Duan Y, Pan X, Luo J, et al. Association of Inflammatory Cytokines With Non-Alcoholic Fatty Liver Disease. Front Immunol. 2022;13:880298. Published 2022 May 6. doi:10.3389/fimmu.2022.880298 Bekçibaşı M, Deveci Ö, Oğuz A, Bozkurt F, Dayan S, Çelen MK. Serum TNF-α, IL-1β, and IL-6 levels in chronic HBV-infected patients. Int J Clin Pract. 2021;75(8):e14292. doi:10.1111/ijcp.14292 Li D, Guo YY, Cen XF, et al. Lupeol protects against cardiac hypertrophy via TLR4-PI3K-Akt-NF-κB pathways. Acta Pharmacol Sin. 2022;43(8):1989-2002. doi:10.1038/s41401-021-00820-3 Xie F, Kitagawa Y, Ogata H, Yasuhara S, You Z, Jeevendra Martyn JA. Morphine induces inflammatory responses via both TLR4 and cGAS-STING signaling pathways. Cytokine. 2024;183:156737. doi:10.1016/j.cyto.2024.156737 Mcdonald KA, Huang H, Tohme S, et al. Toll-like receptor 4 (TLR4) antagonist eritoran tetrasodium attenuates liver ischemia and reperfusion injury through inhibition of high-mobility group box protein B1 (HMGB1) signaling. Mol Med. 2015;20(1):639-648. Published 2015 Mar 13. doi:10.2119/molmed.2014.00076 Lin M, Yiu WH, Li RX, et al. The TLR4 antagonist CRX-526 protects against advanced diabetic nephropathy. Kidney Int. 2013;83(5):887-900. doi:10.1038/ki.2013.11 Shinde A, Tang X, Singh R, Brindley DN. Infliximab, a Monoclonal Antibody against TNF-α, Inhibits NF-κB Activation, Autotaxin Expression and Breast Cancer Metastasis to Lungs. Cancers (Basel). 2023;16(1):52. Published 2023 Dec 21. doi:10.3390/cancers16010052 Chen M, Xie H, Chen Z, et al. Thalidomide ameliorates rosacea-like skin inflammation and suppresses NF-κB activation in keratinocytes. Biomed Pharmacother. 2019;116:109011. doi:10.1016/j.biopha.2019.109011 He S, Li W, Wang G, et al. FTO-mediated m6A modification alleviates autoimmune uveitis by regulating microglia phenotypes via the GPC4/TLR4/NF-κB signaling axis. Genes Dis. 2022;10(5):2179-2193. Published 2022 Oct 4. doi:10.1016/j.gendis.2022.09.008 Kang Y, Kuang X, Yan H, et al. A Novel Synbiotic Alleviates Autoimmune Hepatitis by Modulating the Gut Microbiota-Liver Axis and Inhibiting the Hepatic TLR4/NF-κB/NLRP3 Signaling Pathway. mSystems. 2023;8(2):e0112722. doi:10.1128/msystems.01127-22 Muhammad T, Ikram M, Ullah R, Rehman SU, Kim MO. Hesperetin, a Citrus Flavonoid, Attenuates LPS-Induced Neuroinflammation, Apoptosis and Memory Impairments by Modulating TLR4/NF-κB Signaling. Nutrients. 2019;11(3):648. Published 2019 Mar 17. doi:10.3390/nu11030648 Ali W, Choe K, Park JS, et al. Kojic acid reverses LPS-induced neuroinflammation and cognitive impairment by regulating the TLR4/NF-κB signaling pathway. Front Pharmacol. 2024;15:1443552. Published 2024 Aug 9. doi:10.3389/fphar.2024.1443552 Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterial1.pdf SupplementaryMaterial2.pdf SupplementaryMaterial3.pdf SupplementaryMaterial41.pdf SupplementaryMaterial42.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6462699","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":451609026,"identity":"c3957920-fca1-4d14-964f-2aee3146783f","order_by":0,"name":"Mingli Zhuge","email":"","orcid":"","institution":"Liuzhou Maternal and Child Health Hospital","correspondingAuthor":false,"prefix":"","firstName":"Mingli","middleName":"","lastName":"Zhuge","suffix":""},{"id":451609028,"identity":"7ab764fc-9615-4f80-80f9-630c46b726a2","order_by":1,"name":"Hongjing Liu","email":"","orcid":"","institution":"Guangxi Health Science College","correspondingAuthor":false,"prefix":"","firstName":"Hongjing","middleName":"","lastName":"Liu","suffix":""},{"id":451609029,"identity":"c4986d83-a897-4230-8660-e9e9452b8238","order_by":2,"name":"Lang Qin","email":"","orcid":"","institution":"Guangxi Health Science College","correspondingAuthor":false,"prefix":"","firstName":"Lang","middleName":"","lastName":"Qin","suffix":""},{"id":451609030,"identity":"160ee109-0fef-46cc-a723-b9b43d459b8c","order_by":3,"name":"Guiqiu Wang","email":"","orcid":"","institution":"Guangxi Health Science College","correspondingAuthor":false,"prefix":"","firstName":"Guiqiu","middleName":"","lastName":"Wang","suffix":""},{"id":451609031,"identity":"792326e5-b75a-49d9-9f95-534d3c1cac5a","order_by":4,"name":"Xueping Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYBACPmYIzcPAwHwAJmiAVwsbQgtbApFaEEweuEoCWth5zKR5Ku7ImPOv+fyat60usYG9eZsEQ80dPA7jMTbmOfOMx3LG222WM9vYEht4jpVJMBx7hk+L4WPetsM8BjfObjP4uI0nsUEix0yCseEwPi0Gh3n/gbSceWaQuE0isUH+DUEtQFsagFrO9zA/+LjNAGgLDyEtbMWGc449A9rCZsY481+CcRtPWrFFwjHcWvj5D2+TeFNzx97g/OHHn3nO1Mn2sx/eeONDDW4tUHCAgUEigU0CyHJsA/ETCGkAa+E/wPwByLInrHgUjIJRMApGGgAAacBQ4ioi5UIAAAAASUVORK5CYII=","orcid":"","institution":"Guangxi Health Science College","correspondingAuthor":true,"prefix":"","firstName":"Xueping","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-04-16 10:53:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6462699/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6462699/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":82179173,"identity":"3abe4147-051d-49b5-8fcf-c33066a12302","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":11192,"visible":true,"origin":"","legend":"\u003cp\u003eStructural formula of Epigoitrin\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/26c43c428ba1f307fda7b7bd.png"},{"id":82180109,"identity":"bab35a4d-522d-45d9-9b8a-9ff1b3e0562b","added_by":"auto","created_at":"2025-05-07 11:40:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":17206,"visible":true,"origin":"","legend":"\u003cp\u003eSerum levels of ALT and AST in mice. EPG-H: epigoitrin high-dose group, EPG-L: epigoitrin low-dose group. Data are presented as the mean ± standard deviation (\u003cem\u003ex̄ \u003c/em\u003e±\u003cem\u003e s\u003c/em\u003e);\u003cem\u003e n \u003c/em\u003e= 6\u003cem\u003e \u003c/em\u003eanimals per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 vs. model group. The raw data are available in Supplementary Material 1.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/3a6f86561bac6db01df81f5b.png"},{"id":82179180,"identity":"df891a2b-44f3-4005-83ea-65b5c8e7d769","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":259978,"visible":true,"origin":"","legend":"\u003cp\u003ePathological changes in the liver of mice (H\u0026amp;E staining). EPG-H, high dose of epigoitrin (200 mg/kg). EPG-L, low dose of epigoitrin (100 mg/kg).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/e448c5392e05ceb86b957a84.png"},{"id":82179175,"identity":"d3d7251e-8cc1-4473-a020-0b3d121aa18b","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":13868,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of IL-1β, IL-6, and TNF-α in mouse liver. EPG-H: epigoitrin high-dose group, EPG-L: epigoitrin low-dose group. Data are presented as the mean ± standard deviation (\u003cem\u003ex̄\u003c/em\u003e ± \u003cem\u003es\u003c/em\u003e); \u003cem\u003en\u003c/em\u003e = 3 animals per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 vs. model group. The raw data are available in Supplementary Material 2.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/7fb9527b4541fba11b51fee2.png"},{"id":82179179,"identity":"ef2b5568-6904-476f-88eb-4c27773fdb8b","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":18523,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the gene expression levels of TLR4 and NF-κB p65 in mice liver under EPG intervention. EPG-H: epigoitrin high-dose group. Data are presented as the mean ± standard deviation (\u003cem\u003ex̄ \u003c/em\u003e± \u003cem\u003es\u003c/em\u003e);\u003cem\u003e n \u003c/em\u003e= 3 animals per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 vs. model group. The raw data are available in Supplementary Material 3.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/73f80fe9fc5792d77cfc4d3a.png"},{"id":82179177,"identity":"1bdf55cf-fef8-4f4f-97cb-00dfae86a7c1","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":117631,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the protein expression levels of TLR4 and NF-κB p65 in mice liver under EPG intervention. EPG-H: epigoitrin high-dose group. Data are presented as the mean ± standard deviation (\u003cem\u003ex̄ \u003c/em\u003e± \u003cem\u003es\u003c/em\u003e);\u003cem\u003e n \u003c/em\u003e= 3 animals per group. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 vs. model group. The raw data and gel imprinting are available in Supplementary Material 4-1 and 4-2.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/a277af4baa1db0abe6fc658d.png"},{"id":82179184,"identity":"0fef2d57-5e37-4c2e-80f9-35ce89224ec8","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":194528,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of EPG's protective effect against liver injury by inhibiting the TLR4/NF-κB signaling pathway.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/197facb6ab77b69b3bf445f1.png"},{"id":86220661,"identity":"d40cf16d-8fb8-4626-a554-400c949cf4c8","added_by":"auto","created_at":"2025-07-08 07:02:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1285910,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/edc6e8d0-2a3d-4f3b-bb54-a68d8f2ac587.pdf"},{"id":82179170,"identity":"0a83170a-922e-4208-ad82-b3220fed9b0e","added_by":"auto","created_at":"2025-05-07 11:32:24","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":50953,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/e3b24c66129ce2b5c0bbcd84.pdf"},{"id":82180110,"identity":"b77c8e76-b200-4f9e-a065-a2505a60e49e","added_by":"auto","created_at":"2025-05-07 11:40:24","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":50959,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/b08852a54596f6d9b8704e7d.pdf"},{"id":82180111,"identity":"fa778921-53cd-4645-a4c7-7f24b4a111fd","added_by":"auto","created_at":"2025-05-07 11:40:24","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":56281,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/1fcb9dda70186753fc77ba3d.pdf"},{"id":82180114,"identity":"faaba740-23df-4c04-ace6-1c7ad9ac33db","added_by":"auto","created_at":"2025-05-07 11:40:24","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":51307,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial41.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/6fb51b312a9901cf4f364831.pdf"},{"id":82180116,"identity":"69886210-cfe9-4673-bc7e-2423916ab819","added_by":"auto","created_at":"2025-05-07 11:40:24","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":223796,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial42.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6462699/v1/3bd92e570354a1aca0a3b2f4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Epigoitrin ameliorates acute liver injury in mice via regulation of the TLR4/NF-κB signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eALI is commonly triggered by drug abuse, chemical toxins, viral infections, and other factors. It directly induces hepatocellular necrosis and hepatic inflammatory responses, and may indirectly lead to cholestasis, jaundice, coagulation disorders, hepatic encephalopathy, and multi-organ failure. Persistent hepatic inflammation further increases the risk of carcinogenesis \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe pathogenesis of ALI is closely associated with aberrant activation of the Toll-like receptor 4 (TLR4)/nuclear factor-kappa B (NF-κB) signaling pathway \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Upon exposure to toxic agents such as CCl₄, damaged hepatocytes release damage-associated molecular patterns (DAMPs, e.g., HMGB1 and S100 proteins) \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, which activate TLR4 on hepatocyte membranes, initiating MyD88-dependent signaling. This cascade facilitates phosphorylation and degradation of the IκBα inhibitor by the IKK complex, leading to nuclear translocation of the NF-κB p65/p50 dimer. Consequently, transcription of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-1β is upregulated, amplifying the inflammatory cascade \u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Furthermore, sustained NF-κB activation promotes excessive reactive oxygen species (ROS) production, exacerbating mitochondrial dysfunction and hepatocyte apoptosis/necrosis, thereby establishing a vicious cycle of \"inflammation-oxidative stress-cell death\" \u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. Current studies confirm that targeted inhibition of this pathway (e.g., TLR4 antagonist TAK-242 \u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, NF-κB inhibitor BAY11-7082 \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e) significantly alleviates experimental ALI \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIsatis indigotica root, a traditional Chinese herb, is renowned for its heat-clearing and detoxifying effects \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Modern pharmacological studies reveal its anti-inflammatory properties \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. EPG (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), a major bioactive component of Isatidis Radix, exhibits antiviral, anti-inflammatory, and antioxidant activities. EPG exerts its pharmacological effects partly through NF-κB inhibition \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Notably, a mixture of Isatidis Radix, Forsythia suspensa, and gypsum has been shown to suppress IL-6 and TNF-α expression via the TLR4/NF-κB pathway. However, the therapeutic effects of EPG on ALI remain poorly investigated. This study employs a classical CCl₄-induced ALI murine model to validate EPG\u0026rsquo;s hepatoprotective efficacy and elucidate its underlying mechanisms, aiming to expand the pharmacological profile of EPG and provide insights for ALI treatment strategies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal Experiments\u003c/h2\u003e \u003cp\u003eThis study was conducted in compliance with the ARRIVE guidelines 2.0. All experimental procedures were approved by the Ethics Committee of Guangxi Medical University (Approval No. 2023-SW017-01) and were carried out in accordance with relevant guidelines and regulations. Specific pathogen-free (SPF) Kunming (KM) mice (half male and female, 20\u0026ndash;25 g) were purchased from the Experimental Animal Center of Guangxi Medical University (Animal Production License No. SCXK-Gui 2020-0003; Animal Use License No. SCXK-Gui 2020-0004). Mice were housed in the Functional Laboratory of Guangxi Health Science College under controlled conditions: temperature 21\u0026thinsp;\u0026plusmn;\u0026thinsp;4\u0026deg;C, relative humidity 55\u0026ndash;60%, and a 12-hour light/dark cycle. All mice had free access to food and water and were acclimatized for 1 week prior to experimentation. The mice were randomly devided into 5 groups by using a random number table (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10/group). Control group: No treatment. Model group: CCl₄-induced liver injury. Bifendate group: Treated with bifendate (positive control). EPG-H group: High-dose EPG (0.2 mg/kg). EPG-L group: Low-dose EPG (0.1 mg/kg). EPG (purity 98%, Batch No. CQBGYC20240313; Shaanxi Chengqian Biotechnology Co., Ltd.) and bifendate pills (Batch No. 19J220522; Wanbangde Pharmaceutical Group Co., Ltd.) were dissolved in saline. All treatments were administered by oral gavage once daily for 7 consecutive days. The Control and Model groups received equivalent volumes of saline. One hour after the final administration, the Model, Bifendate, EPG-H, and EPG-L groups received a single intraperitoneal injection of 0.2% CCl₄ in olive oil (10 mL/kg) to induce acute liver injury. The Control group remained untreated. Mice were fasted (with water ad libitum) for 16 hours post-modeling and then euthanized via intraperitoneal injection of pentobarbital sodium (100 mg/kg), with cessation of breathing and heartbeat as the criterion for death. Collected each mice\u0026rsquo;s liver, each one was divided into two parts: the right lobe was snap-frozen at -80\u0026deg;C for subsequent analysis, and the left lobe was fixed in 4% paraformaldehyde.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eLiver Function Assessment\u003c/h3\u003e\n\u003cp\u003eSerum supernatant from each group of mice was collected. Serum ALTand AST levels were measured using a fully automated biochemical analyzer (Chemray 800; Shenzhen Rayto Life and Analytical Sciences Co., Ltd.) following the manufacturer\u0026rsquo;s instructions for the ALT assay kit (Cat. No. S03030, Batch No. 20240430) and AST assay kit (Cat. No. S03040, Batch No. 20240428) from the same manufacturer.\u003c/p\u003e\n\u003ch3\u003eHematoxylin and Eosin (H\u0026E) Staining\u003c/h3\u003e\n\u003cp\u003eLiver tissues fixed in 4% paraformaldehyde were processed through paraffin embedding and sectioned into 4-\u0026micro;m-thick slices. The sections were stained with hematoxylin and eosin (H\u0026amp;E) following standard protocols. Histopathological alterations in liver tissues were examined under a light microscope, and the severity of hepatocellular injury was compared across experimental groups.\u003c/p\u003e\n\u003ch3\u003eDetermine the levels of IL-1β, IL-6, and TNF-α by ELISA\u003c/h3\u003e\n\u003cp\u003eELISA was employed to determine the levels of IL-1β, IL-6, and TNF-α. Briefly, mouse liver tissues were homogenized in phosphate-buffered saline (PBS), centrifuged at 3000 rpm for 20 minutes, and the supernatants were collected. The levels of cytokines were measured using IL-1β, IL-6, and TNF-α ELISA kits (Shanghai Youxuan Biotechnology Co., Ltd., Catalog numbers YX-091203M, YX-091206M, and YX-201407M, respectively) and a microplate reader (BioTek, ELx808) according to the manufacturer's instructions.\u003c/p\u003e\n\u003ch3\u003eReal-time quantitative PCR (RT-qPCR)\u003c/h3\u003e\n\u003cp\u003eLiver tissues were thoroughly ground into a homogenate with RNA stabilization solution under low-temperature conditions. Total RNA was extracted from liver tissues using the Total RNA Extraction Kit (Servicebio, Cat. G3640-50T). RNA concentration was measured with a NanoDrop 2000 Ultramicro Spectrophotometer (Thermo Fisher, Model: ND-2000). Subsequently, cDNA was synthesized using the Reverse Transcription Kit (Vazyme, Cat. R223-01). Reaction mixtures were prepared according to the Fluorescent Quantitative Detection Kit (Vazyme, Cat. Q131-02), with m-GAPDH as the internal reference gene (primers listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). RT-qPCR analysis was performed on a Real-time PCR System (Applied Biosystems, USA, Model: ABI 7500), with three independent experimental replicates. The 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method was employed for data analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers(5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct length\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003em-TLR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCTGACACCAGGAAGCTTGA\u003c/p\u003e \u003cp\u003eR:CTTCAAGGGGTTGAAGCTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e142 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003em-NF-KB p65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CAAGTACCTGCGCACTCCG\u003c/p\u003e \u003cp\u003eR:TTAGGATCCATCTGCGCTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003em-GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:GCATCTTCTTGTGCAGTGCC\u003c/p\u003e \u003cp\u003eR:TACGGCCAAATCCGTTCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e74 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting (WB)\u003c/h2\u003e \u003cp\u003eLiver tissues were homogenized under low-temperature conditions and lysed with RIPA lysis buffer on ice, followed by centrifugation to collect the supernatant. Total protein was extracted from liver tissues using the BCA Protein Assay Kit (Henan Dinghan Biotechnology Co., Ltd., Cat. HC0801) for quantitative analysis. Proteins were separated by SDS-PAGE gel electrophoresis (Henan Dinghan Biotechnology Co., Ltd., Cat. HC0824) and transferred onto a PVDF membrane. After blocking, the membrane was incubated overnight at 4\u0026deg;C with primary antibodies, including Phospho-NF-κB p65 (Cell Signaling Technology, Cat. 3033T), TLR4 Monoclonal Antibody (Wuhan Sanying, Cat.66350-1-Ig), and β-actin (Wuhan Sanying, Cat.81115-1-RR). The next day, the membrane was incubated with an HRP-conjugated goat anti-mouse secondary antibody (Henan Dinghan Biotechnology Co., Ltd., Cat. HR0601) at 37\u0026deg;C for 1 hour. Protein bands were visualized using ECL ultrasensitive chemiluminescent substrate (Henan Dinghan Biotechnology Co., Ltd., Cat.HR0802) and imaged with a Bio-Rad imaging system. Experiments were repeated three times. Results were analyzed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eExperimental data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (\u003cem\u003ex̄\u003c/em\u003e \u0026plusmn; \u003cem\u003es\u003c/em\u003e). Statistical comparisons were performed using SPSS statistical software. A value of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eLiver Biochemical Parameters\u003c/h2\u003e \u003cp\u003eThe liver biochemical parameters of the mice are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The ALT and AST levels were significantly increased in the model group, indicating liver injury. After intervention with high-dose and low-dose EPG, both ALT and AST levels were significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological Changes in Liver Tissue\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the liver tissue of mice in the normal group exhibited normal morphology, with hepatocytes arranged radially around the central vein in an orderly manner and no inflammatory cell infiltration. In contrast, the liver tissue of mice in the model group showed significant swelling and necrosis of hepatocytes, as well as pronounced inflammatory cell infiltration. In the EPG and bifendate groups, the inflammatory infiltration in the liver tissue was reduced, and the swelling and necrosis of hepatocytes were also alleviated, indicating an improvement in the inflammatory response.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eLevels of IL-1β, IL-6, and TNF-α\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the levels of IL-1β, IL-6, and TNF-α in the liver tissue of mice in the model group were significantly increased, indicating the occurrence of an inflammatory response. In contrast, the levels of these cytokines were significantly decreased in the normal group, as well as in the bifendate and EPG groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting an alleviation of the inflammatory response.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eGene Expression of TLR4 and NF-κB p65\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the gene expression levels of TLR4 and NF-κB p65 were significantly increased in the model group compared to the normal group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the EPG high-dose group, the gene expression levels of TLR4 and NF-κB p65 were significantly decreased, suggesting that EPG has an inhibitory effect on the TLR4 and NF-κB p65 related signaling pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eProtein Expression of TLR4 and NF-κB p65\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, the protein expression levels of TLR4 and NF-κB p65 were significantly increased in the model group compared to the normal group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the EPG high-dose group, the protein expression levels of TLR4 and NF-κB p65 were significantly decreased, suggesting that EPG has an inhibitory effect on the TLR4 and NF-κB p65 related signaling pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study reveals that EPG can ameliorate ALI, potentially through inhibiting the TLR4/NF-\u0026kappa;B signaling pathway. Experimental results demonstrate that following EPG intervention, serum levels of ALT and AST, as well as hepatic levels of inflammatory cytokines IL-1\u0026beta;, IL-6, and TNF-\u0026alpha;, are significantly reduced. Additionally, there is a marked alleviation of inflammatory infiltration in liver tissues, with comprehensive indicators suggesting an improvement in liver inflammation. Further mechanistic investigations reveal that the expression of TLR4, NF-\u0026kappa;B p65 genes, and their corresponding proteins is notably downregulated. The reduction in the release of downstream inflammatory cytokines IL-1\u0026beta;, IL-6, and TNF-\u0026alpha; also collectively substantiates the inhibition of the TLR4/NF-\u0026kappa;B signaling pathway. The mechanism of action is schematically presented in Fig.\u0026nbsp;7. This finding aligns closely with the modern pharmacological interpretation of the traditional \u0026quot;heat-clearing and detoxifying\u0026quot; efficacy of Isatis indigotica root\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, suggesting that its hepatoprotective effects may be closely associated with the suppression of excessive activation of the innate immune system.\u003c/p\u003e\n\u003cp\u003eThe liver is a vital organ for metabolism and detoxification in the human body, yet various factors such as drugs, alcohol, and viruses can trigger liver damage\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e, leading to elevated liver function indicators ALT and AST\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. The overexpression of inflammatory cytokines like IL-1\u0026beta;, IL-6, and TNF-\u0026alpha; exacerbates hepatocyte damage and death\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. The TLR4 and NF-\u0026kappa;B p65 signaling pathways are crucial in inflammatory responses, and their aberrant activation results in the massive production of inflammatory cytokines\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. By inhibiting these signaling pathways, EPG reduces the generation and release of inflammatory cytokines, thereby mitigating liver inflammatory injury and preserving normal hepatocyte function.\u003c/p\u003e\n\u003cp\u003eDespite clarifying the key role of the TLR4/NF-\u0026kappa;B pathway in this study, certain limitations remain. Exploring the synergistic effects of EPG with other TLR4 inhibitors (such as Eritoran\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e, CRX-526\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e) and NF-\u0026kappa;B inhibitors (such as Infliximab\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e,Thalidomide\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e) may provide more convincing evidence and represents a future research direction. Furthermore, future studies should employ gene knockout models to further verify pathway targeting.\u003c/p\u003e\n\u003cp\u003eFrom a broader perspective, the TLR4/NF-\u0026kappa;B signaling pathway is implicated in various diseases, including inflammatory disorders, autoimmune diseases\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e, and neurodegenerative diseases\u003csup\u003e[\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. The mechanism by which EPG alleviates inflammation through inhibiting this pathway not only offers novel insights into the treatment of acute liver injury but also provides potential strategies for managing other inflammation-related conditions.\u003c/p\u003e\n\u003cp\u003eMoreover, as a natural product, EPG boasts advantages such as widespread availability. and high safety. While its application in ALI holds promising prospects, it currently remains in the experimental research phase. Future studies should further investigate its clinical efficacy and safety to offer more effective therapeutic options for patients with ALI.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study found that EPG achieved a protective effect against liver injury by inhibiting the liver function indicators ALT and AST as well as the inflammatory cytokines IL-1β, IL-6, and TNF-α. The mechanism of action may be related to its inhibition of the TLR4/NF-κB p65 signaling pathway.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eALI \u0026nbsp; Acute liver injury\u003c/p\u003e\n\u003cp\u003eEPG \u0026nbsp; Epigoitrin\u003c/p\u003e\n\u003cp\u003eTLR4 \u0026nbsp; Toll-like receptor 4\u003c/p\u003e\n\u003cp\u003eNF-\u0026Kappa;b \u0026nbsp; Nuclear factor-\u0026kappa;B\u003c/p\u003e\n\u003cp\u003eCCl₄\u0026nbsp; \u0026nbsp; Carbon tetrachloride\u003c/p\u003e\n\u003cp\u003eALT \u0026nbsp; Alanine aminotransferase\u003c/p\u003e\n\u003cp\u003eAST \u0026nbsp; \u0026nbsp;Aspartate aminotransferase\u003c/p\u003e\n\u003cp\u003eIL-1\u0026beta;\u0026nbsp; Interleukin-1\u0026beta;\u003c/p\u003e\n\u003cp\u003eIL-6 \u0026nbsp; Interleukin-6\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha;\u0026nbsp; \u0026nbsp;Tumor necrosis factor-\u0026alpha;\u003c/p\u003e\n\u003cp\u003eELISA \u0026nbsp; \u0026nbsp;Enzyme-linked immunosorbent assay\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E \u0026nbsp; \u0026nbsp;Hematoxylin and eosin\u003c/p\u003e\n\u003cp\u003eq-PCR \u0026nbsp; Quantitative real-time PCR\u003c/p\u003e\n\u003cp\u003eWB \u0026nbsp; \u0026nbsp;Western blot\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMingli Zhuge contributed to the main execution of experiments. Xueping Liu contributed to the study concept and design experiments, interpretation of data, acquisition of data, statistical analysis, writing of the manuscript and provided the research funds. Hongjing Liu, Lang Qin, Guiqiu Wang, assisted in the execution of experiments and contributed to the study concept and provided critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the 2024 Guangxi Middle-aged and Young University Teachers\u0026apos; Research Fundamental Capacity Enhancement Project (No. 2024KY1432) and Self-funded Research Project of Guangxi Zhuang Autonomous Region Administration of Traditional Chinese Medicine (No. GXZYA20230247).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study protocol was approved by the Ethics Committee of Guangxi Medical University (Approval No. 2023-SW017-01). As mandated by China Animal Protection and Use Committee regulations, every effort was made to guarantee the comfort and welfare of the animals throughout the studies. All animal procedures were conducted in accordance with ARRIVE guidelines and NIH animal care standards.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eLiuzhou Maternity and Child Healthcare Hospital, Liuzhou 545001 China, People\u0026rsquo;s Republic of China\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e2\u003c/sup\u003eBasic Medical Sciences Department, Guangxi Health Science College, Nanning 530021, People\u0026rsquo;s Republic of China\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAlkandahri MY, Pamungkas BT, Oktoba Z, et al. Hepatoprotective effect of kaempferol: A review of the dietary sources, bioavailability, mechanisms of action, and safety. Adv Pharmacol Pharm Sci (2023) 2023:1\u0026ndash;16. doi: 10.1155/2023/1387665\u003c/li\u003e\n \u003cli\u003eYang W, Wang Y, Zhang C, et al. Maresin1 Protect Against Ferroptosis-Induced Liver Injury Through ROS Inhibition and Nrf2/HO-1/GPX4 Activation. Front Pharmacol. 2022;13:865689. Published 2022 Apr 4. doi:10.3389/fphar.2022.865689\u003c/li\u003e\n \u003cli\u003eMa Y, Li W, Yao Q, et al. Harmine ameliorates CCl4-induced acute liver injury through suppression of autophagy and inflammation. Int Immunopharmacol. 2024;129:111538. doi:10.1016/j.intimp.2024.111538\u003c/li\u003e\n \u003cli\u003eLiu Y, Liu N, Liu Y, et al. Ginsenoside Rb1 Reduces D-GalN/LPS-induced Acute Liver Injury by Regulating TLR4/NF-\u0026kappa;B Signaling and NLRP3 Inflammasome. J Clin Transl Hepatol. 2022;10(3):474-485. doi:10.14218/JCTH.2021.00072\u003c/li\u003e\n \u003cli\u003eAmin AR, Islam AB. Genomic analysis and differential expression of HMG and S100A family in human arthritis: upregulated expression of chemokines, IL-8 and nitric oxide by HMGB1. DNA Cell Biol. 2014;33(8):550-565. doi:10.1089/dna.2013.2198\u003c/li\u003e\n \u003cli\u003eWang Z, Sun P, Zhao T, et al. E Se tea extract ameliorates CCl4 induced liver fibrosis via regulating Nrf2/NF-\u0026kappa;B/TGF-\u0026beta;1/Smad pathway. Phytomedicine. 2023;115:154854. doi:10.1016/j.phymed.2023.154854\u003c/li\u003e\n \u003cli\u003eLiu S, Wang H, Liu S, et al. Fermented Ginsenosides Alleviate Acute Liver Injury Induced by CCl4 in Mice by Regulating the AKT/mTOR Signaling Pathway. J Med Food. 2024;27(10):961-970. doi:10.1089/jmf.2023.k.0322\u003c/li\u003e\n \u003cli\u003eAn Y, Zhang H, Wang C, et al. Activation of ROS/MAPKs/NF-\u0026kappa;B/NLRP3 and inhibition of efferocytosis in osteoclast-mediated diabetic osteoporosis. FASEB J. 2019;33(11):12515-12527. doi:10.1096/fj.201802805RR\u003c/li\u003e\n \u003cli\u003eMorgan MJ, Liu ZG. Crosstalk of reactive oxygen species and NF-\u0026kappa;B signaling. Cell Res. 2011;21(1):103-115. doi:10.1038/cr.2010.178\u003c/li\u003e\n \u003cli\u003eMatsunaga N, Tsuchimori N, Matsumoto T, Ii M. TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Mol Pharmacol. 2011;79(1):34-41. doi:10.1124/mol.110.068064\u003c/li\u003e\n \u003cli\u003eWang F, Li YM, Li RY, Yang YE, Wei M, Ha C. U0126 and BAY11-7082 Inhibit the Progression of Endometriosis in a Rat Model by Suppressing the MEK/ERK/NF-\u0026kappa;B Pathway. Womens Health Rep (New Rochelle). 2023;4(1):65-77. Published 2023 Feb 6. doi:10.1089/whr.2021.0151\u003c/li\u003e\n \u003cli\u003eZhou Q, He DX, Deng YL, et al. MiR-124-3p targeting PDE4B attenuates LPS-induced ALI through the TLR4/NF-\u0026kappa;B signaling pathway. Int Immunopharmacol. 2022;105:108540. doi:10.1016/j.intimp.2022.108540\u003c/li\u003e\n \u003cli\u003eFeng J, Shen C, Tian S, et al. Total flavonoids from the aerial parts of Tetrastigma hemsleyanum prevent LPS-induced ALI by modulating the TLR4/NF-\u0026kappa;B pathway in mice. Fitoterapia. 2024;178:106175. doi:10.1016/j.fitote.2024.106175\u003c/li\u003e\n \u003cli\u003eCommission C. P. Pharmacopoeia of the People\u0026rsquo;s Republic of China . Beijing, China: China Medical Science Press; 2019.\u003c/li\u003e\n \u003cli\u003eRen L, Li Q, Li H, et al. Polysaccharide extract from Isatidis Radix inhibits multiple inflammasomes activation and alleviate gouty arthritis. Phytother Res. 2022;36(8):3295-3312. doi:10.1002/ptr.7514\u003c/li\u003e\n \u003cli\u003eFan Z, Cai L, Wang Y, Zhu Q, Wang S, Chen B. The Acidic Fraction of Isatidis Radix Regulates Inflammatory Response in LPS-Stimulated RAW264.7 Macrophages through MAPKs and NF-\u0026kappa;B Pathway. Evid Based Complement Alternat Med. 2021;2021:8879862. Published 2021 Mar 9. doi:10.1155/2021/8879862\u003c/li\u003e\n \u003cli\u003eChen H, Jie C, Tang LP, et al. New insights into the effects and mechanism of a classic traditional Chinese medicinal formula on influenza prevention. Phytomedicine. 2017;27:52-62. doi:10.1016/j.phymed.2017.02.004\u003c/li\u003e\n \u003cli\u003eDeng JL, Tao YL, He YQ, Chen WS. Zhongguo Zhong Yao Za Zhi. 2021;46(8):2029-2036. doi:10.19540/j.cnki.cjcmm.20201230.601\u003c/li\u003e\n \u003cli\u003eChen J, Zhu Z, Gao T, et al. Isatidis Radix and Isatidis Folium: A systematic review on ethnopharmacology, phytochemistry and pharmacology. J Ethnopharmacol. 2022;283:114648. doi:10.1016/j.jep.2021.114648\u003c/li\u003e\n \u003cli\u003eNeuman MG, Seitz HK, Teschke R, et al. Molecular, Viral and Clinical Features of Alcohol- and Non-Alcohol-Induced Liver Injury. Curr Issues Mol Biol. 2022;44(3):1294-1315. Published 2022 Mar 16. doi:10.3390/cimb44030087\u003c/li\u003e\n \u003cli\u003eNeuman MG, Seitz HK, Teschke R, et al. Molecular, Viral and Clinical Features of Alcohol- and Non-Alcohol-Induced Liver Injury. Curr Issues Mol Biol. 2022;44(3):1294-1315. Published 2022 Mar 16. doi:10.3390/cimb44030087\u003c/li\u003e\n \u003cli\u003eAmernia B, Moosavy SH, Banookh F, Zoghi G. FIB-4, APRI, and AST/ALT ratio compared to FibroScan for the assessment of hepatic fibrosis in patients with non-alcoholic fatty liver disease in Bandar Abbas, Iran. BMC Gastroenterol. 2021;21(1):453. Published 2021 Dec 3. doi:10.1186/s12876-021-02038-3\u003c/li\u003e\n \u003cli\u003eChinnappan R, Mir TA, Alsalameh S, et al. Aptasensors Are Conjectured as Promising ALT and AST Diagnostic Tools for the Early Diagnosis of Acute Liver Injury. Life (Basel). 2023;13(6):1273. Published 2023 May 29. doi:10.3390/life13061273\u003c/li\u003e\n \u003cli\u003eDuan Y, Pan X, Luo J, et al. Association of Inflammatory Cytokines With Non-Alcoholic Fatty Liver Disease. Front Immunol. 2022;13:880298. Published 2022 May 6. doi:10.3389/fimmu.2022.880298\u003c/li\u003e\n \u003cli\u003eBek\u0026ccedil;ibaşı M, Deveci \u0026Ouml;, Oğuz A, Bozkurt F, Dayan S, \u0026Ccedil;elen MK. Serum TNF-\u0026alpha;, IL-1\u0026beta;, and IL-6 levels in chronic HBV-infected patients. Int J Clin Pract. 2021;75(8):e14292. doi:10.1111/ijcp.14292\u003c/li\u003e\n \u003cli\u003eLi D, Guo YY, Cen XF, et al. Lupeol protects against cardiac hypertrophy via TLR4-PI3K-Akt-NF-\u0026kappa;B pathways. Acta Pharmacol Sin. 2022;43(8):1989-2002. doi:10.1038/s41401-021-00820-3\u003c/li\u003e\n \u003cli\u003eXie F, Kitagawa Y, Ogata H, Yasuhara S, You Z, Jeevendra Martyn JA. Morphine induces inflammatory responses via both TLR4 and cGAS-STING signaling pathways. Cytokine. 2024;183:156737. doi:10.1016/j.cyto.2024.156737\u003c/li\u003e\n \u003cli\u003eMcdonald KA, Huang H, Tohme S, et al. Toll-like receptor 4 (TLR4) antagonist eritoran tetrasodium attenuates liver ischemia and reperfusion injury through inhibition of high-mobility group box protein B1 (HMGB1) signaling. Mol Med. 2015;20(1):639-648. Published 2015 Mar 13. doi:10.2119/molmed.2014.00076\u003c/li\u003e\n \u003cli\u003eLin M, Yiu WH, Li RX, et al. The TLR4 antagonist CRX-526 protects against advanced diabetic nephropathy. Kidney Int. 2013;83(5):887-900. doi:10.1038/ki.2013.11\u003c/li\u003e\n \u003cli\u003eShinde A, Tang X, Singh R, Brindley DN. Infliximab, a Monoclonal Antibody against TNF-\u0026alpha;, Inhibits NF-\u0026kappa;B Activation, Autotaxin Expression and Breast Cancer Metastasis to Lungs. Cancers (Basel). 2023;16(1):52. Published 2023 Dec 21. doi:10.3390/cancers16010052\u003c/li\u003e\n \u003cli\u003eChen M, Xie H, Chen Z, et al. Thalidomide ameliorates rosacea-like skin inflammation and suppresses NF-\u0026kappa;B activation in keratinocytes. Biomed Pharmacother. 2019;116:109011. doi:10.1016/j.biopha.2019.109011\u003c/li\u003e\n \u003cli\u003eHe S, Li W, Wang G, et al. FTO-mediated m6A modification alleviates autoimmune uveitis by regulating microglia phenotypes via the GPC4/TLR4/NF-\u0026kappa;B signaling axis. Genes Dis. 2022;10(5):2179-2193. Published 2022 Oct 4. doi:10.1016/j.gendis.2022.09.008\u003c/li\u003e\n \u003cli\u003eKang Y, Kuang X, Yan H, et al. A Novel Synbiotic Alleviates Autoimmune Hepatitis by Modulating the Gut Microbiota-Liver Axis and Inhibiting the Hepatic TLR4/NF-\u0026kappa;B/NLRP3 Signaling Pathway. mSystems. 2023;8(2):e0112722. doi:10.1128/msystems.01127-22\u003c/li\u003e\n \u003cli\u003eMuhammad T, Ikram M, Ullah R, Rehman SU, Kim MO. Hesperetin, a Citrus Flavonoid, Attenuates LPS-Induced Neuroinflammation, Apoptosis and Memory Impairments by Modulating TLR4/NF-\u0026kappa;B Signaling. Nutrients. 2019;11(3):648. Published 2019 Mar 17. doi:10.3390/nu11030648\u003c/li\u003e\n \u003cli\u003eAli W, Choe K, Park JS, et al. Kojic acid reverses LPS-induced neuroinflammation and cognitive impairment by regulating the TLR4/NF-\u0026kappa;B signaling pathway. Front Pharmacol. 2024;15:1443552. Published 2024 Aug 9. doi:10.3389/fphar.2024.1443552\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"TLR4, NF-κB, Epigoitrin, Isatis indigotica root, Acute liver injury","lastPublishedDoi":"10.21203/rs.3.rs-6462699/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6462699/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground \u003c/strong\u003eAcute liver injury (ALI), frequently triggered by drugs, toxins, or viral infections, is closely associated with the aberrant activation of the TLR4/NF-κB signaling pathway. Epigoitrin (EPG), a major bioactive component derived from Isatis indigotica root, exhibits anti-inflammatory, antioxidant properties, and potential NF-κB inhibitory effects. However, the specific mechanisms underlying its therapeutic action in ALI remain to be elucidated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective\u003c/strong\u003e To investigate the protective effects and underlying mechanisms of EPG against carbon tetrachloride (CCl\u003csub\u003e4\u003c/sub\u003e)-induced ALI in mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods \u003c/strong\u003eKunming mice were randomly divided into five groups: normal control group, model group, bifendate group, high-dose EPG group, and low-dose EPG group. The treatment groups received corresponding doses of the drugs, while the normal control and model groups were given an equal volume of distilled water via intragastric gavage once daily for 7 consecutive days. One hour after the final administration, all groups except the normal control group were intraperitoneally injected with 0.2% CCl₄-olive oil solution to induce liver injury. Sixteen hours post-injection, blood samples were collected to measure serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Liver tissues were harvested to assess interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) using enzyme-linked immunosorbent assay (ELISA). Hematoxylin and eosin (H\u0026amp;E) staining was performed to observe histopathological changes in the liver. The effects on the Toll-like receptor 4/nuclear factor-κB (TLR4/NF-κB) signaling pathway were evaluated by quantitative real-time PCR and Western blot analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eEPG significantly reduced serum liver function markers (ALT and AST) and levels of pro-inflammatory cytokines, including interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), in mice (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). Histopathological examination demonstrated that EPG effectively ameliorated CCl₄-induced hepatocellular necrosis. Furthermore, qPCR and Western blot (WB) analyses revealed that EPG markedly suppressed the TLR4/NF-κB signaling pathway (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e EPG exerts a protective effect against CCl₄-induced ALI in mice, and its mechanism may involve the suppression of the TLR4/NF-κB signaling pathway.\u003c/p\u003e","manuscriptTitle":"Epigoitrin ameliorates acute liver injury in mice via regulation of the TLR4/NF-κB signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-07 11:32:19","doi":"10.21203/rs.3.rs-6462699/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"73ab5490-f0aa-4dbd-9451-95c853eb2ec6","owner":[],"postedDate":"May 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":48038447,"name":"Biological sciences/Drug discovery"},{"id":48038448,"name":"Health sciences/Molecular medicine"}],"tags":[],"updatedAt":"2025-07-08T06:54:17+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-07 11:32:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6462699","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6462699","identity":"rs-6462699","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}