Improving baseline information on over-looked generalists: occurrence and mitochondrial DNA diversity of Campbell’s (Cercopithecus campbelli) and green monkeys (Chlorocebus sabaeus) in Guinea-Bissau, West Africa

Improving baseline information on over-looked generalists: occurrence and mitochondrial DNA diversity of Campbell’s (Cercopithecus campbelli) and green monkeys (Chlorocebus sabaeus) in Guinea-Bissau, West Africa | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Improving baseline information on over-looked generalists: occurrence and mitochondrial DNA diversity of Campbell’s ( Cercopithecus campbelli ) and green monkeys ( Chlorocebus sabaeus ) in Guinea-Bissau, West Africa Ivo Colmonero-Costeira, Mamadú Lamine Djaló, Nelson Fernandes, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5372533/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jun, 2025 Read the published version in International Journal of Primatology → Version 1 posted You are reading this latest preprint version Abstract Campbell’s ( Cercopithecus campbelli ) and green monkeys ( Chlorocebus sabaeus ) are sympatric medium-sized West African guenons (tribe Cercopithecini) that are generally understudied in most of their distribution. Both species are ecological generalists and are globally considered non-threatened, but populations are decreasing locally. National conservation management lacks baseline information on local populations of primate species. C. campbelli and Chl. sabaeus are considered the most abundant primates out of the ten extant species and are the most frequently hunted for meat consumption. Here, we aimed to update the occurrence and estimate the country-wide mitochondrial (mtDNA) genetic diversity for both species. From 2008 to 2022, we conducted surveys in four mainland protected areas and on the islands of the Bijagós archipelago where primates are known to occur. We identified C. campbelli populations outside their known distribution. We found relatively high mtDNA diversity for both species in the mainland and lower or no diversity in insular populations. Our results show significant signals of geographically induced mtDNA differentiation, particularly in C. campbelli , which pattern of population structure suggests female philopatry. In constrast, we found divergent Chl. sabaeus haplotypes at geographically close locations, suggesting female dispersal. We identified differentiated haplogroups with an estimated divergence time of 1.53 in C. campbelli and 1.16 Ma in Chl. sabaeus , possibly linked to Pleistocene climatic fluctuations. Our results add further evidence that Guinea-Bissau harbors high genetic diversity for primate species and the country should be prioritized for conservation in West Africa. Conservation Biology Population Genetics Guenon Cercopithecini widespread taxa phylogenetic structure sex-biased dispersal. Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Over half of mainland African non-human primates (hereafter primates) are threatened with extinction, and more than 80% have a declining population trend (Estrada et al., 2017 ). Considering the scale of the conservation crisis and the urgency to mitigate species extinction, primates classified as Least Concern and Near Threatened by the International Union for Conservation of Nature (IUCN) are usually overlooked in global conservation efforts (Fernández et al. 2022) REF). Primates not classified as threatened by IUCN frequently occupy large ranges, have broad fewer dietary requirements, and have smaller body size (Fernández et al. 2022) and have and are thought to be at lower risk of extinction than threatened species. However, populations of globally non-endangered primates non-threatened primates can undergo local extirpation, particularly if the interplay of several threats undermines their resilience (e.g., Ferreira da Silva et al., 2014 ). Genetic data is increasingly used in conservation management and policies to delimitate conservation units, such as differentiated populations, or to describe the patterns of connectivity, hybridization processes, and assess historical population size (Hoban et al 2022). Moreover, estimates of genetic diversity are key to evaluate the ability of populations to persist in the face of environmental changes and is a crucial parameter to inform planning of conservation actions (Ferreira da Silva & Bruford, 2017; Bertola et al 2024). For elusive illusive species with unknown occurrence, genetic data can be obtained from non-invasive samples collected across variable geographic scales; mitochondrial DNA genes can be applied as genetic markers to a large number of opportunistically-collected samples with relative ease when compared to other more informative markers that require higher host DNA quantity and quality (Bertola et al 2024; e.g., Colmonero-Costeira et al., 2019 ; Ferreira da Silva et al., 2020 ). The characterization of mitochondrial genetic diversity and differentiation (e.g., spatial structuring and estimation of divergence times) across all the extant primate species is recognized as important for the future prioritization of areas of conservation interest (Carvalho et al., 2017 ). Nevertheless, the incorporation of molecular data in management plans remain challenging particularly for locally threatened species distributed in low to middle-income countries, where infrastructures, financial and human resources are scarce to conduct such studies (Bertola et al 2024, Helmy et al 2016, e.g., Ferreira da Silva et al in review). Here, we aimed to update the information on the distribution of two IUCN Least Concern and Near Threatened generalists primates and to provide the first assessment of their mitochondrial diversity and structure in a low-income West African country, aiming to advance the current knowledge and conservation planning actions. Campbell’s monkey ( Cercopithecus campbelli , Waterhouse, 1838) and the green monkey ( Chlorocebus sabaeus , Linnaeus, 1766) are medium-sized African primates that have wide distributions across West Africa (Fig. 1). C. campbelli is present from The Gambia to Côte D’Ivoire (Matsuda Goodwin et al., 2020 ) (Fig. 1). Chl. sabaeus is distributed across a larger area, including Mauritania, Mali, Burkina Faso, and Ghana (Gonedelé Bi et al., 2020 ) and shows high phenotypic variability (Turner et al., 2018 ) (Fig. 1). Both species are considered generalists in dietary requirements and inhabit a wide range of landscapes (Rowe & Myers, 2016 ). The two species differ in group composition and dispersal patterns. C. campbelli is organized in groups of one adult male and multiple females, in which males are the most frequent dispersing sex, and females are philopatric (Rowe & Myers, 2016 ). Groups of Chl. sabaeus are formed of multiple males and females (Rowe & Myers, 2016 ) and the social organization may be flexible and dependent on environmental factors ( e.g. , food availability, Galat & Galat-Luong 1977 ). In the most recent IUCN conservation status assessment, C. campbelli was classified as Near Threatened and Chl. sabaeus as Least Concern (Gonedelé Bi et al., 2020 ; Matsuda Goodwin et al., 2020 ). Both species are assumed to have a decreasing population trend due to habitat loss and hunting for wildmeat throughout their geographic ranges (Gonedelé Bi et al., 2020 ; Matsuda Goodwin et al., 2020 ). Little is known about the evolutionary history of C. campbelli , which is the least studied guenon in the Cercopithecus mona group. In contrast, the Chlorocebus genus is a relatively well studied phylogeographical model for the evolution of wide-spread savannah species (Haus et al., 2013 ; Warren et al., 2015 ; Dolotovskaya et al., 2017 ; Svardal et al., 2017 ; Gagnon et al., 2022 ). However, population-level studies of the Westernmost species ( Chl. sabaeus ) are scarce (e.g., Almeida et al 2024 Haus et al 2013 ). Guinea-Bissau (36,125 km 2 ), a West African country bordered by Senegal and the Republic of Guinea, comprises one mainland region and the Bijagós archipelago. Ten primate species have been reported in the country (Gippoliti & Dell’Omo, 2003 ; Bersacola et al., 2018; Ferreira da Silva et al., 2020 ; Colmonero-Costeira et al., 2023 ). Most primate populations are threatened with habitat degradation/fragmentation and commercial hunting for meat, activities which are thought to have intensified in the last three decades (Gippoliti & Dell’Omo, 2003 ; Minhós et al., 2013 b; Ferreira da Silva et al., 2021 ; Minhós et al., 2023 ; Colmonero-Costeira et al., 2023 ). A lack of baseline information for most fauna, including primates, hinders effective conservation planning in the country (Ferreira da Silva et al., 2020 ; Colmonero-Costeira et al., 2023 ; Palma et al., 2023). Most of the surveys documenting the occurrence and the conservation status of local primates are twenty 20 years old (Gippoliti & Dell’Omo, 1996 ; Gippoliti & Dell’Omo, 2003 ) or have only considered species taxa with an IUCN Endangered status, such as the Western chimpanzee (Pan troglodytes verus,) and colobus monkeys ( Piliocolobus badius temminckii and Colobus polykomos , Casanova & Sousa, 2007). More recent information on primate occurrence may exist in non-digital repositories and unpublished reports but these are usually difficult to access. There is an urgent need to re-evaluate the local conservation status and elaborate produce action plans for species that were not considered threatened in the past but may have become impacted affected in the last three decades. Specifically, there is an important gap in baseline information on the national occurrence and genetic diversity of generalist primates, such as C. campbelli and Chl. sabaeus , which limits the understanding of the degree of threat and thus decision-making regarding conservation efforts. C. campbelli ( mona or kankulma in Guinea-Bissau creole) and Chl. sabaeus ( santchu di tarrafi in Guinea-Bissau Creole) were widely distributed throughout the mainland territory, except in the northeast at least up to the last three decades (Gippoliti & Dell’Omo, 2003 ). However, the occurrence of C. campbelli is uncertain in the southeast of the country (the Boé sector). In the Bijagós archipelago, Chl. sabaeus is reported in Formosa, Orango, Bubaque, Rubane, Enu and Carache islands, and C. campbelli in the Caravela island (Reiner & Simões 1999 ; Campredon et al., 2001 ; Gippoliti & Dell’Omo 2003 ; Colmonero-Costeira et al., 2019 ) (Fig. 1). C. campbelli and Chl. sabaeus are considered the most abundant primates in Guinea-Bissau (Gippoliti & Dell’Omo 2003 ; Karibuhoye, 2004 ; Bersacola et al., 2018). Yet, a survey in two wildmeat markets in the capital city (Bissau) revealed that these two species were the most traded of all the primates, with approximately 500 specimens of each species sold during the dry season in 2010 (Minhós et al., 2013 b). Consumption of C. campbelli is also widespread in more rural locations (Ferreira da Silva et al., 2021 ). Furthermore, the trade in primate infants as pets seems common for both species (Gippoliti & Dell’Omo, 2003 ; Karibuhoye, 2004 ), and may be a sub-product of the occasional hunting of lactating females (Ferreira da Silva et al., 2021 ; Colmonero-Costeira et al., 2023 ). Farmers from Southern Guinea-Bissau classify the species as two of the most impactful crop-foragers and commonly pursue and kill monkeys (Amador et al., 2015). Overall, these observations suggest that the two species are heavily hunted, populations may be under threat and that the species may have become rare or extinct in areas where they were previously recorded ( e.g. , by Gippoliti and Dell’Omo 1996 ; 2003 ). Here, we aimed to update the information on the distribution of C. campbelli and Chl. sabaeus and to assess their mitochondrial diversity and structure at a country-wide scale. Between 2008 and 2022, we recorded direct and indirect geo-referenced presence data and collected non-invasive biological material for molecular analyses for the two species across a large area of Guinea-Bissau, which included the four parks in southern mainland Guinea-Bissau and eight of the largest islands of the Bijagós archipelago (Fig. 1). Our specific objectives were to i) compile geo-referenced visual and molecular records collected between 2008 and 2022 to confirm species occurrence and update information on the distribution, ii) estimate mitochondrial genetic diversity and population structure using a non-invasive mtDNA dataset for the two guenons, iii) reconstruct the phylogenetic relations of mtDNA haplotypes and estimate divergence times between lineages, and iv) identify themes for future research which would improve the national conservation strategy for these primates. Methods Study area The study area encompasses most of the described range of C. campbelli and Chl. sabaeus in Guinea-Bissau (Gippoliti & Dell’Omo, 2003 ; Colmonero-Costeira et al., 2019 ) (Fig. 1): Cantanhez National Park, Cufada Lagoons Natural Park, Dulombi National Park, Boé National Park, and Bijagós archipelago. The sampling area lies across an ecological transition. In approximately 200 km, from the southwestern regions to the northeast part of the country, the vegetation changes from sub-humid and dry tropical forests to mosaics of dry tropical forest and savanna woodland (Catarino et al., 2001 ). Data collection We carried out surveys from 2015 to 2022 as part of the PRIMACTION project - Protecting the Western chimpanzee and other primate species from illegal logging and hunting in Guinea-Bissau . Expeditions aimed to update non-human primate distributions across the country and collect information on species diversity, population structure, and gene flow patterns. We collected geo-referenced observations and biological material in Cufada Lagoons Natural Park (December 2015), Dulombi National Park (February 2016), and Boé National Park (January 2017), and in the largest islands of the Bijagós archipelago (Galinha, Canhabaque, Canogo, Orango, Uracane, Uno and Caravela, from March to September 2016, and Formosa in 2022) (Fig. 1). MJFS collected presence and genetic data from Cantanhez Forest National Park between 2008 and 2010 (Ferreira da Silva, 2012). During expeditions and prior to fieldwork, we requested the help of local guards and villagers to identify areas frequently used by primates. We visited the primate’s drinking spots, sleeping sites and foraging areas in croplands, woodland savannah and gallery, mangrove, primary and secondary forests. When arriving at these locations, we attempted to observe groups or searched for indirect signs of the species’ presence (footprints, vocalizations, and/or fecal samples). We remained at each location for a minimum of 30 minutes. We recorded the geographic coordinates of sites where we observed, heard, or photographed primates, and collected fecal samples, using a Geographic Positioning System (GPS) device. We collected fecal samples that were fresh and still holding structural integrity to the original form and that were more than 2 m apart in an attempt to prevent sampling the same individuals repeatedly. To preserve fecal DNA, we used RNAlater™ (Invitrogen™, USA), 99% ethanol (Sigma-Aldrich, USA), or the “two-step” protocol (Roeder et al., 2004). We obtained tissue samples opportunistically from locally hunted individuals, which we preserved in 98% ethanol (Sigma-Aldrich, USA) at room temperature until DNA extraction. Samples were taken from carcasses that were found by chance during expeditions and were collected free of charge after obtaining informed consent of hunters/owners, to not encourage hunting. DNA extraction We exported samples to Portugal and processed them in CIBIO-InBIO (at Centro de Investigação em Biodiversidade e Recursos Genéticos, Research Center for Biodiversity and Genetic Resources , Porto University, Portugal). We extracted total genomic DNA from feces using the QIAamp DNA Stool Mini Kit (Qiagen, Germany) with a few modifications from the manufacturer’s protocol to maximize DNA yield (Ferreira da Silva et al., 2014 ). We took several precautions to avoid contamination from exogenous human DNA or cross-contamination between samples (Colmonero-Costeira et al., 2019 ; Colmonero-Costeira, 2019). We extracted DNA from tissue samples using DNeasy Blood & Tissue Kit (Qiagen, Germany) following the manufacturer’s protocol. DNA amplification and sequencing We used two fragments of mitochondrial DNA (mtDNA) to assign samples to the species level and estimate mitochondrial genetic diversity. We amplified the following mtDNA fragments by Polymerase Chain Reaction (PCR): 1) 402 base pairs (bp) of the cytochrome b gene ( cytb ) for both species using primers GVL14724, 5’ GATATGAAAAACCATCGTTG 3’ and, H15149, 5’ CTCAGAATGATATTTGTCCTCA 3’ (Gaubert et al., 2015 ); and 2) 339 and 329 bp of the hypervariable region I (HVRI) for Chl. sabaeus and C. campbelli respectively, using primers LCERCOHVRI − 5’ CGTGCATTACTGCTAGCCAAC 3’, and HCERCOHVRI − 5’ GGGATATTGATTTCACGGAGGA 3’ (Colmonero-Costeira et al., 2019 ). PCRs had a total volume of 10 µL and included 1X MyTaq™ Mix (Bioline, UK). Cytb amplifications contained 0.1 µM of each primer and 1 µL of DNA extract. HVRI amplifications contained 0.2 µM of each primer and 2 µL of DNA extract. Cytochrome b PCRs started with a Taq DNA polymerase activating step of 15 minutes at 94ºC followed by 35 cycles of denaturing at 92ºC for 30 seconds, annealing at 50ºC for 30 seconds, extension at 72ºC for 30 seconds, and a final extension step at 72 ºC for 15 minutes. Hypervariable Region I PCRs started with an activating step of 15 minutes at 95ºC followed by 40 cycles of denaturing at 94ºC for 30 seconds, annealing at 58ºC for 30 seconds, extension at 72ºC for 30 seconds, and final extension 72 ºC for 15 minutes. We conducted all the PCRs in a T100™ 96 Well Thermal Cycler (Bio-Rad, USA). To limit DNA cross-contamination between samples and by exogenous DNA, we prepared PCRs in non-invasive DNA PCR preparation rooms. We tested amplification success by electrophoresis at 300V using 2% agarose gels stained with GelRed™ (Biotium, USA) and visualized using a UV Gel Doc™ XR + Gel Documentation System (Bio-Rad, USA) transilluminator. We purified PCR products using Exonuclease I and FastAP (1 UµL-1) (Thermo Fisher Scientific™, USA) and sequenced them using a 3130XL automated sequencer (Applied Biosystems™, USA) at CTM - Center for Molecular Testing, at CIBIO/ In-BIO, Portugal) facilities using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems™, USA). We confirmed the quality of forward and reverse sequences and the polymorphic positions visually using Geneious v4.8.5 (Kearse et al., 2012 ). We assigned samples to species using the Basic Local Alignment Search Tool (BLAST; Altschul et al., 1990) in the National Center for Biotechnology Information (NCBI) database ( http://www.ncbi.nlm.nih.gov ). We aligned sequences of each fragment separately for each species using Geneious v4.8.5 automatic alignment option and trimmed the alignments to the length of the shortest sequence. We adopted procedures to control for the presence of NUMTs (Nuclear Mitochondrial DNA Segments i.e., unintended amplification of nuclear insertions of mitochondrial genes; Bensasson et al., 2001 ). We screened the chromatograms for double electrophoretic peaks and translated cytb fragments to the aminoacidic sequences to identify the presence of multiple STOP codons (Bensasson et al., 2001 ). We took a conservative approach by removing all sequences showing double electrophoretic peaks from the final datasets. Data analyses Mapping current occurrence of Cercopithecus campbelli and Chlorocebus sabaeus We entered geo-referenced species records, such as observations, and molecular identifications of fecal samples into Geographic Information System software (QGIS v3.32). Because we could not observe most of the primate groups defecating, we grouped fecal samples located within a radius equal to estimates of each species’ daily range (1,155 m for C. campbelli and 11,000 m for Chl. sabaeus , Rowe & Myers, 2016 ) together in the same “geographically distinct location”. We overlaid our presence data on the distribution of the two species published by IUCN to identify differences from these distributions. Estimating mitochondrial genetic diversity and spatial structure We computed summary mitochondrial genetic diversity statistics for cytb and HVRI fragments separately, and for the concatenated alignment using DNAsp v6.12.03 (Rozas et al., 2017 ). We estimated the number of haplotypes, haplotype diversity (Hd), nucleotide diversity (π) (Nei, 1987 ), and respective standard deviations for the overall genetic dataset for each species and sampling area. We estimated haplotype richness following a rarefication approach to account for the different sample sizes and implemented in vegan v2.6-4 R package (Oksanen et al., 2022). We computed a 95% parsimony haplotype network for cytb and HVRI fragments separately and for the concatenated alignment using Popart (Leigh & Bryant, 2015 ) to visualize genetic variation and explore the spatial distribution of the mtDNA haplotypes. To assess whether the observed genetic variation patterns for each species were consistent with a model of neutrally evolving locus under mutation-drift equilibrium we estimated Tajima’s D (Tajima, 1989 ), Fu’s Fs (Fu, 1997 ), and Ramos-Onsins and Rozas’ R 2 (Ramos-Onsins & Rozas, 2002 ) summary test statistics for the concatenated alignment using DNAsp v6.12.03 (Rozas et al., 2017 ). To account for the confounding effects caused by population structure on mutation-drift equilibrium summary test statistics (Moeller et al., 2007 ; Städler et al., 2009 ) we estimated these statistics for each differentiated haplogroup within each species. We tested for spatial structuring and isolation-by-distance by performing distance-based redundancy analyses (db-RDA; Legendre & Anderson, 1999 ) and Mantel tests on the concatenated alignment of each species. Distance-based redundancy analysis combines an ordination method (multidimensional scaling) with multiple regressions of a trend-surface of the geographic coordinates of sampling locations (Legendre & Legendre, 2012 ). We generated nine geographic variables based on geographic coordinates (long, lat, long x lat, long 2 , lat 2 , long 2 x lat, long x lat 2 , long 3 , lat 3 ). We used a forward selection procedure to avoid over-fitting the regression models. We used a significance level of 0.01 and the adjusted determination coefficient (R 2 ) as stopping criteria (Blanchet et al., 2008 ). Subsequently, we estimated the variance inflation factor (VIF) of the model and removed highly collinear variables (VIF > 5) in a stepwise manner. We obtained the statistical significance of the multiple regression models and each of the resulting canonical axes (CAP) using ANOVA-like permutation tests (9,999 permutations). To obtain a visual representation of the main spatial structures, we interpolated the fitted site scores of the first significant canonical axis using the inverse distance weighting with power equal to two (more detailed information on the spatial methods and the list of R packages used can be found in Supplementary Material 1). We conducted statistical analysis in R v4.2.2 (R CoreTeam 2022 ) coupled with RStudio v2023.06.2 + 561 (Posit team 2023 ). Reconstructing the phylogeny and estimating divergence times between lineages We concatenated fragments of cytb and HVRI and collapsed sequences into unique haplotypes. We used sequences from Theropithecus gelada , Papio papio , Papio ursinus , Macaca mulatta , and Macaca sylvanus retrieved from GenBank as outgroups (see Supplementary Material 2 for accession numbers). We corrected the final alignment visually and pruned indels and miss-aligned positions using Gb0.91b, allowing for smaller final blocks ( http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks ). For phylogenetic tree reconstruction, we used 1) maximum likelihood (ML), implemented in IQ-Tree 1.5.2 (Nguyen et al., 2015 ; Trifinopoulos et al., 2016 ), and 2) Bayesian inference, implemented in BEAST2 v2.6.1. (Bouckaert et al., 2014 ). We set concatenated partitions as - cytb (1 to 344 bp) and HVRI (345 to 569 bp). To identify the best-fit model of molecular evolution, we used Model Finder (Kalyaanamoorthy et al., 2017 ) implemented in IQ-Tree and chose the best-fit model based on BIC. We selected the models TPM3u + I with empirical base frequencies for the cytb and the HKY + G4 with empirical base frequencies for HVRI partitions. We estimated the statistical significance of ML trees reconstructed in IQ-Tree using 9,999 ultrafast bootstrap (BS) replicates (Hoang et al., 2018 ). We used a Bayesian approach implemented in BEAST2 v2.6.1 to estimate the divergence time between mitochondrial haplogroups. We applied the best-fit model of molecular evolution to cytb and HVRI partitions but assumed an uncorrelated relaxed lognormal clock model and Coalescent Constant Population tree prior model for both. To calibrate the molecular clock, we defined priors of the most recent common ancestor (MRCA) to the splits (1) Papionini and Cercopithecini, (2) Macacina and Papionina, (3) Papio and Theropithecus , and (4) African and Eurasian Macacina. We retrieved the prior distributions for constraints 1–4 from the most conservative calibration set (set-2) described in Roos (2019). To calibrate the African and non-African Macacina MRCA, we used hard minimum bounds (based on the youngest possible age of the earliest known unambiguous member of a clade) and soft maximum bounds (based on the oldest possible age of the earliest known unambiguous member of the most closely related sister-taxon; Roos et al., 2019 ). We set the minimum bound of the MRCA constrain at 5.3 Ma., following the timing estimated for the earliest known exemplars of non-African Macaca sp. in Spain (5.9–5.3 Ma.; Köhler et al., 2000) and Italy (5.4–5.3 Ma.; Alba et al., 2014). We set the maximum bound at 7.4 Ma. using the timing of the earliest known members of Papionina (e.g., Parapapio lothagamensis in Lothagam, Kenya, 7.4-5.0 Ma.; Jablonski & Frost, 2010). We applied a gamma distribution with ß equal to 0.38 and an offset of 5.30, which placed the 95% Highest Posterior Density (HPD) interval at 5.39–7.42 Ma. We conducted three 25 million generations-long independent runs. We sampled trees and parameters every 1,000 generations. We inspected the convergence of sampling parameters using Tracer (Rambaut et al., 2018) and assured 10% burn-in adequacy by effective sample size of all the parameters (ESS) larger than 200. We combined the outputs from independent runs using LogCombiner. We obtained the maximum clade credibility trees containing the node heights using TreeAnnotator after a burn-in of 10% of the sampled trees (Drummond & Rambaut, 2007 ). We visualized phylogenetic trees using FigTree v1.4.4 ( http://tree.bio.ed.ac.uk/software/figtree/ ). Ethical note The research complied with rules and protocols approved by Instituto para a Biodiversidade e Áreas Protegidas (IBAP, Guinea-Bissau) and adhered to the legal requirements of Guinea-Bissau. We obtained all the fecal samples non-invasively from unidentified individuals without manipulation and minimal or perturbation of their daily behavior. We obtained six6 tissue samples opportunistically from dead animals in the hands of local hunters after informing of the purpose of the study and obtaining the informed consent of carcasses’ owners. We maintained the identity of hunters and carcasses owners secret and did not denounce hunting activities to national authorities. We did not pay for these samples to prevent encouragement of hunting activities. Instituto para a Biodiversidade e Áreas Protegidas (IBAP - Institute for Biodiversity and Protected Areas )BAP, local CITES focal person and Instituto para a Conservação da Natureza e Florestas Portugal (ICNF, Institute for Nature Conservation and Forests ) authorized exportation and importation of fecal and tissue samples from Guinea-Bissau to Portugal (CITES permits N.° 18PTLX005901 and 18PTLX00586). Data availability DNA sequences produced in this study are deposited in the GenBank database ( https://www.ncbi.nlm.nih.gov/genbank/ ) with accession numbers PP053763 – PP053988. The geographic location of each sample used for spatially explicit analyses is available as supplementary material (Supplementary Material 2). The R scripts used in this work are deposited in GitHub ( https://github.com/Colmonero-CI/Campbelli_sabaeus_GB2024 ). Results DNA extraction, mtDNA amplification and sequencing Out of 371 fecal samples putatively collected from the species under study, we molecularly assigned 71 fecal samples to C. campbelli and 76 to Chl. sabaeus , using at least one of the mtDNA fragments ( cytb or HVRI) (Fig. 1). Of the six tissue samples, two were assigned molecularly to C. campbelli and four to Chl. sabaeus . Using BLAST, C. campbelli cytb haplotypes showed 94.49–98.84% identity to NCBI GenBank C. campbelli sequences. Our Chl. sabaeus cytb haplotypes showed 99.13–100.00% identity to NCBI GenBank Chl. sabaeus sequences. We successfully sequenced 54 samples of C. campbelli (13 in Bijagós archipelago, six in Cufada Lagoons Natural Park, ten in Cantanhez Forest National Park, 13 in Dulombi National Park, and 12 in Boé National Park) and 59 samples of Chl. sabaeus (17 in Bijagós archipelago, seven in Cufada Lagoons Natural Park, two in Cantanhez Forest National Park, 14 in Dulombi National Park, and 19 in BNP) for both mtDNA fragments ( cytb and HVRI) (Fig. 2). After trimming the length to the shortest sequence, the final cytb alignment was 345 bp long for both C. campbelli and Chl. sabaeus and the final HVRI alignment was 295 bp long for C. campbelli and 283 bp for Chl. sabaeus . We deposited mitochondrial DNA sequences in GenBank (accession numbers: PP053763 – PP053988). Species occurrence During our surveys in southern mainland Guinea-Bissau and the Bijagós archipelago between 2015 and 2022 we observed 7 groups of C. campbelli and 18 groups of Chl. sabaeus (Fig. 1). We observed C. campbelli groups in primary and secondary forests at Cufada Lagoons Natural Park (4 groups) and Dulombi National Park (3 groups). We observed Chl. sabaeus groups in mangroves, primary and secondary forests at Cufada Lagoons Natural Park (3 groups) and Dulombi National Park (3 groups), as well as woodland and herbaceous savanna habitats at BNP (12 groups). We collected the 71 fecal samples molecularly identified as being from C. campbelli in 24 geographically distinct locations, four in Cufada Lagoons Natural Park, three in Cantanhez Forest National Park, ten in Dulombi National Park, four in BNP, and three in Caravela island (Fig. 1.). For Chl. sabaeus , we collected the 76 molecularly identified fecal samples in 11 geographically distinct locations, two in Cufada Lagoons Natural Park, two in Cantanhez Forest National Park, three in Dulombi National Park, three in Boé National Park, and one in Ganogo island (Fig. 1.) Mitochondrial Genetic Diversity and Spatial Structure We found 13 unique haplotypes and 53 polymorphic positions in the 640 bp-long concatenated dataset (N = 54) for C. campbelli , and 22 unique haplotypes and 75 polymorphic positions in a 628 bp long mtDNA concatenated dataset (N = 59) for Chl. sabaeus . Estimated levels of mitochondrial genetic diversity were high for both species (Table 1 ). Haplotype richness in C. campbelli varied between 1 (in Bijagós archipelago) and 4.21 (in Dulombi National Park). Haplotype richness in Chl. sabaeus was similar between localities but was higher in Cufada Lagoons Natural Park and Dulombi National Park when compared to the other localities (Table 1 ). The C. campbelli’s concatenated haplotype network suggests the existence of two divergent haplogroups distanced by 36 nucleotide substitutions (Fig. 2A). Haplogroup A is composed of 10 haplotypes in a star-shaped phylogeny, in which the most frequent haplotype is connected to the surrounding haplotypes by 1–3 nucleotide substitutions. Haplogroup A was present at Bijagós archipelago, Cufada Lagoons Natural Park, Cantanhez Forest National Park, and Dulombi National Park. The most frequent haplotype was shared between Cufada Lagoons Natural Park, Dulombi National Park, and Bijagós archipelago. Haplogroup B, which we only sampled in BNP, was formed of three haplotypes, separated by a maximum of five nucleotide substitutions. For Chl. sabaeus , the concatenated haplotype network also suggests the existence of two divergent haplogroups, distanced by 10 nucleotide substitutions (Fig. 2B). Haplogroup A is formed of 10 haplotypes, sampled primarily on the insular and coastal regions (Bijagós archipelago, Cufada Lagoons Natural Park, and Cantanhez Forest National Park). Haplogroup B is formed of 12 haplotypes, seven sampled in Dulombi National Park and the rest in Boé National Park and Cufada Lagoons Natural Park. We did not find shared haplotypes between sampling locations. In both species, we retrieved haplogroups A and B for both mitochondrial markers independently ( cytb and HVRI, Supplementary Materials 3, Supplementary Fig. 1. and Fig. 2.). Only C. campbelli haplogroup A was out of mutation-drift equilibrium (Fu’s Fs = -2.77, P < 0.05; Supplementary Materials 3, supplementary Table 1). The remaining mutation drift equilibrium test statistics, Tajima’s D, Ramos-Onsins and Rozas’ R 2 and the raggedness index did not differ significantly from the expectations under a neutral evolution model with constant population size (Supplementary Materials 3, Supplementary Table 1). Table 1 Mitochondrial genetic diversity of Cercopithecus campbelli and Chlorocebus. sabaeus across insular and Southern mainland Guinea-Bissau based on cytb and HVRI mitochondrial DNA fragments. Sampling Area cytb HVRI concatenated a N nH Hr S Hd (SD) π x 10 − 2 (SD) N nH Hr S Hd (SD) π x 10 − 2 (SD) N nH Hr S Hd (SD) π x 10 − 2 (SD) C. campbelli BA 13 1 1.00 0 – – 13 1 1.00 0 – – 13 1 1.00 – – – CLNP 7 1 1.00 0 – – 6 2 2.00 1 0.73 (0.16) 0.30 (0.08) 6 2 2.00 2 0.33 (0.21) 0.10 (0.07) CNP 16 2 1.44 1 0.13 (0.01) 0.04 (0.03) 10 3 2.20 6 0.38 (0.18) 0.42 (0.27) 10 3 2.20 7 0.38 (0.18) 0.22 (0.14) DNP 17 2 2.00 1 0.53 (0.05) 0.17 (0.01) 14 5 3.79 4 0.81 (0.07) 0.53 (0.06) 13 6 4.21 5 0.86 (0.06) 0.32 (0.03) BNP 17 1 1.00 0 – – 13 3 2.19 7 0.41 (0.15) 0.75 (0.32) 12 3 2.27 7 0.44 (0.25) 0.38 (0.15) Overall 70 4 – 8 0.54 (0.05) 0.83 (0.10) 56 12 – 45 0.81 (0.04) 4.69 (0.70) 54 13 – 53 0.83 (0.04) 2.48 (0.40) Chl. sabaeus BA 17 1 1.00 0 – – 19 5 1.65 8 0.65 (0.09) 0.56 (0.20) 17 4 1.63 7 0.63 (0.08) 0.26 (0.10) CLNP 9 4 1.99 4 0.58 (0.03) 0.28 (0.12) 7 6 1.95 43 0.95 (0.10) 5.89 (1.18) 7 6 1.95 45 0.95 (0.10) 2.79 (0.56) CNP 3 1 1.00 0 – – 2 1 1.00 0 – – 2 1 1.00 – – – DNP 16 3 1.98 5 0.43 (0.13) 0.52 (0.18) 14 7 1.86 35 0.85 (0.07) 3.68 (0.80) 14 7 1.85 40 0.85 (0.05) 1.87 (0.45) BNP 26 3 1.96 6 0.61 (0.05) 0.58 (0.12) 21 5 1.55 43 0.55 (0.12) 4.22 (0.87) 19 4 1.52 41 0.52 (0.12) 2.05 (0.48) Overall 71 6 – 8 0.73 (0.02) 0.49 (0.07) 63 24 – 65 0.91 (0.02) 5.12 (0.31) 59 22 – 75 0.91 (0.02) 2.59 (0.17) Number of samples (N); number of haplotypes (nH); number of polymorphic positions (S); haplotype diversity (Hd); haplotype richness (Hr) nucleotide diversity (π). Standard deviations are presented in brackets. a Only samples where both mitochondrial fragments were successfully amplified were included in the concatenated dataset. The trend-surface analysis revealed a significant signal of geographically induced genetic differentiation, with sampling sites explaining 98.9% of C. campbelli mitochondrial differentiation (adjusted R 2 = 0.99; pseudo-F = 649.88, df = 5, P < 0.001). The fitted site scores from the first significant Canonical Axis explained 99.40% of the constrained variation. After extrapolation, we found a steep gradient of genetic variation from BNP towards the remaining sampling regions (Fig. 3A). When we removed highly divergent haplotypes sampled in Boé National Park for C. campbelli , the variance explained by spatial locations of sites was still significant but decreased to 40.06% (adjusted R 2 = 0.39; pseudo-F = 18.56, df = 1, P < 0.001). The extrapolated CAP1 fitted site scores (100% of the constrained variation) showed a spatial gradient of genetic variation from Dulombi National Park towards the Cantanhez Forest National Park (Fig. 3A, 3B). Sampling locations explained 38.55% of Chl. sabaeus mitochondrial differentiation (adjusted R 2 = 0.37; pseudo-F = 11.29, df = 3, P < 0.001). We found a spatial gradient from Dulombi National Park towards the remaining sampling regions (Fig. 3C) based on the extrapolated CAP1 fitted site scores (80.41% of the constrained variation). A significant correlation between genetic and geographic distances was evident in Mantel tests for the overall C. campbelli dataset (p < 0.001) but not for the C. campbelli ∅ Boé National Park partial dataset (p = 0.18). Genetic and geographic distances were also significantly correlated for Chl. sabaeus (p < 0.001). Phylogenetic reconstruction and lineage divergence time The tree topology in C. campbelli is characterized by two divergent haplogroups corresponding to those retrieved in the haplotype network (Fig. 4). Monophyly was supported for both haplogroups (PP > 0.99; Fig. 4). Haplogroups A and B were estimated to have diverged approximately 1.53 Mya [2.56–0.65 Mya, 95% highest posterior density (HPD)]. We found a similar result for Chl. sabaeus , for which we identified two divergent haplogroups in the tree (PP > 0.96; Fig. 4). Haplogroups A and B were estimated to have diverged approximately 1.16 Mya (1.83–0.67 Mya 95% HPD). The split between C. campbelli and Chl. sabaeus was estimated as 10.51–3.63 Mya (95% HPD) and the split between the two species and the outgroups at 13.18–7.43 Mya (95% HPD). Discussion This study gathered recent baseline information (2008–2022) on C. campbelli and Chl. sabaeus populations distributed in southern mainland Guinea-Bissau and the Bijagós archipelago. Our work gathered evidence for a wider distribution of C. campbelli and broader habitat use for Chl. sabaeus in Guinea-Bissau. Our results suggest relatively high mtDNA genetic diversity for the two species in the mainland and lower genetic diversity in the insular populations. Moreover, our work suggests that variables other than geographic distances contributed to shape the contemporary and historical mtDNA genetic structure across Guinea-Bissau. We recorded the presence of the two species in areas with previously known occurrences (e.g., Gippoliti & Dell’Omo, 2003 ). Moreover, we gather molecular and visual evidence for the occurrence of C. campbelli in the Boé National Park. This area is outside the distribution polygon of the most recent IUCN species assessment. Our results also suggests that Chl. sabaeus uses a large diversity of habitats in Guinea-Bissau, namely mangroves, primary forest, and patchy woodland savanna habitats. Similarly, past studies Bersacola et al. (2018) recorded green monkey individuals in Dulombi National ParkDNP using grassland, woodland savannah, and cashew orchards ( Anacardium occidentale ) habitats (Bersacola et al. 2018). These records do not support the common narrow association of Chl. sabaeus green monkeys to mangrove forests in the country (Gippoliti & Dell’Omo 1996 ; Gippoliti & Dell’Omo 2003 ). We found relatively high mtDNA genetic diversity for the two species in mainland sampling sites. These high levels of mitochondrial genetic are consistent with patterns found for other co-occurring primates in the same region ( e.g., Papio papio : HVRI Hd = 0.81, π = 1.30 x10 − 3 , Ferreira da Silva et al., 2014 ) and Pan troglodytes verus , HVRI Hd = 0.94, π = 3.70 x10 − 3 , Borges, 2017 ). A significant and negative Fu’s Fs in C. campbelli haplogroup A could be interpreted as historical population expansion in the country (Fu 1997 ). Although we found similar levels of mitochondrial genetic diversity between the regions we sampled in the mainland, insular populations of both species showed the lowest mtDNA diversity. This is particularly evident for the insular C. campbelli population in Caravela island, where we found a single haplotype in 13 samples. Low genetic diversity is frequent in insular/translocated populations and often arises from the founding effect associated with a colonization process mediated by a small number of individuals and subsequent loss of genetic diversity by genetic drift (Eales et al., 2010 ; Freeland, 2020 ; Allendorf et al., 2013 ). However, the specific processes of the colonization of the Bijagós archipelago by mammals, primates included, are yet to be investigated. Our results suggest close genetic proximity between the insular and mainland coastal populations for the two species. The single haplotype sampled for C. campbelli at Caravela island is indistinguishable from the most frequent haplotype in Cufada Lagoons Natural Park, suggesting that the insular populations originate from Cufada or surrounding coastal regions. We sampled multiple closely related and private haplotypes for Chl. sabaeus in the Bijagós archipelago, which suggests a more complex and/or possibly older colonization process than C. campbelli (Hayaishi & Kawamoto, 2006 ). Our estimations of mitochondrial spatial structure on the mainland for C. campbelli and Chl. sabaeus are compatible with an isolation-by-distance pattern. In this pattern, in which gene flow occurs mainly to nearby groups in a stepwise manner. The location of sampling sites explained approximately 40% of the total genetic differentiation for C. campbelli ( C. campbelli ∅ Boé National ParkBNP partial dataset) and for Chl. sabaeus , suggesting that variables other than geographic distances contributed to the contemporary and historical mtDNA structure. Considering the ecological features of Guinea-Bissau and the habitat requirements of Chl. sabaeus and C. campbelli , spatial structuring may have been shaped by a variation of the habitat composition/ecotones (Casado et al., 2010 ) and/or by insurmountable barriers, such as permanent water bodies (Telfer et al., 2003 ). For C. campbelli , divergent haplogroups seem to be geographically separated. This is expected in male-biased dispersal species, in which females remain philopatric in natal groups or their movement is very limited in space (Di Fiore et al., 2009 ). In species with male-biased dispersal, mtDNA variation is expected to be strongly structured compared to nuclear or Y chromosome genetic markers, and demes may show reduced mtDNA haplotype diversity (Melnick & Hoelzer, 1992 ; Di Fiore, 2003 ). Our sampling strategy based on non-invasive fecal sample collection from unidentified individuals and mtDNA markers does not allow us to estimate male-specific gene flow. Nonetheless, descriptions of C. campbelli in Tai Forest, Côte d’Ivoire suggest female philopatry. In Tai, groups are formed by of one adult male and multiple females. The groups’ males were observed in agonistic interactions with immigrant males, to prevent their presence in the groups’ home range (Buzzard & Eckardt 2007 ). These behaviors suggest that males are the dispersing sex in this C. campbelli population. Moreover, the spatial distribution of mtDNA variation for C. campbelli suggests that both isolation-by-distance and potentially isolation-by-environment may have contributed to shaping historical female gene flow across sampling sites in the mainland. We found that the main axis of genetic variation was from coastal to interior regions of the country. C. campbelli main axis of genetic variation coincides with an important ecological transition in southern Guinea-Bissau, in which the dominant vegetation changes from Guinea-Congolian sub-humid and dry forest in the coastal areas (Cufada Lagoon Natural Park and Cantanhez Forest National Park to open forest and savannah woodlands of Sudanese affinity in the western-most regions (Dulombi National Park and Boé National Park in only 200 km (Catarino et al., 2001 ). For Chl. sabaeus , the interpolated fitted site scores from distance-based redundancy analyses suggest limited female historical or contemporary gene flow between Dulombi National Park and the remaining sampling areas potentially due to the presence of the Corubal River. Although Chl. sabaeus can swim, this behavior seems to be restricted to small distances and shallow waters (Rowe & Myers, 2016 ) and they may not be able to traverse the Corubal River near Cufada Lagoons Natural Park since it can reach over 1 km in width. The two haplogroups found for Chl. sabaeus overlap in Cufada Lagoon Natural Park and Boé National Park (both located in the southern margin of the Corubal River) which suggests a degree of female historical or contemporary gene flow between these localities (Di Fiore, 2003 ; e.g., Minhós et al., 2013 a; Ferreira da Silva et al., 2014 ; Kopp et al., 2014 ). This pattern is not unexpected since females have been described to disperse occasionally in Chl. sabaeus (Rowe & Myers 2016 ). A similar pattern of mtDNA variation was found in two well-studied Cercopithecidae primate species with female-biased dispersal ( Papio papio and Papio hamadryas ) (Ferreira da Silva et al., 2013, Hapke et al., 2001, Kopp et al., 2014 ). The association between mtDNA variation and the geographic location of demes is weak or non-existent (Kopp et al., 2014 ). Our observations at a smaller scale in Guinea-Bissau in Chl. sabaeus are similar to the pattern of mtDNA variation in Papio papio across its West African range, which is characterized by i) haplotype clusters not associated with the geographic origin of samples, and which are shared by many distant demes (in some cases, over 500 km), and ii) closely-located demes which harbor very divergent haplotypes ( e.g ., 16 nucleotide substitutions between haplotypes all sampled in the Republic of Guinea (Kopp et al., 2014 ). Another female-biased dispersal species in Guinea-Bissau, Pan troglodytes verus , shows a similar pattern of mtDNA variation in which Guinea-Bissau populations share haplotypes with populations at Nimba mountains, located over 800 km apart (Sá 2013 ). The patterns of mtDNA variation we observed for C. campbelli and Chl. sabaeus in Guinea-Bissau likely represent a a generalized pattern although we only sampled protected areas within the country. The two species are the most hunted primates in Guinea-Bissau the country (Minhós et al., 2013 b) and group densities are thought to be very low outside of the protected areas (MJFS, pers. obs.), even within ecological corridors where law enforcement is negligent (). Our results suggest the presence of two significantly divergent haplogroups for C. campbelli and Chl. sabaeus in Guinea-Bissau, with the estimated lineage divergence within the early Pleistocene (2.58–0.77 Mya; Cohen et al., 2013 ) and within the timeframe of intraspecific diversification events of many guenon species (1.9–0.1 Mya 95% HPD; Guschanski et al., 2013 ). The existence of genetically divergent haplogroups in a relatively small area, such as southern Guinea-Bissau, is unexpected but is in agreement to the pattern found for other species in Guinea-Bissau. Divergent mitochondrial haplotypes/haplogroups have been reported for P. papio (Ferreira da Silva et al., 2014 )d t. verus (Sá, 2013 ). The spatial distribution of the mtDNA differentiation found in this work for C. campbelli and Chl. sabaeus across these other primate species seems to follows the same axis of differentiation between coastal (Cufada Lagoons National Park and Cantanhez Forest National Park) and interior areas (Dulombi National Park and Boé National Park) as found across these other primate species. Similar mtDNA diversity levels, spatial structure, significant divergence between sampled haplogroups across the several of the country’s primate species could be related to the relatively central position of the country in distribution of species in West Africa (the center–periphery hypothesis; Pironon et al., 2014). Alternatively, the Guinea-Bissau primates may have went through similar intra-species vicariant and demographic events that occurred thousands of generations in the past (Zinner et al., 2009 ; Haus et al., 2013 ). For example, shifts in the main sub-Saharan biomes due to Pleistocene climatic fluctuations, often accompanied by recurring periods of population range retraction and re-colonisation, are usually considered to be a cause of phylogeographic patterns in West African primates (e.g. Papio sp., Zinner et al., 2009 ); Chlorocebus sp., Haus et al., 2013 ; Dolotovskaya et al., 2017 ), and other mammals (Bertola et al., 2016 ). Guinea-Bissau is at the center of the Fouta Djallon-Casamance differentiation region (Oates et al., 2011). This region likely contained pockets of gallery forest which could have promoted the differentiation of genetic lineages that later came into contact in Guinea-Bissau after range re-expansion (Oates et al., 2011). It is difficult to contextualize the degree of mitochondrial genetic diversity and divergence of intra-specific haplogroups in Guinea-Bissau because of the lack of geo-referenced mtDNA data for other populations and incomplete assessment of the patterns of genetic variation for most West -African primates, particularly for arboreal guenons, C. campbelli included. Our study is limited by the small size of the mitochondrial DNA fragments we amplified (628–640 bp concatenated size) which results in large 95% HPD intervals for the estimated divergence times between the haplogroups sampled. Nevertheless, the estimated 95% HPD intervals across our estimated phylogeny are within the divergence timeframes estimated using complete mitochondrial genomes (Guschanski et al., 2013 ; Jensen et al., 2023 ). Implications for local primate conservation and future perspectives Broad-scale and short-fragment mtmitochondrial DNA databases based on non-invasive sampling for multiple populations of co-distributed primates in West Africa contribute to improving the effectiveness of conservation actions. Among other factors, prioritizing conservation areas can be based on levels of inter and intraspecific genetic diversity (Carvalho et al., 2017 ). Our results suggest that Guinea-Bissau harbors high mitochondrial genetic diversity and multiple mitochondrial lineages for many of the extant primate species, including C. campbelli and Chl. sabaeus , and the country could be considered as an area of high conservation priority in West Africa. Nevertheless, using short mitochondrial fragments as genetic markers has limitations. The rate of evolution of the mitochondrial D-loop (humans, 2.4x10 − 7 substitutions/site/year; Santos et al. 2005 ) falls short of what is required for assessing more recent and subtle changes in the genetic diversity and fine-scale patterns of population structure (Freeland, 2020 ), which are expected to be related to the impacts of human activities during the last two to three primate generations. Further studies aiming to improve our understanding of the effects of the increasing recent anthropogenic impacts on these understudied primate populations should include genetic markers with higher evolution rates such as autosomal microsatellites (10x − 6 – 10x − 2 mutations/locus/generation), or sequencing of polymorphic positions using NGS technologies (Freeland 2020 ), which coupled with sequencing of the whole mitochondrial genome would also provide a more accurate estimation of demographic parameters of conservation interest. C. campbelli and Chl. sabaeus were the most hunted and traded primates in urban wild meat markets and dedicated bars in 2010 and 2016 (Minhós et al., 2013 b; Ferreira da Silva et al., 2021 ). These observations inform the recent update of their global conservation status from Least Concern to Near Threatened (IUCN, 2023). However, the extent to which current hunting activities impacts populations of these two guenons is currently unknown, but are likely to resemble those proposed for other generalist primates that are hunted in Guinea Bissau. These impacts may entail i) shifts in habitat use and occupancy, ii) increased dispersal distances leading to secondary contact between divergent genetic lineages, iii) preferential movements towards areas where hunting is less frequent causing restriction of gene flow between populations, and iv) low genetic diversity and reduction of effective population sizes (Minhós et al., 2013 a; Ferreira da Silva et al., 2014 ; Minhós et al., 2016 ; Ferreira da Silva et al., 2018 ; Minhós & Ferreira da Silva., 2020; Bersacola et al., 2021 ; Minhós et al., 2023 ). Furthermore, the insular populations of C. campbelli and Chl sabaeus show the lowest levels of mtDNA genetic diversity in the country. Considering the ongoing high rate of habitat conversion into agricultural areas and wildmeat hunting on the islands, the long-term survival of insular primates could be threatened (Karibuhoye, 2004 ; Colmonero-Costeira et al., 2023 ). Further works should also clarify whether recent hunting or deforestation have severely decreased populations in areas previously reported as part of the species’ national range but not sampled here, particularly in the northeast (e.g., Cacheu Mangroves Natural Park) and northwest parts of the country (Gippoliti & Dell’Omo 2003 ), where surveys are urgent. Abbreviations IUCN International Union for Conservation of Nature IBAP Instituto para a Biodiversidade e Áreas Protegidas CMNP Cacheu Mangroves Natural Park UCMPA Urok Communitarian Marine Protected Area ONP Orango National Park JVPMNP João Vieira and Poilão Marine National Park mtDNA Mitochondrial DNA PCR Polymerase Chain Reaction Cytb Cytochrome b gene HVRI Hypervariable region I of the mitochondrial D–loop BLAST Basic Local Alignment Search Tool NCBI National Center for Biotechnology Information database NUMTs Nuclear mitochondrial DNA segments Hd Haplotype diversity Π Nucleotide diversity Db RDA–Distance–based redundancy analysis VIF Variance inflation factor CAP Canonical axis MRCA Most recent common ancestor ML Maximum likelihood PP Bayesian posterior probabilities BS Maximum likelihood bootstrap ESS Effective sample size HPD Highest Posterior Density IBD Isolation by distance Declarations Acknowledgments We are very grateful to the Guinea-Bissau governmental agency Instituto de Biodiversidade e Áreas Protegidas (IBAP), particularly to the director Dr. Aissa Regalla and former director Dr. Justino Biai, and Dr. Abilio Said, Dr. Augusto Cá, Dr. Joãozinho Mané and Dr Dradjo Danfa for fieldwork and sampling permits and fieldwork logistics. We are grateful for the help and support of Abel Vieira, Iaia Cassama, Benjamin Indeque, Braima Bemba Canté. We would like to acknowledge the Direcção Geral de Florestas e Fauna (DGFF) and CITES focal person for sample exportation permits; the research assistants and guides Sadjo Camará, Mamadu Soares, Mamadu Turé, Idrissa Camará, and Bemba; the NGO CHIMBO and Tiniguena for logistical support during fieldwork in the Boé region and UROK islands, respectively. To I. Espinosa and H. Foito for logistical support in Bissau; We thank P. Huet, L. Palma, and F. Gerini for facilitating photographs. We thank C. Silva for translation of abstract to Guinea-Bissau Kriol. This work was funded by Fundação para a Ciência e Tecnologia project PRIMATOMICS (ref: PTDC/IVC-ANT/3058/2014) and by the Born Free Foundation, Chester Zoo Conservation Fund, Primate Conservation Incorporated, The Genetics Society, CAROSI, Cápsulas do Norte, Camarc, JA-Rolhas e Cápsulas. The work was partly funded by the project TROPIBIO NORTE-01-0145-FEDER-000046, supported by Norte Portugal Regional Operational Programme (NORTE2020), under the PORTUGAL 2020 Partnership Agreement, through the European Regional Development Fund (ERDF). MJFS worked under an FCT contract (https://doi.org/10.54499/CEECIND/01937/2017/CP1423/CT0010) and IAP, I.C.C., and F.B. were supported by FCT-doctoral fellowship (IAP: https://doi.org/10.54499/SFRH/BD/118444/2016; I.C.C.: https://doi.org/10.54499/SFRH/BD/146509/2019; FB: https://doi.org/10.54499/2020.05839.BD). Photographs by L. Palma were taken as part of the project CIBIO-BIOPOLIS/ECF-WCN project: Forest elephant conservation status in Guinea-Bissau. Authors contribution MJFS, FG, IAP, MD and NF collected samples and presence data across Guinea-Bissau. IAP, FB, MC, FG and ICC conducted molecular work or contributed to obtaining genetic data. ICC performed data statistical analyses. MJFS and TM designed the study and contributed to funding acquisition. All authors contributed to the writing of the original draft and to review & editing the final manuscript. Inclusion and Diversity statement This work includes Bissau-Guinean authors who provided invaluable contributions to the sample design and collection. References Allendorf FW, Luikart G, Aitken SN (2013) Conservation and the Genetics of Populations, 2nd edn. John Wiley & Sons, Ltd. https://doi.org/10.1093/jhered/esl039 Almeida L, Colmonero-Costeira I, Silva MJFd, Veracini C, Vasconcelos R (2024) Insights into the Geographical Origins of the Cabo Verde Green Monkey. Genes 15:504. https://doi.org/10.3390/genes15040504 Bensasson D, Zhang DX, Hartl DL, Hewitt GM (2001) Mitochondrial pseudogenes: Evolution’s misplaced witnesses. In Trends in Ecology and Evolution (Vol. 16, Issue 6, pp. 314–321). https://doi.org/10.1016/S0169-5347(01)02151-6 Bersacola E, Hill CM, Hockings KJ (2021) Chimpanzees balance resources and risk in an anthropogenic landscape of fear. Sci Rep 2021 11(1):1–13. https://doi.org/10.1038/s41598-021-83852-3 Bertola LD, Jongbloed H, Van Der Gaag KJ, De Knijff P, Yamaguchi N, Hooghiemstra H, Bauer H, Henschel P, White PA, Driscoll CA, Tende T, Ottosson U, Saidu Y, Vrieling K, De Iongh HH (2016) Phylogeographic Patterns in Africa and High Resolution Delineation of Genetic Clades in the Lion (Panthera leo). Scientific Reports 2016 6:1, 6(1), 1–11. https://doi.org/10.1038/srep30807 Blanchet FG, Legendre P, Borcard D (2008) Forward selection of explanatory variables. Ecology 89(9):2623–2632. https://doi.org/10.1890/07-0986.1 Borges F (2017) A country-level genetic survey of the IUCN critically endangered western chimpanzee (Pan troglodytes verus) in Guinea-Bissau [MSc Thesis]. University of Porto Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu C-H, Xie D, Suchard MA, Rambaut A, Drummond AJ (2014) BEAST 2: A Software Platform for Bayesian Evolutionary Analysis. PLoS Comput Biol 10(4):e1003537. https://doi.org/10.1371/journal.pcbi.1003537 Buzzard PJ, Eckardt W (2007) Social systems of the Taï guenons (Cercopithecus spp). In: Zuberbühler K, McGraw S, Noë R (eds) Monkeys of the Taï Forest: An African Primate Community. Cambridge University Press. https://doi.org/10.1017/CBO9780511542121.003 Campredon P, Cuq F, Giraudet E, Giraudet J, Goulemon F, Pennober G, Silva AS (2001) da. Un Système dÍnformation Géographique pour láide à la gestion intégrée de lárchipel des Bijagos (Guinée-Bissau). Notice de la carte, constitution et exploitation du SIG. Géosystèmes-CNRS. https://searchworks.stanford.edu/view/5320334 Casado F, Bonvicino CR, Nagle C, Comas B, Manzur TD, Lahoz MM, Seuánez HN (2010) Mitochondrial divergence between 2 populations of the hooded capuchin, cebus (sapajus) cay (platyrrhini, primates). J Hered 101(3):261–269. https://doi.org/10.1093/jhered/esp119 Carvalho SB, Velo-Antón G, Tarroso P, Portela AP, Barata M, Carranza S, Moritz C, Possingham HP (2017) Spatial conservation prioritization of biodiversity spanning the evolutionary continuum. Nat Ecol Evol 2017 1(6):1–8. https://doi.org/10.1038/s41559-017-0151 Catarino L, Martins ES, Moreira I (2001) Influence of Environmental Features in the Phytogeographic Framework of Guinea-Bissau. Plant Systematics and Phytogeography for the Understanding of African Biodiversity, Proceedings of the XVIth AETFAT Congress, 71(2), 1079–1086. https://doi.org/10.2307/3668740 Cohen KM, Finney SC, Gibbard PL, Fan J-X (2013) The ICS International Chronostratigraphic Chart 2020/01. Int Comm Stratigraphy 36:199–204 Colmonero-Costeira I, Minhós T, Djaló B, Fernandes N, da Ferreira M (2019) Confirmação da ocorrência de primatas não-humanos no Arquipélago dos Bijagós com base em técnicas de identificação molecular. Sintidus 2:145–179 Colmonero-Costeira I, Sá RM, Djaló ML, Cunha N, Cunha J, Minhós T, Russo I-RM, Bruford MW, Costa S, da Silva F, M. J (2023) Notes on the conservation threats to the western lesser spot-nosed monkey (Cercopithecus petaurista buettikoferi) in the Bijagós Archipelago (Guinea-Bissau, West Africa). https://doi.org/10.1007/s10329-023-01090-9 . Primates Di Fiore A (2003) Molecular genetic approaches to the study of primate behavior, social organization, and reproduction. Am J Phys Anthropol 122(S37):62–99. https://doi.org/10.1002/AJPA.10382 Di Fiore A, Link A, Schmitt CA, Spehar SN (2009) Dispersal patterns in sympatric woolly and spider monkeys: Integrating molecular and observational data. Behaviour 146(4–5):437–470. https://doi.org/10.1163/156853909X426345 Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7(1):1–8. https://doi.org/10.1186/1471-2148-7-214 Dolotovskaya S, Bordallo JT, Haus T, Noll A, Hofreiter M, Zinner D, Roos C (2017) Comparing mitogenomic timetrees for two African savannah primate genera (Chlorocebus and Papio). Zool J Linn Soc 181(2):471–483. https://doi.org/10.1093/ZOOLINNEAN/ZLX001 Eales J, Thorpe RS, Malhotra A (2010) Colonization history and genetic diversity: Adaptive potential in early stage invasions. Mol Ecol 19(14):2858–2869. https://doi.org/10.1111/j.1365-294X.2010.04710.x Estrada A, Garber PA, Rylands AB, Roos C, Fernandez-Duque E, Di Fiore A, Nekaris KA-I, Nijman V, Heymann EW, Lambert JE, Rovero F, Barelli C, Setchell JM, Gillespie TR, Mittermeier RA, Arregoitia LV, de Guinea M, Gouveia S, Dobrovolski R, Li B (2017) Impending extinction crisis of the world’s primates: why primates matter. Sci Adv 3(1):e1600946. https://doi.org/10.1126/sciadv.1600946 Ferreira da Silva MJ, Camará M, Egeter B, Minhós T, Bruford MW, Godinho R (2021) Using meta-barcoding tools to monitor primate meat consumption at dedicated establishments in Guinea-Bissau, West Africa. ARPHA Conference Abstracts 4: E65575, 4, e65575-. https://doi.org/10.3897/ACA.4.E65575 Ferreira da Silva MJ, Godinho R, Casanova C, Minhós T, Sá R, Bruford MW (2014) Assessing the impact of hunting pressure on population structure of Guinea baboons (Papio papio) in Guinea-Bissau. Conserv Genet 15(6):1339–1355. https://doi.org/10.1007/s10592-014-0621-0 Ferreira da Silva MJ, Kopp GH, Casanova C, Godinho R, Minhós T, Sá R, Zinner D, Bruford MW (2018) Disrupted dispersal and its genetic consequences: Comparing protected and threatened baboon populations (Papio papio) in West Africa. PLoS ONE 13(4):e0194189. https://doi.org/10.1371/journal.pone.0194189 Ferreira da Silva MJ, Paddock C, Gerini F, Borges F, Aleixo-Pais I, Costa M, Colmonero-Costeira I, Casanova C, Lecoq M, Silva C, Bruford MW, Varanda J, Minhós T (2020) Chasing a ghost: notes on the present distribution and conservation of the sooty mangabey (Cercocebus atys) in Guinea-Bissau, West Africa. Primates 61(3):357–363. https://doi.org/10.1007/s10329-020-00817-2 Freeland JR (2020) Molecular Ecology, 3rd edn. John Wiley & Sons Ltd Fu YX (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147(2), 915–925. https://doi.org/genetics.org//147/2/915 Gagnon CM, Svardal H, Jasinska AJ, Cramer D, Freimer J, Grobler NBP, Turner J, T. R., Schmitt CA (2022) Evidence of selection in the uncoupling protein 1 gene region suggests local adaptation to solar irradiance in savannah monkeys (Chlorocebus spp.). Proceedings of the Royal Society B, 289(1982). https://doi.org/10.1098/RSPB.2022.1254 Galat G, Galat-Luong A (1977) Demographie et regime alimentaire d’une troupe de Cercopithecus aethiops sabaeus en habitat marginal au nord Senegal. Terre Et La Vie 31(4):557–577 Gaubert P, Njiokou F, Olayemi A, Pagani P, Dufour S, Danquah E, Nutsuakor MEK, Ngua G, Missoup AD, Tedesco PA, Dernat R, Antunes A (2015) Bushmeat genetics: Setting up a reference framework for the DNA typing of African forest bushmeat. Mol Ecol Resour 15(3):633–651. https://doi.org/10.1111/1755-0998.12334 Gippoliti S, Dell’Omo G (1996) Primates of the Cantanhez Forest and the Cacine Basin, Guinea-Bissau. Oryx 30(1):74–80. https://doi.org/10.1017/s0030605300021414 Gippoliti S, Dell’Omo G (2003) Primates of Guinea-Bissau, West Africa: distribution and conservation status. Primate Conserv 19(19):73–77 Gonedelé Bi S, Galat G, Galat-Luong A, Koné I, Osei D, Wallis J, Wiafe E, Zinner D (2020) Chlorocebus sabaeus. The IUCN Red List of Threatened Species, e.T136265A. Guschanski K, Krause J, Sawyer S, Valente LM, Bailey S, Finstermeier K, Sabin R, Gilissen E, Sonet G, Nagy ZT, Lenglet G, Mayer F, Savolainen V (2013) Next-generation museomics disentangles one of the largest primate radiations. Syst Biol 62(4):539–554. https://doi.org/10.1093/sysbio/syt018 Hanson JO, Veríssimo A, Velo-Antón G, Marques A, Camacho-Sanchez M, Martínez-Solano Í, Gonçalves H, Sequeira F, Possingham HP, Carvalho SB (2021) Evaluating surrogates of genetic diversity for conservation planning. Conserv Biol 35(2):634–642. https://doi.org/10.1111/COBI.13602 Haus T, Akom E, Agwanda B, Hofreiter M, Roos C, Zinner D (2013) Mitochondrial Diversity and Distribution of African Green Monkeys (Chlorocebus Gray, 1870). Am J Primatol 75(4):350–360. https://doi.org/10.1002/AJP.22113 Hayaishi S, Kawamoto Y (2006) Low genetic diversity and biased distribution of mitochondrial DNA haplotypes in the Japanese macaque (Macaca fuscata yakui) on Yakushima Island. Primates 47(2):158–164. https://doi.org/10.1007/s10329-005-0169-1 Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Mol Biol Evol 35(2):518–522. https://doi.org/10.1093/molbev/msx281 Jensen A, Swift F, de Vries D, Beck RMD, Kuderna LFK, Knauf S, Chuma IS, Keyyu JD, Kitchener AC, Farh K, Rogers J, Marques-Bonet T, Detwiler KM, Roos C, Guschanski K (2023) Complex Evolutionary History With Extensive Ancestral Gene Flow in an African Primate Radiation. Mol Biol Evol 40(12). https://doi.org/10.1093/MOLBEV/MSAD247 Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat Methods 14(6):587–589. https://doi.org/10.1038/nmeth.4285 Karibuhoye C (2004) Mammal Conservation status and Prospects for community-based wildlife management in coastal Guinea-Bissau, West Africa [PhD]. Georg-August-Universität Göttingen Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12):1647–1649. https://doi.org/10.1093/bioinformatics/bts199 Kopp GH, Ferreira da Silva MJ, Fischer J, Brito JC, Regnaut S, Roos C, Zinner D (2014) The Influence of Social Systems on Patterns of Mitochondrial DNA Variation in Baboons. Int J Primatol 35(1):210–225. https://doi.org/10.1007/s10764-013-9725-5 Kopp GH, Fischer J, Patzelt A, Roos C, Zinner D (2015) Population genetic insights into the social organization of Guinea baboons (Papio papio): Evidence for female-biased dispersal. Am J Primatol 77(8):878–889. https://doi.org/10.1002/ajp.22415 Legendre P, Anderson MJ (1999) Distance-based redundancy analysis: Testing multispecies responses in multifactorial ecological experiments. Ecol Monogr 69(1):1–24. https://doi.org/10.1039/b916289e Legendre P, Legendre L (2012) Numerical Ecology, 3rd edn. Elsevier B.V. Leigh JW, Bryant D (2015) POPART: Full-feature software for haplotype network construction. Methods Ecol Evol 6(9):1110–1116. https://doi.org/10.1111/2041-210X.12410 Matsuda Goodwin R, Gonedelé Bi S, Koné I (2020) Cercopithecus campbelli. He IUCN Red List of Threatened Species. e.T136930A Melnick DJ, Hoelzer GA (1992) Differences in male and female macaque dispersal lead to contrasting distributions of nuclear and mitochondrial DNA variation. Int J Primatol 13(4):379–393. https://doi.org/10.1007/BF02547824/METRICS Moeller DA, Tenaillon MI, Tiffin P (2007) Population Structure and Its Effects on Patterns of Nucleotide Polymorphism in Teosinte (Zea mays ssp. parviglumis). Genetics 176(3):1799–1809. https://doi.org/10.1534/GENETICS.107.070631 Minhós T, Borges F, Parreira B, Oliveira R, Aleixo-Pais I, Leendertz FH, Wittig R, Fernandes CR, Silva M, Duarte GHL, Bruford M, Ferreira MW, da Silva MJ, Chikhi L (2023) The importance of well protected forests for the conservation genetics of West African colobine monkeys. Am J Primatol 85:e23453. https://doi.org/10.1002/ajp.23453 Minhós T, Chikhi L, Sousa C, Vicente LM, Ferreira da Silva MJ, Heller R, Casanova C, Bruford MW (2016) Genetic consequences of human forest exploitation in two colobus monkeys in Guinea Bissau. Biol Conserv 194:194–208. https://doi.org/10.1016/j.biocon.2015.12.019 Minhós T, Fererira da Silva MJ (2020) Primate behavioral adaptations to anthropogenic habitats – the case of Cantanhez National Park in Guinea-Bissau. In: Roque AC, Brito C, Veracini C (eds) Peoples, Nature and Environments: Learning to Live Together, 1st edn. Cambridge Scholars Publishing, pp 129–144 Minhós T, Nixon E, Sousa C, Vicente LM, Silva D, Sá MF, R. M., Bruford MW (2013) Genetic evidence for spatio-temporal changes in the dispersal patterns of two sympatric African colobine monkeys. Am J Phys Anthropol 150(3):464–474. https://doi.org/10.1002/ajpa.22223 Minhós T, Wallace E, Ferreira da Silva MJ, Sá RM, Carmo M, Barata A, Bruford MW (2013) DNA identification of primate bushmeat from urban markets in Guinea-Bissau and its implications for conservation. Biol Conserv 167:43–49. https://doi.org/10.1016/j.biocon.2013.07.018 Nei M (1987) Molecular Evolutionary Genetics. Columbia University Press. https://doi.org/10.7312/nei-92038 Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32(1):268–274. https://doi.org/10.1093/molbev/msu300 Oates JF (2011) Primates of West Africa: A Field Guide and Natural History. Conservation International Pironon S, Villellas J, Morris WF, Doak DF, García MB (2015) Do geographic, climatic or historical ranges differentiate the performance of central versus peripheral populations? Glob Ecol Biogeogr 24(6):611–620. https://doi.org/10.1111/GEB.12263 Posit team (2023) RStudio: Integrated Development for R. (v2023.06.2 + 561). Posit Software, PBC R CoreTeam (2022) R: A language and environment for statistical computing. (4.2.2). Foundation for Statistical Computing. https://www.r-project.org Ramos-Onsins SE, Rozas J (2002) Statistical Properties of New Neutrality Tests Against Population Growth. Mol Biol Evol 19(12):2092–2100. https://doi.org/10.1093/oxfordjournals.molbev.a004034 Reiner F, Simões P (1999) Mamíferos Selvagens da Guiné - Bissau. Projeto Delfim - Centro Português de Estudos dos Mamíferos Marinhos Roos C, Kothe M, Alba DM, Delson E, Zinner D (2019) The radiation of macaques out of Africa: Evidence from mitogenome divergence times and the fossil record. J Hum Evol 133:114–132. https://doi.org/10.1016/J.JHEVOL.2019.05.017 Rowe N, Myers M (2016) All the World’s Primates. Pogonias Rozas J, Ferrer-Mata A, Sanchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sanchez-Gracia A (2017) Mol Biol Evol 34(12):3299–3302. https://doi.org/10.1093/molbev/msx248 . DnaSP 6: DNA sequence polymorphism analysis of large data sets Santos C, Montiel R, Sierra B, Bettencourt C, Fernandez E, Alvarez L, Lima M, Abade A, Aluja MP (2005) Understanding Differences Between Phylogenetic and Pedigree-Derived mtDNA Mutation Rate: A Model Using Families from the Azores Islands (Portugal). Mol Biol Evol 22(6):1490–1505. https://doi.org/10.1093/MOLBEV/MSI141 Sá RM (2013) Phylogeography, conservation genetics and parasitology of chimpanzees (Pan troglodytes versus) in Guinea-Bissau. West Africa [PhD, Universidade Nova de Lisboa] Städler T, Haubold B, Merino C, Stephan W, Pfaffelhuber P (2009) The Impact of Sampling Schemes on the Site Frequency Spectrum in Nonequilibrium Subdivided Populations. Genetics 182(1):205–216. https://doi.org/10.1534/GENETICS.108.094904 Svardal H, Jasinska AJ, Apetrei C, Coppola G, Huang Y, Schmitt CA, Jacquelin B, Ramensky V, Müller-Trutwin M, Antonio M, Weinstock G, Grobler JP, Dewar K, Wilson RK, Turner TR, Warren WC, Freimer NB, Nordborg M (2017) Ancient hybridization and strong adaptation to viruses across African vervet monkey populations. Nat Genet 2017 49(12):1705–1713. https://doi.org/10.1038/ng.3980 Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123(3), 585–595. https://doi.org/PMC1203831 Telfer PT, Souquière S, Clifford SL, Abernethy KA, Bruford MW, Disotell TR, Sterner KN, Roques P, Marx PA, Wickings EJ (2003) Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx. Mol Ecol 12(7):2019–2024. https://doi.org/10.1046/j.1365-294X.2003.01877.x Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44(W1):W232–W235. https://doi.org/10.1093/NAR/GKW256 Turner TR, Schmitt CA, Cramer JD, Lorenz J, Grobler JP, Jolly CJ, Freimer NB (2018) Morphological variation in the genus Chlorocebus: Ecogeographic and anthropogenically mediated variation in body mass, postcranial morphology, and growth. Am J Phys Anthropol 166(3):682–707. https://doi.org/10.1002/AJPA.23459 Warren WC, Jasinska AJ, García-Pérez R, Svardal H, Tomlinson C, Rocchi M, Archidiacono N, Capozzi O, Minx P, Montague MJ, Kyung K, Hillier LDW, Kremitzki M, Graves T, Chiang C, Hughes J, Tran N, Huang Y, Ramensky V, Freimer NB (2015) The genome of the vervet (Chlorocebus aethiops sabaeus). Genome Res 25(12):1921–1933. https://doi.org/10.1101/GR.192922.115 Zinner D, Groeneveld LF, Keller C, Roos C (2009) Mitochondrial phylogeography of baboons (Papio spp.) Indication for introgressive hybridization? BMC Evol Biol 9(1):1–15. https://doi.org/10.1186/1471-2148-9-83 Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Published Journal Publication published 03 Jun, 2025 Read the published version in International Journal of Primatology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5372533","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":372947217,"identity":"656bd1de-212a-428a-996a-3de951a78d0d","order_by":0,"name":"Ivo Colmonero-Costeira","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABQElEQVRIie3RMUvDQBTA8RcOkuVK1ldarB/A4ZVCsbRYP4ZjRUjHrh1EIsVzyQdov4UgiIPDhQedAq4VJ5dODgldKoqaS3UJFTo63H8Ix3E/Lo8DsNn+YX4ows3K0+aL+RablZDepNgBKhHUzg+RAwBtiHAHBZHzwVZCx78E9w0pDptDAv4k3uXVTXbfG/koeJWOD0f+RGbp20O3Ll1w0jVwq0xkrJ5mSdCZTd0AdYKdKVduq9FyKHMiqhFwu0zwVD1XFBMtZBtihQRcuQOpWfYbIdQAuLedfBnSSuNPpAbLpfORE3PL+zZyUhCdkwPCOEQilq6QG+KaW8o/homZRZ1RNQoCTOZITXZbtbo2sziqE9GwPL5/PZkvMnVEvsecjs8vaO+RX7JX3e3nl/FiPe42Q9g982TlV7HZbDbbLn0DFxtvHuIgPB0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-9914-0713","institution":"Cardiff University School of Biosciences, Organisms and Environment Division","correspondingAuthor":true,"prefix":"","firstName":"Ivo","middleName":"","lastName":"Colmonero-Costeira","suffix":""},{"id":372947218,"identity":"47fb50f3-e435-450b-a205-5f3acd5368dd","order_by":1,"name":"Mamadú Lamine Djaló","email":"","orcid":"","institution":"Aldeia de Abu, Ganogo, Guinea-Bissau","correspondingAuthor":false,"prefix":"","firstName":"Mamadú","middleName":"Lamine","lastName":"Djaló","suffix":""},{"id":372947219,"identity":"e9cde8e8-7078-45e5-bb26-09342f8fd8ce","order_by":2,"name":"Nelson Fernandes","email":"","orcid":"","institution":"Aldeia de Anghôr, Orango, Guinea-Bissau","correspondingAuthor":false,"prefix":"","firstName":"Nelson","middleName":"","lastName":"Fernandes","suffix":""},{"id":372947220,"identity":"3cd8b361-5814-4ce6-9118-ee70ce24145c","order_by":3,"name":"Filipa Borges","email":"","orcid":"https://orcid.org/0000-0002-1405-2341","institution":"CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos","correspondingAuthor":false,"prefix":"","firstName":"Filipa","middleName":"","lastName":"Borges","suffix":""},{"id":372947221,"identity":"62532e39-3207-4a28-8079-ec5fe49fb3b2","order_by":4,"name":"Isa Aleixo-Pais","email":"","orcid":"https://orcid.org/0000-0003-2730-3688","institution":"Cardiff University School of Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Isa","middleName":"","lastName":"Aleixo-Pais","suffix":""},{"id":372947222,"identity":"f6281abf-ec9f-42d0-a030-f2ce240fd1c6","order_by":5,"name":"Federica Gerini","email":"","orcid":"","institution":"CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos","correspondingAuthor":false,"prefix":"","firstName":"Federica","middleName":"","lastName":"Gerini","suffix":""},{"id":372947223,"identity":"f7b261b2-29d2-4388-95cd-57d84066ca7d","order_by":6,"name":"Mafalda Costa","email":"","orcid":"https://orcid.org/0000-0003-1329-8929","institution":"Cardiff University School of Biosciences","correspondingAuthor":false,"prefix":"","firstName":"Mafalda","middleName":"","lastName":"Costa","suffix":""},{"id":372947224,"identity":"07d7b3a1-2643-42e1-98ac-930e7e68623d","order_by":7,"name":"Tania Minhós","email":"","orcid":"https://orcid.org/0000-0003-0183-1343","institution":"Centre for Research in Anthropology (CRIA-NOVA FCSH/IN2PAST","correspondingAuthor":false,"prefix":"","firstName":"Tania","middleName":"","lastName":"Minhós","suffix":""},{"id":372947225,"identity":"c292d1e8-fae0-48a3-a613-f99fd6995d12","order_by":8,"name":"Maria Joana Ferreira da Silva","email":"","orcid":"https://orcid.org/0000-0001-6747-9827","institution":"CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Joana Ferreira da","lastName":"Silva","suffix":""}],"badges":[],"createdAt":"2024-11-01 10:10:31","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-5372533/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5372533/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10764-025-00496-0","type":"published","date":"2025-06-04T00:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68145289,"identity":"1f97bcbe-7ce4-4a39-87df-7ea624c3f073","added_by":"auto","created_at":"2024-11-04 05:58:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2950905,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-5372533/v1/0b81ce07590d82e574f96253.png"},{"id":68145291,"identity":"44a37e4a-8328-4d03-9f66-fc8825325dc1","added_by":"auto","created_at":"2024-11-04 05:58:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":394343,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-5372533/v1/85f7ae25138e3101ff720552.png"},{"id":68145290,"identity":"a2bc460f-2523-4b81-a4c5-f9b9a1278cda","added_by":"auto","created_at":"2024-11-04 05:58:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":444428,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-5372533/v1/d9c412178201d34acd9da271.png"},{"id":68145288,"identity":"ecf7460e-bb2a-42d3-aeaa-6403d97721fa","added_by":"auto","created_at":"2024-11-04 05:58:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":500166,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-5372533/v1/18cc462bdab43aca95eb2148.png"},{"id":84576705,"identity":"c302e8e7-3b48-45b5-b77e-89a048018986","added_by":"auto","created_at":"2025-06-13 16:57:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5894123,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5372533/v1/f3d07ed0-5007-47bb-b277-34f20f9ab675.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003eImproving baseline information on over-looked generalists: occurrence and mitochondrial DNA diversity of Campbell’s (\u003cem\u003eCercopithecus campbelli\u003c/em\u003e) and green monkeys (\u003cem\u003eChlorocebus sabaeus\u003c/em\u003e) in Guinea-Bissau, West Africa\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOver half of mainland African non-human primates (hereafter primates) are threatened with extinction, and more than 80% have a declining population trend (Estrada et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Considering the scale of the conservation crisis and the urgency to mitigate species extinction, primates classified as Least Concern and Near Threatened by the International Union for Conservation of Nature (IUCN) are usually overlooked in global conservation efforts (Fern\u0026aacute;ndez et al. 2022) REF). Primates not classified as threatened by IUCN frequently occupy large ranges, have broad fewer dietary requirements, and have smaller body size (Fern\u0026aacute;ndez et al. 2022) and have and are thought to be at lower risk of extinction than threatened species. However, populations of globally non-endangered primates non-threatened primates can undergo local extirpation, particularly if the interplay of several threats undermines their resilience (e.g., Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenetic data is increasingly used in conservation management and policies to delimitate conservation units, such as differentiated populations, or to describe the patterns of connectivity, hybridization processes, and assess historical population size (Hoban et al 2022). Moreover, estimates of genetic diversity are key to evaluate the ability of populations to persist in the face of environmental changes and is a crucial parameter to inform planning of conservation actions (Ferreira da Silva \u0026amp; Bruford, 2017; Bertola et al 2024). For elusive illusive species with unknown occurrence, genetic data can be obtained from non-invasive samples collected across variable geographic scales; mitochondrial DNA genes can be applied as genetic markers to a large number of opportunistically-collected samples with relative ease when compared to other more informative markers that require higher host DNA quantity and quality (Bertola et al 2024; e.g., Colmonero-Costeira et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ferreira da Silva et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The characterization of mitochondrial genetic diversity and differentiation (e.g., spatial structuring and estimation of divergence times) across all the extant primate species is recognized as important for the future prioritization of areas of conservation interest (Carvalho et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Nevertheless, the incorporation of molecular data in management plans remain challenging particularly for locally threatened species distributed in low to middle-income countries, where infrastructures, financial and human resources are scarce to conduct such studies (Bertola et al 2024, Helmy et al 2016, e.g., Ferreira da Silva et al in review). Here, we aimed to update the information on the distribution of two IUCN Least Concern and Near Threatened generalists primates and to provide the first assessment of their mitochondrial diversity and structure in a low-income West African country, aiming to advance the current knowledge and conservation planning actions.\u003c/p\u003e \u003cp\u003eCampbell\u0026rsquo;s monkey (\u003cem\u003eCercopithecus campbelli\u003c/em\u003e, Waterhouse, 1838) and the green monkey (\u003cem\u003eChlorocebus sabaeus\u003c/em\u003e, Linnaeus, 1766) are medium-sized African primates that have wide distributions across West Africa (Fig.\u0026nbsp;1). \u003cem\u003eC. campbelli\u003c/em\u003e is present from The Gambia to C\u0026ocirc;te D\u0026rsquo;Ivoire (Matsuda Goodwin et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) (Fig.\u0026nbsp;1). \u003cem\u003eChl. sabaeus\u003c/em\u003e is distributed across a larger area, including Mauritania, Mali, Burkina Faso, and Ghana (Gonedel\u0026eacute; Bi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and shows high phenotypic variability (Turner et al., \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) (Fig.\u0026nbsp;1). Both species are considered generalists in dietary requirements and inhabit a wide range of landscapes (Rowe \u0026amp; Myers, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The two species differ in group composition and dispersal patterns. \u003cem\u003eC. campbelli\u003c/em\u003e is organized in groups of one adult male and multiple females, in which males are the most frequent dispersing sex, and females are philopatric (Rowe \u0026amp; Myers, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Groups of \u003cem\u003eChl. sabaeus\u003c/em\u003e are formed of multiple males and females (Rowe \u0026amp; Myers, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and the social organization may be flexible and dependent on environmental factors (\u003cem\u003ee.g.\u003c/em\u003e, food availability, Galat \u0026amp; Galat-Luong \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1977\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the most recent IUCN conservation status assessment, \u003cem\u003eC. campbelli\u003c/em\u003e was classified as Near Threatened and \u003cem\u003eChl. sabaeus\u003c/em\u003e as Least Concern (Gonedel\u0026eacute; Bi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Matsuda Goodwin et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Both species are assumed to have a decreasing population trend due to habitat loss and hunting for wildmeat throughout their geographic ranges (Gonedel\u0026eacute; Bi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Matsuda Goodwin et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Little is known about the evolutionary history of \u003cem\u003eC. campbelli\u003c/em\u003e, which is the least studied guenon in the \u003cem\u003eCercopithecus mona\u003c/em\u003e group. In contrast, the \u003cem\u003eChlorocebus\u003c/em\u003e genus is a relatively well studied phylogeographical model for the evolution of wide-spread savannah species (Haus et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Warren et al., \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Dolotovskaya et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Svardal et al., \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Gagnon et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). However, population-level studies of the Westernmost species (\u003cem\u003eChl. sabaeus\u003c/em\u003e) are scarce (e.g., Almeida et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e Haus et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGuinea-Bissau (36,125 km\u003csup\u003e2\u003c/sup\u003e), a West African country bordered by Senegal and the Republic of Guinea, comprises one mainland region and the Bijag\u0026oacute;s archipelago. Ten primate species have been reported in the country (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Bersacola et al., 2018; Ferreira da Silva et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Most primate populations are threatened with habitat degradation/fragmentation and commercial hunting for meat, activities which are thought to have intensified in the last three decades (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003eb; Ferreira da Silva et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Minh\u0026oacute;s et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA lack of baseline information for most fauna, including primates, hinders effective conservation planning in the country (Ferreira da Silva et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Palma et al., 2023). Most of the surveys documenting the occurrence and the conservation status of local primates are twenty 20 years old (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) or have only considered species taxa with an IUCN Endangered status, such as the Western chimpanzee (Pan troglodytes verus,) and colobus monkeys (\u003cem\u003ePiliocolobus badius temminckii\u003c/em\u003e and \u003cem\u003eColobus polykomos\u003c/em\u003e, Casanova \u0026amp; Sousa, 2007). More recent information on primate occurrence may exist in non-digital repositories and unpublished reports but these are usually difficult to access. There is an urgent need to re-evaluate the local conservation status and elaborate produce action plans for species that were not considered threatened in the past but may have become impacted affected in the last three decades. Specifically, there is an important gap in baseline information on the national occurrence and genetic diversity of generalist primates, such as \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e, which limits the understanding of the degree of threat and thus decision-making regarding conservation efforts.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. campbelli\u003c/em\u003e (\u003cem\u003emona\u003c/em\u003e or \u003cem\u003ekankulma\u003c/em\u003e in Guinea-Bissau creole) and \u003cem\u003eChl. sabaeus\u003c/em\u003e (\u003cem\u003esantchu di tarrafi\u003c/em\u003e in Guinea-Bissau Creole) were widely distributed throughout the mainland territory, except in the northeast at least up to the last three decades (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). However, the occurrence of \u003cem\u003eC. campbelli\u003c/em\u003e is uncertain in the southeast of the country (the Bo\u0026eacute; sector). In the Bijag\u0026oacute;s archipelago, \u003cem\u003eChl. sabaeus\u003c/em\u003e is reported in Formosa, Orango, Bubaque, Rubane, Enu and Carache islands, and \u003cem\u003eC. campbelli\u003c/em\u003e in the Caravela island (Reiner \u0026amp; Sim\u0026otilde;es \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Campredon et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Gippoliti \u0026amp; Dell\u0026rsquo;Omo \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) (Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e are considered the most abundant primates in Guinea-Bissau (Gippoliti \u0026amp; Dell\u0026rsquo;Omo \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Karibuhoye, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Bersacola et al., 2018). Yet, a survey in two wildmeat markets in the capital city (Bissau) revealed that these two species were the most traded of all the primates, with approximately 500 specimens of each species sold during the dry season in 2010 (Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003eb). Consumption of \u003cem\u003eC. campbelli\u003c/em\u003e is also widespread in more rural locations (Ferreira da Silva et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Furthermore, the trade in primate infants as pets seems common for both species (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Karibuhoye, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), and may be a sub-product of the occasional hunting of lactating females (Ferreira da Silva et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Farmers from Southern Guinea-Bissau classify the species as two of the most impactful crop-foragers and commonly pursue and kill monkeys (Amador et al., 2015). Overall, these observations suggest that the two species are heavily hunted, populations may be under threat and that the species may have become rare or extinct in areas where they were previously recorded (\u003cem\u003ee.g.\u003c/em\u003e, by Gippoliti and Dell\u0026rsquo;Omo \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHere, we aimed to update the information on the distribution of \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e and to assess their mitochondrial diversity and structure at a country-wide scale. Between 2008 and 2022, we recorded direct and indirect geo-referenced presence data and collected non-invasive biological material for molecular analyses for the two species across a large area of Guinea-Bissau, which included the four parks in southern mainland Guinea-Bissau and eight of the largest islands of the Bijag\u0026oacute;s archipelago (Fig.\u0026nbsp;1). Our specific objectives were to i) compile geo-referenced visual and molecular records collected between 2008 and 2022 to confirm species occurrence and update information on the distribution, ii) estimate mitochondrial genetic diversity and population structure using a non-invasive mtDNA dataset for the two guenons, iii) reconstruct the phylogenetic relations of mtDNA haplotypes and estimate divergence times between lineages, and iv) identify themes for future research which would improve the national conservation strategy for these primates.\u003c/p\u003e"},{"header":"Methods","content":"\n\u003ch3\u003eStudy area\u003c/h3\u003e\n\u003cp\u003eThe study area encompasses most of the described range of \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e in Guinea-Bissau (Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) (Fig.\u0026nbsp;1): Cantanhez National Park, Cufada Lagoons Natural Park, Dulombi National Park, Bo\u0026eacute; National Park, and Bijag\u0026oacute;s archipelago. The sampling area lies across an ecological transition. In approximately 200 km, from the southwestern regions to the northeast part of the country, the vegetation changes from sub-humid and dry tropical forests to mosaics of dry tropical forest and savanna woodland (Catarino et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eData collection\u003c/h2\u003e \u003cp\u003eWe carried out surveys from 2015 to 2022 as part of the PRIMACTION project - \u003cem\u003eProtecting the Western chimpanzee and other primate species from illegal logging and hunting in Guinea-Bissau\u003c/em\u003e. Expeditions aimed to update non-human primate distributions across the country and collect information on species diversity, population structure, and gene flow patterns. We collected geo-referenced observations and biological material in Cufada Lagoons Natural Park (December 2015), Dulombi National Park (February 2016), and Bo\u0026eacute; National Park (January 2017), and in the largest islands of the Bijag\u0026oacute;s archipelago (Galinha, Canhabaque, Canogo, Orango, Uracane, Uno and Caravela, from March to September 2016, and Formosa in 2022) (Fig.\u0026nbsp;1). MJFS collected presence and genetic data from Cantanhez Forest National Park between 2008 and 2010 (Ferreira da Silva, 2012).\u003c/p\u003e \u003cp\u003eDuring expeditions and prior to fieldwork, we requested the help of local guards and villagers to identify areas frequently used by primates. We visited the primate\u0026rsquo;s drinking spots, sleeping sites and foraging areas in croplands, woodland savannah and gallery, mangrove, primary and secondary forests. When arriving at these locations, we attempted to observe groups or searched for indirect signs of the species\u0026rsquo; presence (footprints, vocalizations, and/or fecal samples). We remained at each location for a minimum of 30 minutes. We recorded the geographic coordinates of sites where we observed, heard, or photographed primates, and collected fecal samples, using a Geographic Positioning System (GPS) device. We collected fecal samples that were fresh and still holding structural integrity to the original form and that were more than 2 m apart in an attempt to prevent sampling the same individuals repeatedly. To preserve fecal DNA, we used RNAlater\u0026trade; (Invitrogen\u0026trade;, USA), 99% ethanol (Sigma-Aldrich, USA), or the \u0026ldquo;two-step\u0026rdquo; protocol (Roeder et al., 2004). We obtained tissue samples opportunistically from locally hunted individuals, which we preserved in 98% ethanol (Sigma-Aldrich, USA) at room temperature until DNA extraction. Samples were taken from carcasses that were found by chance during expeditions and were collected free of charge after obtaining informed consent of hunters/owners, to not encourage hunting.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA extraction\u003c/h3\u003e\n\u003cp\u003eWe exported samples to Portugal and processed them in CIBIO-InBIO (at Centro de Investiga\u0026ccedil;\u0026atilde;o em Biodiversidade e Recursos Gen\u0026eacute;ticos, \u003cem\u003eResearch Center for Biodiversity and Genetic Resources\u003c/em\u003e, Porto University, Portugal). We extracted total genomic DNA from feces using the QIAamp DNA Stool Mini Kit (Qiagen, Germany) with a few modifications from the manufacturer\u0026rsquo;s protocol to maximize DNA yield (Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). We took several precautions to avoid contamination from exogenous human DNA or cross-contamination between samples (Colmonero-Costeira et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Colmonero-Costeira, 2019). We extracted DNA from tissue samples using DNeasy Blood \u0026amp; Tissue Kit (Qiagen, Germany) following the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003ch3\u003eDNA amplification and sequencing\u003c/h3\u003e\n\u003cp\u003eWe used two fragments of mitochondrial DNA (mtDNA) to assign samples to the species level and estimate mitochondrial genetic diversity. We amplified the following mtDNA fragments by Polymerase Chain Reaction (PCR): 1) 402 base pairs (bp) of the \u003cem\u003ecytochrome b\u003c/em\u003e gene (\u003cem\u003ecytb\u003c/em\u003e) for both species using primers GVL14724, 5\u0026rsquo; GATATGAAAAACCATCGTTG 3\u0026rsquo; and, H15149, 5\u0026rsquo; CTCAGAATGATATTTGTCCTCA 3\u0026rsquo; (Gaubert et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e); and 2) 339 and 329 bp of the hypervariable region I (HVRI) for \u003cem\u003eChl. sabaeus\u003c/em\u003e and \u003cem\u003eC. campbelli\u003c/em\u003e respectively, using primers LCERCOHVRI \u0026minus;\u0026thinsp;5\u0026rsquo; CGTGCATTACTGCTAGCCAAC 3\u0026rsquo;, and HCERCOHVRI \u0026minus;\u0026thinsp;5\u0026rsquo; GGGATATTGATTTCACGGAGGA 3\u0026rsquo; (Colmonero-Costeira et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). PCRs had a total volume of 10 \u0026micro;L and included 1X MyTaq\u0026trade; Mix (Bioline, UK). \u003cem\u003eCytb\u003c/em\u003e amplifications contained 0.1 \u0026micro;M of each primer and 1 \u0026micro;L of DNA extract. HVRI amplifications contained 0.2 \u0026micro;M of each primer and 2 \u0026micro;L of DNA extract. \u003cem\u003eCytochrome b\u003c/em\u003e PCRs started with a Taq DNA polymerase activating step of 15 minutes at 94\u0026ordm;C followed by 35 cycles of denaturing at 92\u0026ordm;C for 30 seconds, annealing at 50\u0026ordm;C for 30 seconds, extension at 72\u0026ordm;C for 30 seconds, and a final extension step at 72 \u0026ordm;C for 15 minutes. Hypervariable Region I PCRs started with an activating step of 15 minutes at 95\u0026ordm;C followed by 40 cycles of denaturing at 94\u0026ordm;C for 30 seconds, annealing at 58\u0026ordm;C for 30 seconds, extension at 72\u0026ordm;C for 30 seconds, and final extension 72 \u0026ordm;C for 15 minutes. We conducted all the PCRs in a T100\u0026trade; 96 Well Thermal Cycler (Bio-Rad, USA). To limit DNA cross-contamination between samples and by exogenous DNA, we prepared PCRs in non-invasive DNA PCR preparation rooms. We tested amplification success by electrophoresis at 300V using 2% agarose gels stained with GelRed\u0026trade; (Biotium, USA) and visualized using a UV Gel Doc\u0026trade; XR\u0026thinsp;+\u0026thinsp;Gel Documentation System (Bio-Rad, USA) transilluminator. We purified PCR products using Exonuclease I and FastAP (1 U\u0026micro;L-1) (Thermo Fisher Scientific\u0026trade;, USA) and sequenced them using a 3130XL automated sequencer (Applied Biosystems\u0026trade;, USA) at CTM - Center for Molecular Testing, at CIBIO/ In-BIO, Portugal) facilities using BigDye\u0026trade; Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems\u0026trade;, USA).\u003c/p\u003e \u003cp\u003eWe confirmed the quality of forward and reverse sequences and the polymorphic positions visually using Geneious v4.8.5 (Kearse et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). We assigned samples to species using the Basic Local Alignment Search Tool (BLAST; Altschul et al., 1990) in the National Center for Biotechnology Information (NCBI) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e We aligned sequences of each fragment separately for each species using Geneious v4.8.5 automatic alignment option and trimmed the alignments to the length of the shortest sequence. We adopted procedures to control for the presence of NUMTs (Nuclear Mitochondrial DNA Segments i.e., unintended amplification of nuclear insertions of mitochondrial genes; Bensasson et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). We screened the chromatograms for double electrophoretic peaks and translated \u003cem\u003ecytb\u003c/em\u003e fragments to the aminoacidic sequences to identify the presence of multiple STOP codons (Bensasson et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). We took a conservative approach by removing all sequences showing double electrophoretic peaks from the final datasets.\u003c/p\u003e\n\u003ch3\u003eData analyses\u003c/h3\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMapping current occurrence of Cercopithecus campbelli and Chlorocebus sabaeus\u003c/h2\u003e \u003cp\u003eWe entered geo-referenced species records, such as observations, and molecular identifications of fecal samples into Geographic Information System software (QGIS v3.32). Because we could not observe most of the primate groups defecating, we grouped fecal samples located within a radius equal to estimates of each species\u0026rsquo; daily range (1,155 m for \u003cem\u003eC. campbelli\u003c/em\u003e and 11,000 m for \u003cem\u003eChl. sabaeus\u003c/em\u003e, Rowe \u0026amp; Myers, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) together in the same \u0026ldquo;geographically distinct location\u0026rdquo;. We overlaid our presence data on the distribution of the two species published by IUCN to identify differences from these distributions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEstimating mitochondrial genetic diversity and spatial structure\u003c/h2\u003e \u003cp\u003eWe computed summary mitochondrial genetic diversity statistics for \u003cem\u003ecytb\u003c/em\u003e and HVRI fragments separately, and for the concatenated alignment using DNAsp v6.12.03 (Rozas et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We estimated the number of haplotypes, haplotype diversity (Hd), nucleotide diversity (π) (Nei, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e1987\u003c/span\u003e), and respective standard deviations for the overall genetic dataset for each species and sampling area. We estimated haplotype richness following a rarefication approach to account for the different sample sizes and implemented in \u003cem\u003evegan\u003c/em\u003e v2.6-4 R package (Oksanen et al., 2022). We computed a 95% parsimony haplotype network for \u003cem\u003ecytb\u003c/em\u003e and HVRI fragments separately and for the concatenated alignment using Popart (Leigh \u0026amp; Bryant, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) to visualize genetic variation and explore the spatial distribution of the mtDNA haplotypes. To assess whether the observed genetic variation patterns for each species were consistent with a model of neutrally evolving locus under mutation-drift equilibrium we estimated Tajima\u0026rsquo;s D (Tajima, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e1989\u003c/span\u003e), Fu\u0026rsquo;s Fs (Fu, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1997\u003c/span\u003e), and Ramos-Onsins and Rozas\u0026rsquo; R\u003csub\u003e2\u003c/sub\u003e (Ramos-Onsins \u0026amp; Rozas, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2002\u003c/span\u003e) summary test statistics for the concatenated alignment using DNAsp v6.12.03 (Rozas et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). To account for the confounding effects caused by population structure on mutation-drift equilibrium summary test statistics (Moeller et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; St\u0026auml;dler et al., \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) we estimated these statistics for each differentiated haplogroup within each species.\u003c/p\u003e \u003cp\u003eWe tested for spatial structuring and isolation-by-distance by performing distance-based redundancy analyses (db-RDA; Legendre \u0026amp; Anderson, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e1999\u003c/span\u003e) and Mantel tests on the concatenated alignment of each species. Distance-based redundancy analysis combines an ordination method (multidimensional scaling) with multiple regressions of a trend-surface of the geographic coordinates of sampling locations (Legendre \u0026amp; Legendre, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). We generated nine geographic variables based on geographic coordinates (long, lat, long x lat, long\u003csup\u003e2\u003c/sup\u003e, lat\u003csup\u003e2\u003c/sup\u003e, long\u003csup\u003e2\u003c/sup\u003e x lat, long x lat\u003csup\u003e2\u003c/sup\u003e, long\u003csup\u003e3\u003c/sup\u003e, lat\u003csup\u003e3\u003c/sup\u003e). We used a forward selection procedure to avoid over-fitting the regression models. We used a significance level of 0.01 and the adjusted determination coefficient (R\u003csup\u003e2\u003c/sup\u003e) as stopping criteria (Blanchet et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Subsequently, we estimated the variance inflation factor (VIF) of the model and removed highly collinear variables (VIF\u0026thinsp;\u0026gt;\u0026thinsp;5) in a stepwise manner. We obtained the statistical significance of the multiple regression models and each of the resulting canonical axes (CAP) using ANOVA-like permutation tests (9,999 permutations). To obtain a visual representation of the main spatial structures, we interpolated the fitted site scores of the first significant canonical axis using the inverse distance weighting with power equal to two (more detailed information on the spatial methods and the list of R packages used can be found in Supplementary Material 1). We conducted statistical analysis in R v4.2.2 (R CoreTeam \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) coupled with RStudio v2023.06.2\u0026thinsp;+\u0026thinsp;561 (Posit team \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReconstructing the phylogeny and estimating divergence times between lineages\u003c/h3\u003e\n\u003cp\u003eWe concatenated fragments of \u003cem\u003ecytb\u003c/em\u003e and HVRI and collapsed sequences into unique haplotypes. We used sequences from \u003cem\u003eTheropithecus gelada\u003c/em\u003e, \u003cem\u003ePapio papio\u003c/em\u003e, \u003cem\u003ePapio ursinus\u003c/em\u003e, \u003cem\u003eMacaca mulatta\u003c/em\u003e, and \u003cem\u003eMacaca sylvanus\u003c/em\u003e retrieved from GenBank as outgroups (see Supplementary Material 2 for accession numbers). We corrected the final alignment visually and pruned indels and miss-aligned positions using Gb0.91b, allowing for smaller final blocks (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks\u003c/span\u003e\u003cspan address=\"http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e For phylogenetic tree reconstruction, we used 1) maximum likelihood (ML), implemented in IQ-Tree 1.5.2 (Nguyen et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Trifinopoulos et al., \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and 2) Bayesian inference, implemented in BEAST2 v2.6.1. (Bouckaert et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). We set concatenated partitions as - \u003cem\u003ecytb\u003c/em\u003e (1 to 344 bp) and HVRI (345 to 569 bp). To identify the best-fit model of molecular evolution, we used Model Finder (Kalyaanamoorthy et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) implemented in IQ-Tree and chose the best-fit model based on BIC. We selected the models TPM3u\u0026thinsp;+\u0026thinsp;I with empirical base frequencies for the \u003cem\u003ecytb\u003c/em\u003e and the HKY\u0026thinsp;+\u0026thinsp;G4 with empirical base frequencies for HVRI partitions. We estimated the statistical significance of ML trees reconstructed in IQ-Tree using 9,999 ultrafast bootstrap (BS) replicates (Hoang et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe used a Bayesian approach implemented in BEAST2 v2.6.1 to estimate the divergence time between mitochondrial haplogroups. We applied the best-fit model of molecular evolution to \u003cem\u003ecytb\u003c/em\u003e and HVRI partitions but assumed an uncorrelated relaxed lognormal clock model and Coalescent Constant Population tree prior model for both. To calibrate the molecular clock, we defined priors of the most recent common ancestor (MRCA) to the splits (1) Papionini and Cercopithecini, (2) Macacina and Papionina, (3) \u003cem\u003ePapio\u003c/em\u003e and \u003cem\u003eTheropithecus\u003c/em\u003e, and (4) African and Eurasian Macacina. We retrieved the prior distributions for constraints 1\u0026ndash;4 from the most conservative calibration set (set-2) described in Roos (2019). To calibrate the African and non-African Macacina MRCA, we used hard minimum bounds (based on the youngest possible age of the earliest known unambiguous member of a clade) and soft maximum bounds (based on the oldest possible age of the earliest known unambiguous member of the most closely related sister-taxon; Roos et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). We set the minimum bound of the MRCA constrain at 5.3 Ma., following the timing estimated for the earliest known exemplars of non-African \u003cem\u003eMacaca\u003c/em\u003e sp. in Spain (5.9\u0026ndash;5.3 Ma.; K\u0026ouml;hler et al., 2000) and Italy (5.4\u0026ndash;5.3 Ma.; Alba et al., 2014). We set the maximum bound at 7.4 Ma. using the timing of the earliest known members of Papionina (e.g., \u003cem\u003eParapapio lothagamensis\u003c/em\u003e in Lothagam, Kenya, 7.4-5.0 Ma.; Jablonski \u0026amp; Frost, 2010). We applied a gamma distribution with \u0026szlig; equal to 0.38 and an offset of 5.30, which placed the 95% Highest Posterior Density (HPD) interval at 5.39\u0026ndash;7.42 Ma. We conducted three 25\u0026nbsp;million generations-long independent runs. We sampled trees and parameters every 1,000 generations. We inspected the convergence of sampling parameters using Tracer (Rambaut et al., 2018) and assured 10% burn-in adequacy by effective sample size of all the parameters (ESS) larger than 200. We combined the outputs from independent runs using LogCombiner. We obtained the maximum clade credibility trees containing the node heights using TreeAnnotator after a burn-in of 10% of the sampled trees (Drummond \u0026amp; Rambaut, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). We visualized phylogenetic trees using FigTree v1.4.4 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tree.bio.ed.ac.uk/software/figtree/\u003c/span\u003e\u003cspan address=\"http://tree.bio.ed.ac.uk/software/figtree/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e\u003c/p\u003e\n\u003ch3\u003eEthical note\u003c/h3\u003e\n\u003cp\u003e The research complied with rules and protocols approved by Instituto para a Biodiversidade e \u0026Aacute;reas Protegidas (IBAP, Guinea-Bissau) and adhered to the legal requirements of Guinea-Bissau. We obtained all the fecal samples non-invasively from unidentified individuals without manipulation and minimal or perturbation of their daily behavior. We obtained six6 tissue samples opportunistically from dead animals in the hands of local hunters after informing of the purpose of the study and obtaining the informed consent of carcasses\u0026rsquo; owners. We maintained the identity of hunters and carcasses owners secret and did not denounce hunting activities to national authorities. We did not pay for these samples to prevent encouragement of hunting activities. Instituto para a Biodiversidade e \u0026Aacute;reas Protegidas (IBAP - \u003cem\u003eInstitute for Biodiversity and Protected Areas\u003c/em\u003e)BAP, local CITES focal person and Instituto para a Conserva\u0026ccedil;\u0026atilde;o da Natureza e Florestas Portugal (ICNF, \u003cem\u003eInstitute for Nature Conservation and Forests\u003c/em\u003e) authorized exportation and importation of fecal and tissue samples from Guinea-Bissau to Portugal (CITES permits N.\u0026deg; 18PTLX005901 and 18PTLX00586).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eDNA sequences produced in this study are deposited in the GenBank database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genbank/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e with accession numbers PP053763 \u0026ndash; PP053988. The geographic location of each sample used for spatially explicit analyses is available as supplementary material (Supplementary Material 2). The R scripts used in this work are deposited in GitHub (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/Colmonero-CI/Campbelli_sabaeus_GB2024\u003c/span\u003e\u003cspan address=\"https://github.com/Colmonero-CI/Campbelli_sabaeus_GB2024\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e).\u003c/span\u003e\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction, mtDNA amplification and sequencing\u003c/h2\u003e \u003cp\u003eOut of 371 fecal samples putatively collected from the species under study, we molecularly assigned 71 fecal samples to \u003cem\u003eC. campbelli\u003c/em\u003e and 76 to \u003cem\u003eChl. sabaeus\u003c/em\u003e, using at least one of the mtDNA fragments (\u003cem\u003ecytb\u003c/em\u003e or HVRI) (Fig.\u0026nbsp;1). Of the six tissue samples, two were assigned molecularly to \u003cem\u003eC. campbelli\u003c/em\u003e and four to \u003cem\u003eChl. sabaeus\u003c/em\u003e. Using BLAST, \u003cem\u003eC. campbelli cytb\u003c/em\u003e haplotypes showed 94.49\u0026ndash;98.84% identity to NCBI GenBank \u003cem\u003eC. campbelli\u003c/em\u003e sequences. Our \u003cem\u003eChl. sabaeus cytb\u003c/em\u003e haplotypes showed 99.13\u0026ndash;100.00% identity to NCBI GenBank \u003cem\u003eChl. sabaeus\u003c/em\u003e sequences.\u003c/p\u003e \u003cp\u003eWe successfully sequenced 54 samples of \u003cem\u003eC. campbelli\u003c/em\u003e (13 in Bijag\u0026oacute;s archipelago, six in Cufada Lagoons Natural Park, ten in Cantanhez Forest National Park, 13 in Dulombi National Park, and 12 in Bo\u0026eacute; National Park) and 59 samples of \u003cem\u003eChl. sabaeus\u003c/em\u003e (17 in Bijag\u0026oacute;s archipelago, seven in Cufada Lagoons Natural Park, two in Cantanhez Forest National Park, 14 in Dulombi National Park, and 19 in BNP) for both mtDNA fragments (\u003cem\u003ecytb\u003c/em\u003e and HVRI) (Fig.\u0026nbsp;2). After trimming the length to the shortest sequence, the final \u003cem\u003ecytb\u003c/em\u003e alignment was 345 bp long for both \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e and the final HVRI alignment was 295 bp long for \u003cem\u003eC. campbelli\u003c/em\u003e and 283 bp for \u003cem\u003eChl. sabaeus\u003c/em\u003e. We deposited mitochondrial DNA sequences in GenBank (accession numbers: PP053763 \u0026ndash; PP053988).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSpecies occurrence\u003c/h2\u003e \u003cp\u003eDuring our surveys in southern mainland Guinea-Bissau and the Bijag\u0026oacute;s archipelago between 2015 and 2022 we observed 7 groups of \u003cem\u003eC. campbelli\u003c/em\u003e and 18 groups of \u003cem\u003eChl. sabaeus\u003c/em\u003e (Fig.\u0026nbsp;1). We observed \u003cem\u003eC. campbelli\u003c/em\u003e groups in primary and secondary forests at Cufada Lagoons Natural Park (4 groups) and Dulombi National Park (3 groups). We observed \u003cem\u003eChl. sabaeus\u003c/em\u003e groups in mangroves, primary and secondary forests at Cufada Lagoons Natural Park (3 groups) and Dulombi National Park (3 groups), as well as woodland and herbaceous savanna habitats at BNP (12 groups).\u003c/p\u003e \u003cp\u003eWe collected the 71 fecal samples molecularly identified as being from \u003cem\u003eC. campbelli\u003c/em\u003e in 24 geographically distinct locations, four in Cufada Lagoons Natural Park, three in Cantanhez Forest National Park, ten in Dulombi National Park, four in BNP, and three in Caravela island (Fig.\u0026nbsp;1.). For \u003cem\u003eChl. sabaeus\u003c/em\u003e, we collected the 76 molecularly identified fecal samples in 11 geographically distinct locations, two in Cufada Lagoons Natural Park, two in Cantanhez Forest National Park, three in Dulombi National Park, three in Bo\u0026eacute; National Park, and one in Ganogo island (Fig.\u0026nbsp;1.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMitochondrial Genetic Diversity and Spatial Structure\u003c/h2\u003e \u003cp\u003eWe found 13 unique haplotypes and 53 polymorphic positions in the 640 bp-long concatenated dataset (N\u0026thinsp;=\u0026thinsp;54) for \u003cem\u003eC. campbelli\u003c/em\u003e, and 22 unique haplotypes and 75 polymorphic positions in a 628 bp long mtDNA concatenated dataset (N\u0026thinsp;=\u0026thinsp;59) for \u003cem\u003eChl. sabaeus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eEstimated levels of mitochondrial genetic diversity were high for both species (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Haplotype richness in \u003cem\u003eC. campbelli\u003c/em\u003e varied between 1 (in Bijag\u0026oacute;s archipelago) and 4.21 (in Dulombi National Park). Haplotype richness in \u003cem\u003eChl. sabaeus\u003c/em\u003e was similar between localities but was higher in Cufada Lagoons Natural Park and Dulombi National Park when compared to the other localities (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The \u003cem\u003eC. campbelli\u0026rsquo;s\u003c/em\u003e concatenated haplotype network suggests the existence of two divergent haplogroups distanced by 36 nucleotide substitutions (Fig.\u0026nbsp;2A). Haplogroup A is composed of 10 haplotypes in a star-shaped phylogeny, in which the most frequent haplotype is connected to the surrounding haplotypes by 1\u0026ndash;3 nucleotide substitutions. Haplogroup A was present at Bijag\u0026oacute;s archipelago, Cufada Lagoons Natural Park, Cantanhez Forest National Park, and Dulombi National Park. The most frequent haplotype was shared between Cufada Lagoons Natural Park, Dulombi National Park, and Bijag\u0026oacute;s archipelago. Haplogroup B, which we only sampled in BNP, was formed of three haplotypes, separated by a maximum of five nucleotide substitutions. For \u003cem\u003eChl. sabaeus\u003c/em\u003e, the concatenated haplotype network also suggests the existence of two divergent haplogroups, distanced by 10 nucleotide substitutions (Fig.\u0026nbsp;2B). Haplogroup A is formed of 10 haplotypes, sampled primarily on the insular and coastal regions (Bijag\u0026oacute;s archipelago, Cufada Lagoons Natural Park, and Cantanhez Forest National Park). Haplogroup B is formed of 12 haplotypes, seven sampled in Dulombi National Park and the rest in Bo\u0026eacute; National Park and Cufada Lagoons Natural Park. We did not find shared haplotypes between sampling locations. In both species, we retrieved haplogroups A and B for both mitochondrial markers independently (\u003cem\u003ecytb\u003c/em\u003e and HVRI, Supplementary Materials 3, Supplementary Fig.\u0026nbsp;1. and Fig.\u0026nbsp;2.). Only \u003cem\u003eC. campbelli\u003c/em\u003e haplogroup A was out of mutation-drift equilibrium (Fu\u0026rsquo;s Fs = -2.77, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Supplementary Materials 3, supplementary Table\u0026nbsp;1). The remaining mutation drift equilibrium test statistics, Tajima\u0026rsquo;s D, Ramos-Onsins and Rozas\u0026rsquo; R\u003csub\u003e2\u003c/sub\u003e and the raggedness index did not differ significantly from the expectations under a neutral evolution model with constant population size (Supplementary Materials 3, Supplementary Table\u0026nbsp;1).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMitochondrial genetic diversity of \u003cem\u003eCercopithecus campbelli\u003c/em\u003e and \u003cem\u003eChlorocebus. sabaeus\u003c/em\u003e across insular and Southern mainland Guinea-Bissau based on \u003cem\u003ecytb\u003c/em\u003e and HVRI mitochondrial DNA fragments.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"20\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c15\" colnum=\"15\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c16\" colnum=\"16\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c17\" colnum=\"17\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c18\" colnum=\"18\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c19\" colnum=\"19\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c20\" colnum=\"20\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSampling Area\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecytb\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c13\" namest=\"c9\"\u003e \u003cp\u003eHVRI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"6\" nameend=\"c20\" namest=\"c15\"\u003e \u003cp\u003econcatenated\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003enH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHd\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eπ x 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003enH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003eHr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c11\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c12\"\u003e \u003cp\u003eHd\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c13\"\u003e \u003cp\u003eπ x 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c14\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c15\"\u003e \u003cp\u003enH\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c16\"\u003e \u003cp\u003eHr\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c17\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c18\"\u003e \u003cp\u003eHd\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c19\"\u003e \u003cp\u003eπ x 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e(SD)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"20\" nameend=\"c20\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eC. campbelli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCLNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.73\u003c/p\u003e \u003cp\u003e(0.16)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.30\u003c/p\u003e \u003cp\u003e(0.08)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e2.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.33\u003c/p\u003e \u003cp\u003e(0.21)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003cp\u003e(0.07)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003cp\u003e(0.01)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.04\u003c/p\u003e \u003cp\u003e(0.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003cp\u003e(0.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.42\u003c/p\u003e \u003cp\u003e(0.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003cp\u003e(0.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.22\u003c/p\u003e \u003cp\u003e(0.14)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003cp\u003e(0.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.17\u003c/p\u003e \u003cp\u003e(0.01)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e3.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003cp\u003e(0.07)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.53\u003c/p\u003e \u003cp\u003e(0.06)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e4.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.86\u003c/p\u003e \u003cp\u003e(0.06)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.32\u003c/p\u003e \u003cp\u003e(0.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e2.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.41\u003c/p\u003e \u003cp\u003e(0.15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.75\u003c/p\u003e \u003cp\u003e(0.32)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e2.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.44\u003c/p\u003e \u003cp\u003e(0.25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.38\u003c/p\u003e \u003cp\u003e(0.15)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOverall\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.54\u003c/p\u003e \u003cp\u003e(0.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003cp\u003e(0.10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003cp\u003e(0.04)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e4.69\u003c/p\u003e \u003cp\u003e(0.70)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.83\u003c/p\u003e \u003cp\u003e(0.04)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e2.48\u003c/p\u003e \u003cp\u003e(0.40)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"20\" nameend=\"c20\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eChl. sabaeus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.65\u003c/p\u003e \u003cp\u003e(0.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.56\u003c/p\u003e \u003cp\u003e(0.20)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.63\u003c/p\u003e \u003cp\u003e(0.08)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e0.26\u003c/p\u003e \u003cp\u003e(0.10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCLNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003cp\u003e(0.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003cp\u003e(0.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.95\u003c/p\u003e \u003cp\u003e(0.10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e5.89\u003c/p\u003e \u003cp\u003e(1.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.95\u003c/p\u003e \u003cp\u003e(0.10)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e2.79\u003c/p\u003e \u003cp\u003e(0.56)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.43\u003c/p\u003e \u003cp\u003e(0.13)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003cp\u003e(0.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003cp\u003e(0.07)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e3.68\u003c/p\u003e \u003cp\u003e(0.80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.85\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.85\u003c/p\u003e \u003cp\u003e(0.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e1.87\u003c/p\u003e \u003cp\u003e(0.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBNP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.61\u003c/p\u003e \u003cp\u003e(0.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.58\u003c/p\u003e \u003cp\u003e(0.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.55\u003c/p\u003e \u003cp\u003e(0.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e4.22\u003c/p\u003e \u003cp\u003e(0.87)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e1.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.52\u003c/p\u003e \u003cp\u003e(0.12)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e2.05\u003c/p\u003e \u003cp\u003e(0.48)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOverall\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.73\u003c/p\u003e \u003cp\u003e(0.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.49\u003c/p\u003e \u003cp\u003e(0.07)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003cp\u003e(0.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e5.12\u003c/p\u003e \u003cp\u003e(0.31)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c15\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c16\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c17\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c18\"\u003e \u003cp\u003e0.91\u003c/p\u003e \u003cp\u003e(0.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c19\"\u003e \u003cp\u003e2.59\u003c/p\u003e \u003cp\u003e(0.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c20\" namest=\"c20\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"20\" nameend=\"c20\" namest=\"c1\"\u003e \u003cp\u003eNumber of samples (N); number of haplotypes (nH); number of polymorphic positions (S); haplotype diversity (Hd); haplotype richness (Hr) nucleotide diversity (π). Standard deviations are presented in brackets. \u003csup\u003ea\u003c/sup\u003e Only samples where both mitochondrial fragments were successfully amplified were included in the concatenated dataset.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe trend-surface analysis revealed a significant signal of geographically induced genetic differentiation, with sampling sites explaining 98.9% of \u003cem\u003eC. campbelli\u003c/em\u003e mitochondrial differentiation (adjusted R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.99; pseudo-F\u0026thinsp;=\u0026thinsp;649.88, df\u0026thinsp;=\u0026thinsp;5, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The fitted site scores from the first significant Canonical Axis explained 99.40% of the constrained variation. After extrapolation, we found a steep gradient of genetic variation from BNP towards the remaining sampling regions (Fig.\u0026nbsp;3A). When we removed highly divergent haplotypes sampled in Bo\u0026eacute; National Park for \u003cem\u003eC. campbelli\u003c/em\u003e, the variance explained by spatial locations of sites was still significant but decreased to 40.06% (adjusted R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.39; pseudo-F\u0026thinsp;=\u0026thinsp;18.56, df\u0026thinsp;=\u0026thinsp;1, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). The extrapolated CAP1 fitted site scores (100% of the constrained variation) showed a spatial gradient of genetic variation from Dulombi National Park towards the Cantanhez Forest National Park (Fig.\u0026nbsp;3A, 3B). Sampling locations explained 38.55% of \u003cem\u003eChl. sabaeus\u003c/em\u003e mitochondrial differentiation (adjusted R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.37; pseudo-F\u0026thinsp;=\u0026thinsp;11.29, df\u0026thinsp;=\u0026thinsp;3, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). We found a spatial gradient from Dulombi National Park towards the remaining sampling regions (Fig.\u0026nbsp;3C) based on the extrapolated CAP1 fitted site scores (80.41% of the constrained variation). A significant correlation between genetic and geographic distances was evident in Mantel tests for the overall \u003cem\u003eC. campbelli\u003c/em\u003e dataset (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) but not for the \u003cem\u003eC. campbelli\u003c/em\u003e \u0026empty; Bo\u0026eacute; National Park partial dataset (p\u0026thinsp;=\u0026thinsp;0.18). Genetic and geographic distances were also significantly correlated for \u003cem\u003eChl. sabaeus\u003c/em\u003e (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic reconstruction and lineage divergence time\u003c/h2\u003e \u003cp\u003eThe tree topology in \u003cem\u003eC. campbelli\u003c/em\u003e is characterized by two divergent haplogroups corresponding to those retrieved in the haplotype network (Fig.\u0026nbsp;4). Monophyly was supported for both haplogroups (PP\u0026thinsp;\u0026gt;\u0026thinsp;0.99; Fig.\u0026nbsp;4). Haplogroups A and B were estimated to have diverged approximately 1.53 Mya [2.56\u0026ndash;0.65 Mya, 95% highest posterior density (HPD)]. We found a similar result for \u003cem\u003eChl. sabaeus\u003c/em\u003e, for which we identified two divergent haplogroups in the tree (PP\u0026thinsp;\u0026gt;\u0026thinsp;0.96; Fig.\u0026nbsp;4). Haplogroups A and B were estimated to have diverged approximately 1.16 Mya (1.83\u0026ndash;0.67 Mya 95% HPD). The split between \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e was estimated as 10.51\u0026ndash;3.63 Mya (95% HPD) and the split between the two species and the outgroups at 13.18\u0026ndash;7.43 Mya (95% HPD).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study gathered recent baseline information (2008\u0026ndash;2022) on \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e populations distributed in southern mainland Guinea-Bissau and the Bijag\u0026oacute;s archipelago. Our work gathered evidence for a wider distribution of \u003cem\u003eC. campbelli\u003c/em\u003e and broader habitat use for \u003cem\u003eChl. sabaeus\u003c/em\u003e in Guinea-Bissau. Our results suggest relatively high mtDNA genetic diversity for the two species in the mainland and lower genetic diversity in the insular populations. Moreover, our work suggests that variables other than geographic distances contributed to shape the contemporary and historical mtDNA genetic structure across Guinea-Bissau.\u003c/p\u003e \u003cp\u003eWe recorded the presence of the two species in areas with previously known occurrences (e.g., Gippoliti \u0026amp; Dell\u0026rsquo;Omo, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Moreover, we gather molecular and visual evidence for the occurrence of \u003cem\u003eC. campbelli\u003c/em\u003e in the Bo\u0026eacute; National Park. This area is outside the distribution polygon of the most recent IUCN species assessment. Our results also suggests that \u003cem\u003eChl. sabaeus\u003c/em\u003e uses a large diversity of habitats in Guinea-Bissau, namely mangroves, primary forest, and patchy woodland savanna habitats. Similarly, past studies Bersacola \u003cem\u003eet al.\u003c/em\u003e (2018) recorded green monkey individuals in Dulombi National ParkDNP using grassland, woodland savannah, and cashew orchards (\u003cem\u003eAnacardium occidentale\u003c/em\u003e) habitats (Bersacola \u003cem\u003eet al.\u003c/em\u003e 2018). These records do not support the common narrow association of \u003cem\u003eChl. sabaeus\u003c/em\u003e green monkeys to mangrove forests in the country (Gippoliti \u0026amp; Dell\u0026rsquo;Omo \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Gippoliti \u0026amp; Dell\u0026rsquo;Omo \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe found relatively high mtDNA genetic diversity for the two species in mainland sampling sites. These high levels of mitochondrial genetic are consistent with patterns found for other co-occurring primates in the same region (\u003cem\u003ee.g., Papio papio\u003c/em\u003e: HVRI Hd\u0026thinsp;=\u0026thinsp;0.81, π\u0026thinsp;=\u0026thinsp;1.30 x10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and \u003cem\u003ePan troglodytes verus\u003c/em\u003e, HVRI Hd\u0026thinsp;=\u0026thinsp;0.94, π\u0026thinsp;=\u0026thinsp;3.70 x10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, Borges, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). A significant and negative Fu\u0026rsquo;s Fs in \u003cem\u003eC. campbelli\u003c/em\u003e haplogroup A could be interpreted as historical population expansion in the country (Fu \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Although we found similar levels of mitochondrial genetic diversity between the regions we sampled in the mainland, insular populations of both species showed the lowest mtDNA diversity. This is particularly evident for the insular \u003cem\u003eC. campbelli\u003c/em\u003e population in Caravela island, where we found a single haplotype in 13 samples. Low genetic diversity is frequent in insular/translocated populations and often arises from the founding effect associated with a colonization process mediated by a small number of individuals and subsequent loss of genetic diversity by genetic drift (Eales et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Freeland, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Allendorf et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, the specific processes of the colonization of the Bijag\u0026oacute;s archipelago by mammals, primates included, are yet to be investigated. Our results suggest close genetic proximity between the insular and mainland coastal populations for the two species. The single haplotype sampled for \u003cem\u003eC. campbelli\u003c/em\u003e at Caravela island is indistinguishable from the most frequent haplotype in Cufada Lagoons Natural Park, suggesting that the insular populations originate from Cufada or surrounding coastal regions. We sampled multiple closely related and private haplotypes for \u003cem\u003eChl. sabaeus\u003c/em\u003e in the Bijag\u0026oacute;s archipelago, which suggests a more complex and/or possibly older colonization process than \u003cem\u003eC. campbelli\u003c/em\u003e (Hayaishi \u0026amp; Kawamoto, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur estimations of mitochondrial spatial structure on the mainland for \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e are compatible with an isolation-by-distance pattern. In this pattern, in which gene flow occurs mainly to nearby groups in a stepwise manner. The location of sampling sites explained approximately 40% of the total genetic differentiation for \u003cem\u003eC. campbelli\u003c/em\u003e (\u003cem\u003eC. campbelli\u003c/em\u003e \u0026empty; Bo\u0026eacute; National ParkBNP partial dataset) and for \u003cem\u003eChl. sabaeus\u003c/em\u003e, suggesting that variables other than geographic distances contributed to the contemporary and historical mtDNA structure. Considering the ecological features of Guinea-Bissau and the habitat requirements of \u003cem\u003eChl. sabaeus\u003c/em\u003e and \u003cem\u003eC. campbelli\u003c/em\u003e, spatial structuring may have been shaped by a variation of the habitat composition/ecotones (Casado et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and/or by insurmountable barriers, such as permanent water bodies (Telfer et al., \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). For \u003cem\u003eC. campbelli\u003c/em\u003e, divergent haplogroups seem to be geographically separated. This is expected in male-biased dispersal species, in which females remain philopatric in natal groups or their movement is very limited in space (Di Fiore et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In species with male-biased dispersal, mtDNA variation is expected to be strongly structured compared to nuclear or Y chromosome genetic markers, and demes may show reduced mtDNA haplotype diversity (Melnick \u0026amp; Hoelzer, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Di Fiore, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Our sampling strategy based on non-invasive fecal sample collection from unidentified individuals and mtDNA markers does not allow us to estimate male-specific gene flow. Nonetheless, descriptions of \u003cem\u003eC. campbelli\u003c/em\u003e in Tai Forest, C\u0026ocirc;te d\u0026rsquo;Ivoire suggest female philopatry. In Tai, groups are formed by of one adult male and multiple females. The groups\u0026rsquo; males were observed in agonistic interactions with immigrant males, to prevent their presence in the groups\u0026rsquo; home range (Buzzard \u0026amp; Eckardt \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). These behaviors suggest that males are the dispersing sex in this \u003cem\u003eC. campbelli\u003c/em\u003e population. Moreover, the spatial distribution of mtDNA variation for \u003cem\u003eC. campbelli\u003c/em\u003e suggests that both isolation-by-distance and potentially isolation-by-environment may have contributed to shaping historical female gene flow across sampling sites in the mainland. We found that the main axis of genetic variation was from coastal to interior regions of the country. \u003cem\u003eC. campbelli\u003c/em\u003e main axis of genetic variation coincides with an important ecological transition in southern Guinea-Bissau, in which the dominant vegetation changes from Guinea-Congolian sub-humid and dry forest in the coastal areas (Cufada Lagoon Natural Park and Cantanhez Forest National Park to open forest and savannah woodlands of Sudanese affinity in the western-most regions (Dulombi National Park and Bo\u0026eacute; National Park in only 200 km (Catarino et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). For \u003cem\u003eChl. sabaeus\u003c/em\u003e, the interpolated fitted site scores from distance-based redundancy analyses suggest limited female historical or contemporary gene flow between Dulombi National Park and the remaining sampling areas potentially due to the presence of the Corubal River. Although \u003cem\u003eChl. sabaeus\u003c/em\u003e can swim, this behavior seems to be restricted to small distances and shallow waters (Rowe \u0026amp; Myers, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) and they may not be able to traverse the Corubal River near Cufada Lagoons Natural Park since it can reach over 1 km in width. The two haplogroups found for \u003cem\u003eChl. sabaeus\u003c/em\u003e overlap in Cufada Lagoon Natural Park and Bo\u0026eacute; National Park (both located in the southern margin of the Corubal River) which suggests a degree of female historical or contemporary gene flow between these localities (Di Fiore, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; e.g., Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003ea; Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kopp et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This pattern is not unexpected since females have been described to disperse occasionally in \u003cem\u003eChl. sabaeus\u003c/em\u003e (Rowe \u0026amp; Myers \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). A similar pattern of mtDNA variation was found in two well-studied Cercopithecidae primate species with female-biased dispersal (\u003cem\u003ePapio papio\u003c/em\u003e and \u003cem\u003ePapio hamadryas\u003c/em\u003e) (Ferreira da Silva et al., 2013, Hapke et al., 2001, Kopp et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The association between mtDNA variation and the geographic location of demes is weak or non-existent (Kopp et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Our observations at a smaller scale in Guinea-Bissau in \u003cem\u003eChl. sabaeus\u003c/em\u003e are similar to the pattern of mtDNA variation in \u003cem\u003ePapio papio\u003c/em\u003e across its West African range, which is characterized by i) haplotype clusters not associated with the geographic origin of samples, and which are shared by many distant demes (in some cases, over 500 km), and ii) closely-located demes which harbor very divergent haplotypes (\u003cem\u003ee.g\u003c/em\u003e., 16 nucleotide substitutions between haplotypes all sampled in the Republic of Guinea (Kopp et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Another female-biased dispersal species in Guinea-Bissau, \u003cem\u003ePan troglodytes verus\u003c/em\u003e, shows a similar pattern of mtDNA variation in which Guinea-Bissau populations share haplotypes with populations at Nimba mountains, located over 800 km apart (S\u0026aacute; \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The patterns of mtDNA variation we observed for \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e in Guinea-Bissau likely represent a a generalized pattern although we only sampled protected areas within the country. The two species are the most hunted primates in Guinea-Bissau the country (Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003eb) and group densities are thought to be very low outside of the protected areas (MJFS, pers. obs.), even within ecological corridors where law enforcement is negligent ().\u003c/p\u003e \u003cp\u003eOur results suggest the presence of two significantly divergent haplogroups for \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e in Guinea-Bissau, with the estimated lineage divergence within the early Pleistocene (2.58\u0026ndash;0.77 Mya; Cohen et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and within the timeframe of intraspecific diversification events of many guenon species (1.9\u0026ndash;0.1 Mya 95% HPD; Guschanski et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The existence of genetically divergent haplogroups in a relatively small area, such as southern Guinea-Bissau, is unexpected but is in agreement to the pattern found for other species in Guinea-Bissau. Divergent mitochondrial haplotypes/haplogroups have been reported for \u003cem\u003eP. papio\u003c/em\u003e (Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e)d t. \u003cem\u003everus\u003c/em\u003e (S\u0026aacute;, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The spatial distribution of the mtDNA differentiation found in this work for \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e across these other primate species seems to follows the same axis of differentiation between coastal (Cufada Lagoons National Park and Cantanhez Forest National Park) and interior areas (Dulombi National Park and Bo\u0026eacute; National Park) as found across these other primate species. Similar mtDNA diversity levels, spatial structure, significant divergence between sampled haplogroups across the several of the country\u0026rsquo;s primate species could be related to the relatively central position of the country in distribution of species in West Africa (the center\u0026ndash;periphery hypothesis; Pironon et al., 2014). Alternatively, the Guinea-Bissau primates may have went through similar intra-species vicariant and demographic events that occurred thousands of generations in the past (Zinner et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Haus et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). For example, shifts in the main sub-Saharan biomes due to Pleistocene climatic fluctuations, often accompanied by recurring periods of population range retraction and re-colonisation, are usually considered to be a cause of phylogeographic patterns in West African primates (e.g. \u003cem\u003ePapio\u003c/em\u003e sp., Zinner et al., \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2009\u003c/span\u003e); \u003cem\u003eChlorocebus\u003c/em\u003e sp., Haus et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Dolotovskaya et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and other mammals (Bertola et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Guinea-Bissau is at the center of the Fouta Djallon-Casamance differentiation region (Oates et al., 2011). This region likely contained pockets of gallery forest which could have promoted the differentiation of genetic lineages that later came into contact in Guinea-Bissau after range re-expansion (Oates et al., 2011).\u003c/p\u003e \u003cp\u003eIt is difficult to contextualize the degree of mitochondrial genetic diversity and divergence of intra-specific haplogroups in Guinea-Bissau because of the lack of geo-referenced mtDNA data for other populations and incomplete assessment of the patterns of genetic variation for most West -African primates, particularly for arboreal guenons, \u003cem\u003eC. campbelli\u003c/em\u003e included. Our study is limited by the small size of the mitochondrial DNA fragments we amplified (628\u0026ndash;640 bp concatenated size) which results in large 95% HPD intervals for the estimated divergence times between the haplogroups sampled. Nevertheless, the estimated 95% HPD intervals across our estimated phylogeny are within the divergence timeframes estimated using complete mitochondrial genomes (Guschanski et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Jensen et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eImplications for local primate conservation and future perspectives\u003c/p\u003e \u003cp\u003eBroad-scale and short-fragment mtmitochondrial DNA databases based on non-invasive sampling for multiple populations of co-distributed primates in West Africa contribute to improving the effectiveness of conservation actions. Among other factors, prioritizing conservation areas can be based on levels of inter and intraspecific genetic diversity (Carvalho et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Our results suggest that Guinea-Bissau harbors high mitochondrial genetic diversity and multiple mitochondrial lineages for many of the extant primate species, including \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e, and the country could be considered as an area of high conservation priority in West Africa.\u003c/p\u003e \u003cp\u003eNevertheless, using short mitochondrial fragments as genetic markers has limitations. The rate of evolution of the mitochondrial D-loop (humans, 2.4x10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e substitutions/site/year; Santos et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) falls short of what is required for assessing more recent and subtle changes in the genetic diversity and fine-scale patterns of population structure (Freeland, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which are expected to be related to the impacts of human activities during the last two to three primate generations. Further studies aiming to improve our understanding of the effects of the increasing recent anthropogenic impacts on these understudied primate populations should include genetic markers with higher evolution rates such as autosomal microsatellites (10x\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e \u0026ndash; 10x\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e mutations/locus/generation), or sequencing of polymorphic positions using NGS technologies (Freeland \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which coupled with sequencing of the whole mitochondrial genome would also provide a more accurate estimation of demographic parameters of conservation interest.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl. sabaeus\u003c/em\u003e were the most hunted and traded primates in urban wild meat markets and dedicated bars in 2010 and 2016 (Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003eb; Ferreira da Silva et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These observations inform the recent update of their global conservation status from Least Concern to Near Threatened (IUCN, 2023). However, the extent to which current hunting activities impacts populations of these two guenons is currently unknown, but are likely to resemble those proposed for other generalist primates that are hunted in Guinea Bissau. These impacts may entail i) shifts in habitat use and occupancy, ii) increased dispersal distances leading to secondary contact between divergent genetic lineages, iii) preferential movements towards areas where hunting is less frequent causing restriction of gene flow between populations, and iv) low genetic diversity and reduction of effective population sizes (Minh\u0026oacute;s et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2013\u003c/span\u003ea; Ferreira da Silva et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Minh\u0026oacute;s et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ferreira da Silva et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Minh\u0026oacute;s \u0026amp; Ferreira da Silva., 2020; Bersacola et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Minh\u0026oacute;s et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Furthermore, the insular populations of \u003cem\u003eC. campbelli\u003c/em\u003e and \u003cem\u003eChl sabaeus\u003c/em\u003e show the lowest levels of mtDNA genetic diversity in the country. Considering the ongoing high rate of habitat conversion into agricultural areas and wildmeat hunting on the islands, the long-term survival of insular primates could be threatened (Karibuhoye, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Colmonero-Costeira et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Further works should also clarify whether recent hunting or deforestation have severely decreased populations in areas previously reported as part of the species\u0026rsquo; national range but not sampled here, particularly in the northeast (e.g., Cacheu Mangroves Natural Park) and northwest parts of the country (Gippoliti \u0026amp; Dell\u0026rsquo;Omo \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), where surveys are urgent.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIUCN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInternational Union for Conservation of Nature\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIBAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInstituto para a Biodiversidade e \u0026Aacute;reas Protegidas\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCMNP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCacheu Mangroves Natural Park\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eUCMPA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eUrok Communitarian Marine Protected Area\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eONP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOrango National Park\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eJVPMNP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eJo\u0026atilde;o Vieira and Poil\u0026atilde;o Marine National Park\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003emtDNA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMitochondrial DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePolymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCytb\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCytochrome b gene\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHVRI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHypervariable region I of the mitochondrial D\u0026ndash;loop\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBLAST\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBasic Local Alignment Search Tool\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNCBI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNational Center for Biotechnology Information database\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNUMTs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNuclear mitochondrial DNA segments\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHd\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHaplotype diversity\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eΠ\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNucleotide diversity\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDb\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRDA\u0026ndash;Distance\u0026ndash;based redundancy analysis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVIF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVariance inflation factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCAP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCanonical axis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMRCA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMost recent common ancestor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eML\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMaximum likelihood\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBayesian posterior probabilities\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMaximum likelihood bootstrap\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eESS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eEffective sample size\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHPD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHighest Posterior Density\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIBD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIsolation by distance\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are very grateful to the Guinea-Bissau governmental agency Instituto de Biodiversidade e Áreas Protegidas (IBAP), particularly to the director Dr. Aissa Regalla and former director Dr. Justino Biai, and Dr. Abilio Said, Dr. Augusto Cá, Dr. Joãozinho Mané and Dr Dradjo Danfa for fieldwork and sampling permits and fieldwork logistics. We are grateful for the help and support of Abel Vieira, Iaia Cassama, Benjamin Indeque, Braima Bemba Canté. We would like to acknowledge the Direcção Geral de Florestas e Fauna (DGFF) and CITES focal person for sample exportation permits; the research assistants and guides Sadjo Camará, Mamadu Soares, Mamadu Turé, Idrissa Camará, and Bemba; the NGO CHIMBO and Tiniguena for logistical support during fieldwork in the Boé region and UROK islands, respectively. To I. Espinosa and H. Foito for logistical support in Bissau; We thank P. Huet, L. Palma, and F. Gerini for facilitating photographs. We thank C. Silva for translation of abstract to Guinea-Bissau Kriol. This work was funded by Fundação para a Ciência e Tecnologia project PRIMATOMICS (ref: PTDC/IVC-ANT/3058/2014) and by the Born Free Foundation, Chester Zoo Conservation Fund, Primate Conservation Incorporated, The Genetics Society, CAROSI, Cápsulas do Norte, Camarc, JA-Rolhas e Cápsulas. The work was partly funded by the project TROPIBIO NORTE-01-0145-FEDER-000046, supported by Norte Portugal Regional Operational Programme (NORTE2020), under the PORTUGAL 2020 Partnership Agreement, through the European Regional Development Fund (ERDF). MJFS worked under an FCT contract (https://doi.org/10.54499/CEECIND/01937/2017/CP1423/CT0010) and IAP, I.C.C., and F.B. were supported by FCT-doctoral fellowship (IAP: https://doi.org/10.54499/SFRH/BD/118444/2016; I.C.C.: https://doi.org/10.54499/SFRH/BD/146509/2019; FB: https://doi.org/10.54499/2020.05839.BD). Photographs by L. Palma were taken as part of the project CIBIO-BIOPOLIS/ECF-WCN project: Forest elephant conservation status in Guinea-Bissau.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMJFS, FG, IAP, MD and NF collected samples and presence data across Guinea-Bissau. IAP, FB, MC, FG and ICC conducted molecular work or contributed to obtaining genetic data. ICC performed data statistical analyses. MJFS and TM designed the study and contributed to\u0026nbsp;funding acquisition. All authors contributed to the writing of the original draft and to review \u0026amp; editing the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInclusion and Diversity statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work includes Bissau-Guinean authors who provided invaluable contributions to the sample design and collection.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAllendorf FW, Luikart G, Aitken SN (2013) Conservation and the Genetics of Populations, 2nd edn. John Wiley \u0026amp; Sons, Ltd. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jhered/esl039\u003c/span\u003e\u003cspan address=\"10.1093/jhered/esl039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmeida L, Colmonero-Costeira I, Silva MJFd, Veracini C, Vasconcelos R (2024) Insights into the Geographical Origins of the Cabo Verde Green Monkey. Genes 15:504. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes15040504\u003c/span\u003e\u003cspan address=\"10.3390/genes15040504\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBensasson D, Zhang DX, Hartl DL, Hewitt GM (2001) Mitochondrial pseudogenes: Evolution\u0026rsquo;s misplaced witnesses. In Trends in Ecology and Evolution (Vol. 16, Issue 6, pp. 314\u0026ndash;321). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0169-5347(01)02151-6\u003c/span\u003e\u003cspan address=\"10.1016/S0169-5347(01)02151-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBersacola E, Hill CM, Hockings KJ (2021) Chimpanzees balance resources and risk in an anthropogenic landscape of fear. Sci Rep 2021 11(1):1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-83852-3\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-83852-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertola LD, Jongbloed H, Van Der Gaag KJ, De Knijff P, Yamaguchi N, Hooghiemstra H, Bauer H, Henschel P, White PA, Driscoll CA, Tende T, Ottosson U, Saidu Y, Vrieling K, De Iongh HH (2016) Phylogeographic Patterns in Africa and High Resolution Delineation of Genetic Clades in the Lion (Panthera leo). Scientific Reports 2016 6:1, 6(1), 1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep30807\u003c/span\u003e\u003cspan address=\"10.1038/srep30807\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlanchet FG, Legendre P, Borcard D (2008) Forward selection of explanatory variables. Ecology 89(9):2623\u0026ndash;2632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1890/07-0986.1\u003c/span\u003e\u003cspan address=\"10.1890/07-0986.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorges F (2017) A country-level genetic survey of the IUCN critically endangered western chimpanzee (Pan troglodytes verus) in Guinea-Bissau [MSc Thesis]. University of Porto\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBouckaert R, Heled J, K\u0026uuml;hnert D, Vaughan T, Wu C-H, Xie D, Suchard MA, Rambaut A, Drummond AJ (2014) BEAST 2: A Software Platform for Bayesian Evolutionary Analysis. PLoS Comput Biol 10(4):e1003537. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pcbi.1003537\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1003537\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuzzard PJ, Eckardt W (2007) Social systems of the Ta\u0026iuml; guenons (Cercopithecus spp). In: Zuberb\u0026uuml;hler K, McGraw S, No\u0026euml; R (eds) Monkeys of the Ta\u0026iuml; Forest: An African Primate Community. Cambridge University Press. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/CBO9780511542121.003\u003c/span\u003e\u003cspan address=\"10.1017/CBO9780511542121.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampredon P, Cuq F, Giraudet E, Giraudet J, Goulemon F, Pennober G, Silva AS (2001) da. Un Syst\u0026egrave;me d\u0026Iacute;nformation G\u0026eacute;ographique pour l\u0026aacute;ide \u0026agrave; la gestion int\u0026eacute;gr\u0026eacute;e de l\u0026aacute;rchipel des Bijagos (Guin\u0026eacute;e-Bissau). Notice de la carte, constitution et exploitation du SIG. G\u0026eacute;osyst\u0026egrave;mes-CNRS. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://searchworks.stanford.edu/view/5320334\u003c/span\u003e\u003cspan address=\"https://searchworks.stanford.edu/view/5320334\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasado F, Bonvicino CR, Nagle C, Comas B, Manzur TD, Lahoz MM, Seu\u0026aacute;nez HN (2010) Mitochondrial divergence between 2 populations of the hooded capuchin, cebus (sapajus) cay (platyrrhini, primates). J Hered 101(3):261\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jhered/esp119\u003c/span\u003e\u003cspan address=\"10.1093/jhered/esp119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarvalho SB, Velo-Ant\u0026oacute;n G, Tarroso P, Portela AP, Barata M, Carranza S, Moritz C, Possingham HP (2017) Spatial conservation prioritization of biodiversity spanning the evolutionary continuum. Nat Ecol Evol 2017 1(6):1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41559-017-0151\u003c/span\u003e\u003cspan address=\"10.1038/s41559-017-0151\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCatarino L, Martins ES, Moreira I (2001) Influence of Environmental Features in the Phytogeographic Framework of Guinea-Bissau. Plant Systematics and Phytogeography for the Understanding of African Biodiversity, Proceedings of the XVIth AETFAT Congress, 71(2), 1079\u0026ndash;1086. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2307/3668740\u003c/span\u003e\u003cspan address=\"10.2307/3668740\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen KM, Finney SC, Gibbard PL, Fan J-X (2013) The ICS International Chronostratigraphic Chart 2020/01. Int Comm Stratigraphy 36:199\u0026ndash;204\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColmonero-Costeira I, Minh\u0026oacute;s T, Djal\u0026oacute; B, Fernandes N, da Ferreira M (2019) Confirma\u0026ccedil;\u0026atilde;o da ocorr\u0026ecirc;ncia de primatas n\u0026atilde;o-humanos no Arquip\u0026eacute;lago dos Bijag\u0026oacute;s com base em t\u0026eacute;cnicas de identifica\u0026ccedil;\u0026atilde;o molecular. Sintidus 2:145\u0026ndash;179\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColmonero-Costeira I, S\u0026aacute; RM, Djal\u0026oacute; ML, Cunha N, Cunha J, Minh\u0026oacute;s T, Russo I-RM, Bruford MW, Costa S, da Silva F, M. J (2023) Notes on the conservation threats to the western lesser spot-nosed monkey (Cercopithecus petaurista buettikoferi) in the Bijag\u0026oacute;s Archipelago (Guinea-Bissau, West Africa). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10329-023-01090-9\u003c/span\u003e\u003cspan address=\"10.1007/s10329-023-01090-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Primates\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Fiore A (2003) Molecular genetic approaches to the study of primate behavior, social organization, and reproduction. Am J Phys Anthropol 122(S37):62\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/AJPA.10382\u003c/span\u003e\u003cspan address=\"10.1002/AJPA.10382\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Fiore A, Link A, Schmitt CA, Spehar SN (2009) Dispersal patterns in sympatric woolly and spider monkeys: Integrating molecular and observational data. Behaviour 146(4\u0026ndash;5):437\u0026ndash;470. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1163/156853909X426345\u003c/span\u003e\u003cspan address=\"10.1163/156853909X426345\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7(1):1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2148-7-214\u003c/span\u003e\u003cspan address=\"10.1186/1471-2148-7-214\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDolotovskaya S, Bordallo JT, Haus T, Noll A, Hofreiter M, Zinner D, Roos C (2017) Comparing mitogenomic timetrees for two African savannah primate genera (Chlorocebus and Papio). Zool J Linn Soc 181(2):471\u0026ndash;483. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/ZOOLINNEAN/ZLX001\u003c/span\u003e\u003cspan address=\"10.1093/ZOOLINNEAN/ZLX001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEales J, Thorpe RS, Malhotra A (2010) Colonization history and genetic diversity: Adaptive potential in early stage invasions. Mol Ecol 19(14):2858\u0026ndash;2869. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-294X.2010.04710.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-294X.2010.04710.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEstrada A, Garber PA, Rylands AB, Roos C, Fernandez-Duque E, Di Fiore A, Nekaris KA-I, Nijman V, Heymann EW, Lambert JE, Rovero F, Barelli C, Setchell JM, Gillespie TR, Mittermeier RA, Arregoitia LV, de Guinea M, Gouveia S, Dobrovolski R, Li B (2017) Impending extinction crisis of the world\u0026rsquo;s primates: why primates matter. Sci Adv 3(1):e1600946. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/sciadv.1600946\u003c/span\u003e\u003cspan address=\"10.1126/sciadv.1600946\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira da Silva MJ, Camar\u0026aacute; M, Egeter B, Minh\u0026oacute;s T, Bruford MW, Godinho R (2021) Using meta-barcoding tools to monitor primate meat consumption at dedicated establishments in Guinea-Bissau, West Africa. ARPHA Conference Abstracts 4: E65575, 4, e65575-. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3897/ACA.4.E65575\u003c/span\u003e\u003cspan address=\"10.3897/ACA.4.E65575\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira da Silva MJ, Godinho R, Casanova C, Minh\u0026oacute;s T, S\u0026aacute; R, Bruford MW (2014) Assessing the impact of hunting pressure on population structure of Guinea baboons (Papio papio) in Guinea-Bissau. Conserv Genet 15(6):1339\u0026ndash;1355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10592-014-0621-0\u003c/span\u003e\u003cspan address=\"10.1007/s10592-014-0621-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira da Silva MJ, Kopp GH, Casanova C, Godinho R, Minh\u0026oacute;s T, S\u0026aacute; R, Zinner D, Bruford MW (2018) Disrupted dispersal and its genetic consequences: Comparing protected and threatened baboon populations (Papio papio) in West Africa. PLoS ONE 13(4):e0194189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0194189\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0194189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira da Silva MJ, Paddock C, Gerini F, Borges F, Aleixo-Pais I, Costa M, Colmonero-Costeira I, Casanova C, Lecoq M, Silva C, Bruford MW, Varanda J, Minh\u0026oacute;s T (2020) Chasing a ghost: notes on the present distribution and conservation of the sooty mangabey (Cercocebus atys) in Guinea-Bissau, West Africa. Primates 61(3):357\u0026ndash;363. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10329-020-00817-2\u003c/span\u003e\u003cspan address=\"10.1007/s10329-020-00817-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreeland JR (2020) Molecular Ecology, 3rd edn. John Wiley \u0026amp; Sons Ltd\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu YX (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147(2), 915\u0026ndash;925. https://doi.org/genetics.org//147/2/915\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGagnon CM, Svardal H, Jasinska AJ, Cramer D, Freimer J, Grobler NBP, Turner J, T. R., Schmitt CA (2022) Evidence of selection in the uncoupling protein 1 gene region suggests local adaptation to solar irradiance in savannah monkeys (Chlorocebus spp.). Proceedings of the Royal Society B, 289(1982). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1098/RSPB.2022.1254\u003c/span\u003e\u003cspan address=\"10.1098/RSPB.2022.1254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalat G, Galat-Luong A (1977) Demographie et regime alimentaire d\u0026rsquo;une troupe de Cercopithecus aethiops sabaeus en habitat marginal au nord Senegal. Terre Et La Vie 31(4):557\u0026ndash;577\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaubert P, Njiokou F, Olayemi A, Pagani P, Dufour S, Danquah E, Nutsuakor MEK, Ngua G, Missoup AD, Tedesco PA, Dernat R, Antunes A (2015) Bushmeat genetics: Setting up a reference framework for the DNA typing of African forest bushmeat. Mol Ecol Resour 15(3):633\u0026ndash;651. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1755-0998.12334\u003c/span\u003e\u003cspan address=\"10.1111/1755-0998.12334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGippoliti S, Dell\u0026rsquo;Omo G (1996) Primates of the Cantanhez Forest and the Cacine Basin, Guinea-Bissau. Oryx 30(1):74\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/s0030605300021414\u003c/span\u003e\u003cspan address=\"10.1017/s0030605300021414\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGippoliti S, Dell\u0026rsquo;Omo G (2003) Primates of Guinea-Bissau, West Africa: distribution and conservation status. Primate Conserv 19(19):73\u0026ndash;77\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonedel\u0026eacute; Bi S, Galat G, Galat-Luong A, Kon\u0026eacute; I, Osei D, Wallis J, Wiafe E, Zinner D (2020) Chlorocebus sabaeus. The IUCN Red List of Threatened Species, e.T136265A.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuschanski K, Krause J, Sawyer S, Valente LM, Bailey S, Finstermeier K, Sabin R, Gilissen E, Sonet G, Nagy ZT, Lenglet G, Mayer F, Savolainen V (2013) Next-generation museomics disentangles one of the largest primate radiations. Syst Biol 62(4):539\u0026ndash;554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/sysbio/syt018\u003c/span\u003e\u003cspan address=\"10.1093/sysbio/syt018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanson JO, Ver\u0026iacute;ssimo A, Velo-Ant\u0026oacute;n G, Marques A, Camacho-Sanchez M, Mart\u0026iacute;nez-Solano \u0026Iacute;, Gon\u0026ccedil;alves H, Sequeira F, Possingham HP, Carvalho SB (2021) Evaluating surrogates of genetic diversity for conservation planning. Conserv Biol 35(2):634\u0026ndash;642. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/COBI.13602\u003c/span\u003e\u003cspan address=\"10.1111/COBI.13602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaus T, Akom E, Agwanda B, Hofreiter M, Roos C, Zinner D (2013) Mitochondrial Diversity and Distribution of African Green Monkeys (Chlorocebus Gray, 1870). Am J Primatol 75(4):350\u0026ndash;360. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/AJP.22113\u003c/span\u003e\u003cspan address=\"10.1002/AJP.22113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayaishi S, Kawamoto Y (2006) Low genetic diversity and biased distribution of mitochondrial DNA haplotypes in the Japanese macaque (Macaca fuscata yakui) on Yakushima Island. Primates 47(2):158\u0026ndash;164. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10329-005-0169-1\u003c/span\u003e\u003cspan address=\"10.1007/s10329-005-0169-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Mol Biol Evol 35(2):518\u0026ndash;522. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msx281\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen A, Swift F, de Vries D, Beck RMD, Kuderna LFK, Knauf S, Chuma IS, Keyyu JD, Kitchener AC, Farh K, Rogers J, Marques-Bonet T, Detwiler KM, Roos C, Guschanski K (2023) Complex Evolutionary History With Extensive Ancestral Gene Flow in an African Primate Radiation. Mol Biol Evol 40(12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/MOLBEV/MSAD247\u003c/span\u003e\u003cspan address=\"10.1093/MOLBEV/MSAD247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat Methods 14(6):587\u0026ndash;589. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.4285\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.4285\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaribuhoye C (2004) Mammal Conservation status and Prospects for community-based wildlife management in coastal Guinea-Bissau, West Africa [PhD]. Georg-August-Universit\u0026auml;t G\u0026ouml;ttingen\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12):1647\u0026ndash;1649. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bts199\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bts199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKopp GH, Ferreira da Silva MJ, Fischer J, Brito JC, Regnaut S, Roos C, Zinner D (2014) The Influence of Social Systems on Patterns of Mitochondrial DNA Variation in Baboons. Int J Primatol 35(1):210\u0026ndash;225. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10764-013-9725-5\u003c/span\u003e\u003cspan address=\"10.1007/s10764-013-9725-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKopp GH, Fischer J, Patzelt A, Roos C, Zinner D (2015) Population genetic insights into the social organization of Guinea baboons (Papio papio): Evidence for female-biased dispersal. Am J Primatol 77(8):878\u0026ndash;889. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ajp.22415\u003c/span\u003e\u003cspan address=\"10.1002/ajp.22415\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegendre P, Anderson MJ (1999) Distance-based redundancy analysis: Testing multispecies responses in multifactorial ecological experiments. Ecol Monogr 69(1):1\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/b916289e\u003c/span\u003e\u003cspan address=\"10.1039/b916289e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegendre P, Legendre L (2012) Numerical Ecology, 3rd edn. Elsevier B.V.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeigh JW, Bryant D (2015) POPART: Full-feature software for haplotype network construction. Methods Ecol Evol 6(9):1110\u0026ndash;1116. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/2041-210X.12410\u003c/span\u003e\u003cspan address=\"10.1111/2041-210X.12410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatsuda Goodwin R, Gonedel\u0026eacute; Bi S, Kon\u0026eacute; I (2020) Cercopithecus campbelli. He IUCN Red List of Threatened Species. e.T136930A\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMelnick DJ, Hoelzer GA (1992) Differences in male and female macaque dispersal lead to contrasting distributions of nuclear and mitochondrial DNA variation. Int J Primatol 13(4):379\u0026ndash;393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02547824/METRICS\u003c/span\u003e\u003cspan address=\"10.1007/BF02547824/METRICS\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoeller DA, Tenaillon MI, Tiffin P (2007) Population Structure and Its Effects on Patterns of Nucleotide Polymorphism in Teosinte (Zea mays ssp. parviglumis). Genetics 176(3):1799\u0026ndash;1809. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/GENETICS.107.070631\u003c/span\u003e\u003cspan address=\"10.1534/GENETICS.107.070631\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh\u0026oacute;s T, Borges F, Parreira B, Oliveira R, Aleixo-Pais I, Leendertz FH, Wittig R, Fernandes CR, Silva M, Duarte GHL, Bruford M, Ferreira MW, da Silva MJ, Chikhi L (2023) The importance of well protected forests for the conservation genetics of West African colobine monkeys. Am J Primatol 85:e23453. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ajp.23453\u003c/span\u003e\u003cspan address=\"10.1002/ajp.23453\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh\u0026oacute;s T, Chikhi L, Sousa C, Vicente LM, Ferreira da Silva MJ, Heller R, Casanova C, Bruford MW (2016) Genetic consequences of human forest exploitation in two colobus monkeys in Guinea Bissau. Biol Conserv 194:194\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocon.2015.12.019\u003c/span\u003e\u003cspan address=\"10.1016/j.biocon.2015.12.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh\u0026oacute;s T, Fererira da Silva MJ (2020) Primate behavioral adaptations to anthropogenic habitats \u0026ndash; the case of Cantanhez National Park in Guinea-Bissau. In: Roque AC, Brito C, Veracini C (eds) Peoples, Nature and Environments: Learning to Live Together, 1st edn. Cambridge Scholars Publishing, pp 129\u0026ndash;144\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh\u0026oacute;s T, Nixon E, Sousa C, Vicente LM, Silva D, S\u0026aacute; MF, R. M., Bruford MW (2013) Genetic evidence for spatio-temporal changes in the dispersal patterns of two sympatric African colobine monkeys. Am J Phys Anthropol 150(3):464\u0026ndash;474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ajpa.22223\u003c/span\u003e\u003cspan address=\"10.1002/ajpa.22223\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinh\u0026oacute;s T, Wallace E, Ferreira da Silva MJ, S\u0026aacute; RM, Carmo M, Barata A, Bruford MW (2013) DNA identification of primate bushmeat from urban markets in Guinea-Bissau and its implications for conservation. Biol Conserv 167:43\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocon.2013.07.018\u003c/span\u003e\u003cspan address=\"10.1016/j.biocon.2013.07.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNei M (1987) Molecular Evolutionary Genetics. Columbia University Press. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7312/nei-92038\u003c/span\u003e\u003cspan address=\"10.7312/nei-92038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32(1):268\u0026ndash;274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msu300\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msu300\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOates JF (2011) Primates of West Africa: A Field Guide and Natural History. Conservation International\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePironon S, Villellas J, Morris WF, Doak DF, Garc\u0026iacute;a MB (2015) Do geographic, climatic or historical ranges differentiate the performance of central versus peripheral populations? Glob Ecol Biogeogr 24(6):611\u0026ndash;620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/GEB.12263\u003c/span\u003e\u003cspan address=\"10.1111/GEB.12263\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePosit team (2023) RStudio: Integrated Development for R. (v2023.06.2\u0026thinsp;+\u0026thinsp;561). Posit Software, PBC\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR CoreTeam (2022) R: A language and environment for statistical computing. (4.2.2). Foundation for Statistical Computing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.r-project.org\u003c/span\u003e\u003cspan address=\"https://www.r-project.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos-Onsins SE, Rozas J (2002) Statistical Properties of New Neutrality Tests Against Population Growth. Mol Biol Evol 19(12):2092\u0026ndash;2100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/oxfordjournals.molbev.a004034\u003c/span\u003e\u003cspan address=\"10.1093/oxfordjournals.molbev.a004034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiner F, Sim\u0026otilde;es P (1999) Mam\u0026iacute;feros Selvagens da Guin\u0026eacute; - Bissau. Projeto Delfim - Centro Portugu\u0026ecirc;s de Estudos dos Mam\u0026iacute;feros Marinhos\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoos C, Kothe M, Alba DM, Delson E, Zinner D (2019) The radiation of macaques out of Africa: Evidence from mitogenome divergence times and the fossil record. J Hum Evol 133:114\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/J.JHEVOL.2019.05.017\u003c/span\u003e\u003cspan address=\"10.1016/J.JHEVOL.2019.05.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRowe N, Myers M (2016) All the World\u0026rsquo;s Primates. Pogonias\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRozas J, Ferrer-Mata A, Sanchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sanchez-Gracia A (2017) Mol Biol Evol 34(12):3299\u0026ndash;3302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msx248\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. DnaSP 6: DNA sequence polymorphism analysis of large data sets\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos C, Montiel R, Sierra B, Bettencourt C, Fernandez E, Alvarez L, Lima M, Abade A, Aluja MP (2005) Understanding Differences Between Phylogenetic and Pedigree-Derived mtDNA Mutation Rate: A Model Using Families from the Azores Islands (Portugal). Mol Biol Evol 22(6):1490\u0026ndash;1505. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/MOLBEV/MSI141\u003c/span\u003e\u003cspan address=\"10.1093/MOLBEV/MSI141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS\u0026aacute; RM (2013) Phylogeography, conservation genetics and parasitology of chimpanzees (Pan troglodytes versus) in Guinea-Bissau. West Africa [PhD, Universidade Nova de Lisboa]\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSt\u0026auml;dler T, Haubold B, Merino C, Stephan W, Pfaffelhuber P (2009) The Impact of Sampling Schemes on the Site Frequency Spectrum in Nonequilibrium Subdivided Populations. Genetics 182(1):205\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/GENETICS.108.094904\u003c/span\u003e\u003cspan address=\"10.1534/GENETICS.108.094904\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvardal H, Jasinska AJ, Apetrei C, Coppola G, Huang Y, Schmitt CA, Jacquelin B, Ramensky V, M\u0026uuml;ller-Trutwin M, Antonio M, Weinstock G, Grobler JP, Dewar K, Wilson RK, Turner TR, Warren WC, Freimer NB, Nordborg M (2017) Ancient hybridization and strong adaptation to viruses across African vervet monkey populations. Nat Genet 2017 49(12):1705\u0026ndash;1713. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.3980\u003c/span\u003e\u003cspan address=\"10.1038/ng.3980\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123(3), 585\u0026ndash;595. https://doi.org/PMC1203831\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTelfer PT, Souqui\u0026egrave;re S, Clifford SL, Abernethy KA, Bruford MW, Disotell TR, Sterner KN, Roques P, Marx PA, Wickings EJ (2003) Molecular evidence for deep phylogenetic divergence in Mandrillus sphinx. Mol Ecol 12(7):2019\u0026ndash;2024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-294X.2003.01877.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-294X.2003.01877.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res 44(W1):W232\u0026ndash;W235. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/NAR/GKW256\u003c/span\u003e\u003cspan address=\"10.1093/NAR/GKW256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner TR, Schmitt CA, Cramer JD, Lorenz J, Grobler JP, Jolly CJ, Freimer NB (2018) Morphological variation in the genus Chlorocebus: Ecogeographic and anthropogenically mediated variation in body mass, postcranial morphology, and growth. Am J Phys Anthropol 166(3):682\u0026ndash;707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/AJPA.23459\u003c/span\u003e\u003cspan address=\"10.1002/AJPA.23459\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarren WC, Jasinska AJ, Garc\u0026iacute;a-P\u0026eacute;rez R, Svardal H, Tomlinson C, Rocchi M, Archidiacono N, Capozzi O, Minx P, Montague MJ, Kyung K, Hillier LDW, Kremitzki M, Graves T, Chiang C, Hughes J, Tran N, Huang Y, Ramensky V, Freimer NB (2015) The genome of the vervet (Chlorocebus aethiops sabaeus). Genome Res 25(12):1921\u0026ndash;1933. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/GR.192922.115\u003c/span\u003e\u003cspan address=\"10.1101/GR.192922.115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZinner D, Groeneveld LF, Keller C, Roos C (2009) Mitochondrial phylogeography of baboons (Papio spp.) Indication for introgressive hybridization? BMC Evol Biol 9(1):1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2148-9-83\u003c/span\u003e\u003cspan address=\"10.1186/1471-2148-9-83\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Guenon, Cercopithecini, widespread taxa, phylogenetic structure, sex-biased dispersal.","lastPublishedDoi":"10.21203/rs.3.rs-5372533/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5372533/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCampbell\u0026rsquo;s (\u003cem\u003eCercopithecus campbelli\u003c/em\u003e) and green monkeys (\u003cem\u003eChlorocebus sabaeus\u003c/em\u003e) are sympatric medium-sized West African guenons (tribe Cercopithecini) that are generally understudied in most of their distribution. Both species are ecological generalists and are globally considered non-threatened, but populations are decreasing locally. National conservation management lacks baseline information on local populations of primate species. \u003cem\u003eC. campbelli and Chl. sabaeus\u003c/em\u003e are considered the most abundant primates out of the ten extant species and are the most frequently hunted for meat consumption. Here, we aimed to update the occurrence and estimate the country-wide mitochondrial (mtDNA) genetic diversity for both species. From 2008 to 2022, we conducted surveys in four mainland protected areas and on the islands of the Bijag\u0026oacute;s archipelago where primates are known to occur. We identified \u003cem\u003eC. campbelli\u003c/em\u003e populations outside their known distribution. We found relatively high mtDNA diversity for both species in the mainland and lower or no diversity in insular populations. Our results show significant signals of geographically induced mtDNA differentiation, particularly in \u003cem\u003eC. campbelli\u003c/em\u003e, which pattern of population structure suggests female philopatry. In constrast, we found divergent \u003cem\u003eChl. sabaeus\u003c/em\u003e haplotypes at geographically close locations, suggesting female dispersal. We identified differentiated haplogroups with an estimated divergence time of 1.53 in \u003cem\u003eC. campbelli\u003c/em\u003e and 1.16 Ma in \u003cem\u003eChl. sabaeus\u003c/em\u003e, possibly linked to Pleistocene climatic fluctuations. Our results add further evidence that Guinea-Bissau harbors high genetic diversity for primate species and the country should be prioritized for conservation in West Africa.\u003c/p\u003e","manuscriptTitle":"Improving baseline information on over-looked generalists: occurrence and mitochondrial DNA diversity of Campbell’s (Cercopithecus campbelli) and green monkeys (Chlorocebus sabaeus) in Guinea-Bissau, West Africa","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-04 05:58:31","doi":"10.21203/rs.3.rs-5372533/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e38ba591-b1a5-4914-8ae9-35e7595d7650","owner":[],"postedDate":"November 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":39699854,"name":"Conservation Biology"},{"id":39699855,"name":"Population Genetics"}],"tags":[],"updatedAt":"2025-06-13T16:57:43+00:00","versionOfRecord":{"articleIdentity":"rs-5372533","link":"https://doi.org/10.1007/s10764-025-00496-0","journal":{"identity":"international-journal-of-primatology","isVorOnly":false,"title":"International Journal of Primatology"},"publishedOn":"2025-06-04 00:00:00","publishedOnDateReadable":"June 4th, 2025"},"versionCreatedAt":"2024-11-04 05:58:31","video":"","vorDoi":"10.1007/s10764-025-00496-0","vorDoiUrl":"https://doi.org/10.1007/s10764-025-00496-0","workflowStages":[]},"version":"v1","identity":"rs-5372533","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5372533","identity":"rs-5372533","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}