Control of CDH1 and IDH1mut glioblastoma cell cycle by D-2- hydroxyglutarate

Control of CDH1 and IDH1mut glioblastoma cell cycle by D-2- hydroxyglutarate | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Control of CDH1 and IDH1mut glioblastoma cell cycle by D-2- hydroxyglutarate Meng-Qi You, Wei Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4240423/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Glioblastoma (GBM) is a prevalent and lethal primary brain tumor. Patients with the IDH1 R132H (isocitrate dehydrogenase 1) mutation exhibit extended survival and aneuploidy, yet the underlying mechanisms are unclear. Here, we reveal that the accumulation of D-2-hydroxyglutarate (2-HG) produced by IDH1 R132H mutation induces the degradation of Fizzy-related protein1(FZR1 or CDH1) by inhibiting prolyl hydroxylase EGLN2 activity. CDH1 levels are stabilized by α-KG and oxygen, independent of HIF-1α, through EGLN2-mediated hydroxylation. This novel mechanism represents the first instance of prolyl hydroxylation stabilizing a protein. The 2-HG-EGLN2-CDH1 axis induces mitotic arrest and cell growth inhibition, potentially contributing to the extended survival observed in patients with IDH1 R132H mutant GBM. Isocitrate dehydrogenase 1 D-2-hydroxyglutarate CDH1 EGLN2 Oxygen Cell cycle Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Glioblastoma(GBM) is a heterogeneous primary brain tumor characterized by extensive cerebral invasion and premature death[1 , 2]. IDH1(Isocitrate dehydrogenase 1) is a crucial enzyme involved in redox reactions, DNA repair, and epigenetic regulation, primarily functioning in cytoplasm and peroxisomes. Over 85% of low-grade glioblastomas harbor an IDH1 heterozygous missense mutation from arginine to histidine (R132H)[ 3 ]. The mutant IDH1 acquires a new enzymatic function and can utilize NADPH in a reduction reaction to convert α-ketoglutarate (α-KG) to D-2-hydroxyglutarate (2-HG). The decrease in NADPH leads to a depletion of antioxidant glutathione content, which increases reactive oxygen species(ROS) in the glioblastoma cells due to compromised antioxidant defense mechanisms[ 4 ]. Patients with IDH1 R132H mutation have been shown to have a longer survival period, a tendency for a more positive response to certain chemotherapy regimens [ 5 ], and are associated with a generally better prognosis[ 6 – 8 ]. However, the mechanisms underlying IDH1 R132H glioblastoma development remain unclear. Critical for tumor progression and treatment resistance is the aberrant regulation of the cell cycle, which often occurs alongside the inherent genomic instability found in cancer cells. Aneuploidy, a hallmark present in nearly 90% of human cancers[ 9 ], is also observed in GBM patients with IDH1 R132H mutation, suggesting a potential link between 2-HG production by the IDH1 R132H mutation and cell cycle regulation. Fizzy-related protein homologs (CDH1) play a pivotal role in regulating mitotic exit and the G1/S transition[ 10 ]. CDH1 acts as a co-activator of Anaphase Promoting Complex/Cyclosome (APC/C), forming the APC/C CDH1 complex responsible for the degradation of various cell cycle regulators. 2-HG inhibits cellular differentiation[ 11 ] and α-KG-dependent dioxygenases, including the PHD family comprising EGLN1, EGLN2, and EGLN3. Under normoxia, these enzymes hydroxylate the alpha subunit of the hypoxia-inducible factor (HIF-1α), promoting its proteasomal degradation via VHL E3 ligase[ 12 ]. EGLN1 primarily regulates HIF[ 13 ], while the HIF-independent roles of EGLN2 and EGLN3 remain unclear, although some studies suggest that EGLN3 has an HIF-independent role in the modulation of apoptosis[14 , 15]. PHDs employ α-KG, ferrous iron(Fe2+), and oxygen as substrates to hydroxylate prolines, thereby regulating protein stability[ 16 ]. Oxygen is vital for cell cycle activity, and HIF-1α accumulation can disrupt normal cell cycle regulation, potentially contributing to tumorigenesis[ 17 ]. CDH1 deletions and reduced expression are common in various human tumor tissues[18 , 19] Additionally, hyperphosphorylation of CDH1 which attenuates APC/C CDH1 activity has been observed in GBM[19 , 20]. The ligase activity of APC/C CDH1 is further diminished in the G1 phase of the cell cycle in GBM, resulting in elevated levels of its substrates throughout the cell cycle[ 21 ]. Since CDH1 plays an important role in the cell cycle and GBM tumorigenesis, we ask whether 2-HG produced by IDH1 R132H and PHD family activity affects CDH1 activity. In the present study, we elucidate the presence of IDH1 R132H mutation and subsequent accumulation of 2-HG impact on the cell cycle dynamics by modulating the proteasomal degradation of the cell cycle regulator CDH1. Consequently, this disturbs the cell cycle, ultimately leading to the cell growth inhibition. Materials and methods Reagents and antibodies Chemical and reagents: 2-HG and AGI5198 were purchased from MedChemExpress. Thymidine, MG132, CoCl2`6H2O,α-KG, and Flag-Beads were purchased from Sigma. DMOG was purchased from Selleck. Annexin V-FITC/PI apoptosis analysis kit, Cell counting kit-8, and Propidium iodide were purchased from Yeasen. Antibodies: anti-VHL,anti-β-Trcp1, anti-Cyclin A 2 , and anti-Actin were purchased from Abcam. anti-Flag,anti-Myc, and anti-HA were purchased from Abmart. anti-CDH1 was purchased from Proteintech. anti-HIF-1αwas purchased from Cell Signaling Technology. Cell culture The cell lines were all cultured in Gibco Modified Eagle medium (DMEM) with 10% fetal bovine serum supplementation at 37°C in an incubator with 5% CO2 humidity. Upon examination of their morphology and growth rate, all cell lines were confirmed to be mycoplasma-free. Cell Transfection Plasmid transfections were carried out by Lipofectamine 8000 (Beyotime). When the cell density reached 50–60%, the Lipofectamine 8000 and plasmids were mixed well in serum-free DMEM and immediately added to dishes. After 10-12hrs, the fresh medium was replaced. Culture cells for 24 hours to detect the expression of target genes. CCK8-cell proliferation assay The 96-well plates were seeded with cell suspension (3000 cells /100µL/ well). 10µL solution of CCK-8 was added to each well. Avoid bubbles and react for 1hr at the incubator. Use a plate reader (SpectraMax i3x, Molecular Devices) to measure the absorbance. OD450 statistical data were recorded continuously. Synchronization with Double thymidine and release of synchronized cells HeLa cells with a density of 20%-30% were selected and cultured for 18 hrs in DMEM containing 2mM Thymidine for the first block. After washing twice with PBS, replace the culture medium with fresh DMEM. After 9 hrs, cells were cultured again with 2mM Thymidine for 18 hrs for a second block. At this time, cells had been synchronized in the G1/S phase, and after PBS washing twice, they were replaced with thymidine-free DMEM, and the cell cycle began to release. The cells were sampled at the indicated times and subjected to flow cytometric analysis before other measurements. Flow cytometry For apoptosis detection, the Apoptosis Detection Kit (Yeason, China) was used to stain the cells. For cell cycle analysis, cells were digested, centrifuged, suspended in 75% ethanol, and stored at -20℃ overnight. After fixation, centrifuge, and washing twice with PBS, 50mg/mL propyl iodide (PI) was added, mixed, and incubated for 15 min. Use a fluorescence-activated cell sorter (FACS Calibur) to analyze the cells SDS-PAGE and Western blotting Western blotting and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were carried out by conventional procedures. In short, 100 mm plates containing exponentially developing cells were once cleaned with cold PBS and then immediately lysed in 1 mL of SDS loading buffer that contained 50 mM Tris-HCl pH 6.8, 10% v/v glycerol, 2% SDS (w/v), 4% β-mercaptoethanol, and 0.0012% bromophenol blue (w/v). Each sample was put through SDS-PAGE and then transferred to nitrocellulose membranes (GE Healthcare Life Science) for western blot analysis. After blocking the membranes for one hour at room temperature in 5% (w/v) skim milk in Tris-buffered saline containing 0.1% (v/v) Tween-20 (TBST), they were probed with primary antibodies overnight at 4°C in antibody dilution buffer (QuickBlockTM, Beyotime). Following an incubation period with secondary antibodies conjugated with horseradish peroxidase (HRP) in TBST (including 5% skim milk), membranes were visualized using the Typhoon system (GE Healthcare Life Science) and developed using ECL-Plus (Thermo Fisher Scientific). Hypoxia Transfer cells to a hypoxia incubator (ThermoFisher Scientific, USA). Cells were harvested at a specified time point no more than 8 hours after hypoxia exposure. Quantitative RT-PCR Extract RNA from cells using FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme) and reverse-transcribe into cDNA. Using the ChamQ SYBR qPCR Master Mix kit (enzyme) for quantitative RT-PCR. Actin served as an internal reference standard. These primer sequences used are listed below. Actin:5’- CCTCTCCCAAGTCCACACAG − 3’(sense), 5’- GGGCACGAAGGCTCATCATT − 3’ (antisense); CDH1:5’- CCGTTCGACAAAGGAGTCTGT − 3’(sense), 5’- GGAAGGCAGAGTCCATGCAA − 3’ (antisense); Immunoprecipitation Cells were co-transfected with the target gene plasmid for 36 hrs. Cell lysate was prepared by lysing cells in a suitable buffer. The lysate was added to Flag-beads, and gently rotated at 4°C to facilitate antibody-antigen binding. After incubation, the beads are washed to remove unbound proteins. Finally, the bound antigen-antibody complexes are eluted from the beads for western blotting. In vivo ubiquitination assay Cells were subjected to co-transfection with the target gene-containing plasmid for a duration of 36 hours. MG132 was added into the system at a terminal concentration of 10µM and incubated for 4–6 hrs before harvesting. Lysis was performed in ubiquitinated lysis buffer containing 1 mM DTT, mixed by blowing, and boiled at 99 ℃ for 5 min until the cell clusters became clear. Centrifuge for 10 minutes at 4°C (12,000 rpm). Lysates were diluted in Tris-HCl before immunoprecipitation. Edu staining After culturing U87MG cells at a concentration suitable for their proliferation, EDU was incorporated into a medium and allowed to incubate for one hour. After harvesting the cells, the leftover media was removed by twice washing them in PBS. Fix cells at room temperature in 4% paraformaldehyde. The cocktail (215 µL of PBS, 10 µL of 100 mM CuSO4, 0.6 µL of 2 mM Azide, and 25 µL Sodium Ascorbate). After that, Hoechst 33342 was added for nuclear staining. Use a fluorescence microscope to visually inspect cells. CRISPR/Cas9 editing for the production of knockout cells By cloning the annealed sgRNA into the px459 vector, the plasmid was created. The CRISPR Design website ( http://crispr.mit.edu ) was utilized to design the sgRNAs. HeLa cells were transfected with guide RNAs, and after 36 hours, the cells were selected using 2 µg/mL puromycin (Amresco). The remaining cells were taken after three days and sown at a density of one cell per well into a 96-well plate. Western blotting was utilized to confirm the knockouts. To generate HIF-1α-knockout HeLa cells, we used the following guide sequence targeting the human HIF-1α, 5′-CACCGTTCTTTACTTCGCCGAGATC-3′. To generate EGLN2-knockout HeLa cells, we used the following guide sequence targeting the human EGLN2, 5′-CACCGCAGCCGCAGCCCCTAAGTC-3′. Statistical methods We use Prism 6.0 software to perform statistical analysis. We use Image J to adjust the picture. Results IDH1 R132H and 2-HG promote CDH1 proteasomal degradation First, we investigated how IDH1 R132H and 2-HG regulate CDH1 levels. IDH1 R132H over-expression and 2-HG treatment resulted in a notable reduction in endogenous CDH1 levels and an increase in CDH1 substrates, named VHL and cyclin A 2 (Fig. 1 a,b). AGI5198, an inhibitor of IDH1 R132H neo-enzymatic activity and 2-HG production, reversed the effects of IDH1 R132H expression on CDH1 levels(Fig. 1 c). To explore the mechanism by which 2-HG and IDH1 R132H regulate the protein levels of CDH1, we treated cells with cycloheximide (CHX), a protein translation inhibitor, to inhibit protein synthesis. We found that CHX failed to prevent CDH1 degradation. 2-HG and IDH1 R132H over-expression significantly reduced CDH1 half-life, destabilized CDH1 protein, and promoted its degradation(Fig. 1 d,e), confirming the role of 2-HG in regulating CDH1 stability. Additionally, treatment with MG132, a proteasome inhibitor, increased endogenous CDH1 levels, preventing downregulation by 2-HG and IDH1 R132H (Fig. 1 f, g). Ubiquitination assay revealed that MG132 increased ubiquitination levels of ectopically expressed CDH1, with additional enhancement by 2-HG and IDH1 R132H over-expression(Fig. 1 h, i). These findings collectively confirm that 2-HG and IDH1 R132H promote the ubiquitin-proteasome degradation of CDH1, which leads to low levels of CDH1. CDH1 can decrease DNA synthesis[ 22 ]. We further investigated whether 2-HG influenced DNA synthesis. Employing EDU staining as a method for tracking DNA synthesis progress, we observed that both IDH1 R132H overexpression and supplementation with 20mM 2-HG increased DNA synthesis in U87MG cells(Fig. 1 j,k). These findings were consistent with the observation that IDH1 R132H and 2-HG decreased CDH1 protein levels. α-KG and hypoxia regulate CDH1 protein levels The sole structural distinction between 2-HG and α-KG lies in the substitution of hydroxyl groups for oxygen atoms bonded to C2 in α-KG. To explore if α-KG regulates CDH1 opposite to 2-HG, cells were cultured in a glutamine-deficient medium to decrease intracellular α-KG levels, followed by a dose-dependent α-KG manner. α-KG treatment increased endogenous CDH1 levels (Fig. 2 a) and reversed 2-HG-induced CDH1 decrease(Fig. 2 b). These results collectively confirmed that 2-HG regulated CDH1 levels by inhibiting α-KG. Almost all solid tumors develop a hypoxia phenotype in the intratumoral region, and cancer cells use hypoxia to defend against immune cell attacks, which leads to immune escape and therapeutic resistance[ 23 ]. We next investigated oxygen's impact on CDH1 regulation. Hypoxia time-dependently reduced CDH1 expression (Fig. 2 c), which was reversed by α-KG supplementation (Fig. 2 d). These observations supported the assumption that CDH1 levels were positively regulated by oxygen. Moreover, CDH1 mRNA levels did not change upon hypoxia stimulation(Fig. 2 e). Treatment with the MG132 elevated endogenous CDH1 levels, counteracting hypoxia-induced downregulation(Fig. 2 f). Furthermore, hypoxia increased CDH1 ubiquitination levels(Fig. 2 g). These observations confirmed that hypoxia controls CDH1 degradation by the ubiquitin-proteasome pathway. CDH1 undergoes phosphorylation on specific serine and threonine residues by kinases, facilitating its recognition by the E3 ligase prior to degradation[ 24 ]. Indeed, we observed upregulation of CDH1 phosphorylation levels by 2-HG(Fig. 2 h). It is reported that CDH1 was phosphorylated on four conserved sites.(Ser40, Thr121, Ser151, Ser163)[ 25 ]. We found that replacing the four phosphorylation sites with alanine(CDH1 4A ), abolished hypoxia-induced higher ubiquitination levels in CDH1 4A (Fig. 2 i). These collectively confirmed hypoxia’s role in enhancing CDH1 degradation via increased phosphorylation. IDH1 mutations and hypoxia could elevate HIF-1α levels[ 26 ], indicating a potential involvement of HIF-1α in 2-HG function. To address this problem, we treated HeLa cells with 2-HG and hypoxia stimulation in wild-type and HIF-1α knockout(KO) cells. Interestingly, 2-HG and hypoxia still down-regulated CDH1 levels in HIF-1α-KO HeLa cells (Fig. 2 j,k). In addition, HIF-1α had no impact on the regulation of CDH1 by α-KG(Fig. 2 l), confirming HIF-1α independence in the regulatory mechanism of 2-HG and oxygen on CDH1. 2-HG decreases CDH1 protein by inhibiting EGLN2 In the previous studies, we confirmed the positive regulatory effects of α-KG and oxygen on CDH1. PHD enzymes, crucial for HIF-1α degradation, rely on both α-KG and oxygen as substrates. Next, we investigated the role of PHDs in regulating CDH1. Co-immunoprecipitation assays revealed that PHDs could interact with CDH1(Fig. 3 a). However, hypoxia decreased endogenous CDH1 levels and only EGLN2 could rescue the decreased CDH1 levels induced by hypoxia (Fig. 3 b), suggesting EGLN2 could improve CDH1 stability by integrating oxygen. Moreover, EGLN2 overexpression abrogated 2-HG to stabilize CDH1 levels(Fig. 3 c) and decreased the ubiquitination of CDH1(Fig. 3 d). Knockout EGLN2 decreased endogenous CDH1 levels(Fig. 3 e). Furthermore, EGLN2 ablation rendered CDH1 levels irresponsive to 2-HG(Fig. 3 f), confirming that EGLN2 regulates CDH1 stability. These results suggested that CDH1 was specifically regulated by EGLN2. DMOG, a prodrug of N-oxalylglycine (NOG), acts as a hypoxia-inducing agent by inhibiting prolyl hydroxylases (PHD), while CoCl 2 chelates metal ions to disrupt α-KG-dependent hydroxylase function. Both DMOG and CoCl 2 supplementation resulted in decreased CDH1 levels but elevated VHL and Cyclin A 2 levels in U87MG cells (Fig. 3 g, h). Moreover, DMOG increased CDH1 ubiquitination levels(Supplementary Fig. 1). These findings collectively confirmed that 2-HG regulates CDH1 levels by inhibiting EGLN2. 2-HG leads to the cell cycle arrest CDH1 is expressed to primarily regulate the mitotic exit and the G1/S transition[ 13 ]. To examine 2-HG’s impact on the tumor cell cycle, we synchronized HeLa cells to the G1/S boundary and released them with or without 2-HG supplementation. 2-HG treatment disrupted cell cycle progression compared to the normal process (Fig. 4 a). HeLa cells with 2-HG supplementation transitioned faster from G1 to S phase but were arrested at M phase, unable to exit the cell cycle (Fig. 4 b). Post-release of double thymidine-synchronized G1/S phase cells, CDH1 levels decreased after transiting from G1 to S phase and rose during G2/M phase. VHL and Cyclin A 2 levels, downstream substrates of CDH1, exhibited an inverse correlation with CDH1(Fig. 4 c). Upon release of arrested HeLa cells accompanied by 2-HG treatment, CDH1 levels remained unchanged throughout cell cycle progression. VHL and Cyclin A 2 ceased to decline in the M phase and remained at high levels(Fig. 4 d). CDH1 and its substrates were unable to function normally. These findings demonstrated that 2-HG disrupted the cell cycle, delaying progression through the M phase by reducing CDH1 levels. Furthermore, an analysis of the cell cycle phase distribution after treatment with 2-HG showed a heightened proportion of HeLa cells occupying the S and G2/M stages. It was observed that CDH1 overexpression notably augmented the proportion of cells residing in the G1 phase. The cell cycle arrest induced by 2-HG was rescued by CDH1 overexpression(Fig. 4 e). We next investigated the impact of IDH1 R132H knockin and 2-HG supplementation on cell growth. Our results demonstrated that HeLa cell growth was inhibited by both IDH1 R132H knockin and 2-HG supplementation. Interestingly, IDH1 R132H knockin strains exhibited increased sensitivity to 2-HG(Fig. 4 f). Downregulation of EGLN2 suppressed cancer cell proliferation[ 27 ]. As expected, EGLN2 knockout strains proliferation was markedly reduced. EGLN2 knockout abolished the inhibitory effect of 2-HG on cell growth. (Fig. 4 g). Additionally, IDH1 R132H and 2-HG induced apoptosis in HeLa cells(Fig. 4 h). All these results confirmed that IDH1 R132H and 2-HG inhibited cell proliferation and promoted apoptosis by decreasing CDH1 protein levels. Discussion Our data indicate that 2-HG, produced by IDH1 R132H in gliomas, inhibited the proline hydroxylase EGLN2 activity, resulting in reduced CDH1 protein levels by ubiquitin-proteasome pathway and finally arrested the cell cycle. EGLN2 could stabilize CDH1, inhibiting the degradation of CDH1. Consequently, sustained low levels of CDH1 induced by 2-HG halted the cell cycle, impeding tumor development. These findings offer a theoretical basis for the improved prognosis observed in patients with IDH1 R132H mutations(Fig. 5 ). Mutations in the IDH1 are common in various tumors. Most cancer-associated IDH1 mutations occur at the well-known site R132, which is characterized by reducing α-KG to the carcinogenic metabolite 2-HG. Glioblastoma patients with IDH1 R132H mutations have some unique clinical characteristics, such as markedly better clinical prognosis and younger age[ 28 ], but the reason remains unclear. This study focuses on this phenomenon to explore the mechanism of IDH1 R132H mutation and 2-HG in it. We observed that IDH1 R132H and 2-HG increased CDH1 proteasomal degradation, resulting in elevated levels of CDH1 substrates such as VHL and Cyclin A 2 . These observations align with the overexpression of various CDH1 substrates, including DNA replication factors[ 29 ], mitotic kinases[ 30 ], and mitotic and S phase cyclins[ 31 ], which are commonly observed in a broad range of human malignancies. The sole structural distinction between 2-HG and α-KG lies in the substitution of hydroxyl groups for oxygen atoms bonded to C2 in α-KG. This similarity implies that 2-HG might inhibit prolyl hydroxylases (PHD), which catalyze proline hydroxylation using α-KG and oxygen. Our findings suggested that both α-KG and oxygen independently increased CDH1 expression, regardless of HIF-1α. Furthermore, we observed that hypoxia enhanced CDH1 phosphorylation levels. Efficient cell-cycle progression requires a significant reduction in APC/C CDH1 activity as cells transition from G1 to S-phase. This reduced activity is achieved primarily through the hyperphosphorylation of CDH1 by cyclin-dependent kinases (CDK) in late G1, which inhibits the interaction of CDH1 with the APC/C[ 32 ]. We showed that after mutating four phosphorylation sites to alanine, hypoxia failed to increase CDH1 4A degradation. Recent reports have also emphasized elevated CyclinD-CDK4/6 activity in human cancer cells, attributing it to the inactivation of APC/C CDH1 through hyperphosphorylation of CDH1[33 , 34]. Furthermore, our findings indicated that EGLN2 positively regulated CDH1 protein levels. 2-HG disrupted the cell cycle by interfering with EGLN2-mediated hydroxylation of CDH1. Inhibition of EGLN2 has been shown to disrupt the cell cycle; for instance, EGLN2 regulates cyclin D1 protein levels independently of HIF[ 35 ]. Loss of EGLN2 inhibits mitotic progression by inducing mitotic spindle disorganization[ 36 ]. We propose that the E3 ligase preferentially targets un-hydroxylated CDH1, which is produced when EGLN2 is inhibited, for degradation, thereby linking α-KG inhibition and hypoxia to aneuploidy. Our findings demonstrated that CDH1 prolyl hydroxylation by EGLN2 inhibited its proteasomal degradation, contrasting with HIF-1α, whose prolyl hydroxylation by EGLN2 promotes its proteasomal degradation[ 37 ]. To our knowledge, this is the first example that prolylhydroxylation stabilizes a protein, and it makes physiologic sense given that high oxygen and KG signals would facilitate cell proliferation, in which high CDH1 levels and smooth chromosome segregation are required. In this study, we demonstrated that both 2-HG and IDH1 R132H knockin inhibited HeLa proliferation, with IDH1 R132H knockin cells showing greater sensitivity to 2-HG treatment. Additionally, Pianka et al.[ 38 ] proposed a distinct mechanism for 2-HG-mediated inhibition of IDH1mut glioma growth, suggesting that 2-HG can reduce glioma growth by inhibiting the m6A demethylase, FTO. Additionally, EGLN2 knockout showed no response to 2-HG supplementation in our study. Moreover, our results indicated that both 2-HG and exogenous overexpression of IDH1 R132H promoted cell apoptosis. These findings are consistent with 2-HG's inhibition of mTOR signaling and ATP synthase, resulting in growth arrest and tumor suppression[39 , 40]. Apoptosis and cell cycle arrest are well-known mechanisms for inhibiting cell growth, while chromosomal aneuploidy is frequently observed in solid tumors[ 41 ], indicative of aberrant cell cycle progression. Our study uncovered that 2-HG induced cell cycle arrest, notably impeding exit from the M phase, and diminished CDH1 levels. APC/C CDH1 , a key regulator of the cell cycle, governs the stability of M and G1 phases[ 42 ]. The precise segregation of chromosomes during the M phase is crucial to prevent the acquisition of abnormal karyotypes by daughter cells[ 43 ]. Our findings implied that dysregulation of CDH1 by 2-HG may potentially trigger aneuploidy in pathological samples from patients with IDH1 mutations. Further investigation into the specific mechanisms involved will be pursued in our follow-up studies. We observed that 2-HG increased DNA synthesis. This aligns with previous studies indicating that 2-HG contributes to metabolic reprogramming, including nucleotide synthesis utilization and DNA repair capacity[44 , 45]. The degradation of CDH1 by ubiquitination induced by 2-HG leads to cell cycle arrest, which could be rescued by CDH1 overexpression. This disruption can result in errors during DNA replication in S phase and missegregation of sister chromatids, ultimately leading to chromosome aneuploidy. These results provide insights into why IDH1 mutation carriers exhibit longer survival rates: lower CDH1 levels and a slower cell division process induced by 2-HG delay tumor development, contributing to prolonged survival. We speculate that cell cycle arrest triggered by 2-HG may represent a suppressive mechanism against tumor development within the body. In summary, our study elucidates that the accumulation of the metabolite 2-HG, induced by IDH1 R132H mutation in glioblastoma patients, leads to the phosphorylation and subsequent degradation of CDH1 through inhibition of hydroxylation by EGLN2, ultimately causing cell cycle arrest at the M phase and inhibiting cell proliferation. This provides a theoretical basis for the extended survival observed in IDH1 R132H mutation patients and sheds light on the molecular mechanism underlying oxygen's regulation of the cell cycle. Abbreviations IDH1: Isocitrate dehydrogenase 1 2-HG: D-2-hydroxyglutarate α-KG : α-ketoglutarate CDH1: CDC20 homologue-1 APC/C: Anaphase-Promoting Complex/Cyclosome CHX: Cycloheximide PHD: Prolyl hydroxylase domain protein family HIF-1α: Hypoxia-inducible factor 1-alpha DTB: Double thymidine block VHL: Von Hippel-Lindau DMOG: Dimethyloxaloylglycine Declarations Funding This research was supported by the National Key Research and Development Program youth project, grant number 2018YFA0801300. Competing Interests statement The authors declare no conflicts of interest. Author contributions Meng-qi You wrote the main manuscript and performed the biochemical cell biologic experiments. Wei Xu conceived the project and received funding for the study. All authors reviewed the manuscript. Data availability Upon a reasonable request, the corresponding author can provide access to the datasets utilized and/or examined in the present study. Ethics approval There was no human or animal experiment in this study. Consent to participate Not applicable. Consent to publish Not applicable. References van den Bent, M.J.; Smits, M.; Kros, J.M.; Chang, S.M. Diffuse Infiltrating Oligodendroglioma and Astrocytoma. J. Clin. Oncol. 2017 , 35, 2394-2401, doi:10.1200/JCO.2017.72.6737. Wen, P.Y.; Weller, M.; Lee, E.Q.; Alexander, B.M.; Barnholtz-Sloan, J.S.; Barthel, F.P.; Batchelor, T.T.; Bindra, R.S.; Chang, S.M.; Chiocca, E.A. et al. Glioblastoma in adults: a Society for Neuro-Oncology (SNO) and European Society of Neuro-Oncology (EANO) consensus review on current management and future directions. Neuro-Oncology 2020 , 22, 1073-1113, doi:10.1093/neuonc/noaa106. Watanabe, T.; Vital, A.; Nobusawa, S.; Kleihues, P.; Ohgaki, H. Selective acquisition of IDH1 R132C mutations in astrocytomas associated with Li-Fraumeni syndrome. Acta Neuropathol. 2009 , 117, 653-656, doi:10.1007/s00401-009-0528-x. Shi, J.; Zuo, H.; Ni, L.; Xia, L.; Zhao, L.; Gong, M.; Nie, D.; Gong, P.; Cui, D.; Shi, W. et al. An IDH1 mutation inhibits growth of glioma cells via GSH depletion and ROS generation. Neurol. Sci. 2014 , 35, 839-845, doi:10.1007/s10072-013-1607-2. SongTao, Q.; Lei, Y.; Si, G.; YanQing, D.; HuiXia, H.; XueLin, Z.; LanXiao, W.; Fei, Y. IDH mutations predict longer survival and response to temozolomide in secondary glioblastoma. Cancer Sci. 2012 , 103, 269-273, doi:10.1111/j.1349-7006.2011.02134.x. Yan, H.; Parsons, D.W.; Jin, G.; McLendon, R.; Rasheed, B.A.; Yuan, W.; Kos, I.; Batinic-Haberle, I.; Jones, S.; Riggins, G.J. et al. IDH1 and IDH2 mutations in gliomas. N. Engl. J. Med. 2009 , 360, 765-773, doi:10.1056/NEJMoa0808710. Weller, M.; Felsberg, J.; Hartmann, C.; Berger, H.; Steinbach, J.P.; Schramm, J.; Westphal, M.; Schackert, G.; Simon, M.; Tonn, J.C. et al. Molecular predictors of progression-free and overall survival in patients with newly diagnosed glioblastoma: a prospective translational study of the German Glioma Network. J. Clin. Oncol. 2009 , 27, 5743-5750, doi:10.1200/JCO.2009.23.0805. Combs, S.E.; Rieken, S.; Wick, W.; Abdollahi, A.; von Deimling, A.; Debus, J.; Hartmann, C. Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: one step forward, and one step back? Radiat. Oncol. 2011 , 6, 115, doi:10.1186/1748-717X-6-115. Taylor, A.M.; Shih, J.; Ha, G.; Gao, G.F.; Zhang, X.; Berger, A.C.; Schumacher, S.E.; Wang, C.; Hu, H.; Liu, J. et al. Genomic and Functional Approaches to Understanding Cancer Aneuploidy. Cancer Cell 2018 , 33, 676-689, doi:10.1016/j.ccell.2018.03.007. de Boer, H.R.; Guerrero, L.S.; van Vugt, M.A. Controlling the response to DNA damage by the APC/C-Cdh1. Cell. Mol. Life Sci. 2016 , 73, 949-960, doi:10.1007/s00018-015-2096-7. Bhavya, B.; Anand, C.R.; Madhusoodanan, U.K.; Rajalakshmi, P.; Krishnakumar, K.; Easwer, H.V.; Deepti, A.N.; Gopala, S. To be Wild or Mutant: Role of Isocitrate Dehydrogenase 1 (IDH1) and 2-Hydroxy Glutarate (2-HG) in Gliomagenesis and Treatment Outcome in Glioma. Cell. Mol. Neurobiol. 2020 , 40, 53-63, doi:10.1007/s10571-019-00730-3. Lee, F.S.; Percy, M.J. The HIF pathway and erythrocytosis. Annu. Rev. Pathol. 2011 , 6, 165-192, doi:10.1146/annurev-pathol-011110-130321. Minamishima, Y.A.; Moslehi, J.; Bardeesy, N.; Cullen, D.; Bronson, R.T.; Kaelin, W.J. Somatic inactivation of the PHD2 prolyl hydroxylase causes polycythemia and congestive heart failure. Blood 2008 , 111, 3236-3244, doi:10.1182/blood-2007-10-117812. Rantanen, K.; Pursiheimo, J.; Hogel, H.; Himanen, V.; Metzen, E.; Jaakkola, P.M. Prolyl hydroxylase PHD3 activates oxygen-dependent protein aggregation. Mol. Biol. Cell. 2008 , 19, 2231-2240, doi:10.1091/mbc.e07-11-1124. Schlisio, S.; Kenchappa, R.S.; Vredeveld, L.C.; George, R.E.; Stewart, R.; Greulich, H.; Shahriari, K.; Nguyen, N.V.; Pigny, P.; Dahia, P.L. et al. The kinesin KIF1Bbeta acts downstream from EglN3 to induce apoptosis and is a potential 1p36 tumor suppressor. Genes. Dev. 2008 , 22, 884-893, doi:10.1101/gad.1648608. Schofield, C.J.; Ratcliffe, P.J. Oxygen sensing by HIF hydroxylases. Nat. Rev. Mol. Cell Biol. 2004 , 5, 343-354, doi:10.1038/nrm1366. Shi, J.; Sun, B.; Shi, W.; Zuo, H.; Cui, D.; Ni, L.; Chen, J. Decreasing GSH and increasing ROS in chemosensitivity gliomas with IDH1 mutation. Tumour Biol 2015 , 36, 655-662, doi:10.1007/s13277-014-2644-z. Fujita, T.; Liu, W.; Doihara, H.; Wan, Y. Regulation of Skp2-p27 axis by the Cdh1/anaphase-promoting complex pathway in colorectal tumorigenesis. Am. J. Pathol. 2008 , 173, 217-228, doi:10.2353/ajpath.2008.070957. Bassermann, F.; Frescas, D.; Guardavaccaro, D.; Busino, L.; Peschiaroli, A.; Pagano, M. The Cdc14B-Cdh1-Plk1 axis controls the G2 DNA-damage-response checkpoint. Cell 2008 , 134, 256-267, doi:10.1016/j.cell.2008.05.043. De K; Grubb, T.M.; Zalenski, A.A.; Pfaff, K.E.; Pal, D.; Majumder, S.; Summers, M.K.; Venere, M. Hyperphosphorylation of CDH1 in Glioblastoma Cancer Stem Cells Attenuates APC/C(CDH1) Activity and Pharmacologic Inhibition of APC/C(CDH1/CDC20) Compromises Viability. Mol. Cancer Res. 2019 , 17, 1519-1530, doi:10.1158/1541-7786.MCR-18-1361. Venere, M.; Horbinski, C.; Crish, J.F.; Jin, X.; Vasanji, A.; Major, J.; Burrows, A.C.; Chang, C.; Prokop, J.; Wu, Q. et al. The mitotic kinesin KIF11 is a driver of invasion, proliferation, and self-renewal in glioblastoma. Sci. Transl. Med. 2015 , 7, 304ra143, doi:10.1126/scitranslmed.aac6762. Li, Y.; Yao, C.F.; Xu, F.J.; Qu, Y.Y.; Li, J.T.; Lin, Y.; Cao, Z.L.; Lin, P.C.; Xu, W.; Zhao, S.M. et al. APC/C(CDH1) synchronizes ribose-5-phosphate levels and DNA synthesis to cell cycle progression. Nat. Commun. 2019 , 10, 2502, doi:10.1038/s41467-019-10375-x. Anderson, N.M.; Simon, M.C. The tumor microenvironment. Curr. Biol. 2020 , 30, R921-R925, doi:10.1016/j.cub.2020.06.081. Pal, D.; Torres, A.E.; Stromberg, B.R.; Messina, A.L.; Dickson, A.S.; De K; Willard, B.; Venere, M.; Summers, M.K. Chk1-mediated phosphorylation of Cdh1 promotes the SCF(betaTRCP)-dependent degradation of Cdh1 during S-phase and efficient cell-cycle progression. Cell Death Dis. 2020 , 11, 298, doi:10.1038/s41419-020-2493-1. Hein, J.B.; Hertz, E.; Garvanska, D.H.; Kruse, T.; Nilsson, J. Distinct kinetics of serine and threonine dephosphorylation are essential for mitosis. Nat. Cell Biol. 2017 , 19, 1433-1440, doi:10.1038/ncb3634. Zhao, S.; Lin, Y.; Xu, W.; Jiang, W.; Zha, Z.; Wang, P.; Yu, W.; Li, Z.; Gong, L.; Peng, Y. et al. Glioma-derived mutations in IDH1 dominantly inhibit IDH1 catalytic activity and induce HIF-1alpha. Science 2009 , 324, 261-265, doi:10.1126/science.1170944. Seth, P.; Krop, I.; Porter, D.; Polyak, K. Novel estrogen and tamoxifen induced genes identified by SAGE (Serial Analysis of Gene Expression). Oncogene 2002 , 21, 836-843, doi:10.1038/sj.onc.1205113. Neftel, C.; Laffy, J.; Filbin, M.G.; Hara, T.; Shore, M.E.; Rahme, G.J.; Richman, A.R.; Silverbush, D.; Shaw, M.L.; Hebert, C.M. et al. An Integrative Model of Cellular States, Plasticity, and Genetics for Glioblastoma. Cell 2019 , 178, 835-849, doi:10.1016/j.cell.2019.06.024. Petersen, B.O.; Wagener, C.; Marinoni, F.; Kramer, E.R.; Melixetian, M.; Lazzerini, D.E.; Gieffers, C.; Matteucci, C.; Peters, J.M.; Helin, K. Cell cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on APC-CDH1. Genes. Dev. 2000 , 14, 2330-2343, doi:10.1101/gad.832500. Lindon, C.; Pines, J. Ordered proteolysis in anaphase inactivates Plk1 to contribute to proper mitotic exit in human cells. J. Cell. Biol. 2004 , 164, 233-241, doi:10.1083/jcb.200309035. Geley, S.; Kramer, E.; Gieffers, C.; Gannon, J.; Peters, J.M.; Hunt, T. Anaphase-promoting complex/cyclosome-dependent proteolysis of human cyclin A starts at the beginning of mitosis and is not subject to the spindle assembly checkpoint. J. Cell. Biol. 2001 , 153, 137-148, doi:10.1083/jcb.153.1.137. Amon, A.; Irniger, S.; Nasmyth, K. Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. Cell 1994 , 77, 1037-1050, doi:10.1016/0092-8674(94)90443-x. The, I.; Ruijtenberg, S.; Bouchet, B.P.; Cristobal, A.; Prinsen, M.B.; van Mourik, T.; Koreth, J.; Xu, H.; Heck, A.J.; Akhmanova, A. et al. Rb and FZR1/Cdh1 determine CDK4/6-cyclin D requirement in C. elegans and human cancer cells. Nat. Commun. 2015 , 6, 5906, doi:10.1038/ncomms6906. Wan, L.; Chen, M.; Cao, J.; Dai, X.; Yin, Q.; Zhang, J.; Song, S.J.; Lu, Y.; Liu, J.; Inuzuka, H. et al. The APC/C E3 Ligase Complex Activator FZR1 Restricts BRAF Oncogenic Function. Cancer Discov. 2017 , 7, 424-441, doi:10.1158/2159-8290.CD-16-0647. Zhang, Q.; Gu, J.; Li, L.; Liu, J.; Luo, B.; Cheung, H.W.; Boehm, J.S.; Ni, M.; Geisen, C.; Root, D.E. et al. Control of cyclin D1 and breast tumorigenesis by the EglN2 prolyl hydroxylase. Cancer Cell 2009 , 16, 413-424, doi:10.1016/j.ccr.2009.09.029. Moser, S.C.; Bensaddek, D.; Ortmann, B.; Maure, J.F.; Mudie, S.; Blow, J.J.; Lamond, A.I.; Swedlow, J.R.; Rocha, S. PHD1 links cell-cycle progression to oxygen sensing through hydroxylation of the centrosomal protein Cep192. Dev. Cell 2013 , 26, 381-392, doi:10.1016/j.devcel.2013.06.014. Kaelin, W.G. Proline hydroxylation and gene expression. Annu. Rev. Biochem. 2005 , 74, 115-128, doi:10.1146/annurev.biochem.74.082803.133142. Pianka, S.T.; Li, T.; Prins, T.J.; Eldred, B.; Kevan, B.M.; Liang, H.; Zapanta, R.S.; Kornblum, H.I.; Nathanson, D.A.; Pellegrini, M. et al. D-2-HG Inhibits IDH1mut Glioma Growth via FTO Inhibition and Resultant m6A Hypermethylation. Cancer Res Commun 2024 , 4, 876-894, doi:10.1158/2767-9764.CRC-23-0271. Fu, X.; Chin, R.M.; Vergnes, L.; Hwang, H.; Deng, G.; Xing, Y.; Pai, M.Y.; Li, S.; Ta, L.; Fazlollahi, F. et al. 2-Hydroxyglutarate Inhibits ATP Synthase and mTOR Signaling. Cell Metab. 2015 , 22, 508-515, doi:10.1016/j.cmet.2015.06.009. Liu, X.; Yamaguchi, K.; Takane, K.; Zhu, C.; Hirata, M.; Hikiba, Y.; Maeda, S.; Furukawa, Y.; Ikenoue, T. Cancer-associated IDH mutations induce Glut1 expression and glucose metabolic disorders through a PI3K/Akt/mTORC1-Hif1alpha axis. PLoS One 2021 , 16, e257090, doi:10.1371/journal.pone.0257090. Kristin A. Knouse, T.D.S.J. Aneuploidy in Cancer: Seq-ing Answers to Old Questions. ANNUAL REVIEW OF CANCER BIOLOGY 2017 , 335-354. Nakayama, K.I.; Nakayama, K. Ubiquitin ligases: cell-cycle control and cancer. Nat. Rev. Cancer 2006 , 6, 369-381, doi:10.1038/nrc1881. Lara-Gonzalez, P.; Westhorpe, F.G.; Taylor, S.S. The spindle assembly checkpoint. Curr. Biol. 2012 , 22, R966-R980, doi:10.1016/j.cub.2012.10.006. Yang, H.; Ye, D.; Guan, K.L.; Xiong, Y. IDH1 and IDH2 mutations in tumorigenesis: mechanistic insights and clinical perspectives. Clin. Cancer Res. 2012 , 18, 5562-5571, doi:10.1158/1078-0432.CCR-12-1773. Garrett, M.; Sperry, J.; Braas, D.; Yan, W.; Le TM; Mottahedeh, J.; Ludwig, K.; Eskin, A.; Qin, Y.; Levy, R. et al. Metabolic characterization of isocitrate dehydrogenase (IDH) mutant and IDH wildtype gliomaspheres uncovers cell type-specific vulnerabilities. Cancer Metab. 2018 , 6, 4, doi:10.1186/s40170-018-0177-4. Additional Declarations No competing interests reported. Supplementary Files Supplementalmaterial.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4240423","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":289676853,"identity":"447439f4-e32b-4110-836e-673eec49918a","order_by":0,"name":"Meng-Qi You","email":"","orcid":"","institution":"Institutes of Biomedical Sciences Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Meng-Qi","middleName":"","lastName":"You","suffix":""},{"id":289676855,"identity":"9fea708e-a2ad-4ddf-8815-ae90ea3c3106","order_by":1,"name":"Wei Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYLCCBAaJ+jb25gMfGNjAfANitNgw9vMcS5xBvBYGhjTGmTN8DInTYnAjx/DBA4bDzAY3eD4285TZ5TGwN2+TYKi5g1OL5IwcY4MEhsNsBrd7NzbznEsuZuA5VibBcOwZTi38ErnbJIBaeAzunN3+mLeNObFBIsdMgrHhME4tbBK5238AtUgAXfiwmbetPrFB/g1+LSBbgCGWZgB0ISNQy2GgLTz4tUj2vP8MdJhNAj/PMcPGOeeOJ7bxpBVbJBzDrcXgeFrixx8MEgls7M0PG96UVSf2sx/eeONDDW4tYMD4D9l3ICIBv4ZRMApGwSgYBQQAAMOOVQx7r8ZSAAAAAElFTkSuQmCC","orcid":"","institution":"Institutes of Biomedical Sciences Fudan University","correspondingAuthor":true,"prefix":"","firstName":"Wei","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2024-04-09 07:48:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4240423/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4240423/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54999802,"identity":"35603c74-391b-4fc2-b50e-cc4d9cf5b507","added_by":"auto","created_at":"2024-04-19 18:32:28","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1263833,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHG controls CDH1 proteasomal degradation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a)IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expression decreased CDH1 levels and increased VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e levels. The CDH1, VHL, and Cyclin A\u003csub\u003e2\u003c/sub\u003e levels in IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expression U87MG cells were determined by Western blot.\u003c/p\u003e\n\u003cp\u003e(b) 2-HG downregulated CDH1 levels. The endogenous CDH1 VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e levels of U87MG cells treated with 20 mM 2-HG for 6h were determined by Western blot.\u003c/p\u003e\n\u003cp\u003e(c) The endogenous CDH1 levels in IDH1\u003csup\u003eR132H\u003c/sup\u003e overexpression U87MG cells treated with different AGI5198 concentrations for 48h were determined by Western blot.\u003c/p\u003e\n\u003cp\u003e(d) U87MG cells were treated with CHX for the indicated time under IDH1\u003csup\u003eR132H \u003c/sup\u003eover-expression. CDH1 protein levels were analyzed by immunoblotting.\u003c/p\u003e\n\u003cp\u003e(e) U87MG cells were treated with CHX for the indicated time under 2-HG treatment. CDH1 protein levels were analyzed by immunoblotting.\u003c/p\u003e\n\u003cp\u003e(f),(g)U87MG cells were transfected with myc-tagged IDH1\u003csup\u003eR132H\u003c/sup\u003e for 36 hours(f) or treated with 20mM 2-HG(g) for 6 hours and then treated with MG132. CDH1 protein levels were analyzed by immunoblotting.\u003c/p\u003e\n\u003cp\u003e(h),(i)Flag-tagged CDH1 was expressed in 293T cells. The ubiquitination levels of CDH1 expressed from cells under the overexpression of IDH1\u003csup\u003eR132H\u003c/sup\u003e(h) or treatment of 20 mM 2-HG(i) were analyzed.\u003c/p\u003e\n\u003cp\u003e(j),(k) Illustrative examples of EDU staining outcomes are displayed for U87MG cells with IDH1\u003csup\u003eR132H\u003c/sup\u003e overexpression(j) and supplemented with 20mM 2-HG (k). Quantitation of EDU staining from these independent assays is shown. (*p \u0026lt; 0.05). Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"image1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/15f95d4e507c22e726b5259f.jpeg"},{"id":54998270,"identity":"9c644234-c043-4f16-b003-2b59335008e7","added_by":"auto","created_at":"2024-04-19 18:24:28","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":914360,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBoth α-KG and oxygen upregulate CDH1 levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a)α-KG increased endogenous CDH1 levels. U87MG cells were cultured in a glutamine-deficient medium in advance. The endogenous CDH1 levels treated with various α-KG concentrations for 6h were determined by Western blot.\u003c/p\u003e\n\u003cp\u003e(b) α-KG reversed CDH1 levels. CDH1 levels in cells treated with α-KG or/and 2-HG were determined.\u003c/p\u003e\n\u003cp\u003e(c) CDH1 protein levels are regulated by hypoxia. Endogenous protein levels of CDH1, HIF-1α, and Actin were determined in response to hypoxia(1% oxygen) for the indicated time.\u003c/p\u003e\n\u003cp\u003e(d) U87MG cells were pretreated for 12 hours with different concentrations of a-KG in normal culture conditions followed by exposure to hypoxia for 4 hours. CDH1 and HIF-1a protein levels were determined by western blot.\u003c/p\u003e\n\u003cp\u003e(e) CDH1 is not regulated at the transcription level under hypoxia conditions. CDH1 mRNA levels of U87MG cells with or without hypoxia treatment for 4h were determined by qRT-PCR. Each column represents the mean±SEM (n=3 biologically independent samples).\u003c/p\u003e\n\u003cp\u003e(f) CDH1 levels in cells treated with MG132 and/or hypoxia stimulation were determined.\u003c/p\u003e\n\u003cp\u003e(g) Flag-tagged CDH1 was expressed in 293T cells. The ubiquitination levels of CDH1 expressed from cells under the treatment of hypoxia were analyzed.\u003c/p\u003e\n\u003cp\u003e(h) Hypoxia increased CDH1 phosphorylation levels.\u003c/p\u003e\n\u003cp\u003e(i) Flag-tagged CDH14A was expressed in 293T cells. The ubiquitination levels of CDH14A expressed from cells under the treatment of hypoxia were analyzed.\u003c/p\u003e\n\u003cp\u003e(j),(k),(l) The regulation of CDH1 is HIF-1α dependent. CDH1 levels were determined in the absence and presence of 20mM 2-HG(j), hypoxia(k), and 10mM α-KG(l) in HeLa and HIF-1α knockout HeLa cells.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/bd3e3130c6a8bdcd485b40d9.jpeg"},{"id":54998271,"identity":"591707c5-2724-4aa2-8503-76750023476f","added_by":"auto","created_at":"2024-04-19 18:24:28","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":703676,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e2-HG decreases CDH1 protein by inhibiting EGLN2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a)The interaction between CDH1 and each EGLN family member was determined by coimmunoprecipitation.\u003c/p\u003e\n\u003cp\u003e(b)CDH1 protein levels were determined in U87MG cells expressing the indicated EGLN family members under normal or hypoxic conditions.\u003c/p\u003e\n\u003cp\u003e(c) CDH1 protein levels were determined in U87MG cells expressing the EGLN2 in the presence or absence of 2-HG.\u003c/p\u003e\n\u003cp\u003e(d)Flag-tagged CDH1 and myc-tagged EGLN2 were co-expressed in 293T cells. The ubiquitination levels of CDH1 expressed from cells were analyzed under treatment with MG132.\u003c/p\u003e\n\u003cp\u003e(e)The CDH1 endogenous protein level was detected in EGLN2 knockout HeLa cells.\u003c/p\u003e\n\u003cp\u003e(f) In EGLN2-/- HeLa cells under control or 2-HG supplementation, CDH1 and HIF-1a endogenous protein levels were determined by western blot analysis.\u003c/p\u003e\n\u003cp\u003e(g),(h) DMOG and CoCl\u003csub\u003e2\u003c/sub\u003e decreased endogenous CDH1 levels. Endogenous protein levels of CDH1 and the CDH1-downregulated substrates VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e were determined in response to (h)DMOG and (i)CoCl\u003csub\u003e2\u003c/sub\u003e for 12 hours in U87MG cells.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/2acfabd0bcf51cdf4d177678.jpeg"},{"id":54998274,"identity":"a589de9a-6626-45d9-bc69-f26bd5b53c1b","added_by":"auto","created_at":"2024-04-19 18:24:28","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1328855,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIDH1\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eR132H\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e and 2-HG inhibits cell growth and disrupt the cell cycle\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a),(b) HeLa cells were blocked to G1/S boundary with DTB. The cell cycle phases at the relevant time points were validated by flow cytometry without(a) and with 20mM 2-HG(b) treatment. (c),(d) Protein levels throughout the cell cycle. Protein levels of CDH1, VHL, Cyclin A\u003csub\u003e2\u003c/sub\u003e, and Actin at different time points were determined after releasing Hela cells from double thymidine synchronization without(c) and with 20mM 2-HG(d) treatment.\u003c/p\u003e\n\u003cp\u003e(e)Cell cycle distribution of HeLa cells after treatment with 2-HG or 2-HG plus CDH1-overexpression.\u003c/p\u003e\n\u003cp\u003e(f) IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin and 2-HG inhibited cell proliferation. The growth of HeLa, IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin, HeLa treated with 20mM 2-HG, and IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin treated with 20mM 2-HG were compared. n=6 biologically independent samples (***p \u0026lt; 0.001).\u003c/p\u003e\n\u003cp\u003e(g)The growth of EGLN2 knockout cells and EGLN2 knockout cells treated with 20mM 2-HG were compared. n=6 biologically independent samples.\u003c/p\u003e\n\u003cp\u003e(h) Overexpressing IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG treatment promoted cell apoptosis. Use flow cytometry to detect apoptotic cells. The apoptotic rates of control and IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expressing HeLa cells, culturing in the absence and presence of 20 mM 2-HG, were normalized to the control group(***p \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/cc1040c7342b5e02f1f2e0ae.jpeg"},{"id":54998273,"identity":"19bb091d-dd6a-4b72-b38e-c41d5d8a979f","added_by":"auto","created_at":"2024-04-19 18:24:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":632571,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/f4c10c4a751e2a70057a4394.png"},{"id":55002610,"identity":"8dc1600e-7465-4967-b17c-fdc59b809e29","added_by":"auto","created_at":"2024-04-19 18:40:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1171196,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/657e5a04-096f-4cf9-9a80-9345ffa7f393.pdf"},{"id":54998275,"identity":"2e482cac-9e6e-4ec3-b078-05dd8f290191","added_by":"auto","created_at":"2024-04-19 18:24:28","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":231472,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalmaterial.pptx","url":"https://assets-eu.researchsquare.com/files/rs-4240423/v1/a2a51ec56fcb2efb2f5f260d.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Control of CDH1 and IDH1mut glioblastoma cell cycle by D-2- hydroxyglutarate","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioblastoma(GBM) is a heterogeneous primary brain tumor characterized by extensive cerebral invasion and premature death[1\u003csup\u003e,\u003c/sup\u003e2]. IDH1(Isocitrate dehydrogenase 1) is a crucial enzyme involved in redox reactions, DNA repair, and epigenetic regulation, primarily functioning in cytoplasm and peroxisomes. Over 85% of low-grade glioblastomas harbor an IDH1 heterozygous missense mutation from arginine to histidine (R132H)[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The mutant IDH1 acquires a new enzymatic function and can utilize NADPH in a reduction reaction to convert α-ketoglutarate (α-KG) to D-2-hydroxyglutarate (2-HG). The decrease in NADPH leads to a depletion of antioxidant glutathione content, which increases reactive oxygen species(ROS) in the glioblastoma cells due to compromised antioxidant defense mechanisms[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Patients with IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation have been shown to have a longer survival period, a tendency for a more positive response to certain chemotherapy regimens [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], and are associated with a generally better prognosis[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, the mechanisms underlying IDH1\u003csup\u003eR132H\u003c/sup\u003e glioblastoma development remain unclear.\u003c/p\u003e \u003cp\u003eCritical for tumor progression and treatment resistance is the aberrant regulation of the cell cycle, which often occurs alongside the inherent genomic instability found in cancer cells. Aneuploidy, a hallmark present in nearly 90% of human cancers[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], is also observed in GBM patients with IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation, suggesting a potential link between 2-HG production by the IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation and cell cycle regulation. Fizzy-related protein homologs (CDH1) play a pivotal role in regulating mitotic exit and the G1/S transition[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. CDH1 acts as a co-activator of Anaphase Promoting Complex/Cyclosome (APC/C), forming the APC/C\u003csup\u003eCDH1\u003c/sup\u003e complex responsible for the degradation of various cell cycle regulators.\u003c/p\u003e \u003cp\u003e2-HG inhibits cellular differentiation[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] and α-KG-dependent dioxygenases, including the PHD family comprising EGLN1, EGLN2, and EGLN3. Under normoxia, these enzymes hydroxylate the alpha subunit of the hypoxia-inducible factor (HIF-1α), promoting its proteasomal degradation via VHL E3 ligase[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. EGLN1 primarily regulates HIF[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], while the HIF-independent roles of EGLN2 and EGLN3 remain unclear, although some studies suggest that EGLN3 has an HIF-independent role in the modulation of apoptosis[14\u003csup\u003e,\u003c/sup\u003e15]. PHDs employ α-KG, ferrous iron(Fe2+), and oxygen as substrates to hydroxylate prolines, thereby regulating protein stability[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Oxygen is vital for cell cycle activity, and HIF-1α accumulation can disrupt normal cell cycle regulation, potentially contributing to tumorigenesis[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCDH1 deletions and reduced expression are common in various human tumor tissues[18\u003csup\u003e,\u003c/sup\u003e19] Additionally, hyperphosphorylation of CDH1 which attenuates APC/C\u003csup\u003eCDH1\u003c/sup\u003e activity has been observed in GBM[19\u003csup\u003e,\u003c/sup\u003e20]. The ligase activity of APC/C\u003csup\u003eCDH1\u003c/sup\u003e is further diminished in the G1 phase of the cell cycle in GBM, resulting in elevated levels of its substrates throughout the cell cycle[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Since CDH1 plays an important role in the cell cycle and GBM tumorigenesis, we ask whether 2-HG produced by IDH1\u003csup\u003eR132H\u003c/sup\u003e and PHD family activity affects CDH1 activity.\u003c/p\u003e \u003cp\u003eIn the present study, we elucidate the presence of IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation and subsequent accumulation of 2-HG impact on the cell cycle dynamics by modulating the proteasomal degradation of the cell cycle regulator CDH1. Consequently, this disturbs the cell cycle, ultimately leading to the cell growth inhibition.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents and antibodies\u003c/h2\u003e \u003cp\u003eChemical and reagents: 2-HG and AGI5198 were purchased from MedChemExpress. Thymidine, MG132, CoCl2`6H2O,α-KG, and Flag-Beads were purchased from Sigma. DMOG was purchased from Selleck. Annexin V-FITC/PI apoptosis analysis kit, Cell counting kit-8, and Propidium iodide were purchased from Yeasen.\u003c/p\u003e \u003cp\u003eAntibodies: anti-VHL,anti-β-Trcp1, anti-Cyclin A\u003csub\u003e2\u003c/sub\u003e, and anti-Actin were purchased from Abcam. anti-Flag,anti-Myc, and anti-HA were purchased from Abmart. anti-CDH1 was purchased from Proteintech. anti-HIF-1αwas purchased from Cell Signaling Technology.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eThe cell lines were all cultured in Gibco Modified Eagle medium (DMEM) with 10% fetal bovine serum supplementation at 37\u0026deg;C in an incubator with 5% CO2 humidity. Upon examination of their morphology and growth rate, all cell lines were confirmed to be mycoplasma-free.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell Transfection\u003c/h2\u003e \u003cp\u003ePlasmid transfections were carried out by Lipofectamine 8000 (Beyotime). When the cell density reached 50\u0026ndash;60%, the Lipofectamine 8000 and plasmids were mixed well in serum-free DMEM and immediately added to dishes. After 10-12hrs, the fresh medium was replaced. Culture cells for 24 hours to detect the expression of target genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCCK8-cell proliferation assay\u003c/h2\u003e \u003cp\u003eThe 96-well plates were seeded with cell suspension (3000 cells /100\u0026micro;L/ well). 10\u0026micro;L solution of CCK-8 was added to each well. Avoid bubbles and react for 1hr at the incubator. Use a plate reader (SpectraMax i3x, Molecular Devices) to measure the absorbance. OD450 statistical data were recorded continuously.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eSynchronization with Double thymidine and release of synchronized cells\u003c/h2\u003e \u003cp\u003eHeLa cells with a density of 20%-30% were selected and cultured for 18 hrs in DMEM containing 2mM Thymidine for the first block. After washing twice with PBS, replace the culture medium with fresh DMEM. After 9 hrs, cells were cultured again with 2mM Thymidine for 18 hrs for a second block. At this time, cells had been synchronized in the G1/S phase, and after PBS washing twice, they were replaced with thymidine-free DMEM, and the cell cycle began to release. The cells were sampled at the indicated times and subjected to flow cytometric analysis before other measurements.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eFor apoptosis detection, the Apoptosis Detection Kit (Yeason, China) was used to stain the cells.\u003c/p\u003e \u003cp\u003eFor cell cycle analysis, cells were digested, centrifuged, suspended in 75% ethanol, and stored at -20℃ overnight. After fixation, centrifuge, and washing twice with PBS, 50mg/mL propyl iodide (PI) was added, mixed, and incubated for 15 min. Use a fluorescence-activated cell sorter (FACS Calibur) to analyze the cells\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSDS-PAGE and Western blotting\u003c/h2\u003e \u003cp\u003eWestern blotting and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were carried out by conventional procedures. In short, 100 mm plates containing exponentially developing cells were once cleaned with cold PBS and then immediately lysed in 1 mL of SDS loading buffer that contained 50 mM Tris-HCl pH 6.8, 10% v/v glycerol, 2% SDS (w/v), 4% β-mercaptoethanol, and 0.0012% bromophenol blue (w/v). Each sample was put through SDS-PAGE and then transferred to nitrocellulose membranes (GE Healthcare Life Science) for western blot analysis. After blocking the membranes for one hour at room temperature in 5% (w/v) skim milk in Tris-buffered saline containing 0.1% (v/v) Tween-20 (TBST), they were probed with primary antibodies overnight at 4\u0026deg;C in antibody dilution buffer (QuickBlockTM, Beyotime). Following an incubation period with secondary antibodies conjugated with horseradish peroxidase (HRP) in TBST (including 5% skim milk), membranes were visualized using the Typhoon system (GE Healthcare Life Science) and developed using ECL-Plus (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eHypoxia\u003c/h2\u003e \u003cp\u003eTransfer cells to a hypoxia incubator (ThermoFisher Scientific, USA). Cells were harvested at a specified time point no more than 8 hours after hypoxia exposure.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT-PCR\u003c/h2\u003e \u003cp\u003eExtract RNA from cells using FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme) and reverse-transcribe into cDNA. Using the ChamQ SYBR qPCR Master Mix kit (enzyme) for quantitative RT-PCR. Actin served as an internal reference standard. These primer sequences used are listed below.\u003c/p\u003e \u003cp\u003eActin:5\u0026rsquo;- CCTCTCCCAAGTCCACACAG \u0026minus;\u0026thinsp;3\u0026rsquo;(sense),\u003c/p\u003e \u003cp\u003e5\u0026rsquo;- GGGCACGAAGGCTCATCATT \u0026minus;\u0026thinsp;3\u0026rsquo; (antisense);\u003c/p\u003e \u003cp\u003eCDH1:5\u0026rsquo;- CCGTTCGACAAAGGAGTCTGT \u0026minus;\u0026thinsp;3\u0026rsquo;(sense),\u003c/p\u003e \u003cp\u003e5\u0026rsquo;- GGAAGGCAGAGTCCATGCAA \u0026minus;\u0026thinsp;3\u0026rsquo; (antisense);\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation\u003c/h2\u003e \u003cp\u003eCells were co-transfected with the target gene plasmid for 36 hrs. Cell lysate was prepared by lysing cells in a suitable buffer. The lysate was added to Flag-beads, and gently rotated at 4\u0026deg;C to facilitate antibody-antigen binding. After incubation, the beads are washed to remove unbound proteins. Finally, the bound antigen-antibody complexes are eluted from the beads for western blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo ubiquitination assay\u003c/h2\u003e \u003cp\u003eCells were subjected to co-transfection with the target gene-containing plasmid for a duration of 36 hours. MG132 was added into the system at a terminal concentration of 10\u0026micro;M and incubated for 4\u0026ndash;6 hrs before harvesting. Lysis was performed in ubiquitinated lysis buffer containing 1 mM DTT, mixed by blowing, and boiled at 99 ℃ for 5 min until the cell clusters became clear. Centrifuge for 10 minutes at 4\u0026deg;C (12,000 rpm). Lysates were diluted in Tris-HCl before immunoprecipitation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEdu staining\u003c/h2\u003e \u003cp\u003eAfter culturing U87MG cells at a concentration suitable for their proliferation, EDU was incorporated into a medium and allowed to incubate for one hour. After harvesting the cells, the leftover media was removed by twice washing them in PBS. Fix cells at room temperature in 4% paraformaldehyde. The cocktail (215 \u0026micro;L of PBS, 10 \u0026micro;L of 100 mM CuSO4, 0.6 \u0026micro;L of 2 mM Azide, and 25 \u0026micro;L Sodium Ascorbate). After that, Hoechst 33342 was added for nuclear staining. Use a fluorescence microscope to visually inspect cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCRISPR/Cas9 editing for the production of knockout cells\u003c/h2\u003e \u003cp\u003eBy cloning the annealed sgRNA into the px459 vector, the plasmid was created. The CRISPR Design website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://crispr.mit.edu\u003c/span\u003e\u003cspan address=\"http://crispr.mit.edu\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was utilized to design the sgRNAs. HeLa cells were transfected with guide RNAs, and after 36 hours, the cells were selected using 2 \u0026micro;g/mL puromycin (Amresco). The remaining cells were taken after three days and sown at a density of one cell per well into a 96-well plate. Western blotting was utilized to confirm the knockouts.\u003c/p\u003e \u003cp\u003eTo generate HIF-1α-knockout HeLa cells, we used the following guide sequence targeting the human HIF-1α, 5\u0026prime;-CACCGTTCTTTACTTCGCCGAGATC-3\u0026prime;. To generate EGLN2-knockout HeLa cells, we used the following guide sequence targeting the human EGLN2, 5\u0026prime;-CACCGCAGCCGCAGCCCCTAAGTC-3\u0026prime;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical methods\u003c/h2\u003e \u003cp\u003eWe use Prism 6.0 software to perform statistical analysis. We use Image J to adjust the picture.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eIDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG promote CDH1 proteasomal degradation\u003c/h2\u003e\n\u003cp\u003eFirst, we investigated how IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG regulate CDH1 levels. IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expression and 2-HG treatment resulted in a notable reduction in endogenous CDH1 levels and an increase in CDH1 substrates, named VHL and cyclin A\u003csub\u003e2\u003c/sub\u003e(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea,b). AGI5198, an inhibitor of IDH1\u003csup\u003eR132H\u003c/sup\u003e neo-enzymatic activity and 2-HG production, reversed the effects of IDH1\u003csup\u003eR132H\u003c/sup\u003e expression on CDH1 levels(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec). To explore the mechanism by which 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e regulate the protein levels of CDH1, we treated cells with cycloheximide (CHX), a protein translation inhibitor, to inhibit protein synthesis. We found that CHX failed to prevent CDH1 degradation. 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expression significantly reduced CDH1 half-life, destabilized CDH1 protein, and promoted its degradation(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed,e), confirming the role of 2-HG in regulating CDH1 stability. Additionally, treatment with MG132, a proteasome inhibitor, increased endogenous CDH1 levels, preventing downregulation by 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef, g). Ubiquitination assay revealed that MG132 increased ubiquitination levels of ectopically expressed CDH1, with additional enhancement by 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e over-expression(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eh, i). These findings collectively confirm that 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e promote the ubiquitin-proteasome degradation of CDH1, which leads to low levels of CDH1.\u003c/p\u003e\n\u003cp\u003eCDH1 can decrease DNA synthesis[\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. We further investigated whether 2-HG influenced DNA synthesis. Employing EDU staining as a method for tracking DNA synthesis progress, we observed that both IDH1\u003csup\u003eR132H\u003c/sup\u003e overexpression and supplementation with 20mM 2-HG increased DNA synthesis in U87MG cells(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ej,k). These findings were consistent with the observation that IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG decreased CDH1 protein levels.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003e\u0026alpha;-KG and hypoxia regulate CDH1 protein levels\u003c/h2\u003e\n\u003cp\u003eThe sole structural distinction between 2-HG and \u0026alpha;-KG lies in the substitution of hydroxyl groups for oxygen atoms bonded to C2 in \u0026alpha;-KG. To explore if \u0026alpha;-KG regulates CDH1 opposite to 2-HG, cells were cultured in a glutamine-deficient medium to decrease intracellular \u0026alpha;-KG levels, followed by a dose-dependent \u0026alpha;-KG manner. \u0026alpha;-KG treatment increased endogenous CDH1 levels (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea) and reversed 2-HG-induced CDH1 decrease(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb). These results collectively confirmed that 2-HG regulated CDH1 levels by inhibiting \u0026alpha;-KG.\u003c/p\u003e\n\u003cp\u003eAlmost all solid tumors develop a hypoxia phenotype in the intratumoral region, and cancer cells use hypoxia to defend against immune cell attacks, which leads to immune escape and therapeutic resistance[\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. We next investigated oxygen's impact on CDH1 regulation. Hypoxia time-dependently reduced CDH1 expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec), which was reversed by \u0026alpha;-KG supplementation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). These observations supported the assumption that CDH1 levels were positively regulated by oxygen. Moreover, CDH1 mRNA levels did not change upon hypoxia stimulation(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee). Treatment with the MG132 elevated endogenous CDH1 levels, counteracting hypoxia-induced downregulation(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ef). Furthermore, hypoxia increased CDH1 ubiquitination levels(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg). These observations confirmed that hypoxia controls CDH1 degradation by the ubiquitin-proteasome pathway.\u003c/p\u003e\n\u003cp\u003eCDH1 undergoes phosphorylation on specific serine and threonine residues by kinases, facilitating its recognition by the E3 ligase prior to degradation[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Indeed, we observed upregulation of CDH1 phosphorylation levels by 2-HG(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eh). It is reported that CDH1 was phosphorylated on four conserved sites.(Ser40, Thr121, Ser151, Ser163)[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]. We found that replacing the four phosphorylation sites with alanine(CDH1\u003csup\u003e4A\u003c/sup\u003e), abolished hypoxia-induced higher ubiquitination levels in CDH1\u003csup\u003e4A\u003c/sup\u003e(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ei). These collectively confirmed hypoxia\u0026rsquo;s role in enhancing CDH1 degradation via increased phosphorylation.\u003c/p\u003e\n\u003cp\u003eIDH1 mutations and hypoxia could elevate HIF-1\u0026alpha; levels[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e], indicating a potential involvement of HIF-1\u0026alpha; in 2-HG function. To address this problem, we treated HeLa cells with 2-HG and hypoxia stimulation in wild-type and HIF-1\u0026alpha; knockout(KO) cells. Interestingly, 2-HG and hypoxia still down-regulated CDH1 levels in HIF-1\u0026alpha;-KO HeLa cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ej,k). In addition, HIF-1\u0026alpha; had no impact on the regulation of CDH1 by \u0026alpha;-KG(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003el), confirming HIF-1\u0026alpha; independence in the regulatory mechanism of 2-HG and oxygen on CDH1.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003e2-HG decreases CDH1 protein by inhibiting EGLN2\u003c/h2\u003e\n\u003cp\u003eIn the previous studies, we confirmed the positive regulatory effects of \u0026alpha;-KG and oxygen on CDH1. PHD enzymes, crucial for HIF-1\u0026alpha; degradation, rely on both \u0026alpha;-KG and oxygen as substrates. Next, we investigated the role of PHDs in regulating CDH1. Co-immunoprecipitation assays revealed that PHDs could interact with CDH1(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). However, hypoxia decreased endogenous CDH1 levels and only EGLN2 could rescue the decreased CDH1 levels induced by hypoxia (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb), suggesting EGLN2 could improve CDH1 stability by integrating oxygen. Moreover, EGLN2 overexpression abrogated 2-HG to stabilize CDH1 levels(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec) and decreased the ubiquitination of CDH1(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed). Knockout EGLN2 decreased endogenous CDH1 levels(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee). Furthermore, EGLN2 ablation rendered CDH1 levels irresponsive to 2-HG(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ef), confirming that EGLN2 regulates CDH1 stability. These results suggested that CDH1 was specifically regulated by EGLN2.\u003c/p\u003e\n\u003cp\u003eDMOG, a prodrug of N-oxalylglycine (NOG), acts as a hypoxia-inducing agent by inhibiting prolyl hydroxylases (PHD), while CoCl\u003csub\u003e2\u003c/sub\u003e chelates metal ions to disrupt \u0026alpha;-KG-dependent hydroxylase function. Both DMOG and CoCl\u003csub\u003e2\u003c/sub\u003e supplementation resulted in decreased CDH1 levels but elevated VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e levels in U87MG cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eg, h). Moreover, DMOG increased CDH1 ubiquitination levels(Supplementary Fig.\u0026nbsp;1). These findings collectively confirmed that 2-HG regulates CDH1 levels by inhibiting EGLN2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003e2-HG leads to the cell cycle arrest\u003c/h2\u003e\n\u003cp\u003eCDH1 is expressed to primarily regulate the mitotic exit and the G1/S transition[\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]. To examine 2-HG\u0026rsquo;s impact on the tumor cell cycle, we synchronized HeLa cells to the G1/S boundary and released them with or without 2-HG supplementation. 2-HG treatment disrupted cell cycle progression compared to the normal process (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea). HeLa cells with 2-HG supplementation transitioned faster from G1 to S phase but were arrested at M phase, unable to exit the cell cycle (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e\n\u003cp\u003ePost-release of double thymidine-synchronized G1/S phase cells, CDH1 levels decreased after transiting from G1 to S phase and rose during G2/M phase. VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e levels, downstream substrates of CDH1, exhibited an inverse correlation with CDH1(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec). Upon release of arrested HeLa cells accompanied by 2-HG treatment, CDH1 levels remained unchanged throughout cell cycle progression. VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e ceased to decline in the M phase and remained at high levels(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). CDH1 and its substrates were unable to function normally. These findings demonstrated that 2-HG disrupted the cell cycle, delaying progression through the M phase by reducing CDH1 levels. Furthermore, an analysis of the cell cycle phase distribution after treatment with 2-HG showed a heightened proportion of HeLa cells occupying the S and G2/M stages. It was observed that CDH1 overexpression notably augmented the proportion of cells residing in the G1 phase. The cell cycle arrest induced by 2-HG was rescued by CDH1 overexpression(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee).\u003c/p\u003e\n\u003cp\u003eWe next investigated the impact of IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin and 2-HG supplementation on cell growth. Our results demonstrated that HeLa cell growth was inhibited by both IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin and 2-HG supplementation. Interestingly, IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin strains exhibited increased sensitivity to 2-HG(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ef). Downregulation of EGLN2 suppressed cancer cell proliferation[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. As expected, EGLN2 knockout strains proliferation was markedly reduced. EGLN2 knockout abolished the inhibitory effect of 2-HG on cell growth. (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eg). Additionally, IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG induced apoptosis in HeLa cells(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eh). All these results confirmed that IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG inhibited cell proliferation and promoted apoptosis by decreasing CDH1 protein levels.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur data indicate that 2-HG, produced by IDH1\u003csup\u003eR132H\u003c/sup\u003e in gliomas, inhibited the proline hydroxylase EGLN2 activity, resulting in reduced CDH1 protein levels by ubiquitin-proteasome pathway and finally arrested the cell cycle. EGLN2 could stabilize CDH1, inhibiting the degradation of CDH1. Consequently, sustained low levels of CDH1 induced by 2-HG halted the cell cycle, impeding tumor development. These findings offer a theoretical basis for the improved prognosis observed in patients with IDH1\u003csup\u003eR132H\u003c/sup\u003e mutations(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMutations in the IDH1 are common in various tumors. Most cancer-associated IDH1 mutations occur at the well-known site R132, which is characterized by reducing α-KG to the carcinogenic metabolite 2-HG. Glioblastoma patients with IDH1\u003csup\u003eR132H\u003c/sup\u003e mutations have some unique clinical characteristics, such as markedly better clinical prognosis and younger age[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], but the reason remains unclear. This study focuses on this phenomenon to explore the mechanism of IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation and 2-HG in it.\u003c/p\u003e \u003cp\u003eWe observed that IDH1\u003csup\u003eR132H\u003c/sup\u003e and 2-HG increased CDH1 proteasomal degradation, resulting in elevated levels of CDH1 substrates such as VHL and Cyclin A\u003csub\u003e2\u003c/sub\u003e. These observations align with the overexpression of various CDH1 substrates, including DNA replication factors[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], mitotic kinases[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], and mitotic and S phase cyclins[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], which are commonly observed in a broad range of human malignancies.\u003c/p\u003e \u003cp\u003eThe sole structural distinction between 2-HG and α-KG lies in the substitution of hydroxyl groups for oxygen atoms bonded to C2 in α-KG. This similarity implies that 2-HG might inhibit prolyl hydroxylases (PHD), which catalyze proline hydroxylation using α-KG and oxygen. Our findings suggested that both α-KG and oxygen independently increased CDH1 expression, regardless of HIF-1α. Furthermore, we observed that hypoxia enhanced CDH1 phosphorylation levels. Efficient cell-cycle progression requires a significant reduction in APC/C\u003csup\u003eCDH1\u003c/sup\u003e activity as cells transition from G1 to S-phase. This reduced activity is achieved primarily through the hyperphosphorylation of CDH1 by cyclin-dependent kinases (CDK) in late G1, which inhibits the interaction of CDH1 with the APC/C[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. We showed that after mutating four phosphorylation sites to alanine, hypoxia failed to increase CDH1\u003csup\u003e4A\u003c/sup\u003e degradation. Recent reports have also emphasized elevated CyclinD-CDK4/6 activity in human cancer cells, attributing it to the inactivation of APC/C\u003csup\u003eCDH1\u003c/sup\u003e through hyperphosphorylation of CDH1[33\u003csup\u003e,\u003c/sup\u003e34].\u003c/p\u003e \u003cp\u003eFurthermore, our findings indicated that EGLN2 positively regulated CDH1 protein levels. 2-HG disrupted the cell cycle by interfering with EGLN2-mediated hydroxylation of CDH1. Inhibition of EGLN2 has been shown to disrupt the cell cycle; for instance, EGLN2 regulates cyclin D1 protein levels independently of HIF[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Loss of EGLN2 inhibits mitotic progression by inducing mitotic spindle disorganization[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We propose that the E3 ligase preferentially targets un-hydroxylated CDH1, which is produced when EGLN2 is inhibited, for degradation, thereby linking α-KG inhibition and hypoxia to aneuploidy. Our findings demonstrated that CDH1 prolyl hydroxylation by EGLN2 inhibited its proteasomal degradation, contrasting with HIF-1α, whose prolyl hydroxylation by EGLN2 promotes its proteasomal degradation[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. To our knowledge, this is the first example that prolylhydroxylation stabilizes a protein, and it makes physiologic sense given that high oxygen and KG signals would facilitate cell proliferation, in which high CDH1 levels and smooth chromosome segregation are required.\u003c/p\u003e \u003cp\u003eIn this study, we demonstrated that both 2-HG and IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin inhibited HeLa proliferation, with IDH1\u003csup\u003eR132H\u003c/sup\u003e knockin cells showing greater sensitivity to 2-HG treatment. Additionally, Pianka et al.[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] proposed a distinct mechanism for 2-HG-mediated inhibition of IDH1mut glioma growth, suggesting that 2-HG can reduce glioma growth by inhibiting the m6A demethylase, FTO. Additionally, EGLN2 knockout showed no response to 2-HG supplementation in our study. Moreover, our results indicated that both 2-HG and exogenous overexpression of IDH1\u003csup\u003eR132H\u003c/sup\u003e promoted cell apoptosis. These findings are consistent with 2-HG's inhibition of mTOR signaling and ATP synthase, resulting in growth arrest and tumor suppression[39\u003csup\u003e,\u003c/sup\u003e40]. Apoptosis and cell cycle arrest are well-known mechanisms for inhibiting cell growth, while chromosomal aneuploidy is frequently observed in solid tumors[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], indicative of aberrant cell cycle progression. Our study uncovered that 2-HG induced cell cycle arrest, notably impeding exit from the M phase, and diminished CDH1 levels. APC/C\u003csup\u003eCDH1\u003c/sup\u003e, a key regulator of the cell cycle, governs the stability of M and G1 phases[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The precise segregation of chromosomes during the M phase is crucial to prevent the acquisition of abnormal karyotypes by daughter cells[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Our findings implied that dysregulation of CDH1 by 2-HG may potentially trigger aneuploidy in pathological samples from patients with IDH1 mutations. Further investigation into the specific mechanisms involved will be pursued in our follow-up studies.\u003c/p\u003e \u003cp\u003eWe observed that 2-HG increased DNA synthesis. This aligns with previous studies indicating that 2-HG contributes to metabolic reprogramming, including nucleotide synthesis utilization and DNA repair capacity[44\u003csup\u003e,\u003c/sup\u003e45]. The degradation of CDH1 by ubiquitination induced by 2-HG leads to cell cycle arrest, which could be rescued by CDH1 overexpression. This disruption can result in errors during DNA replication in S phase and missegregation of sister chromatids, ultimately leading to chromosome aneuploidy.\u003c/p\u003e \u003cp\u003eThese results provide insights into why IDH1 mutation carriers exhibit longer survival rates: lower CDH1 levels and a slower cell division process induced by 2-HG delay tumor development, contributing to prolonged survival. We speculate that cell cycle arrest triggered by 2-HG may represent a suppressive mechanism against tumor development within the body.\u003c/p\u003e \u003cp\u003eIn summary, our study elucidates that the accumulation of the metabolite 2-HG, induced by IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation in glioblastoma patients, leads to the phosphorylation and subsequent degradation of CDH1 through inhibition of hydroxylation by EGLN2, ultimately causing cell cycle arrest at the M phase and inhibiting cell proliferation. This provides a theoretical basis for the extended survival observed in IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation patients and sheds light on the molecular mechanism underlying oxygen's regulation of the cell cycle.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003eIDH1:\u003c/strong\u003e Isocitrate dehydrogenase 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2-HG:\u003c/strong\u003e D-2-hydroxyglutarate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026alpha;-KG\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e \u0026alpha;-ketoglutarate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCDH1: \u003c/strong\u003eCDC20 homologue-1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAPC/C:\u003c/strong\u003e Anaphase-Promoting Complex/Cyclosome\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCHX: \u003c/strong\u003eCycloheximide\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePHD: \u003c/strong\u003eProlyl hydroxylase domain protein family\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHIF-1\u0026alpha;: \u003c/strong\u003eHypoxia-inducible factor 1-alpha\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDTB: \u003c/strong\u003eDouble thymidine block\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVHL: \u003c/strong\u003eVon Hippel-Lindau\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDMOG: \u003c/strong\u003eDimethyloxaloylglycine\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the National Key Research and Development Program youth project, grant number 2018YFA0801300.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMeng-qi You wrote the main manuscript and performed the biochemical cell biologic experiments. Wei Xu conceived the project and received funding for the study. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUpon a reasonable request, the corresponding author can provide access to the datasets utilized and/or examined in the present study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no human or animal experiment in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003evan den Bent, M.J.; Smits, M.; Kros, J.M.; Chang, S.M. Diffuse Infiltrating Oligodendroglioma and Astrocytoma. \u003cem\u003eJ. Clin. Oncol.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 35, 2394-2401, doi:10.1200/JCO.2017.72.6737.\u003c/li\u003e\n\u003cli\u003eWen, P.Y.; Weller, M.; Lee, E.Q.; Alexander, B.M.; Barnholtz-Sloan, J.S.; Barthel, F.P.; Batchelor, T.T.; Bindra, R.S.; Chang, S.M.; Chiocca, E.A. et al. Glioblastoma in adults: a Society for Neuro-Oncology (SNO) and European Society of Neuro-Oncology (EANO) consensus review on current management and future directions. \u003cem\u003eNeuro-Oncology\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 22, 1073-1113, doi:10.1093/neuonc/noaa106.\u003c/li\u003e\n\u003cli\u003eWatanabe, T.; Vital, A.; Nobusawa, S.; Kleihues, P.; Ohgaki, H. Selective acquisition of IDH1 R132C mutations in astrocytomas associated with Li-Fraumeni syndrome. \u003cem\u003eActa Neuropathol.\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 117, 653-656, doi:10.1007/s00401-009-0528-x.\u003c/li\u003e\n\u003cli\u003eShi, J.; Zuo, H.; Ni, L.; Xia, L.; Zhao, L.; Gong, M.; Nie, D.; Gong, P.; Cui, D.; Shi, W. et al. An IDH1 mutation inhibits growth of glioma cells via GSH depletion and ROS generation. \u003cem\u003eNeurol. Sci.\u003c/em\u003e \u003cstrong\u003e2014\u003c/strong\u003e, 35, 839-845, doi:10.1007/s10072-013-1607-2.\u003c/li\u003e\n\u003cli\u003eSongTao, Q.; Lei, Y.; Si, G.; YanQing, D.; HuiXia, H.; XueLin, Z.; LanXiao, W.; Fei, Y. IDH mutations predict longer survival and response to temozolomide in secondary glioblastoma. \u003cem\u003eCancer Sci.\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 103, 269-273, doi:10.1111/j.1349-7006.2011.02134.x.\u003c/li\u003e\n\u003cli\u003eYan, H.; Parsons, D.W.; Jin, G.; McLendon, R.; Rasheed, B.A.; Yuan, W.; Kos, I.; Batinic-Haberle, I.; Jones, S.; Riggins, G.J. et al. IDH1 and IDH2 mutations in gliomas. \u003cem\u003eN. Engl. J. Med.\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 360, 765-773, doi:10.1056/NEJMoa0808710.\u003c/li\u003e\n\u003cli\u003eWeller, M.; Felsberg, J.; Hartmann, C.; Berger, H.; Steinbach, J.P.; Schramm, J.; Westphal, M.; Schackert, G.; Simon, M.; Tonn, J.C. et al. Molecular predictors of progression-free and overall survival in patients with newly diagnosed glioblastoma: a prospective translational study of the German Glioma Network. \u003cem\u003eJ. Clin. Oncol.\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 27, 5743-5750, doi:10.1200/JCO.2009.23.0805.\u003c/li\u003e\n\u003cli\u003eCombs, S.E.; Rieken, S.; Wick, W.; Abdollahi, A.; von Deimling, A.; Debus, J.; Hartmann, C. Prognostic significance of IDH-1 and MGMT in patients with glioblastoma: one step forward, and one step back? \u003cem\u003eRadiat. Oncol.\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, 6, 115, doi:10.1186/1748-717X-6-115.\u003c/li\u003e\n\u003cli\u003eTaylor, A.M.; Shih, J.; Ha, G.; Gao, G.F.; Zhang, X.; Berger, A.C.; Schumacher, S.E.; Wang, C.; Hu, H.; Liu, J. et al. Genomic and Functional Approaches to Understanding Cancer Aneuploidy. \u003cem\u003eCancer Cell\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 33, 676-689, doi:10.1016/j.ccell.2018.03.007.\u003c/li\u003e\n\u003cli\u003ede Boer, H.R.; Guerrero, L.S.; van Vugt, M.A. Controlling the response to DNA damage by the APC/C-Cdh1. \u003cem\u003eCell. Mol. Life Sci.\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, 73, 949-960, doi:10.1007/s00018-015-2096-7.\u003c/li\u003e\n\u003cli\u003eBhavya, B.; Anand, C.R.; Madhusoodanan, U.K.; Rajalakshmi, P.; Krishnakumar, K.; Easwer, H.V.; Deepti, A.N.; Gopala, S. To be Wild or Mutant: Role of Isocitrate Dehydrogenase 1 (IDH1) and 2-Hydroxy Glutarate (2-HG) in Gliomagenesis and Treatment Outcome in Glioma. \u003cem\u003eCell. Mol. Neurobiol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 40, 53-63, doi:10.1007/s10571-019-00730-3.\u003c/li\u003e\n\u003cli\u003eLee, F.S.; Percy, M.J. The HIF pathway and erythrocytosis. \u003cem\u003eAnnu. Rev. Pathol.\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, 6, 165-192, doi:10.1146/annurev-pathol-011110-130321.\u003c/li\u003e\n\u003cli\u003eMinamishima, Y.A.; Moslehi, J.; Bardeesy, N.; Cullen, D.; Bronson, R.T.; Kaelin, W.J. Somatic inactivation of the PHD2 prolyl hydroxylase causes polycythemia and congestive heart failure. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 111, 3236-3244, doi:10.1182/blood-2007-10-117812.\u003c/li\u003e\n\u003cli\u003eRantanen, K.; Pursiheimo, J.; Hogel, H.; Himanen, V.; Metzen, E.; Jaakkola, P.M. Prolyl hydroxylase PHD3 activates oxygen-dependent protein aggregation. \u003cem\u003eMol. Biol. Cell.\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 19, 2231-2240, doi:10.1091/mbc.e07-11-1124.\u003c/li\u003e\n\u003cli\u003eSchlisio, S.; Kenchappa, R.S.; Vredeveld, L.C.; George, R.E.; Stewart, R.; Greulich, H.; Shahriari, K.; Nguyen, N.V.; Pigny, P.; Dahia, P.L. et al. The kinesin KIF1Bbeta acts downstream from EglN3 to induce apoptosis and is a potential 1p36 tumor suppressor. \u003cem\u003eGenes. Dev.\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 22, 884-893, doi:10.1101/gad.1648608.\u003c/li\u003e\n\u003cli\u003eSchofield, C.J.; Ratcliffe, P.J. Oxygen sensing by HIF hydroxylases. \u003cem\u003eNat. Rev. Mol. Cell Biol.\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, 5, 343-354, doi:10.1038/nrm1366.\u003c/li\u003e\n\u003cli\u003eShi, J.; Sun, B.; Shi, W.; Zuo, H.; Cui, D.; Ni, L.; Chen, J. Decreasing GSH and increasing ROS in chemosensitivity gliomas with IDH1 mutation. \u003cem\u003eTumour Biol\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, 36, 655-662, doi:10.1007/s13277-014-2644-z.\u003c/li\u003e\n\u003cli\u003eFujita, T.; Liu, W.; Doihara, H.; Wan, Y. Regulation of Skp2-p27 axis by the Cdh1/anaphase-promoting complex pathway in colorectal tumorigenesis. \u003cem\u003eAm. J. Pathol.\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 173, 217-228, doi:10.2353/ajpath.2008.070957.\u003c/li\u003e\n\u003cli\u003eBassermann, F.; Frescas, D.; Guardavaccaro, D.; Busino, L.; Peschiaroli, A.; Pagano, M. The Cdc14B-Cdh1-Plk1 axis controls the G2 DNA-damage-response checkpoint. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 134, 256-267, doi:10.1016/j.cell.2008.05.043.\u003c/li\u003e\n\u003cli\u003eDe K; Grubb, T.M.; Zalenski, A.A.; Pfaff, K.E.; Pal, D.; Majumder, S.; Summers, M.K.; Venere, M. Hyperphosphorylation of CDH1 in Glioblastoma Cancer Stem Cells Attenuates APC/C(CDH1) Activity and Pharmacologic Inhibition of APC/C(CDH1/CDC20) Compromises Viability. \u003cem\u003eMol. Cancer Res.\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 17, 1519-1530, doi:10.1158/1541-7786.MCR-18-1361.\u003c/li\u003e\n\u003cli\u003eVenere, M.; Horbinski, C.; Crish, J.F.; Jin, X.; Vasanji, A.; Major, J.; Burrows, A.C.; Chang, C.; Prokop, J.; Wu, Q. et al. The mitotic kinesin KIF11 is a driver of invasion, proliferation, and self-renewal in glioblastoma. \u003cem\u003eSci. Transl. Med.\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, 7, 304ra143, doi:10.1126/scitranslmed.aac6762.\u003c/li\u003e\n\u003cli\u003eLi, Y.; Yao, C.F.; Xu, F.J.; Qu, Y.Y.; Li, J.T.; Lin, Y.; Cao, Z.L.; Lin, P.C.; Xu, W.; Zhao, S.M. et al. APC/C(CDH1) synchronizes ribose-5-phosphate levels and DNA synthesis to cell cycle progression. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 10, 2502, doi:10.1038/s41467-019-10375-x.\u003c/li\u003e\n\u003cli\u003eAnderson, N.M.; Simon, M.C. The tumor microenvironment. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 30, R921-R925, doi:10.1016/j.cub.2020.06.081.\u003c/li\u003e\n\u003cli\u003ePal, D.; Torres, A.E.; Stromberg, B.R.; Messina, A.L.; Dickson, A.S.; De K; Willard, B.; Venere, M.; Summers, M.K. Chk1-mediated phosphorylation of Cdh1 promotes the SCF(betaTRCP)-dependent degradation of Cdh1 during S-phase and efficient cell-cycle progression. \u003cem\u003eCell Death Dis.\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, 11, 298, doi:10.1038/s41419-020-2493-1.\u003c/li\u003e\n\u003cli\u003eHein, J.B.; Hertz, E.; Garvanska, D.H.; Kruse, T.; Nilsson, J. Distinct kinetics of serine and threonine dephosphorylation are essential for mitosis. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 19, 1433-1440, doi:10.1038/ncb3634.\u003c/li\u003e\n\u003cli\u003eZhao, S.; Lin, Y.; Xu, W.; Jiang, W.; Zha, Z.; Wang, P.; Yu, W.; Li, Z.; Gong, L.; Peng, Y. et al. Glioma-derived mutations in IDH1 dominantly inhibit IDH1 catalytic activity and induce HIF-1alpha. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 324, 261-265, doi:10.1126/science.1170944.\u003c/li\u003e\n\u003cli\u003eSeth, P.; Krop, I.; Porter, D.; Polyak, K. Novel estrogen and tamoxifen induced genes identified by SAGE (Serial Analysis of Gene Expression). \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e2002\u003c/strong\u003e, 21, 836-843, doi:10.1038/sj.onc.1205113.\u003c/li\u003e\n\u003cli\u003eNeftel, C.; Laffy, J.; Filbin, M.G.; Hara, T.; Shore, M.E.; Rahme, G.J.; Richman, A.R.; Silverbush, D.; Shaw, M.L.; Hebert, C.M. et al. An Integrative Model of Cellular States, Plasticity, and Genetics for Glioblastoma. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 178, 835-849, doi:10.1016/j.cell.2019.06.024.\u003c/li\u003e\n\u003cli\u003ePetersen, B.O.; Wagener, C.; Marinoni, F.; Kramer, E.R.; Melixetian, M.; Lazzerini, D.E.; Gieffers, C.; Matteucci, C.; Peters, J.M.; Helin, K. Cell cycle- and cell growth-regulated proteolysis of mammalian CDC6 is dependent on APC-CDH1. \u003cem\u003eGenes. Dev.\u003c/em\u003e \u003cstrong\u003e2000\u003c/strong\u003e, 14, 2330-2343, doi:10.1101/gad.832500.\u003c/li\u003e\n\u003cli\u003eLindon, C.; Pines, J. Ordered proteolysis in anaphase inactivates Plk1 to contribute to proper mitotic exit in human cells. \u003cem\u003eJ. Cell. Biol.\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, 164, 233-241, doi:10.1083/jcb.200309035.\u003c/li\u003e\n\u003cli\u003eGeley, S.; Kramer, E.; Gieffers, C.; Gannon, J.; Peters, J.M.; Hunt, T. Anaphase-promoting complex/cyclosome-dependent proteolysis of human cyclin A starts at the beginning of mitosis and is not subject to the spindle assembly checkpoint. \u003cem\u003eJ. Cell. Biol.\u003c/em\u003e \u003cstrong\u003e2001\u003c/strong\u003e, 153, 137-148, doi:10.1083/jcb.153.1.137.\u003c/li\u003e\n\u003cli\u003eAmon, A.; Irniger, S.; Nasmyth, K. Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e1994\u003c/strong\u003e, 77, 1037-1050, doi:10.1016/0092-8674(94)90443-x.\u003c/li\u003e\n\u003cli\u003eThe, I.; Ruijtenberg, S.; Bouchet, B.P.; Cristobal, A.; Prinsen, M.B.; van Mourik, T.; Koreth, J.; Xu, H.; Heck, A.J.; Akhmanova, A. et al. Rb and FZR1/Cdh1 determine CDK4/6-cyclin D requirement in C. elegans and human cancer cells. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, 6, 5906, doi:10.1038/ncomms6906.\u003c/li\u003e\n\u003cli\u003eWan, L.; Chen, M.; Cao, J.; Dai, X.; Yin, Q.; Zhang, J.; Song, S.J.; Lu, Y.; Liu, J.; Inuzuka, H. et al. The APC/C E3 Ligase Complex Activator FZR1 Restricts BRAF Oncogenic Function. \u003cem\u003eCancer Discov.\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 7, 424-441, doi:10.1158/2159-8290.CD-16-0647.\u003c/li\u003e\n\u003cli\u003eZhang, Q.; Gu, J.; Li, L.; Liu, J.; Luo, B.; Cheung, H.W.; Boehm, J.S.; Ni, M.; Geisen, C.; Root, D.E. et al. Control of cyclin D1 and breast tumorigenesis by the EglN2 prolyl hydroxylase. \u003cem\u003eCancer Cell\u003c/em\u003e \u003cstrong\u003e2009\u003c/strong\u003e, 16, 413-424, doi:10.1016/j.ccr.2009.09.029.\u003c/li\u003e\n\u003cli\u003eMoser, S.C.; Bensaddek, D.; Ortmann, B.; Maure, J.F.; Mudie, S.; Blow, J.J.; Lamond, A.I.; Swedlow, J.R.; Rocha, S. PHD1 links cell-cycle progression to oxygen sensing through hydroxylation of the centrosomal protein Cep192. \u003cem\u003eDev. Cell\u003c/em\u003e \u003cstrong\u003e2013\u003c/strong\u003e, 26, 381-392, doi:10.1016/j.devcel.2013.06.014.\u003c/li\u003e\n\u003cli\u003eKaelin, W.G. Proline hydroxylation and gene expression. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cstrong\u003e2005\u003c/strong\u003e, 74, 115-128, doi:10.1146/annurev.biochem.74.082803.133142.\u003c/li\u003e\n\u003cli\u003ePianka, S.T.; Li, T.; Prins, T.J.; Eldred, B.; Kevan, B.M.; Liang, H.; Zapanta, R.S.; Kornblum, H.I.; Nathanson, D.A.; Pellegrini, M. et al. D-2-HG Inhibits IDH1mut Glioma Growth via FTO Inhibition and Resultant m6A Hypermethylation. \u003cem\u003eCancer Res Commun\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, 4, 876-894, doi:10.1158/2767-9764.CRC-23-0271.\u003c/li\u003e\n\u003cli\u003eFu, X.; Chin, R.M.; Vergnes, L.; Hwang, H.; Deng, G.; Xing, Y.; Pai, M.Y.; Li, S.; Ta, L.; Fazlollahi, F. et al. 2-Hydroxyglutarate Inhibits ATP Synthase and mTOR Signaling. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, 22, 508-515, doi:10.1016/j.cmet.2015.06.009.\u003c/li\u003e\n\u003cli\u003eLiu, X.; Yamaguchi, K.; Takane, K.; Zhu, C.; Hirata, M.; Hikiba, Y.; Maeda, S.; Furukawa, Y.; Ikenoue, T. Cancer-associated IDH mutations induce Glut1 expression and glucose metabolic disorders through a PI3K/Akt/mTORC1-Hif1alpha axis. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, 16, e257090, doi:10.1371/journal.pone.0257090.\u003c/li\u003e\n\u003cli\u003eKristin A. Knouse, T.D.S.J. Aneuploidy in Cancer: Seq-ing Answers to Old Questions. \u003cem\u003eANNUAL REVIEW OF CANCER BIOLOGY\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, 335-354.\u003c/li\u003e\n\u003cli\u003eNakayama, K.I.; Nakayama, K. Ubiquitin ligases: cell-cycle control and cancer. \u003cem\u003eNat. Rev. Cancer\u003c/em\u003e \u003cstrong\u003e2006\u003c/strong\u003e, 6, 369-381, doi:10.1038/nrc1881.\u003c/li\u003e\n\u003cli\u003eLara-Gonzalez, P.; Westhorpe, F.G.; Taylor, S.S. The spindle assembly checkpoint. \u003cem\u003eCurr. Biol.\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 22, R966-R980, doi:10.1016/j.cub.2012.10.006.\u003c/li\u003e\n\u003cli\u003eYang, H.; Ye, D.; Guan, K.L.; Xiong, Y. IDH1 and IDH2 mutations in tumorigenesis: mechanistic insights and clinical perspectives. \u003cem\u003eClin. Cancer Res.\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, 18, 5562-5571, doi:10.1158/1078-0432.CCR-12-1773.\u003c/li\u003e\n\u003cli\u003eGarrett, M.; Sperry, J.; Braas, D.; Yan, W.; Le TM; Mottahedeh, J.; Ludwig, K.; Eskin, A.; Qin, Y.; Levy, R. et al. Metabolic characterization of isocitrate dehydrogenase (IDH) mutant and IDH wildtype gliomaspheres uncovers cell type-specific vulnerabilities. \u003cem\u003eCancer Metab.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, 6, 4, doi:10.1186/s40170-018-0177-4.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Isocitrate dehydrogenase 1, D-2-hydroxyglutarate, CDH1, EGLN2, Oxygen, Cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-4240423/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4240423/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlioblastoma (GBM) is a prevalent and lethal primary brain tumor. Patients with the IDH1\u003csup\u003eR132H\u003c/sup\u003e (isocitrate dehydrogenase 1) mutation exhibit extended survival and aneuploidy, yet the underlying mechanisms are unclear. Here, we reveal that the accumulation of D-2-hydroxyglutarate (2-HG) produced by IDH1\u003csup\u003eR132H\u003c/sup\u003e mutation induces the degradation of Fizzy-related protein1(FZR1 or CDH1) by inhibiting prolyl hydroxylase EGLN2 activity. CDH1 levels are stabilized by α-KG and oxygen, independent of HIF-1α, through EGLN2-mediated hydroxylation. This novel mechanism represents the first instance of prolyl hydroxylation stabilizing a protein. The 2-HG-EGLN2-CDH1 axis induces mitotic arrest and cell growth inhibition, potentially contributing to the extended survival observed in patients with IDH1\u003csup\u003eR132H\u003c/sup\u003e mutant GBM.\u003c/p\u003e","manuscriptTitle":"Control of CDH1 and IDH1mut glioblastoma cell cycle by D-2- hydroxyglutarate","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-19 18:24:23","doi":"10.21203/rs.3.rs-4240423/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"11c832cb-80fa-402f-b023-7f169c4649bb","owner":[],"postedDate":"April 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-19T18:24:25+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-19 18:24:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4240423","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4240423","identity":"rs-4240423","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}