CRISPR-Cas9 Mediated Knockout of LacZ Gene in Escherichia Coli for Enhanced Production of Asparaginase

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Genome editing with CRISPR-Cas9 offers a powerful approach for enhancing enzyme production in microorganisms. This study aimed to genetically engineer the lacZ gene in Escherichia coli using CRISPR-Cas9 to evaluate its impact on asparaginase production during submerged fermentation with rice bran serving as a glucose source. Both edited and wild-type E. coli strains were cultured at optimal conditions to produce and characterize asparaginase. The edited E. coli formed distinct colonies, displaying a blue phenotype when exposed to Cas9 without sgRNA or arabinose, yielding a total of 96 colonies. No colonies were observed when Cas9 and sgRNA were present without arabinose, while the addition of Cas9 and arabinose without sgRNA resulted in 309 blue colonies. With Cas9, sgRNA, and arabinose present, repair activation produced 114 distinct white colonies. The editing of the lacZ gene was validated through multiplex PCR and gel electrophoresis, with bands at 650 bp indicated lacZ gene editing, while bands at 1,100 bp indicated the wild-type. Asparaginase production was assessed using plate method assay, submerged fermentation using rice bran as a glucose source, and subsequent purification via ammonium sulfate precipitation and ion-exchange chromatography. Ion-exchange chromatography revealed enhanced purity and activity in the edited strain, with peak activity observed at an elution of 80 mL. The CRISPR-Cas9 edited strain exhibiting significantly higher enzyme activity (1.2 ± 0.002 U/ mL) compared to the wild-type (0.8 ± 0.005 U/mL). Both strains demonstrated maximum asparaginase activity at 40 o C and pH 7. This study concludes that CRISPR-Cas9 meditated lacZ gene editing in E. coli improves its ability to utilize rice bran as a substrate, significantly enhancing asparaginase production. These findings highlight the potential of genetic engineering and agricultural by-products for sustainable enzyme production.
Full text 126,131 characters · extracted from preprint-html · click to expand
CRISPR-Cas9 Mediated Knockout of LacZ Gene in Escherichia Coli for Enhanced Production of Asparaginase | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CRISPR-Cas9 Mediated Knockout of LacZ Gene in Escherichia Coli for Enhanced Production of Asparaginase Opeyemi Hannah Akindusoye, Ruth Chinasa Okafor, Adepeju Matilda Adekoya, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7802084/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Genome editing with CRISPR-Cas9 offers a powerful approach for enhancing enzyme production in microorganisms. This study aimed to genetically engineer the lacZ gene in Escherichia coli using CRISPR-Cas9 to evaluate its impact on asparaginase production during submerged fermentation with rice bran serving as a glucose source. Both edited and wild-type E. coli strains were cultured at optimal conditions to produce and characterize asparaginase. The edited E. coli formed distinct colonies, displaying a blue phenotype when exposed to Cas9 without sgRNA or arabinose, yielding a total of 96 colonies. No colonies were observed when Cas9 and sgRNA were present without arabinose, while the addition of Cas9 and arabinose without sgRNA resulted in 309 blue colonies. With Cas9, sgRNA, and arabinose present, repair activation produced 114 distinct white colonies. The editing of the lacZ gene was validated through multiplex PCR and gel electrophoresis, with bands at 650 bp indicated lacZ gene editing, while bands at 1,100 bp indicated the wild-type. Asparaginase production was assessed using plate method assay, submerged fermentation using rice bran as a glucose source, and subsequent purification via ammonium sulfate precipitation and ion-exchange chromatography. Ion-exchange chromatography revealed enhanced purity and activity in the edited strain, with peak activity observed at an elution of 80 mL. The CRISPR-Cas9 edited strain exhibiting significantly higher enzyme activity (1.2 ± 0.002 U/ mL) compared to the wild-type (0.8 ± 0.005 U/mL). Both strains demonstrated maximum asparaginase activity at 40 o C and pH 7. This study concludes that CRISPR-Cas9 meditated lacZ gene editing in E. coli improves its ability to utilize rice bran as a substrate, significantly enhancing asparaginase production. These findings highlight the potential of genetic engineering and agricultural by-products for sustainable enzyme production. CRISPR-Cas9 Escherichia coli LacZ gene Asparaginase Rice Bran Sustainable Enzyme Bioproduction Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 1. Introduction Enzymes play a critical role in industrial biotechnology due to their ability to catalyze a wide range of biochemical reactions, making them indispensable in sectors such as pharmaceuticals, food processing, biofuels, and environmental biotechnology (Katsimpouras and Stephanopoulos, 2021 ). Among the various enzymes, asparaginase holds particular importance due to its broad substrate specificity and capacity to catalyze reactions in both aqueous and non-aqueous environments (Lubkowski and Wlodawer, 2021 ). Asparaginase is an amidohydrolase enzyme that catalyzes the conversion of L-asparagine into aspartic acid and ammonia (Jia et al., 2021 ; Loch and Jaskolski, 2021 ). It is most commonly derived from bacteria, particularly Escherichia coli and Erwinia chrysanthemi (Maese and Rau, 2022 ). E. coli has long been a model organism in genetic engineering due to its rapid growth, well-studied genetics, and ease of manipulation (Ruiz and Silhavy, 2022 ). Recombinant DNA technology has enabled large-scale enzyme production in E. coli (Chen et al., 2021 ), yet wild-type strains often produce limited enzyme yields because of intrinsic metabolic regulation (Niazi and Magoola, 2023 ). CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR Associated Proteins 9) is a gene-editing tool that allows precise modifications of an organism’s genome, enabling the knockout or insertion of specific genes (Alamillo et al., 2023 ). Studies have demonstrated that CRISPR-Cas9 can achieve allelic exchange in E. coli with up to 65% efficiency and can also regulate gene expression through a nuclease-deficient Cas9 protein (Dong et al., 2021 ). Additionally, the use of sustainable, cost-effective substrates for microbial cultivation is becoming increasingly important (Sharma et al., 2020 ). In this context, agricultural waste products, such as rice bran, represent a viable alternative as an abundant and low-cost glucose source (Spaggiari et al., 2021 ). Utilizing rice bran as a substrate not only reduces production costs but also addresses environmental concerns by repurposing waste materials (Tan et al., 2023 ). This study proposes knocking out the lacZ gene in E. coli using CRISPR-Cas9 to investigate its effect on asparaginase production when cultivated with rice bran as the main carbon source. Ultimately, integrating gene editing with sustainable substrates could provide a cost-effective strategy for industrial enzyme production while promoting environmental sustainability. 2. Materials and Methods Out of the Blue kit was purchased from Bio-Rad Research Company, United States of America. Rice Bran was sourced from a local rice mill in Ogun State, Nigeria. All other reagents used were obtained commercially and of analytical grade. 2.1 CRISPR-Cas9 Genome Editing The Cas9 endonuclease enzyme locates the target DNA with the help of the single-guide RNA (sgRNA). The guide region of the sgRNA is designed to be complementary to the target DNA sequence, directing Cas9 to the precise cutting site. DNA Target 5' tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg 3' 3'atgtggttgc actggatagg gtaatgccag ttaggcggca aacaagggtg cctcttaggc 5' 20-nucleotide Protospacer 3'gttgc actggatagg gtaat 5' 5'caacg tgacctatcc catta 3' 3' guugc acuggauagg guaau 5' 5'caacg ugaccuaucc cauua 3' The Designed sgRNA 5'caacgugaccuaucccauua3' 5'GUUUUAGAGCUAGA AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGCUUUUUU3' Donor Template DNA Inserted sequence: tgcgcccatc 3' |homology arm | 5'tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg3' 5' |homology arm| 3'atgtggttgc actggatagg gtaatgccag ttaggcggca aacaagggtg cctcttaggc5' 5' homology arm: ctatcc cattacggt 3' homology arm: tacggtc aatccgcc Donor Template Deleted base ctatcc cattacggt tgcgcccatc tacggtc aatccgcc 5'homology arm inserted gene 3'homology arm 2.2. Preparation of Lysogeny Broth (LB Agar) Plate The process began by labeling two flasks to distinguish between the different media types: a 500 mL flask labeled “KIX” (Kanamycin) and a 1 L flask labeled “KIX/SPT” (Kanamycin/Spectinomycin). A vial containing arabinose was dissolved by adding 3 mL of deionized water and was vortexed for approximately 1 minute. 500 μL of deionized water was added to the vial containing spectinomycin and vortexed. Once the solutions were ready, 700 mL of deionized water was poured into the flask labeled “KIX/SPT.” Meanwhile, the KIX mix slurry was prepared by adding 3 mL of deionized water to the KIX mix vial. This vial was recapped and shaken gently for approximately 5 seconds to ensure even mixing. The slurry was then transferred to the KIX/SPT flask, which was swirled to ensure it was evenly suspended throughout the solution. 200 mL of the KIX/SPT solution was poured into the 500 mL KIX flask. This created two distinct media, each to be supplemented with additional ingredients. To complete the media, 7 g of LB agar powder was added to the KIX flask, while the remaining LB agar powder was added to the KIX/SPT flask. Both flasks were then autoclaved to sterilize the media. After sterilization, a total of 24 plates were labeled: eight plates were marked “IX,” eight plates were labeled “IX/ARA.” and 8 plates were marked as “IX/SPT.” The molten KIX LB agar was used to fill the one-third to one-half of each plate (~10 mL) of the IX plates. To prepare the IX/ARA plates, 1 mL of rehydrated arabinose solution was added to the remaining molten KIX LB agar. The solution was swirled gently to ensure the arabinose was evenly distributed, and the eight IX/ARA plates were then filled with about 10 mL of the molten agar. For the IX/SPT plates, 500 μL of the rehydrated spectinomycin solution was added to the molten KIX/SPT mixture. Again, the solution was swirled gently to mix the spectinomycin uniformly throughout the agar. Following the plate pouring, the agar was allowed to solidify. Once the agar had solidified, the plates were placed in a dark room at room temperature to dry for two days. After drying, the plates were wrapped in aluminum foil to protect them from light, which could affect the stability of the medium. The plates were then sealed in plastic wrap to maintain sterility and stored upside down in a refrigerator at 4°C to preserve them until they were ready for use. 2.3. Rehydration of Escherichia coli A capsule of LB broth and 50 ml of deionized water were added to a 250 ml bottle, which was then loosely capped and autoclaved. After sterilization, the broth was allowed to cool to room temperature before being stored at 4°C. Using a sterile pipette tip, 250 μl of LB broth was added to the vial containing lyophilized E. coli HB101-pBRKan, followed by gentle shaking to resuspend the bacteria. The vial was then incubated at 37°C for 8-24 hours. 2.4. Streaking and Incubation of Starter Plates A sterile inoculation loop was used to streak the rehydrated E. coli HB101-pBRKan onto eight IX plates and eight IX/ARA plates. The bacteria were streaked across the four quadrants of each plate using a side-to-side motion. The inoculated plates were then incubated upside down at 37°C for 24 hours. After incubation, the plates were stored at 4°C. This preparation was completed 24 hours prior to the gene editing activity. 2.5. Preparation of Plasmids A set of four 2 ml tubes was labeled as follows: TS, LB, pD, and pDG (32 tubes in total). To each of the eight TS tubes, 1.2 ml of transformation solution was added, and 1.2 ml of LB broth was added to each of the eight LB tubes. The pLZDonor and pLZDonorGuide tubes were pulse-spun to collect the liquid at the bottom. Then, 25 μl of pLZDonor and pLZDonorGuide were added to the eight pD and pDG tubes, respectively. All prepared solutions were stored at 4°C until ready for use. 2.6. Gene Editing of Escherichia coli HB101-pBRKan lacZ gene with the Plasmids Four 2 ml microcentrifuge tubes, labeled A-D, were placed on ice. To each tube, 250 μl of ice-cold transformation solution (TS) was added, and the tubes were returned to the ice. Using a sterile inoculation loop, five colonies were picked from the IPTG/X-gal (IX) plate and swirled in tube A for at least 1 minute before placing the tube back on ice. A new sterile loop was then used to pick five more colonies from the same IPTG/X-gal plate, which were swirled in tube B for 1 minute and returned to ice. Similarly, a new sterile loop was used to pick five colonies from the IPTG/X-gal/Ara (IX/ARA) plate, which were swirled in tube C for 1 minute and placed back on ice. Another sterile loop was used to pick five more colonies from the IPTG/X-gal/Ara plate, swirled in tube D for 1 minute, and placed back on ice. A sterile pipette tip was used to add 10 μl of pLZDonor (pD) plasmid to tube A, which was flicked three times to mix and then placed back on ice. Another sterile pipette tip was used to add 10 μl of pD to tube C, which was also flicked and placed on ice. Similarly, 10 μl of pLZDonorGuide (pDG) plasmid was added to tube B using a sterile pipette tip, flicked three times, and placed on ice. A new pipette tip was then used to add 10 μl of pDG to tube D, which was flicked three times and returned to ice. The tubes were incubated on ice for at least 10 minutes, after which they were transferred to a dry bath and heat-shocked at 60°C for exactly 50 seconds. Immediately after the heat shock, the tubes were placed back on ice for 2 minutes. The tubes were then transferred to a tube rack, and 250 μl of LB nutrient broth was aliquoted into each tube, followed by three flicks to mix the contents. Tube A was gently flicked to resuspend the bacteria. Using a sterile pipette tip, 100 μl of sample A was transferred onto plate A and spread evenly across the surface. A fresh sterile pipette tip and inoculation loop were used to transfer 100 μl of samples B, C, and D onto plates B, C, and D, respectively. The plates were incubated upside down at 37°C for 24 hours or at room temperature for 2-3 days. After incubation, the blue-white screening technique was used to confirm the success of the lacZ gene editing. 2.7. Genomic DNA Extraction from Escherichia coli Five screw-cap tubes were labeled S, C, D1, D2, and D3, and 250 μl of the Insta-Gene Matrix (IG) was aliquoted into each tube. Using a sterile pipette tip, a single blue colony was picked from the IX/ARA plate and swirled in tube S. This process was repeated for tubes C, D1, D2, and D3. The tubes were then vortexed for 10 seconds. Then, the tubes were incubated in a dry bath at 56°C for 15 minutes, allowed to cool slightly before being vortexed again for 10 seconds. They were subsequently incubated in a water bath at 95°C for 10 minutes, allowed to cool slightly, and vortexed for 10 seconds. Finally, the tubes were centrifuged at 12,000 x g for 2 minutes. 2.8. Polymerase Chain Reaction (Multiplex PCR) Seven PCR tubes were labeled as S, C, D1, D2, D3, Positive Control (+), and Negative Control (–). 10 μl master mix plus primers (MMP) was aliquoted into each tube. Then, 10 μl of the supernatant from each of the five corresponding screw-cap tubes was added to its matching PCR tube. Additionally, 10 μl of positive PCR control DNA was aliquoted into both the Positive Control (+) and Negative Control (–) tubes. Finally, the tubes were placed in the thermal cycler for amplification. 2.9. Gel Electrophoresis The PCR samples were vortexed to thoroughly mix the contents in the tubes. Then, 5 μl of loading dye was aliquoted into each sample and gently mixed. A 1% TBE agarose gel was placed into the electrophoresis chamber, which was subsequently filled with 400 ml of TAE buffer, ensuring the gel was fully submerged. The lid of the chamber was replaced, and the leads were connected to the power supply. The gel was run at 100V in 0.5x TBE buffer for 30 minutes. After electrophoresis, the DNA bands were visualized under UV light, with the separated bands compared to the DNA ladder for reference. 2.10. Pre-Screening for Asparaginase Activity using the Plate Method Assay Pure cultures of the CRISPR-Cas9 edited E. coli and wild-type E. coli were separately inoculated on asparaginase producing media. One liter of Mueller Hilton agar was modified by supplementing with 6 g KH₂PO₄, 10 g L-Asparagine, 4 mL1M MgSO₄, 2 mL 0.1M CaCl₂, and 0.04 mL 0.009% phenol red indicator to the media. The pH of the media was maintained at 7.0. Colonies exhibiting pink zones formed by the deamination of asparagine to yield aspartate and ammonia were considered as asparaginase positive colonies (Fatima et al ., 2019). 2.11. Asparaginase Production through Submerged Fermentation A fermentation medium was prepared using 6 g Na 2 HPO 4 , 3 g KH 2 PO 4 , 0.5 g NaCl, 1 g Rice Bran, 2 mL 1 M MgSO 4 , and 1 mL 0.1 M CaCl 2, supplemented with 1g of Asparagine. The pH of the medium was adjusted to 7 and divided into two portions: one for the edited E. coli strain and the other for the wild-type E. coli strain. Each portion was further subdivided into three flasks, labeled 10°C, 37°C, and 45°C, respectively. The fermentation media were inoculated with their corresponding E. coli strains and incubated at the designated temperatures (10°C, 37°C, and 45°C) with agitation at 180 RPM for 24 hours. The optical density of the cultures was measured at intervals of 24, 48, 72, 96, and 120 hours to monitor cell growth. Following fermentation, the cultures were harvested by centrifugation at 4,000 RPM for 20 minutes at 4°C. The supernatant, containing the crude asparaginase enzyme, was carefully collected for further analysis (Fatima et al ., 2019). 2.12. Partial Purification of Asparaginase Following submerged fermentation, ammonium sulfate was added to the collected supernatant while stirring at 4°C for 2 hours to ensure complete protein precipitation. The mixture was then centrifuged at 10,000 RPM for 20 minutes at 4°C to pellet the precipitated proteins. The crude extract was resuspended in 10 mL of 50 mM Tris-HCl buffer (pH 7.5). The solution was subsequently dialyzed against the same buffer for 24 hours to remove the ammonium sulfate and other impurities to get the pellets (Niranjana et al ., 2019). 2.13. Ion Exchange Chromatography The pellets were concentrated through dialysis using a 20 mM Tris-HCL solution. The concentrated extract was then subjected to ion-exchange chromatography by loading it onto a DEAE (Diethylaminoethyl) Sepharose column that had been pre-equilibrated with 20 mM Tris-HCl buffer at pH 8.0. Elution of the enzyme was carried out using varying concentrations of sodium chloride (ranging from 0.1 to 1.0 g) in the same buffer at a flow rate of 60 ml/hour, with fractions of 5 ml collected. The protein concentration was monitored using a UV spectrophotometer at 280 nm (Dimowo and Omonigho, 2023). 2.14. Characterization of Purified Asparaginase 2.14.1. Effect of pH on Asparaginase Activity The effect of pH buffer on asparaginase activity was studied by incubating the enzyme preparation in the 50 mM phosphate buffer of various pH ranges (4.0, 5.0, 6.0, 7.0, 8.0, and 9.0) with 40 mM L-asparagine for 15 minutes at room temperature, followed by determination of the enzyme activity (Niranjana et al ., 2019). 2.14.2. Effect of Temperature on Asparaginase Activity In separate tubes, a total volume of 1 mL consisting of asparaginase enzyme , asparagine solution , and 50 mM phosphate buffer (pH 7.5) was prepared. The reaction mixtures were incubated at different temperatures (20°C, 30°C, 40°C, 60°C, and 80°C) for 30 minutes using a water bath. After incubation, the enzyme activity was measured at each temperature using a spectrophotometer . The temperature at which the enzyme exhibited maximum activity was identified and recorded as the optimum temperature for the enzyme (Niranjana et al ., 2019). 2.15. Statistical Analysis The enzymatic activity of asparaginase produced by CRISPR-Cas9 edited and wild-type E. coli was evaluated using one-way analysis of variance. The data were analyzed and visualized using Excel 2016. A significance threshold of P>0.02 was applied to determine statistical relevance. 3. Results and Discussion The CRISPR-Cas9 gene editing system was used to target the lacZ gene in Escherichia coli , with experiments conducted across four distinct Petri dishes. The plates were incubated at 37°C for 24 hours, and the resulting phenotypes and colony counts were documented to analyze the effects of varying experimental conditions. The E. coli cells exposed to the CRISPR-Cas9 system in the presence of Cas9 but without the single guide RNA (sgRNA) or arabinose required to activate the repair machinery displayed colonies with a unique blue phenotype, resulting in a count of 96 colonies (Fig. 1 ). When subjected to CRISPR-Cas9 editing with Cas9 and sgRNA but without the component necessary for repair, specifically arabinose, no colonies were observed, with the total count of blue or white colonies recorded as zero (Fig. 2 ). In the presence of Cas9 and arabinose but without sgRNA, arabinose was activated, however, without sgRNA to guide Cas9 to the lacZ gene target, editing was not directed. As a result, the colonies displayed blue phenotype and a total of 309 colonies were counted (Fig. 3 ). When Cas9, sgRNA, and arabinose were provided together, the repair machinery was activated, unlike the blue colonies observed in Plates 1 and 3, the colonies exhibited a distinct white phenotype and enumeration revealed a total of 114 white colonies (Fig. 4 ). Figure 5 illustrates the gel electrophoresis of the edited lacZ gene in Escherichia coli from the CRISPR-Cas9 experiment. In the lanes labeled as Edited E. coli 1 (ED1), Edited E. coli 2 (ED2), and Edited E. coli 3 (ED3), corresponding to the E. coli colonies displaying a white phenotype, two distinct bands were observed. These bands were estimated to have a size of approximately 650 base pairs (bp). In contrast, the lanes labeled as Starter Plate E. coli (SPE) and Unedited E. coli (UE), representing E. coli colonies with a blue phenotype, displayed two bands with an estimated size of 1,100 bp. The positive control lane demonstrated the expected three-band pattern, with bands measuring 1,100 bp, 650 bp, and 350 bp. The negative control lane, as anticipated, showed no detectable bands. After 24 hours of incubation, asparaginase activity was assessed using the plate assay inoculated with both CRISPR-Cas9 edited and wild-type E. coli . The results, depicted in Fig. 6 , show a distinct clear pink zone surrounding the colonies of the CRISPR-Cas9 edited strain, indicating significantly higher asparaginase activity compared to the unedited strain, as illustrated in Fig. 7 . The growth of CRISPR-Cas9 wild-type E. coli in relation to temperature in the fermentation medium under 5 days of incubation at 10°C, 37°C, and 45°C was recorded. The results demonstrate an increased cell mass at higher temperatures, as shown in Fig. 8 . The cell density increased progressively over time at each temperature, with the maximum growth observed at 37°C after 120 hours, reaching 1.18 OD, compared to 0.72 OD and 0.51 OD at 10°C and 45°C, respectively. The temperature-based growth pattern of CRISPR-Cas9 edited E. coli in a fermentation medium was assessed under 5 days of incubation at 10°C, 37°C, and 45°C. The results revealed an increase in cell mass at all temperatures as time progressed, as shown in Fig. 9 . At 24 hours, the cell density was lowest across all conditions, ranging from 0.23 to 0.73 OD. By 120 hours, the highest growth was observed at 37°C with an OD of 1.26, followed by 10°C (0.87 OD) and 45°C (0.69 OD). Figure 10 displays the crude enzyme extracts obtained through submerged fermentation from both strains and was partially purified using ammonium sulfate. The ion-exchange chromatography results, illustrated in Fig. 11 , demonstrated that the asparaginase from CRISPR-Cas9 edited E. coli exhibited significantly higher enzyme activity across all elution fractions compared to the wild-type strain. Notably, a peak activity of 1.2 U/mL was observed at elution of 80 mL for the CRISPR-Cas9 edited strain, however, beyond 80 mL, both strains exhibited a decline in activity. Figure 12 illustrates the ion-exchange chromatography results, where the wild-type strain reached a peak absorbance of 1.0 at the elution 80 mL similar to the volume of the edited E. coli . Figure 13 showed the effect of pH on the purified asparaginase enzyme produced through fermentation with CRISPR-Cas9 edited and wild-type E. coli . A significant increase (p 0.05) in activity was observed when the pH increased from 8 to 9. Enzyme activity was highest at pH 7 and lowest at pH 4 for both the CRISPR-Cas9 edited and wild-type E. coli . The CRISPR-Cas9 edited E. coli consistently showed higher enzyme activity compared to the wild-type strain. The difference in the effect of pH on the purified asparaginase obtained from rice bran by fermentation with CRISPR-Cas9 edited and wild-type E. coli is significant (p < 0.05). The effect of temperature on the activity of purified asparaginase produced by CRISPR-Cas9 edited and wild-type E. coli cultured with rice bran as illustrated in Fig. 14 . As the temperature increased from 20°C to 40°C, the enzyme activity from both strains reached a peak at 40°C with 1.2 U/mL for the CRISPR-Cas9 edited strain (CCEE) and 0.8 U/mL for the wild-type strain (CCWE). Beyond 40°C, enzyme activity declined, dropping to 0.5 U/mL and 0.3 U/mL at 80°C for CCEE and CCWE, respectively. The asparaginase activity was consistently higher in the CRISPR-Cas9 edited strain compared to the wild-type strain at all temperatures tested. These differences in enzyme activity between the two strains are statistically significant (p < 0.05) at a 95% confidence interval. 4. DISCUSSION Through recent advancements in genetic engineering, CRISPR-Cas9 has emerged as a groundbreaking tool, revolutionizing the modification of specific genes (Zhu, 2022 ). This technology has made it possible to fine-tune microbial systems, especially for industrial and medical purposes, by optimizing their metabolic pathways. Through the use of CRISPR-Cas9 technology, Escherichia coli has been modified genetically to improve their metabolic pathway in a way that enhances asparaginase production. Using the CRISPR-Cas9 technology, the lacZ gene, which is normally present in the E. coli HB101-pBRKan chromosome, was altered in this experiment. The bacteria found on Plate 1 were derived from a starter plate containing kanamycin, IPTG (Isopropyl β-D-1-thiogalactopyranoside), and X-gal but lacked arabinose (the repair mechanism). These bacteria, which carried the plasmid donor (DNA donor template) and Cas9 but lacked single guide RNA (sgRNA), formed blue colonies. The blue coloration indicated that the lacZ gene remained unedited, as active beta-galactosidase hydrolyzed X-gal, stimulated by IPTG. This result aligns with Minari et al. ( 2024 ), who reported that the absence of sgRNA and a repair mechanism resulted in the blue coloration of colony growth. The absence of colonies on Plate 2 which contained kanamycin, IPTG, and X-gal but no arabinose, showed no bacterial growth. Here, E. coli which has the plasmid donor guide (DNA donor template and sgRNA) and Cas9 resulted in the cleavage of the lacZ gene. However, the absence of arabinose meant the repair machinery was inactive. Consequently, the double-stranded DNA breaks were irreparable, leading to bacterial cell death. This finding were reported by Sinha et al., ( 2020 ) who observed that bacteria without functional repair machinery do not survive double-strand breaks and thus do not form colonies. The presence of 239 colonies on Plate 3, which contained the plasmid donor (DNA donor template) and Cas9 but lacked single guide RNA (sgRNA), along with kanamycin, IPTG, X-gal, and arabinose (the repair machinery), indicates that the lacZ gene was not cleaved by Cas9. The blue coloration of the colonies reflects the hydrolysis of X-gal by active beta-galactosidase, which is only expressed when the lacZ gene remains functional and is induced by IPTG. This observation aligns with findings from Fels et al., ( 2020 ), which noted that the insertion of a stop codon by the donor DNA template inhibits the formation of functional beta-galactosidase, preventing the gene from being cleaved or subsequently repaired in such bacterial colonies. White colonies observed on Plate 4 were the result of the presence of kanamycin, IPTG, X-gal, arabinose, a plasmid donor guide, including the DNA donor template and sgRNA. The sgRNA directed Cas9 to target and cut the lacZ gene, while arabinose activated the repair mechanism. The appearance of white colonies indicated that the lacZ gene was successfully cut and repaired. This finding aligns with Yang et al., ( 2020 ), who described the use of homology-directed repair (HDR) facilitated by the DNA donor template to fix double-stranded breaks. The lack of blue coloration, even in the presence of IPTG and X-gal, confirmed that the lacZ gene was no longer functional. PCR samples were analyzed using agarose gel electrophoresis, and each sample yielded specific amplicons. The bands observed in each lane represented the amplicons produced by the corresponding PCR sample. The 1,100 bp amplicon confirmed that the lacZ gene remained functional, as the Cas9 cut site was not modified. This result confirms the presence of active lacZ genes in the unedited E. coli colonies found on Plates A and C. However, the 650 bp amplicon showed that the donor DNA had been used to repair the targeted cut site, confirming the result of CRISPR-Cas9 edited E. coli colonies found on Plate D. Additionally, the presence of a 350 bp amplicon indicated that genomic DNA was successfully extracted and amplified, regardless of whether the lacZ gene was modified. This result is supported by the findings of Minari et al., ( 2024 ), who reported that the first primer pair (1,100 bp) was designed to identify the unmodified lacZ gene, the second primer pair (650 bp) was specifically created to detect the edited lacZ gene, and the third primer pair (350 bp) served as a control by amplifying a region unrelated to the lacZ gene. After editing, both the edited and wild-type E. coli colonies were screened for asparaginase activity. This activity was assessed by the breakdown of asparagine into ammonia and aspartic acid, indicated by the formation of pink colonies, as described by Fatima et al. ( 2019 ). The results suggested that the edited E. coli exhibited higher asparaginase activity, as evidenced by a clearer zone of utilization on the asparaginase medium compared to the wild-type strain. The rice bran medium used in this study effectively supported the growth of the organism. This aligns with the findings of Kargapolova et al. ( 2020 ), who emphasized that microbiological media must satisfy an organism’s requirements for carbon, nitrogen, minerals, growth factors, and water, while being free from inhibitory substances. In this study, the maximum biomass concentration was achieved at 37°C, consistent with the observations of Jaiganesh and Jaganathan, ( 2018 ), who also reported optimal biomass concentration at this temperature. Among the tested conditions (10°C, 37°C, and 45°C), 37°C resulted in the highest biomass yield for both CRISPR-edited and unedited E. coli inoculated on rice bran medium. The optical density (OD) at 540 nm of both wild-type and CRISPR-Cas9 edited E. coli in the fermentation medium was monitored over 120 hours. Both the edited and wild-type strains of E. coli achieve optimal growth at 37°C, with the edited strain exhibiting a slightly higher OD (1.26) compared to the unedited strain (1.18). Growth at temperatures (10°C and 45°C) was significantly reduced in both strains, with the edited strain consistently showing higher growth efficiency. These findings suggest that genetic modifications can enhance growth performance, particularly under sub-optimal conditions. This aligns with the findings of Son and Taylor, ( 2022 ), who reported that 37°C provides the most favorable conditions for E. coli growth, supporting optimal temperature-dependent growth conditions. After submerged fermentation, the crude enzyme was purified using ammonium sulfate, resulting in a clear solution. Minari et al . (2022) adopted a similar approach in their study, achieving comparable clarity in the enzyme solution following ammonium sulfate treatment. The asparaginase enzyme was then subjected to ion-exchange chromatography, and the higher activity observed in the edited strain aligns with findings by Shishparenok et al. ( 2023 ), who reported that genetic modifications, such as CRISPR-Cas9 editing, can enhance the enzymatic efficiency and increase the yield and activity of industrial enzymes, including asparaginase. In contrast, the wild-type strain’s performance resembles baseline enzymatic activity reported in studies like Dumina et al. ( 2021 ), where wild-type E. coli strains demonstrated moderate asparaginase activity under similar purification methods. Optimization studies on asparaginase enzyme production by E. coli in a fermented rice bran medium revealed that various factors significantly influenced asparaginase yield. This finding aligns with the work of Munawar et al. ( 2023 ), who emphasized the importance of optimizing culture conditions and chemical and physical parameters—such as pH, temperature, salt concentration, and incubation time—for maximizing microbial enzyme production. In this study, asparaginase production by wild-type E. coli was compared to that of CRISPR-Cas9 edited E. coli , focusing on pH and temperature effects. The purified asparaginase enzyme from both strains showed a steady increase in activity with rising pH levels, reaching maximum activities of 1.2 ± 0.05 U/mL for wild-type E. coli and 0.95 ± 0.03 U/mL for CRISPR-Cas9-edited E. coli at a neutral pH of 7. These results indicate that pH 7 is optimal for asparaginase activity in both strains, as reported by Abdelrazek et al. ( 2020 ), where the enzymatic activity of asparaginase was shown to peak at neutral pH 7. Temperature optimization revealed that both wild-type and CRISPR-Cas9 edited E. coli cultured with rice bran exhibited maximum asparaginase activity of 0.8 ± 0.005 U/mL and 1.2 ± 0.002 U/mL, respectively, at 40°C. This finding is slightly higher but closely aligns with Arevalo-Tristancho et al., ( 2019 ), who reported an optimum temperature of 37.5°C for asparaginase activity, emphasizing the enzyme’s thermotolerance and adaptability within a physiologically relevant temperature range. This result suggests that the lacZ gene knockout enhances the temperature-dependent activity of asparaginase. Furthermore, beyond 40°C, a decline in activity was observed, with the activity dropping to 0.5 U/mL for the CRISPR-Cas9 edited strain and 0.3 U/mL for the wild-type strain at 80°C. This decline is likely due to enzyme denaturation at higher temperatures, consistent with the thermolabile nature of most microbial enzymes. However, the general trends in both strains demonstrate similar pH and temperature profiles, indicating that the lacZ knockout has an impact on the enzyme’s stability. 5. Conclusion The study demonstrates that CRISPR-Cas9 technology can significantly enhance the yield and functional properties of asparaginase, making it a promising approach for industrial enzyme production. The findings also highlight the importance of optimizing fermentation parameters, particularly temperature and pH, to maximize enzyme output. Future research could explore the underlying mechanisms responsible for the improved performance of CRISPR-edited strains and evaluate their scalability for industrial applications. Additionally, assessing other growth conditions and substrate types could provide broader insights into optimizing enzyme production using genetically modified microorganisms. Declarations Ethics approval and consent to participate Not applicable. This study did not involve human participants, data, or animals requiring ethics approval. Consent for publication Not applicable. No individual person’s data, images, or videos are included in this manuscript. Availability of data and materials Not Applicable Competing interests The authors declare that they have no competing interests. Funding This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. Authors' contributions Opeyemi Hannah Akindusoye conceived and designed the study, performed the CRISPR-Cas9 gene editing experiments and enzyme production, interpreted the results, and drafted the main manuscript text. Ruth Chinasa Okafor contributed to CRISPR-Cas9 gene editing experiment, data analysis, and interpretation of results. Adepeju Matilda Adekoya assisted with enzyme purification and ion-exchange chromatography. Joseph Bamidele Minari supervised the study design, provided critical revisions to the manuscript, and approved the final version. All authors reviewed and approved the final manuscript. Acknowledgments Not Applicable Authors' information (optional) Not Applicable References Abdelrazek NA, Elkhatib WF, Raafat MM, Aboulwafa MM. Production, characterization and bioinformatics analysis of L-asparaginase from a new Stenotrophomonas maltophilia EMCC2297 soil isolate. AMB Express. 2020; 10 (71), 1-16. https://doi.org/10.1186/s13568-020-01005-7 Alamillo JM, López CM, Rivas FJ, Torralbo F, Mustafa Bulut M, Alseekh S. Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein and hairy roots: a perfect match for gene functional analysis and crop improvement. Current Opinion in Biotechnology. 2023; 79 , 1-9. https://doi.org/10.1016/j.copbio.2022.102876 Arevalo-Tristancho E, Diaz LE, Cortazar JE, Valero MF. Production and Characterization of L-Asparaginases of Streptomyces Isolated from the Arauca Riverbank (Colombia). The Open Microbiology Journal. 2019; 13 (1), 204-215. http://dx.doi.org/10.2174/1874285801913010204 Chen X, Li C, Liu H. Enhanced Recombinant Protein Production Under Special Environmental Stress. Frontiers in Microbiology . 2021; 12 , 1-11. https://doi.org/10.3389/fmicb.2021.630814 Dimowo CG, Omonigho, SE. Purification and Characterization of Produced L- Asparaginase from Streptomyces Avermitilis Isolated from Marine Environment in Lagos, Nigeria. Journal of Medical & Basic Science Research. 2023; 1 (2), 25-34. https://10.5281/zenodo.7652562 Dong H, Cui Y, Zhang D. (2021). CRISPR-Cas Technologies and Their Applications in Escherichia coli . Frontiers in Bioengineering and Biotechnology. 2021; 9 (1), 1-10. https://doi.org/10.3389/fbioe.2021.762676 Dumina M, Zhgun A, Pokrovskaya M, Aleksandrova S, Zhdanov D, Sokolov N, El’darov M. Highly Active Thermophilic L-Asparaginase from Melioribacter roseus represents a Novel Large Group of Type II Bacterial L-Asparaginases from Chlorobi Ignavibacteriae-Bacteroidetes Clade. International Journal of Molecular Sciences. 2021; 22 (24), 1-17. https://doi.org/10.3390/ijms222413632 Fatima N, Khan MM, Khan IA. L-asparaginase produced from soil isolates of Pseudomonas aeruginosa shows potent anti-cancer activity on HeLa cells. Saudi Journal of Biological Sciences. 2019; 26 , 1146-1153. https://doi.org/10.1016/j.sjbs.2019.05.001 Fels U, Gevaert K, Van Damme P. Bacterial Genetic Engineering by Means of Recombineering for Reverse Genetics. Frontiers in Microbiology. 2020; 11 (548410), 1-19. https://doi.org/10.3389/fmicb.2020.548410 Jia R, Wan X, Geng X, Xue D, Xie Z, Chen C. Microbial L-asparaginase for Application in Acrylamide Mitigation from Food: Current Research Status and Future Perspectives. Microorganisms. 2021; 9 (1659), 1-21. https://doi.org/10.3390/microorganisms9081659 Jaiganesh R, Jaganathan MK. Isolation, Purification, and Characterization of Lipase from Bacillus Sp. from Kitchen Grease. Asian Journal of Pharmaceutical and Clinical Research . 2018 ; 11 (6), 224-227. http://dx.doi.org/10.22159/ajpcr.2018.v11i6.24955 Katsimpouras C & Stephanopoulos G. Enzymes in biotechnology: Critical platform technologies for bioprocess development. Current Opinion in Biotechnology. 2021; 69 (1), 91-102. https://doi.org/10.1016/j.copbio.2020.12.003 Kargapolova KY, Burygin GL, Tkachenko OV, Evseeva NV, Pukhalskiy YV, Belimov AA. Effectiveness of inoculation of in vitro grown potato microplants with rhizosphere bacteria of the genus Azospirillum. Plant Cell Tissue Organ Culture. 2020; 141 , 351-359. https://doi.org/10.1007/s11240-020-01791-9 Loch JI, Jaskolski M. Structural and biophysical aspects of L-asparaginases: a growing family with amazing diversity. International Union of Crystallography. 2021; 8 (1), 514-531. https://doi.org/10.1107/S2052252521006011 Lubkowski J, Wlodawer A. Structural and biochemical properties of L-asparaginase. FEBS Journal. 2021; 288 (14), 1-27. https://doi.org/10.1111/febs.16042 Maese L, Rau RE. Current Use of Asparaginase in Acute Lymphoblastic Leukemia/Lymphiblastic Lymphoma. Frontiers in Pediatrics . 2022; 10 , 1-13. https://doi.org/10.3389/fped.2022.902117 Minari JB , Agho EE , Emelumadu EN , Adeniyi OA , Olajiga FR . Characterization of laccase from the fungi Fusarium isolated from potato peels using carbon and nitrogen sources . Advances in Technology. 2022; 2 ( 2 ), 183 - 197 . https://doi.org/10.31357/ait.v2i2.5400 Minari JB, Nwosu GE, Dada IS, Abdulazeez DO. Isolation and Characterization of Amylase Produced by CRISPR-Cas9 Edited LacZ Gene and Unedited Escherichia coli using Potato Peel ( Ipomea batata ) as Enzyme Source. Journal of Applied Science of Environmental Management . 2024; 28 (10), 2981-2989. https://dx.doi.org/10.4314/jasem.v28i10.5 Munawar A, Shaheen M, Ramzan S, Masih SA, Jabeen F, Younis T, Aslam M. Diveristy and enzymatic potential of indigenous bacteria from unexplored contaminated soils in Faisalabad. Heliyon . 2023; 9 , 1-15. https://doi.org/10.1016/j.heliyon.2023.e15256 Niazi SK, Magoola M. Advances in Escherichia coli -Based Therapeutic Protein Expression: Mammalian Conversion, Continuous Manufacturing, and Cell-Free Production. Biologics. 2023; 3 (1), 380-401. https://doi.org/10.3390/biologics3040021 Niranjana J, Gandhi KA, Sunmathi D, Nanthavanan P. Extraction, Characterization and Partial Purification of L-Asparaginase from the Leaves of Arachis Hypogaea. Bioscience Biotechnology Research Asia . 2019; 16 (3), 681-691. http://dx.doi.org/10.13005/bbra/2783 Ruiz N, Silhavy TJ. How Escherichia coli Became the Flagship Bacterium of Molecular Biology. Journal of Bacteriology. 2022; 204 (9), 1-9. https://doi.org/10.1128/jb.00230-22 Sharma R, Garg P, Kumar P, Bhatia S, Kulshrestha S. Microbial Fermentation and Its Role in Quality Improvement of Fermented Foods. Fermentation. 2020; 6 (106), 1-20. http://dx.doi.org/10.3390/fermentation6040106 Shishparenok AN, Gladilina YA, Zhdanov DD. Engineering and Expression Strategies for Optimization of L-Asparaginase Development and Production. International Journal of Molecular Sciences . 2023; 24 (15220), 1-60. https://doi.org/10.3390/ijms242015220 Sinha AK, Possoz C, Leach, DR. The Roles of Bacterial DNA Double-Strand Break Repair Proteins in Chromosomal DNA Replication. FEMS Microbiology Reviews. 2020; 44 (3), 351-368. https://doi:10.1093/femsre/fuaa009 Spaggiari M, Dall’Asta C, Galaverna G, Castillo Bilbao, MD. Rice Bran By-Product: From Valorization Strategies to Nutritional Perspectives. Foods . 2021; 10 (85), 1-16. https://doi.org/10.3390/foods10010085 Son MS, Taylor RK. Growth and Maintenance of Escherichia coli Laboratory Strains. Current Protocols. 2022; 1 (1), 1-13. https://doi.org/10.1002/cpz1.20 Tan BL, Norhaizan ME, Chan LC. Rice Bran: From Waste to Nutritious Food Ingredients. Nutrients. 2023; 15 (2503), 1-25. https://doi.org/10.3390/nu15112503 Yang H, Ren S, Yu S, Pan H, Li T, Ge S, Zhang J, Xia N. Methods Favoring Homology-Directed Repair Choice in Response to CRISPR-Cas9 Induced-Double Strand Breaks. International Journal of Molecular Sciences. 2020; 21 (6461), 1-20. http://dx.doi.org/10.3390/ijms21186461 Zhu Y. Advances in CRISPR-Cas9. Biomed Research International. 2022; 2022 (1), 1-13. https://doi.org/10.1155/2022/9978571 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7802084","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":535633283,"identity":"3faa8262-92ea-44eb-9c49-fdb9aae34eac","order_by":0,"name":"Opeyemi Hannah Akindusoye","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYDACHsYGBh44rwKImZkbSNFyBqSFkZAWKAYDxjYwiV8Lf8/htgdv2+rkDI43P3tcOK82mr8dqOVHxTacWiTONrYbzm07bGxw5pi58cxtx3NnHGZsYOw5cxu3NecZ26R52w4kbriRYCbNu+1YbgNQCzNjG24t8hAtdYkb7j//Js0751jufEJaDM42grQwA23hAdrSUJO7gZAWwzMH2yTnnDtsLHkmp0ya59iB3I1ALQfx+UXuTPoziTdldXJ8x49vk+apqcudd/7wwQc/KvB4HwYUDoCpw2DyAGH1QCDfAKbqiFI8CkbBKBgFIwsAAJyXXhXDmTxhAAAAAElFTkSuQmCC","orcid":"","institution":"University of Lagos","correspondingAuthor":true,"prefix":"","firstName":"Opeyemi","middleName":"Hannah","lastName":"Akindusoye","suffix":""},{"id":535633284,"identity":"bc38b0e7-36bc-4d61-a1d5-4db599466eeb","order_by":1,"name":"Ruth Chinasa Okafor","email":"","orcid":"","institution":"University of Lagos","correspondingAuthor":false,"prefix":"","firstName":"Ruth","middleName":"Chinasa","lastName":"Okafor","suffix":""},{"id":535633287,"identity":"32f6ff04-f47e-4cdd-891c-1cd31abdd809","order_by":2,"name":"Adepeju Matilda Adekoya","email":"","orcid":"","institution":"University of Lagos","correspondingAuthor":false,"prefix":"","firstName":"Adepeju","middleName":"Matilda","lastName":"Adekoya","suffix":""},{"id":535633289,"identity":"8b58a1ab-2555-41f7-bb97-05362a74d75a","order_by":3,"name":"Joseph Bamidele Minari","email":"","orcid":"","institution":"University of Lagos","correspondingAuthor":false,"prefix":"","firstName":"Joseph","middleName":"Bamidele","lastName":"Minari","suffix":""}],"badges":[],"createdAt":"2025-10-07 18:53:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7802084/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7802084/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94743775,"identity":"363782f9-99b5-4d29-a5c3-7a5d07051e9d","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1034137,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalArticle.docx","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/15ad4d449da90f195a6fb738.docx"},{"id":94743766,"identity":"6e67bce1-fb61-4ca1-8170-f89a91ad6bc6","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6527,"visible":true,"origin":"","legend":"","description":"","filename":"47199d25157d42b182c57e47787f8a87.json","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/9624688665e4df63b6c08ce8.json"},{"id":94743777,"identity":"3d5dcaf7-368d-4164-9125-9f9c9c10f1b9","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105668,"visible":true,"origin":"","legend":"","description":"","filename":"47199d25157d42b182c57e47787f8a871enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/ed6ec95c4aace68f2090d292.xml"},{"id":94822911,"identity":"a0d68e4c-35b8-4663-8de4-646f94241d38","added_by":"auto","created_at":"2025-10-31 06:45:07","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175506,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/de29015386e42e33b47c74c3.jpeg"},{"id":94823542,"identity":"0aa63b39-ace7-400c-b3b3-d546b51b80ac","added_by":"auto","created_at":"2025-10-31 06:47:34","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100530,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/4db273d77561d07c9f926edd.jpeg"},{"id":94743789,"identity":"3b06f4f2-49e3-40f1-ba5b-e4367f81256a","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176955,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/2f5ed10ac7eb7c66e58ca397.jpeg"},{"id":94823457,"identity":"96cbbccd-2ca5-48cd-9e2a-bc2c41516159","added_by":"auto","created_at":"2025-10-31 06:47:26","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115311,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/e274bd033f64de5e4993951e.jpeg"},{"id":94823689,"identity":"aa702132-c053-4760-9b46-1a3f0f5d059d","added_by":"auto","created_at":"2025-10-31 06:47:50","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":694926,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/e905a0b0662a4dd8b7f2c692.jpeg"},{"id":94743797,"identity":"142d4517-ef72-4696-8f0f-09766c2c8c5b","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":116455,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/807ca6e71f0614423ff69e81.jpeg"},{"id":94823100,"identity":"0dea5561-5259-41a0-a968-33bc3ae7b7b1","added_by":"auto","created_at":"2025-10-31 06:46:07","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113638,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/fbcbd8af2697282f66b706ae.jpeg"},{"id":94823604,"identity":"3d865c31-ce8c-458e-97ea-6ec8cbf88f2b","added_by":"auto","created_at":"2025-10-31 06:47:39","extension":"jpeg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139136,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/b116c63e27c3cde82443965c.jpeg"},{"id":94743792,"identity":"7df5ba4d-5324-472f-b76c-005a0cb0cf2f","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99030,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/53f6b8c02fbf1453c1fb2849.png"},{"id":94743787,"identity":"ce844fe6-0b72-41b3-a10c-30fbe8f514af","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65509,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/20ef9d20c40f7d91a28ad18b.png"},{"id":94822821,"identity":"cfb58a8b-62c5-48e4-bf85-dbd32c79b03b","added_by":"auto","created_at":"2025-10-31 06:44:26","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":117350,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/efa5166c8ec213391c41998c.png"},{"id":94822940,"identity":"3e9dab79-8564-4790-a43d-2277f9f273de","added_by":"auto","created_at":"2025-10-31 06:45:26","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61684,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/ceeee1ca094dab2152cb8de7.png"},{"id":94822869,"identity":"815f9000-94d5-411e-b2df-86ecf16ec318","added_by":"auto","created_at":"2025-10-31 06:44:47","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":86732,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c7155c3d7c9e606d8afab395.png"},{"id":94823659,"identity":"7551cb6f-6cc8-4d8c-a649-ca652a107e20","added_by":"auto","created_at":"2025-10-31 06:47:46","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61724,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c9c59d6f7d922f4a82c57110.png"},{"id":94822883,"identity":"ce99f218-a579-4d28-aa4a-765c2ce1ea82","added_by":"auto","created_at":"2025-10-31 06:44:54","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":63183,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/d5bfc2d259702e64ee71be69.png"},{"id":94743785,"identity":"6782b24f-e096-4774-9307-b649e9643e08","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66284,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/b1f1f25625065337790ecb19.png"},{"id":94743799,"identity":"4d268015-2385-4d59-a3ac-cbf0250dbb8c","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"xml","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104748,"visible":true,"origin":"","legend":"","description":"","filename":"47199d25157d42b182c57e47787f8a871structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/86fd8dc134b1e58067a8894f.xml"},{"id":94743800,"identity":"a301e0f4-e6cc-46f8-acab-66b346cbe053","added_by":"auto","created_at":"2025-10-30 09:14:54","extension":"html","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115585,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c606728c1485d87af90b2b66.html"},{"id":94743765,"identity":"a76f42ea-f550-4cf9-9d1e-8e47d398b309","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":220371,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePetri Dish Showing CRISPR-Cas9 Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e with Cas9 Enzyme but Without Single Guide RNA and Arabinose\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/3eaced8c0a3dff9274b58e83.png"},{"id":94823992,"identity":"fb0cfccc-d008-4edc-a4fe-8535907cc49b","added_by":"auto","created_at":"2025-10-31 06:48:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":210821,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePetri Dish Showing CRISPR-Cas9 Unedited with Cas9 Enzyme and Single Guide RNA But Not Subjected To Arabinose.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/5d9058afa8fe1442f26770a8.png"},{"id":94823060,"identity":"3322d511-6b6d-4e4c-8625-2e94ce801756","added_by":"auto","created_at":"2025-10-31 06:46:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":258242,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePetri Dish Showing CRISPR-Cas9 Unedited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e with Cas9 enzyme and Arabinose but without Single Guide RNA\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/53ccc4ef1b7cb561ee8f9b17.png"},{"id":94743767,"identity":"60466ed7-b9e8-4e06-a386-86530308b6c1","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":187643,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePetri Dish Showing CRISPR-Cas9 Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e, Cas9 Enzyme, Single Guide RNA and Arabinose\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/e92ab6a22634a4b2fbe56ee4.png"},{"id":94823683,"identity":"c029d61f-cafc-43ed-9526-02603b98e656","added_by":"auto","created_at":"2025-10-31 06:47:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":510432,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElectrophoresis Band of the CRISPR-Cas9 Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ePCR Products\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/57eaa7a15caf96fb6bc74456.png"},{"id":94823728,"identity":"9da65b0a-3a99-455c-b9cb-a4e939169246","added_by":"auto","created_at":"2025-10-31 06:47:54","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":342109,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAsparaginase Activity of CRISPR-Cas9 Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/0f29816261cb84b8eb037a1c.png"},{"id":94823704,"identity":"9df69568-0512-48d2-a2da-1cfe24890b0e","added_by":"auto","created_at":"2025-10-31 06:47:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":389718,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAsparaginase Activity of CRISPR-Cas9 Wild-type \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/f651eab4610fde38bed519be.png"},{"id":94743771,"identity":"ab8455b2-d296-42c4-adf5-a12625d0b3de","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":46382,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of Temperature on CRISPR-Cas9 Unedited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in Fermentation Medium (Each plotted value is a mean of two determination ±SD).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c0956a06e4f1ace8c4696408.png"},{"id":94743769,"identity":"de729ce4-45b5-4777-81cb-2ee8aa40621c","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":50013,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of Temperature on CRISPR-Cas9 Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e in Fermentation Medium (Each plotted value is a mean of two determination ±SD).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/8cd504bfefb93cec3b0ea718.png"},{"id":94823337,"identity":"240035cb-6a54-497c-95fc-966afcff40da","added_by":"auto","created_at":"2025-10-31 06:47:06","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":300320,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCrude Enzyme Extracts Obtained Through Submerged Fermentation\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/4a39eee0fe5db40eb96186cd.png"},{"id":94823725,"identity":"41f31a09-8ee4-4c4d-ac54-33845eb3ebb3","added_by":"auto","created_at":"2025-10-31 06:47:54","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":55592,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIon-Exchange Chromatography for Asparaginase from Edited \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/ef8fdac2d89e391fef731661.png"},{"id":94743780,"identity":"93466529-d5e2-47a7-9022-a71b93bc77f9","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":59281,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIon-Exchange Chromatography for Asparaginase from Wild-type \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c24c85940013fbbd91ee019d.png"},{"id":94823450,"identity":"37493ccb-911b-4bc7-8ab0-d48f48e0eed8","added_by":"auto","created_at":"2025-10-31 06:47:25","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":40047,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of pH on Purified Asparaginase Enzyme from CRISPR-Cas9 Edited and Wild-type \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e Cultured with Rice Bran (Each plotted value is a mean of two determinations ± SD).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/7ca210fc0e8e4086414b3efe.png"},{"id":94743778,"identity":"a9517c20-c9d0-435b-ac6f-e4d1493c4353","added_by":"auto","created_at":"2025-10-30 09:14:53","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":44132,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of Temperature on Purified Asparaginase Enzyme from CRISPR-Cas9 Edited and Wild-type \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eEscherichia coli\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e cultured with Rice Bran (Each plotted value is a mean of two determinations ± SD).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"14.png","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/c6536e032a0c1f78668de313.png"},{"id":96247246,"identity":"64515156-96f8-4c5d-8559-62319b84fe5f","added_by":"auto","created_at":"2025-11-19 07:27:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5213488,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7802084/v1/8b7376a9-1570-4b52-b334-2f1a2e1cd035.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"CRISPR-Cas9 Mediated Knockout of LacZ Gene in Escherichia Coli for Enhanced Production of Asparaginase","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEnzymes play a critical role in industrial biotechnology due to their ability to catalyze a wide range of biochemical reactions, making them indispensable in sectors such as pharmaceuticals, food processing, biofuels, and environmental biotechnology (Katsimpouras and Stephanopoulos, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Among the various enzymes, asparaginase holds particular importance due to its broad substrate specificity and capacity to catalyze reactions in both aqueous and non-aqueous environments (Lubkowski and Wlodawer, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Asparaginase is an amidohydrolase enzyme that catalyzes the conversion of L-asparagine into aspartic acid and ammonia (Jia et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Loch and Jaskolski, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It is most commonly derived from bacteria, particularly \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eErwinia chrysanthemi\u003c/em\u003e (Maese and Rau, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e has long been a model organism in genetic engineering due to its rapid growth, well-studied genetics, and ease of manipulation (Ruiz and Silhavy, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Recombinant DNA technology has enabled large-scale enzyme production in \u003cem\u003eE. coli\u003c/em\u003e (Chen et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), yet wild-type strains often produce limited enzyme yields because of intrinsic metabolic regulation (Niazi and Magoola, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR Associated Proteins 9) is a gene-editing tool that allows precise modifications of an organism\u0026rsquo;s genome, enabling the knockout or insertion of specific genes (Alamillo et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Studies have demonstrated that CRISPR-Cas9 can achieve allelic exchange in \u003cem\u003eE. coli\u003c/em\u003e with up to 65% efficiency and can also regulate gene expression through a nuclease-deficient Cas9 protein (Dong et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAdditionally, the use of sustainable, cost-effective substrates for microbial cultivation is becoming increasingly important (Sharma et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this context, agricultural waste products, such as rice bran, represent a viable alternative as an abundant and low-cost glucose source (Spaggiari et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Utilizing rice bran as a substrate not only reduces production costs but also addresses environmental concerns by repurposing waste materials (Tan et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThis study proposes knocking out the \u003cem\u003elacZ\u003c/em\u003e gene in \u003cem\u003eE. coli\u003c/em\u003e using CRISPR-Cas9 to investigate its effect on asparaginase production when cultivated with rice bran as the main carbon source. Ultimately, integrating gene editing with sustainable substrates could provide a cost-effective strategy for industrial enzyme production while promoting environmental sustainability.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cp\u003eOut of the Blue kit was purchased from Bio-Rad Research Company, United States of America. Rice Bran was sourced from a local rice mill in Ogun State, Nigeria. All other reagents used were obtained commercially and of analytical grade.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.1 CRISPR-Cas9 Genome Editing\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Cas9 endonuclease enzyme locates the target DNA with the help of the single-guide RNA (sgRNA). The guide region of the sgRNA is designed to be complementary to the target DNA sequence, directing Cas9 to the precise cutting site.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDNA Target\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e5\u0026apos; tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg 3\u0026apos;\u003c/p\u003e\n\u003cp\u003e3\u0026apos;atgtggttgc actggatagg gtaatgccag ttaggcggca aacaagggtg cctcttaggc 5\u0026apos;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e20-nucleotide Protospacer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e3\u0026apos;gttgc actggatagg gtaat 5\u0026apos;\u003c/p\u003e\n\u003cp\u003e5\u0026apos;caacg tgacctatcc catta 3\u0026apos;\u003c/p\u003e\n\u003cp\u003e3\u0026apos; guugc acuggauagg guaau 5\u0026apos;\u003c/p\u003e\n\u003cp\u003e5\u0026apos;caacg ugaccuaucc cauua 3\u0026apos;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe Designed sgRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e5\u0026apos;caacgugaccuaucccauua3\u0026apos;\u003c/p\u003e\n\u003cp\u003e5\u0026apos;GUUUUAGAGCUAGA AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG\u003c/p\u003e\n\u003cp\u003eAAAAAGUGGCACCGAGUCGGUGCUUUUUU3\u0026apos;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDonor Template DNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInserted sequence: tgcgcccatc\u003c/p\u003e\n\u003cp\u003e3\u0026apos; |homology arm |\u003c/p\u003e\n\u003cp\u003e5\u0026apos;tacaccaacg tgacctatcc cattacggtc aatccgccgt ttgttcccac ggagaatccg3\u0026apos;\u003c/p\u003e\n\u003cp\u003e5\u0026apos; |homology arm|\u003c/p\u003e\n\u003cp\u003e3\u0026apos;atgtggttgc actggatagg gtaatgccag ttaggcggca aacaagggtg cctcttaggc5\u0026apos;\u003c/p\u003e\n\u003cp\u003e5\u0026apos; homology arm: ctatcc cattacggt\u003c/p\u003e\n\u003cp\u003e3\u0026apos; homology arm: tacggtc aatccgcc\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDonor Template\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDeleted base\u003c/p\u003e\n\u003cp\u003ectatcc cattacggt tgcgcccatc tacggtc aatccgcc\u003c/p\u003e\n\u003cp\u003e5\u0026apos;homology arm inserted gene 3\u0026apos;homology arm\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.2. Preparation of Lysogeny Broth (LB Agar) Plate\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe process began by labeling two flasks to distinguish between the different media types: a 500 mL flask labeled \u0026ldquo;KIX\u0026rdquo; (Kanamycin) and a 1 L flask labeled \u0026ldquo;KIX/SPT\u0026rdquo; (Kanamycin/Spectinomycin).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eA vial containing arabinose was dissolved by adding 3 mL of deionized water and was vortexed for approximately 1 minute. 500 \u0026mu;L of deionized water was added to the vial containing spectinomycin and vortexed.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eOnce the solutions were ready, 700 mL of deionized water was poured into the flask labeled \u0026ldquo;KIX/SPT.\u0026rdquo; Meanwhile, the KIX mix slurry was prepared by adding 3 mL of deionized water to the KIX mix vial. This vial was recapped and shaken gently for approximately 5 seconds to ensure even mixing. The slurry was then transferred to the KIX/SPT flask, which was swirled to ensure it was evenly suspended throughout the solution.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e200 mL of the KIX/SPT solution was poured into the 500 mL KIX flask. This created two distinct media, each to be supplemented with additional ingredients. To complete the media, 7 g of LB agar powder was added to the KIX flask, while the remaining LB agar powder was added to the KIX/SPT flask. Both flasks were then autoclaved to sterilize the media.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAfter sterilization, a total of 24 plates were labeled: eight plates were marked \u0026ldquo;IX,\u0026rdquo; eight plates were labeled \u0026ldquo;IX/ARA.\u0026rdquo; and 8 plates were marked as \u0026ldquo;IX/SPT.\u0026rdquo; The molten KIX LB agar was used to fill the one-third to one-half of each plate (~10 mL) of the IX plates. To prepare the IX/ARA plates, 1 mL of rehydrated arabinose solution was added to the remaining molten KIX LB agar. The solution was swirled gently to ensure the arabinose was evenly distributed, and the eight IX/ARA plates were then filled with about 10 mL of the molten agar. For the IX/SPT plates, 500 \u0026mu;L of the rehydrated spectinomycin solution was added to the molten KIX/SPT mixture. Again, the solution was swirled gently to mix the spectinomycin uniformly throughout the agar.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFollowing the plate pouring, the agar was allowed to solidify. Once the agar had solidified, the plates were placed in a dark room at room temperature to dry for two days. After drying, the plates were wrapped in aluminum foil to protect them from light, which could affect the stability of the medium. The plates were then sealed in plastic wrap to maintain sterility and stored upside down in a refrigerator at 4\u0026deg;C to preserve them until they were ready for use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.3. Rehydration of Escherichia coli\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA capsule of LB broth and 50 ml of deionized water were added to a 250 ml bottle, which was then loosely capped and autoclaved. After sterilization, the broth was allowed to cool to room temperature before being stored at 4\u0026deg;C. Using a sterile pipette tip, 250 \u0026mu;l of LB broth was added to the vial containing lyophilized\u0026nbsp;\u003cem\u003eE. coli\u003c/em\u003e HB101-pBRKan, followed by gentle shaking to resuspend the bacteria. The vial was then incubated at 37\u0026deg;C for 8-24 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.4. Streaking and Incubation of Starter Plates\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA sterile inoculation loop was used to streak the rehydrated\u0026nbsp;\u003cem\u003eE. coli\u003c/em\u003e HB101-pBRKan onto eight IX plates and eight IX/ARA plates. The bacteria were streaked across the four quadrants of each plate using a side-to-side motion. The inoculated plates were then incubated upside down at 37\u0026deg;C for 24 hours. After incubation, the plates were stored at 4\u0026deg;C. This preparation was completed 24 hours prior to the gene editing activity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.5. Preparation of Plasmids\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA set of four 2 ml tubes was labeled as follows: TS, LB, pD, and pDG (32 tubes in total). To each of the eight TS tubes, 1.2 ml of transformation solution was added, and 1.2 ml of LB broth was added to each of the eight LB tubes. The pLZDonor and pLZDonorGuide tubes were pulse-spun to collect the liquid at the bottom. Then, 25 \u0026mu;l of pLZDonor and pLZDonorGuide were added to the eight pD and pDG tubes, respectively. All prepared solutions were stored at 4\u0026deg;C until ready for use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.6. Gene Editing of Escherichia coli HB101-pBRKan lacZ gene with the Plasmids\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFour 2 ml microcentrifuge tubes, labeled A-D, were placed on ice. To each tube, 250 \u0026mu;l of ice-cold transformation solution (TS) was added, and the tubes were returned to the ice. Using a sterile inoculation loop, five colonies were picked from the IPTG/X-gal (IX) plate and swirled in tube A for at least 1 minute before placing the tube back on ice. A new sterile loop was then used to pick five more colonies from the same IPTG/X-gal plate, which were swirled in tube B for 1 minute and returned to ice. Similarly, a new sterile loop was used to pick five colonies from the IPTG/X-gal/Ara (IX/ARA) plate, which were swirled in tube C for 1 minute and placed back on ice. Another sterile loop was used to pick five more colonies from the IPTG/X-gal/Ara plate, swirled in tube D for 1 minute, and placed back on ice.\u003c/p\u003e\n\u003cp\u003eA sterile pipette tip was used to add 10 \u0026mu;l of pLZDonor (pD) plasmid to tube A, which was flicked three times to mix and then placed back on ice. Another sterile pipette tip was used to add 10 \u0026mu;l of pD to tube C, which was also flicked and placed on ice. Similarly, 10 \u0026mu;l of pLZDonorGuide (pDG) plasmid was added to tube B using a sterile pipette tip, flicked three times, and placed on ice. A new pipette tip was then used to add 10 \u0026mu;l of pDG to tube D, which was flicked three times and returned to ice. The tubes were incubated on ice for at least 10 minutes, after which they were transferred to a dry bath and heat-shocked at 60\u0026deg;C for exactly 50 seconds. Immediately after the heat shock, the tubes were placed back on ice for 2 minutes.\u003c/p\u003e\n\u003cp\u003eThe tubes were then transferred to a tube rack, and 250 \u0026mu;l of LB nutrient broth was aliquoted into each tube, followed by three flicks to mix the contents. Tube A was gently flicked to resuspend the bacteria. Using a sterile pipette tip, 100 \u0026mu;l of sample A was transferred onto plate A and spread evenly across the surface. A fresh sterile pipette tip and inoculation loop were used to transfer 100 \u0026mu;l of samples B, C, and D onto plates B, C, and D, respectively. The plates were incubated upside down at 37\u0026deg;C for 24 hours or at room temperature for 2-3 days. After incubation, the blue-white screening technique was used to confirm the success of the \u003cem\u003elacZ\u003c/em\u003e gene editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.7. Genomic DNA Extraction from Escherichia coli\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFive screw-cap tubes were labeled S, C, D1, D2, and D3, and 250 \u0026mu;l of the Insta-Gene Matrix (IG) was aliquoted into each tube. Using a sterile pipette tip, a single blue colony was picked from the IX/ARA plate and swirled in tube S. This process was repeated for tubes C, D1, D2, and D3. The tubes were then vortexed for 10 seconds. Then, the tubes were incubated in a dry bath at 56\u0026deg;C for 15 minutes, allowed to cool slightly before being vortexed again for 10 seconds. They were subsequently incubated in a water bath at 95\u0026deg;C for 10 minutes, allowed to cool slightly, and vortexed for 10 seconds. Finally, the tubes were centrifuged at 12,000 x g for 2 minutes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.8. Polymerase Chain Reaction (Multiplex PCR)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSeven PCR tubes were labeled as S, C, D1, D2, D3, Positive Control (+), and Negative Control (\u0026ndash;). 10 \u0026mu;l master mix plus primers (MMP) was aliquoted into each tube. Then, 10 \u0026mu;l of the supernatant from each of the five corresponding screw-cap tubes was added to its matching PCR tube. Additionally, 10 \u0026mu;l of positive PCR control DNA was aliquoted into both the Positive Control (+) and Negative Control (\u0026ndash;) tubes. Finally, the tubes were placed in the thermal cycler for amplification.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.9. Gel Electrophoresis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe PCR samples were vortexed to thoroughly mix the contents in the tubes. Then, 5 \u0026mu;l of loading dye was aliquoted into each sample and gently mixed. A 1% TBE agarose gel was placed into the electrophoresis chamber, which was subsequently filled with 400 ml of TAE buffer, ensuring the gel was fully submerged. The lid of the chamber was replaced, and the leads were connected to the power supply. The gel was run at 100V in 0.5x TBE buffer for 30 minutes. After electrophoresis, the DNA bands were visualized under UV light, with the separated bands compared to the DNA ladder for reference.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.10. Pre-Screening for Asparaginase Activity using the Plate Method Assay\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePure cultures of the CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e and wild-type \u003cem\u003eE. coli\u003c/em\u003e were separately inoculated on asparaginase producing media. One liter of Mueller Hilton agar was modified by supplementing with 6 g KH₂PO₄, 10 g L-Asparagine, 4 mL1M MgSO₄, 2 mL 0.1M CaCl₂, and 0.04 mL 0.009% phenol red indicator to the media. The pH of the media was maintained at 7.0. Colonies exhibiting pink zones formed by the deamination of asparagine to yield aspartate and ammonia were considered as asparaginase positive colonies (Fatima \u003cem\u003eet al\u003c/em\u003e., 2019).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.11. Asparaginase Production through Submerged Fermentation\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA fermentation medium was prepared using 6 g Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, 3 g KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.5 g NaCl, 1 g Rice Bran, 2 mL 1 M MgSO\u003csub\u003e4\u003c/sub\u003e, and 1 mL 0.1 M CaCl\u003csub\u003e2,\u0026nbsp;\u003c/sub\u003esupplemented with 1g of Asparagine. The pH of the medium was adjusted to 7 and divided into two portions: one for the edited \u003cem\u003eE. coli\u003c/em\u003e strain and the other for the wild-type \u003cem\u003eE. coli\u003c/em\u003e strain. Each portion was further subdivided into three flasks, labeled 10\u0026deg;C, 37\u0026deg;C, and 45\u0026deg;C, respectively. The fermentation media were inoculated with their corresponding \u003cem\u003eE. coli\u003c/em\u003e strains and incubated at the designated temperatures (10\u0026deg;C, 37\u0026deg;C, and 45\u0026deg;C) with agitation at 180 RPM for 24 hours. The optical density of the cultures was measured at intervals of 24, 48, 72, 96, and 120 hours to monitor cell growth. Following fermentation, the cultures were harvested by centrifugation at 4,000 RPM for 20 minutes at 4\u0026deg;C. The supernatant, containing the crude asparaginase enzyme, was carefully collected for further analysis (Fatima \u003cem\u003eet al\u003c/em\u003e., 2019).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.12. Partial Purification of Asparaginase\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing submerged fermentation, ammonium sulfate was added to the collected supernatant while stirring at 4\u0026deg;C for 2 hours to ensure complete protein precipitation. The mixture was then centrifuged at 10,000 RPM for 20 minutes at 4\u0026deg;C to pellet the precipitated proteins. The crude extract was resuspended in 10 mL of 50 mM Tris-HCl buffer (pH 7.5). The solution was subsequently dialyzed against the same buffer for 24 hours to remove the ammonium sulfate and other impurities to get the pellets (Niranjana \u003cem\u003eet al\u003c/em\u003e., 2019).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.13. Ion Exchange Chromatography\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pellets were concentrated through dialysis using a 20 mM Tris-HCL solution. The concentrated extract was then subjected to ion-exchange chromatography by loading it onto a DEAE (Diethylaminoethyl) Sepharose column that had been pre-equilibrated with 20 mM Tris-HCl buffer at pH 8.0. Elution of the enzyme was carried out using varying concentrations of sodium chloride (ranging from 0.1 to 1.0 g) in the same buffer at a flow rate of 60 ml/hour, with fractions of 5 ml collected. The protein concentration was monitored using a UV spectrophotometer at 280 nm (Dimowo and Omonigho, 2023).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.14. Characterization of Purified Asparaginase\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.14.1. Effect of pH on Asparaginase Activity\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of pH buffer on asparaginase activity was studied by incubating the enzyme preparation in the 50 mM phosphate buffer of various pH ranges (4.0, 5.0, 6.0, 7.0, 8.0, and 9.0) with 40 mM L-asparagine for 15 minutes at room temperature, followed by determination of the enzyme activity (Niranjana \u003cem\u003eet al\u003c/em\u003e., 2019).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.14.2. Effect of Temperature on Asparaginase Activity\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn separate tubes, a total volume of \u003cstrong\u003e1 mL\u003c/strong\u003e consisting of \u003cstrong\u003easparaginase enzyme\u003c/strong\u003e\u003cstrong\u003e, \u003cstrong\u003easparagine solution\u003c/strong\u003e\u003c/strong\u003e, and \u003cstrong\u003e50 mM phosphate buffer (pH 7.5)\u003c/strong\u003e was prepared. The reaction mixtures were incubated at different temperatures (20\u0026deg;C, 30\u0026deg;C, 40\u0026deg;C, 60\u0026deg;C, and 80\u0026deg;C) for \u003cstrong\u003e30 minutes\u003c/strong\u003e using a water bath. After incubation, the enzyme activity was measured at each temperature using a \u003cstrong\u003espectrophotometer\u003c/strong\u003e. The temperature at which the enzyme exhibited maximum activity was identified and recorded as the \u003cstrong\u003eoptimum temperature\u003c/strong\u003e for the enzyme (Niranjana \u003cem\u003eet al\u003c/em\u003e., 2019).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.15. \u0026nbsp;Statistical Analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe enzymatic activity of asparaginase produced by CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e was evaluated using one-way analysis of variance. The data were analyzed and visualized using Excel 2016. A significance threshold of P\u0026gt;0.02 was applied to determine statistical relevance.\u003c/p\u003e"},{"header":"3. Results and Discussion","content":"\u003cp\u003eThe CRISPR-Cas9 gene editing system was used to target the \u003cem\u003elacZ\u003c/em\u003e gene in \u003cem\u003eEscherichia coli\u003c/em\u003e, with experiments conducted across four distinct Petri dishes. The plates were incubated at 37\u0026deg;C for 24 hours, and the resulting phenotypes and colony counts were documented to analyze the effects of varying experimental conditions.\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eE. coli\u003c/em\u003e cells exposed to the CRISPR-Cas9 system in the presence of Cas9 but without the single guide RNA (sgRNA) or arabinose required to activate the repair machinery displayed colonies with a unique blue phenotype, resulting in a count of 96 colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). When subjected to CRISPR-Cas9 editing with Cas9 and sgRNA but without the component necessary for repair, specifically arabinose, no colonies were observed, with the total count of blue or white colonies recorded as zero (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In the presence of Cas9 and arabinose but without sgRNA, arabinose was activated, however, without sgRNA to guide Cas9 to the \u003cem\u003elacZ\u003c/em\u003e gene target, editing was not directed. As a result, the colonies displayed blue phenotype and a total of 309 colonies were counted (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). When Cas9, sgRNA, and arabinose were provided together, the repair machinery was activated, unlike the blue colonies observed in Plates 1 and 3, the colonies exhibited a distinct white phenotype and enumeration revealed a total of 114 white colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e illustrates the gel electrophoresis of the edited \u003cem\u003elacZ\u003c/em\u003e gene in \u003cem\u003eEscherichia coli\u003c/em\u003e from the CRISPR-Cas9 experiment. In the lanes labeled as Edited \u003cem\u003eE. coli\u003c/em\u003e 1 (ED1), Edited \u003cem\u003eE. coli\u003c/em\u003e 2 (ED2), and Edited \u003cem\u003eE. coli\u003c/em\u003e 3 (ED3), corresponding to the \u003cem\u003eE. coli\u003c/em\u003e colonies displaying a white phenotype, two distinct bands were observed. These bands were estimated to have a size of approximately 650 base pairs (bp). In contrast, the lanes labeled as Starter Plate \u003cem\u003eE. coli\u003c/em\u003e (SPE) and Unedited \u003cem\u003eE. coli\u003c/em\u003e (UE), representing \u003cem\u003eE. coli\u003c/em\u003e colonies with a blue phenotype, displayed two bands with an estimated size of 1,100 bp. The positive control lane demonstrated the expected three-band pattern, with bands measuring 1,100 bp, 650 bp, and 350 bp. The negative control lane, as anticipated, showed no detectable bands.\u003c/p\u003e\u003cp\u003eAfter 24 hours of incubation, asparaginase activity was assessed using the plate assay inoculated with both CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e. The results, depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, show a distinct clear pink zone surrounding the colonies of the CRISPR-Cas9 edited strain, indicating significantly higher asparaginase activity compared to the unedited strain, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eThe growth of CRISPR-Cas9 wild-type \u003cem\u003eE. coli\u003c/em\u003e in relation to temperature in the fermentation medium under 5 days of incubation at 10\u0026deg;C, 37\u0026deg;C, and 45\u0026deg;C was recorded. The results demonstrate an increased cell mass at higher temperatures, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. The cell density increased progressively over time at each temperature, with the maximum growth observed at 37\u0026deg;C after 120 hours, reaching 1.18 OD, compared to 0.72 OD and 0.51 OD at 10\u0026deg;C and 45\u0026deg;C, respectively.\u003c/p\u003e\u003cp\u003eThe temperature-based growth pattern of CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e in a fermentation medium was assessed under 5 days of incubation at 10\u0026deg;C, 37\u0026deg;C, and 45\u0026deg;C. The results revealed an increase in cell mass at all temperatures as time progressed, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e. At 24 hours, the cell density was lowest across all conditions, ranging from 0.23 to 0.73 OD. By 120 hours, the highest growth was observed at 37\u0026deg;C with an OD of 1.26, followed by 10\u0026deg;C (0.87 OD) and 45\u0026deg;C (0.69 OD).\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e displays the crude enzyme extracts obtained through submerged fermentation from both strains and was partially purified using ammonium sulfate. The ion-exchange chromatography results, illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e, demonstrated that the asparaginase from CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e exhibited significantly higher enzyme activity across all elution fractions compared to the wild-type strain. Notably, a peak activity of 1.2 U/mL was observed at elution of 80 mL for the CRISPR-Cas9 edited strain, however, beyond 80 mL, both strains exhibited a decline in activity. Figure\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e illustrates the ion-exchange chromatography results, where the wild-type strain reached a peak absorbance of 1.0 at the elution 80 mL similar to the volume of the edited \u003cem\u003eE. coli\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e13\u003c/span\u003e showed the effect of pH on the purified asparaginase enzyme produced through fermentation with CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e. A significant increase (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in enzyme activity was observed as the pH increased from 4 to 7. However, a significant reduction (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in activity was observed when the pH increased from 8 to 9. Enzyme activity was highest at pH 7 and lowest at pH 4 for both the CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e. The CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e consistently showed higher enzyme activity compared to the wild-type strain. The difference in the effect of pH on the purified asparaginase obtained from rice bran by fermentation with CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e is significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003eThe effect of temperature on the activity of purified asparaginase produced by CRISPR-Cas9 edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e cultured with rice bran as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e14\u003c/span\u003e. As the temperature increased from 20\u0026deg;C to 40\u0026deg;C, the enzyme activity from both strains reached a peak at 40\u0026deg;C with 1.2 U/mL for the CRISPR-Cas9 edited strain (CCEE) and 0.8 U/mL for the wild-type strain (CCWE). Beyond 40\u0026deg;C, enzyme activity declined, dropping to 0.5 U/mL and 0.3 U/mL at 80\u0026deg;C for CCEE and CCWE, respectively. The asparaginase activity was consistently higher in the CRISPR-Cas9 edited strain compared to the wild-type strain at all temperatures tested. These differences in enzyme activity between the two strains are statistically significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) at a 95% confidence interval.\u003c/p\u003e"},{"header":"4. DISCUSSION","content":"\u003cp\u003eThrough recent advancements in genetic engineering, CRISPR-Cas9 has emerged as a groundbreaking tool, revolutionizing the modification of specific genes (Zhu, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This technology has made it possible to fine-tune microbial systems, especially for industrial and medical purposes, by optimizing their metabolic pathways. Through the use of CRISPR-Cas9 technology, \u003cem\u003eEscherichia coli\u003c/em\u003e has been modified genetically to improve their metabolic pathway in a way that enhances asparaginase production. Using the CRISPR-Cas9 technology, the \u003cem\u003elacZ\u003c/em\u003e gene, which is normally present in the \u003cem\u003eE. coli\u003c/em\u003e HB101-pBRKan chromosome, was altered in this experiment.\u003c/p\u003e\u003cp\u003eThe bacteria found on Plate 1 were derived from a starter plate containing kanamycin, IPTG (Isopropyl β-D-1-thiogalactopyranoside), and X-gal but lacked arabinose (the repair mechanism). These bacteria, which carried the plasmid donor (DNA donor template) and Cas9 but lacked single guide RNA (sgRNA), formed blue colonies. The blue coloration indicated that the \u003cem\u003elacZ\u003c/em\u003e gene remained unedited, as active beta-galactosidase hydrolyzed X-gal, stimulated by IPTG. This result aligns with Minari et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), who reported that the absence of sgRNA and a repair mechanism resulted in the blue coloration of colony growth.\u003c/p\u003e\u003cp\u003eThe absence of colonies on Plate 2 which contained kanamycin, IPTG, and X-gal but no arabinose, showed no bacterial growth. Here, \u003cem\u003eE. coli\u003c/em\u003e which has the plasmid donor guide (DNA donor template and sgRNA) and Cas9 resulted in the cleavage of the \u003cem\u003elacZ\u003c/em\u003e gene. However, the absence of arabinose meant the repair machinery was inactive. Consequently, the double-stranded DNA breaks were irreparable, leading to bacterial cell death. This finding were reported by Sinha et al., (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) who observed that bacteria without functional repair machinery do not survive double-strand breaks and thus do not form colonies.\u003c/p\u003e\u003cp\u003eThe presence of 239 colonies on Plate 3, which contained the plasmid donor (DNA donor template) and Cas9 but lacked single guide RNA (sgRNA), along with kanamycin, IPTG, X-gal, and arabinose (the repair machinery), indicates that the \u003cem\u003elacZ\u003c/em\u003e gene was not cleaved by Cas9. The blue coloration of the colonies reflects the hydrolysis of X-gal by active beta-galactosidase, which is only expressed when the \u003cem\u003elacZ\u003c/em\u003e gene remains functional and is induced by IPTG. This observation aligns with findings from Fels et al., (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which noted that the insertion of a stop codon by the donor DNA template inhibits the formation of functional beta-galactosidase, preventing the gene from being cleaved or subsequently repaired in such bacterial colonies.\u003c/p\u003e\u003cp\u003eWhite colonies observed on Plate 4 were the result of the presence of kanamycin, IPTG, X-gal, arabinose, a plasmid donor guide, including the DNA donor template and sgRNA. The sgRNA directed Cas9 to target and cut the \u003cem\u003elacZ\u003c/em\u003e gene, while arabinose activated the repair mechanism. The appearance of white colonies indicated that the \u003cem\u003elacZ\u003c/em\u003e gene was successfully cut and repaired. This finding aligns with Yang et al., (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), who described the use of homology-directed repair (HDR) facilitated by the DNA donor template to fix double-stranded breaks. The lack of blue coloration, even in the presence of IPTG and X-gal, confirmed that the \u003cem\u003elacZ\u003c/em\u003e gene was no longer functional.\u003c/p\u003e\u003cp\u003ePCR samples were analyzed using agarose gel electrophoresis, and each sample yielded specific amplicons. The bands observed in each lane represented the amplicons produced by the corresponding PCR sample. The 1,100 bp amplicon confirmed that the \u003cem\u003elacZ\u003c/em\u003e gene remained functional, as the Cas9 cut site was not modified. This result confirms the presence of active \u003cem\u003elacZ\u003c/em\u003e genes in the unedited \u003cem\u003eE. coli\u003c/em\u003e colonies found on Plates A and C. However, the 650 bp amplicon showed that the donor DNA had been used to repair the targeted cut site, confirming the result of CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e colonies found on Plate D. Additionally, the presence of a 350 bp amplicon indicated that genomic DNA was successfully extracted and amplified, regardless of whether the \u003cem\u003elacZ\u003c/em\u003e gene was modified. This result is supported by the findings of Minari et al., (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), who reported that the first primer pair (1,100 bp) was designed to identify the unmodified \u003cem\u003elacZ\u003c/em\u003e gene, the second primer pair (650 bp) was specifically created to detect the edited \u003cem\u003elacZ\u003c/em\u003e gene, and the third primer pair (350 bp) served as a control by amplifying a region unrelated to the \u003cem\u003elacZ\u003c/em\u003e gene.\u003c/p\u003e\u003cp\u003eAfter editing, both the edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e colonies were screened for asparaginase activity. This activity was assessed by the breakdown of asparagine into ammonia and aspartic acid, indicated by the formation of pink colonies, as described by Fatima et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The results suggested that the edited \u003cem\u003eE. coli\u003c/em\u003e exhibited higher asparaginase activity, as evidenced by a clearer zone of utilization on the asparaginase medium compared to the wild-type strain. The rice bran medium used in this study effectively supported the growth of the organism. This aligns with the findings of Kargapolova et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), who emphasized that microbiological media must satisfy an organism\u0026rsquo;s requirements for carbon, nitrogen, minerals, growth factors, and water, while being free from inhibitory substances.\u003c/p\u003e\u003cp\u003eIn this study, the maximum biomass concentration was achieved at 37\u0026deg;C, consistent with the observations of Jaiganesh and Jaganathan, (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), who also reported optimal biomass concentration at this temperature. Among the tested conditions (10\u0026deg;C, 37\u0026deg;C, and 45\u0026deg;C), 37\u0026deg;C resulted in the highest biomass yield for both CRISPR-edited and unedited \u003cem\u003eE. coli\u003c/em\u003e inoculated on rice bran medium. The optical density (OD) at 540 nm of both wild-type and CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e in the fermentation medium was monitored over 120 hours. Both the edited and wild-type strains of \u003cem\u003eE. coli\u003c/em\u003e achieve optimal growth at 37\u0026deg;C, with the edited strain exhibiting a slightly higher OD (1.26) compared to the unedited strain (1.18). Growth at temperatures (10\u0026deg;C and 45\u0026deg;C) was significantly reduced in both strains, with the edited strain consistently showing higher growth efficiency. These findings suggest that genetic modifications can enhance growth performance, particularly under sub-optimal conditions. This aligns with the findings of Son and Taylor, (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), who reported that 37\u0026deg;C provides the most favorable conditions for \u003cem\u003eE. coli\u003c/em\u003e growth, supporting optimal temperature-dependent growth conditions.\u003c/p\u003e\u003cp\u003eAfter submerged fermentation, the crude enzyme was purified using ammonium sulfate, resulting in a clear solution. Minari \u003cem\u003eet al\u003c/em\u003e. (2022) adopted a similar approach in their study, achieving comparable clarity in the enzyme solution following ammonium sulfate treatment. The asparaginase enzyme was then subjected to ion-exchange chromatography, and the higher activity observed in the edited strain aligns with findings by Shishparenok et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), who reported that genetic modifications, such as CRISPR-Cas9 editing, can enhance the enzymatic efficiency and increase the yield and activity of industrial enzymes, including asparaginase. In contrast, the wild-type strain\u0026rsquo;s performance resembles baseline enzymatic activity reported in studies like Dumina et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), where wild-type \u003cem\u003eE. coli\u003c/em\u003e strains demonstrated moderate asparaginase activity under similar purification methods.\u003c/p\u003e\u003cp\u003eOptimization studies on asparaginase enzyme production by \u003cem\u003eE. coli\u003c/em\u003e in a fermented rice bran medium revealed that various factors significantly influenced asparaginase yield. This finding aligns with the work of Munawar et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), who emphasized the importance of optimizing culture conditions and chemical and physical parameters\u0026mdash;such as pH, temperature, salt concentration, and incubation time\u0026mdash;for maximizing microbial enzyme production. In this study, asparaginase production by wild-type \u003cem\u003eE. coli\u003c/em\u003e was compared to that of CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e, focusing on pH and temperature effects.\u003c/p\u003e\u003cp\u003eThe purified asparaginase enzyme from both strains showed a steady increase in activity with rising pH levels, reaching maximum activities of 1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 U/mL for wild-type \u003cem\u003eE. coli\u003c/em\u003e and 0.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 U/mL for CRISPR-Cas9-edited \u003cem\u003eE. coli\u003c/em\u003e at a neutral pH of 7. These results indicate that pH 7 is optimal for asparaginase activity in both strains, as reported by Abdelrazek et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), where the enzymatic activity of asparaginase was shown to peak at neutral pH 7.\u003c/p\u003e\u003cp\u003eTemperature optimization revealed that both wild-type and CRISPR-Cas9 edited \u003cem\u003eE. coli\u003c/em\u003e cultured with rice bran exhibited maximum asparaginase activity of 0.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005 U/mL and 1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002 U/mL, respectively, at 40\u0026deg;C. This finding is slightly higher but closely aligns with Arevalo-Tristancho et al., (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), who reported an optimum temperature of 37.5\u0026deg;C for asparaginase activity, emphasizing the enzyme\u0026rsquo;s thermotolerance and adaptability within a physiologically relevant temperature range.\u003c/p\u003e\u003cp\u003eThis result suggests that the \u003cem\u003elacZ\u003c/em\u003e gene knockout enhances the temperature-dependent activity of asparaginase. Furthermore, beyond 40\u0026deg;C, a decline in activity was observed, with the activity dropping to 0.5 U/mL for the CRISPR-Cas9 edited strain and 0.3 U/mL for the wild-type strain at 80\u0026deg;C. This decline is likely due to enzyme denaturation at higher temperatures, consistent with the thermolabile nature of most microbial enzymes. However, the general trends in both strains demonstrate similar pH and temperature profiles, indicating that the \u003cem\u003elacZ\u003c/em\u003e knockout has an impact on the enzyme\u0026rsquo;s stability.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe study demonstrates that CRISPR-Cas9 technology can significantly enhance the yield and functional properties of asparaginase, making it a promising approach for industrial enzyme production. The findings also highlight the importance of optimizing fermentation parameters, particularly temperature and pH, to maximize enzyme output. Future research could explore the underlying mechanisms responsible for the improved performance of CRISPR-edited strains and evaluate their scalability for industrial applications. Additionally, assessing other growth conditions and substrate types could provide broader insights into optimizing enzyme production using genetically modified microorganisms.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. This study did not involve human participants, data, or animals requiring ethics approval.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. No individual person\u0026rsquo;s data, images, or videos are included in this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOpeyemi Hannah Akindusoye conceived and designed the study, performed the CRISPR-Cas9 gene editing experiments and enzyme production, interpreted the results, and drafted the main manuscript text. Ruth Chinasa Okafor contributed to CRISPR-Cas9 gene editing experiment, data analysis, and interpretation of results. Adepeju Matilda Adekoya assisted with enzyme purification and ion-exchange chromatography. Joseph Bamidele Minari supervised the study design, provided critical revisions to the manuscript, and approved the final version. All authors reviewed and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information (optional)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdelrazek NA, Elkhatib WF, Raafat MM, Aboulwafa MM. Production, characterization and bioinformatics analysis of L-asparaginase from a new \u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e EMCC2297 soil isolate. AMB Express. 2020; \u003cem\u003e10\u003c/em\u003e(71), 1-16. https://doi.org/10.1186/s13568-020-01005-7 \u003c/li\u003e\n\u003cli\u003eAlamillo JM, L\u0026oacute;pez CM, Rivas FJ, Torralbo F, Mustafa Bulut M, Alseekh S. Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein and hairy roots: a perfect match for gene functional analysis and crop improvement. Current Opinion in Biotechnology. 2023; \u003cem\u003e79\u003c/em\u003e, 1-9. https://doi.org/10.1016/j.copbio.2022.102876 \u003c/li\u003e\n\u003cli\u003eArevalo-Tristancho E, Diaz LE, Cortazar JE, Valero MF. Production and Characterization of L-Asparaginases of \u003cem\u003eStreptomyces\u003c/em\u003e Isolated from the Arauca Riverbank (Colombia). The Open Microbiology Journal. 2019; \u003cem\u003e13\u003c/em\u003e(1), 204-215. http://dx.doi.org/10.2174/1874285801913010204 \u003c/li\u003e\n\u003cli\u003eChen X, Li C, Liu H. Enhanced Recombinant Protein Production Under Special Environmental Stress. Frontiers in Microbiology\u003cem\u003e. \u003c/em\u003e2021;\u003cem\u003e 12\u003c/em\u003e, 1-11. https://doi.org/10.3389/fmicb.2021.630814 \u003c/li\u003e\n\u003cli\u003eDimowo CG, Omonigho, SE. Purification and Characterization of Produced L- Asparaginase from \u003cem\u003eStreptomyces Avermitilis\u003c/em\u003e Isolated from Marine Environment in Lagos, Nigeria. Journal of Medical \u0026amp; Basic Science Research. 2023; \u003cem\u003e1\u003c/em\u003e(2), 25-34. https://10.5281/zenodo.7652562 \u003c/li\u003e\n\u003cli\u003eDong H, Cui Y, Zhang D. (2021). CRISPR-Cas Technologies and Their Applications in \u003cem\u003eEscherichia coli\u003c/em\u003e. Frontiers in Bioengineering and Biotechnology. 2021; \u003cem\u003e9\u003c/em\u003e(1), 1-10. https://doi.org/10.3389/fbioe.2021.762676 \u003c/li\u003e\n\u003cli\u003eDumina M, Zhgun A, Pokrovskaya M, Aleksandrova S, Zhdanov D, Sokolov N, El\u0026rsquo;darov M. Highly Active Thermophilic L-Asparaginase from \u003cem\u003eMelioribacter roseus\u003c/em\u003e represents a Novel Large Group of Type II Bacterial L-Asparaginases from Chlorobi Ignavibacteriae-Bacteroidetes Clade. International Journal of Molecular Sciences. 2021; \u003cem\u003e22\u003c/em\u003e(24), 1-17. https://doi.org/10.3390/ijms222413632 \u003c/li\u003e\n\u003cli\u003eFatima N, Khan MM, Khan IA. L-asparaginase produced from soil isolates of Pseudomonas aeruginosa shows potent anti-cancer activity on HeLa cells. Saudi Journal of Biological Sciences. 2019; \u003cem\u003e26\u003c/em\u003e, 1146-1153. https://doi.org/10.1016/j.sjbs.2019.05.001 \u003c/li\u003e\n\u003cli\u003eFels U, Gevaert K, Van Damme P. Bacterial Genetic Engineering by Means of Recombineering for Reverse Genetics. Frontiers in Microbiology. 2020; \u003cem\u003e11\u003c/em\u003e(548410), 1-19. https://doi.org/10.3389/fmicb.2020.548410 \u003c/li\u003e\n\u003cli\u003eJia R, Wan X, Geng X, Xue D, Xie Z, Chen C. Microbial L-asparaginase for Application in Acrylamide Mitigation from Food: Current Research Status and Future Perspectives. Microorganisms. 2021; \u003cem\u003e9\u003c/em\u003e(1659), 1-21. https://doi.org/10.3390/microorganisms9081659\u003cu\u003e \u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eJaiganesh R, Jaganathan MK. Isolation, Purification, and Characterization of Lipase from \u003cem\u003eBacillus Sp.\u003c/em\u003e from Kitchen Grease. Asian Journal of Pharmaceutical and Clinical Research\u003cem\u003e. \u003c/em\u003e2018\u003cem\u003e; 11\u003c/em\u003e(6), 224-227. http://dx.doi.org/10.22159/ajpcr.2018.v11i6.24955 \u003c/li\u003e\n\u003cli\u003eKatsimpouras C \u0026amp; Stephanopoulos G. Enzymes in biotechnology: Critical platform technologies for bioprocess development. Current Opinion in Biotechnology. 2021; \u003cem\u003e69\u003c/em\u003e(1), 91-102. https://doi.org/10.1016/j.copbio.2020.12.003\u003c/li\u003e\n\u003cli\u003eKargapolova KY, Burygin GL, Tkachenko OV, Evseeva NV, Pukhalskiy YV, Belimov AA. Effectiveness of inoculation of in vitro grown potato microplants with rhizosphere bacteria of the genus Azospirillum. Plant Cell Tissue Organ Culture. 2020; \u003cem\u003e141\u003c/em\u003e, 351-359. https://doi.org/10.1007/s11240-020-01791-9 \u003c/li\u003e\n\u003cli\u003eLoch JI, Jaskolski M. Structural and biophysical aspects of L-asparaginases: a growing family with amazing diversity. International Union of Crystallography. 2021; \u003cem\u003e8\u003c/em\u003e(1), 514-531. https://doi.org/10.1107/S2052252521006011 \u003c/li\u003e\n\u003cli\u003eLubkowski J, Wlodawer A. Structural and biochemical properties of L-asparaginase. FEBS Journal. 2021; \u003cem\u003e288\u003c/em\u003e(14), 1-27. https://doi.org/10.1111/febs.16042\u003c/li\u003e\n\u003cli\u003eMaese L, Rau RE. Current Use of Asparaginase in Acute Lymphoblastic Leukemia/Lymphiblastic Lymphoma. Frontiers in Pediatrics\u003cem\u003e. \u003c/em\u003e2022;\u003cem\u003e 10\u003c/em\u003e, 1-13. https://doi.org/10.3389/fped.2022.902117 \u003c/li\u003e\n\u003cli\u003eMinari JB\u003ccite\u003e, \u003c/cite\u003eAgho EE\u003ccite\u003e,\u003c/cite\u003e Emelumadu EN\u003ccite\u003e, \u003c/cite\u003eAdeniyi OA\u003ccite\u003e, \u003c/cite\u003eOlajiga FR\u003ccite\u003e. \u003c/cite\u003eCharacterization of laccase from the fungi \u003cem\u003eFusarium\u003c/em\u003e isolated from potato peels using carbon and nitrogen sources\u003ccite\u003e. Advances in Technology. 2022; \u003c/cite\u003e2\u003ccite\u003e(\u003c/cite\u003e2\u003ccite\u003e), \u003c/cite\u003e183\u003ccite\u003e-\u003c/cite\u003e197\u003ccite\u003e.\u003c/cite\u003e https://doi.org/10.31357/ait.v2i2.5400 \u003c/li\u003e\n\u003cli\u003eMinari JB, Nwosu GE, Dada IS, Abdulazeez DO. Isolation and Characterization of Amylase Produced by CRISPR-Cas9 Edited \u003cem\u003eLacZ\u003c/em\u003e Gene and Unedited \u003cem\u003eEscherichia\u003c/em\u003e \u003cem\u003ecoli\u003c/em\u003e using Potato Peel (\u003cem\u003eIpomea batata\u003c/em\u003e) as Enzyme Source. Journal of Applied Science of Environmental Management\u003cem\u003e. \u003c/em\u003e2024;\u003cem\u003e 28\u003c/em\u003e(10), 2981-2989. https://dx.doi.org/10.4314/jasem.v28i10.5\u003c/li\u003e\n\u003cli\u003eMunawar A, Shaheen M, Ramzan S, Masih SA, Jabeen F, Younis T, Aslam M. Diveristy and enzymatic potential of indigenous bacteria from unexplored contaminated soils in Faisalabad. Heliyon\u003cem\u003e. \u003c/em\u003e2023;\u003cem\u003e 9\u003c/em\u003e, 1-15. https://doi.org/10.1016/j.heliyon.2023.e15256 \u003c/li\u003e\n\u003cli\u003eNiazi SK, Magoola M. Advances in \u003cem\u003eEscherichia coli\u003c/em\u003e-Based Therapeutic Protein Expression: Mammalian Conversion, Continuous Manufacturing, and Cell-Free Production. Biologics. 2023; \u003cem\u003e3\u003c/em\u003e(1), 380-401. https://doi.org/10.3390/biologics3040021 \u003c/li\u003e\n\u003cli\u003eNiranjana J, Gandhi KA, Sunmathi D, Nanthavanan P. Extraction, Characterization and Partial Purification of L-Asparaginase from the Leaves of Arachis Hypogaea. Bioscience Biotechnology Research Asia\u003cem\u003e. \u003c/em\u003e2019;\u003cem\u003e 16\u003c/em\u003e(3), 681-691. http://dx.doi.org/10.13005/bbra/2783 \u003c/li\u003e\n\u003cli\u003eRuiz N, Silhavy TJ. How \u003cem\u003eEscherichia coli\u003c/em\u003e Became the Flagship Bacterium of Molecular Biology. Journal of Bacteriology. 2022; \u003cem\u003e204\u003c/em\u003e(9), 1-9. https://doi.org/10.1128/jb.00230-22 \u003c/li\u003e\n\u003cli\u003eSharma R, Garg P, Kumar P, Bhatia S, Kulshrestha S. Microbial Fermentation and Its Role in Quality Improvement of Fermented Foods. Fermentation. 2020; \u003cem\u003e6\u003c/em\u003e(106), 1-20. http://dx.doi.org/10.3390/fermentation6040106 \u003c/li\u003e\n\u003cli\u003eShishparenok AN, Gladilina YA, Zhdanov DD. Engineering and Expression Strategies for Optimization of L-Asparaginase Development and Production. International Journal of Molecular Sciences\u003cem\u003e. \u003c/em\u003e2023;\u003cem\u003e 24\u003c/em\u003e(15220), 1-60. https://doi.org/10.3390/ijms242015220 \u003c/li\u003e\n\u003cli\u003eSinha AK, Possoz C, Leach, DR. The Roles of Bacterial DNA Double-Strand Break Repair Proteins in Chromosomal DNA Replication. FEMS Microbiology Reviews. 2020; \u003cem\u003e44\u003c/em\u003e(3), 351-368. https://doi:10.1093/femsre/fuaa009 \u003c/li\u003e\n\u003cli\u003eSpaggiari M, Dall\u0026rsquo;Asta C, Galaverna G, Castillo Bilbao, MD. Rice Bran By-Product: From Valorization Strategies to Nutritional Perspectives. \u003cem\u003eFoods\u003c/em\u003e. 2021; \u003cem\u003e10\u003c/em\u003e(85), 1-16. https://doi.org/10.3390/foods10010085 \u003c/li\u003e\n\u003cli\u003eSon MS, Taylor RK. Growth and Maintenance of \u003cem\u003eEscherichia coli\u003c/em\u003e Laboratory Strains. Current Protocols. 2022; \u003cem\u003e1\u003c/em\u003e(1), 1-13. https://doi.org/10.1002/cpz1.20\u003c/li\u003e\n\u003cli\u003eTan BL, Norhaizan ME, Chan LC. Rice Bran: From Waste to Nutritious Food Ingredients. Nutrients. 2023; \u003cem\u003e15\u003c/em\u003e(2503), 1-25. https://doi.org/10.3390/nu15112503\u003c/li\u003e\n\u003cli\u003eYang H, Ren S, Yu S, Pan H, Li T, Ge S, Zhang J, Xia N. Methods Favoring Homology-Directed Repair Choice in Response to CRISPR-Cas9 Induced-Double Strand Breaks. International Journal of Molecular Sciences. 2020; \u003cem\u003e21\u003c/em\u003e(6461), 1-20. http://dx.doi.org/10.3390/ijms21186461 \u003c/li\u003e\n\u003cli\u003eZhu Y. Advances in CRISPR-Cas9. Biomed Research International. 2022; \u003cem\u003e2022\u003c/em\u003e(1), 1-13. https://doi.org/10.1155/2022/9978571\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CRISPR-Cas9, Escherichia coli, LacZ gene, Asparaginase, Rice Bran, Sustainable Enzyme Bioproduction","lastPublishedDoi":"10.21203/rs.3.rs-7802084/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7802084/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGenome editing with CRISPR-Cas9 offers a powerful approach for enhancing enzyme production in microorganisms. This study aimed to genetically engineer the \u003cem\u003elacZ\u003c/em\u003e gene in \u003cem\u003eEscherichia coli\u003c/em\u003e using CRISPR-Cas9 to evaluate its impact on asparaginase production during submerged fermentation with rice bran serving as a glucose source. Both edited and wild-type \u003cem\u003eE. coli\u003c/em\u003e strains were cultured at optimal conditions to produce and characterize asparaginase. The edited \u003cem\u003eE. coli\u003c/em\u003e formed distinct colonies, displaying a blue phenotype when exposed to Cas9 without sgRNA or arabinose, yielding a total of 96 colonies. No colonies were observed when Cas9 and sgRNA were present without arabinose, while the addition of Cas9 and arabinose without sgRNA resulted in 309 blue colonies. With Cas9, sgRNA, and arabinose present, repair activation produced 114 distinct white colonies. The editing of the \u003cem\u003elacZ\u003c/em\u003e gene was validated through multiplex PCR and gel electrophoresis, with bands at 650 bp indicated \u003cem\u003elacZ\u003c/em\u003e gene editing, while bands at 1,100 bp indicated the wild-type. Asparaginase production was assessed using plate method assay, submerged fermentation using rice bran as a glucose source, and subsequent purification via ammonium sulfate precipitation and ion-exchange chromatography. Ion-exchange chromatography revealed enhanced purity and activity in the edited strain, with peak activity observed at an elution of 80 mL. The CRISPR-Cas9 edited strain exhibiting significantly higher enzyme activity (1.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002 U/ mL) compared to the wild-type (0.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.005 U/mL). Both strains demonstrated maximum asparaginase activity at 40\u003csup\u003eo\u003c/sup\u003eC and pH 7. This study concludes that CRISPR-Cas9 meditated \u003cem\u003elacZ\u003c/em\u003e gene editing in \u003cem\u003eE. coli\u003c/em\u003e improves its ability to utilize rice bran as a substrate, significantly enhancing asparaginase production. These findings highlight the potential of genetic engineering and agricultural by-products for sustainable enzyme production.\u003c/p\u003e","manuscriptTitle":"CRISPR-Cas9 Mediated Knockout of LacZ Gene in Escherichia Coli for Enhanced Production of Asparaginase","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-30 09:14:48","doi":"10.21203/rs.3.rs-7802084/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e5933c1e-474a-4e6b-b903-9257712db9f0","owner":[],"postedDate":"October 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-17T05:08:48+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-30 09:14:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7802084","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7802084","identity":"rs-7802084","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-28T02:00:01.590549+00:00
License: CC-BY-4.0