The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster

The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster Tianmu Zhang , Hongyu Miao , Xiaoli Zhang , Joshua Bagley , Yongwen Huang , View ORCID Profile Woo Jae Kim doi: https://doi.org/10.1101/2025.09.09.675227 Tianmu Zhang 1 The HIT Center for Life Sciences, Harbin Institute of Technology , Harbin, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hongyu Miao 1 The HIT Center for Life Sciences, Harbin Institute of Technology , Harbin, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Xiaoli Zhang 1 The HIT Center for Life Sciences, Harbin Institute of Technology , Harbin, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Joshua Bagley 2 Howard Hughes Medical Institute, Departments of Physiology , Biochemistry, and Biophysics, University of California , San Francisco, San Francisco, USA 3 a:head bio AG , Vienna, Austria Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yongwen Huang 1 The HIT Center for Life Sciences, Harbin Institute of Technology , Harbin, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Woo Jae Kim 1 The HIT Center for Life Sciences, Harbin Institute of Technology , Harbin, China 2 Howard Hughes Medical Institute, Departments of Physiology , Biochemistry, and Biophysics, University of California , San Francisco, San Francisco, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Woo Jae Kim For correspondence: wkim{at}hit.edu.cn Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Following mating, female Drosophila melanogaster display profound behavioral changes, including sensory sensitivity and rejection of courting males. The molecular mechanisms governing this plasticity remain incompletely understood. Here, we identify the conserved microRNA, miR-9a, as a critical regulator of this process. We show that miR-9a mutant females exhibit a premature rejection phenotype, mimicking mated-female behavior, which is correlated with an aberrant overgrowth of adult body wall sensory neurons. We demonstrate that this neuronal phenotype is governed by a dual regulatory system. First, in a non-cell autonomous mechanism, miR-9a expression in the epidermis is required to constrain sensory neuron dendrite growth, indicating that an epithelial-derived signal patterns the underlying neuron. Second, within the neuron itself, miR-9a interacts genetically with the transcription factor senseless ( sens ) and the novel RNA-binding protein bruno2 (bru2) . Reducing the dosage of either sens or bru2 rescues both the neuronal and behavioral defects of miR-9a mutants. Our findings reveal an integrated, inter-tissue signaling axis where epithelial miR-9a orchestrates a non-cell autonomous cue that modulates a cell-intrinsic network to ensure the precise development of sensory neurons, thereby calibrating behavioral responses critical for reproductive success. INTRODUCTION After mating, female Drosophila melanogaster undergo a marked transformation in behavioral response, exhibiting an enhanced sensitivity to a broad array of sensory inputs. This altered sensory perception is a component of a complex suite of post-mating changes that optimize the female’s reproductive strategy ( Yang et al. 2009a ; Zhu et al. 2014 ; Hussain et al. 2016 ; Bath et al. 2017 ). Enhanced sensory reactivity represents a pivotal component of the post-mating behavioral syndrome in female Drosophila melanogaster . This adaptive sensitization is hypothesized to confer selective advantages by facilitating the evasion of predators and/or by aiding in the detection of optimal oviposition sites, thereby enhancing the female’s reproductive success ( Hollis et al. 2019 ). MicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs that predominantly function in the post-transcriptional regulation of gene expression. These molecules exert their regulatory effects by annealing to the complementary sequences within the 3’ untranslated region (3’ UTR) of target messenger RNAs (mRNAs), thereby facilitating either the degradation of the mRNA transcript or the suppression of protein synthesis, depending on the degree of complementarity and other context-dependent factors ( Bartel 2009a ; Brodersen and Voinnet 2009 ). miRNAs are implicated in diverse brain functions including development, cognition, and synaptic plasticity ( Smalheiser and Lugli 2009a ; Cohen et al. 2011a ; Aksoy-Aksel et al. 2014a ; Ye et al. 2016 ; Mohammadi et al. 2022a ). The miR-9a and its mammalian ortholog, miR-9 , are pivotal regulators of post-transcriptional gene expression, with diverse roles in development, cellular differentiation, and disease progression ( Li et al. 2006 ; Biryukova et al. 2009 ; Cassidy et al. 2013a ; Li et al. 2013 ; Yatsenko and Shcherbata 2014 ; Cassidy et al. 2015 ; Suh et al. 2015 ; Daniel et al. 2017 ; Katti et al. 2017 ; Gallicchio et al. 2020 ; Subramanian et al. 2021 ). Although miR-9a is multifunctional, miR-9a was initially recognized for its essential function in neural development, particularly in the precise specification of sensory organ precursors (SOPs) ( Li et al. 2006 ; Parrish et al. 2006 ). Notably, miR-9a exhibits a strong genetic interaction with the senseless ( sens ) gene in controlling SOPs formation ( Li et al. 2006 ). The miR-9a predominantly influences the development of multidendritic sensory neurons and is crucial for the correct morphogenesis of their dendritic arbors ( Parrish et al. 2006 ; Wang et al. 2016a ). In this study, we investigated the role of miR-9a in regulating reproductive behaviors and neuronal development in Drosophila melanogaster . We found that virgin females carrying miR-9a mutations display reduced receptivity, increased rejection of courting males, and abnormal mating termination behavior, while males show distinct defects in courtship displays. These behavioral changes correlate with aberrant overgrowth of body wall sensory neurons, suggesting that miR-9a influences pre-mating behaviors through regulation of neuronal development. Furthermore, genetic interaction experiments with sens and the newly identified interactor bru2 revealed that partial loss of these genes rescues the miR-9a mutant phenotype. Together, our findings demonstrate that miR-9a plays a crucial role in sensory neuron specification and pre-mating reproductive behaviors in Drosophila . RESULTS Female Drosophila melanogaster with mutations in miR-9a exhibit rejection of courting males It is established that internal sensory neurons expressing the pickpocket ( ppk ) gene mediate the post-mating behavioral switch through the binding of sex peptide to its receptor ( Häsemeyer et al. 2009a ; Yang et al. 2009a ). Given that miR-9a is implicated in the development of sensory organ precursors (SOPs) ( Li et al. 2006 ; Wang et al. 2016a ), including ppk -positive neurons, indicating that miR-9a mutations are associated with altered receptivity and may involve changes in ppk -expressing neurons. We used two previously characterized loss-of-function alleles of miR-9a , miR-9a J22 and miR-9a E58 . Both alleles carry deletions that remove the precursor hairpin sequence of miR-9a , resulting in a complete loss of mature miR-9a expression ( Li et al. 2006 ; Biryukova et al. 2009 ). These alleles have been widely used to study miR-9a ’s role in neural development and sensory organ specification. Both miR-9a mutant strains, miR-9a J22 and miR-9a E39 , displayed a significant decrease in receptivity among virgin females across both 20-minute and 120-minute observation periods ( Fig. 1A-B , Fig. S1A-B and Fig. S1F-G). Temporal analysis of receptivity scores definitively revealed that miR-9a mutant females exhibit a substantial delay in the onset of sexual receptivity ( Fig. 1C and Fig. S1C). Relative to wild-type control females, miR-9a mutant females exhibited a significantly higher rejection rate within a 5-minute observation window ( Fig. 1D ). Moreover, miR-9a mutant females that initially accepted a male often subsequently terminated the mating attempt ( Fig. 1E ). This behavior, wherein a female accepts a male and then rapidly rejects accepted male within seconds, is a phenotype that is infrequently observed in wild-type females (Movies 1-4). Download figure Open in new tab Figure 1. miR-9a mutations lead to a specific increase in rejection behavior among virgin females. (A-B) Receptivity of virgin females, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. In each assay, one female of the indicated genotype was confronted with two naive males in a small chamber. Females were scored as receptive when they mated within 20 minutes (A) and 120 minutes (B). Numbers in columns are the numbers of females tested. DBMs represent difference between means. Error bars show the 95% confidence interval for the mean difference, calculated using estimation statistics. The mean value and standard error are labeled within the dot plot (black lines). Asterisks represent significant differences, as revealed by the Student’s t test (* p<0.05, ** p<0.01, *** p<0.001). The same notations for statistical significance are used in other figures. (C) Temporal dynamics of virgin female receptivity over a 120-minute observation period. Each curve represents an independent time-course experiment performed separately from the receptivity assays shown in Figures 1A and 1B, which explains the difference in sample sizes. Females were scored as receptive when copulation occurred, and cumulative receptivity was plotted across the indicated time intervals. Numbers in parentheses denote the number of females tested per genotype. (D) The Receptivity assays of wCS females, miR-9a J22 /miR-9a J22 homozygous mutant and miR-9a E39 /miR-9a E39 homozygous mutant in 5 minutes. (E) Females harboring a miR-9a J22 mutation initially accepted male courtship but subsequently terminated the mating attempt. (F) Rejection of mated females, with the score for rejection behavior as well as genotype of experimental animals given above the graph. PMR means post-mating reaction. For detailed description of the calculation of rejection rate, see Receptivity Assay in Method section (G) Egg laying. For egg laying, 10 females of the appropriate genotype were aged in vials for 4–5 days. Then three or five females were transferred to a vial with grape media and allowed to lay eggs for 24 hr at 25°C. The number of eggs was divided by the number of flies in the vial to give a measure of egg laying. (H) Climbing assays of females. 40–50 flies were placed in an empty vial and were tapped to the bottom of the tube. After tapping of flies, we recorded 10 s of video clip. This experiment was done five times at 5-min intervals. With recorded video files, we captured the position of flies 10 s after tapping the vial. (I) Flight assays of females. For each assay, fifty flies were gently introduced into a water-filled jar. The jar was then tapped to stimulate the flies, and the number of flies that escaped from the water was counted. The percentage (%) of flies that escaped was calculated to determine the effectiveness of the flies’ flight response. Post-mating rejection of male courtship is a conserved element of female post-mating responses (PMR) in Drosophila melanogaster ( Chapman et al. 2003 ; Kubli 2003 ; Yapici et al. 2008 ). While miR-9a mutants did not show a detectable difference in post-mating rejection compared with controls, the rejection rate of mated miR-9a mutants was indistinguishable from that of control mated females ( Fig. 1F and Fig. S1D), indicating that the PMR in miR-9a mutants is intact. Notably, mated miR-9a mutants deposited a greater number of eggs than controls ( Fig. 1G and Fig. S1E), suggesting that miR-9a specifically modulates egg-laying behavior rather than rejection behavior within the PMR. Furthermore, miR-9a mutants exhibited a marked reduction in climbing ( Fig. 1H ) and flight ( Fig. 1I ; Movies 5-6) abilities, indicative of impaired muscle contraction, consistent with previous reports ( Katti et al. 2017 ). Collectively, these findings indicate that miR-9a mutations lead to a specific increase in rejection behavior among virgin females, while the rejection responses of mated females remain unaffected. Male fruit flies with mutations in miR-9a display aberrant courtship behaviors, and the larvae of these mutants exhibit locomotor defects Although our main focus is on virgin female receptivity, we also noted that miR-9a mutant males exhibit altered courtship performance. Specifically, mutant males showed a reduced courtship index ( Fig. 2A ). Notably, a substantial proportion of miR-9a mutant males displayed a unique courtship behavior characterized by bilateral wing vibration ( Fig. 2B ), in contrast to the typical unilateral wing vibration observed in controls ( Fig. 2C ). Approximately two-thirds of miR-9a mutant males exhibited this double wing vibration phenotype ( Fig. 2D and Movies 7-8), indicating that miR-9a mutation leads to specific courtship defects in male flies. Similar to the locomotor deficits observed in mutant females, miR-9a mutant males also exhibited reduced climbing and flight abilities (Fig. S2A-B), suggesting a generalized impact of miR-9a mutation on locomotor behavior. These secondary results suggest that miR-9a influences reproductive behaviors in both sexes, though with distinct outcomes. Download figure Open in new tab Figure 2. Males with miR-9a mutation display abberent courtship behaviors. (A) Courtship assays of males. Once courtship began, courtship index was calculated as the fraction of time a male spent in any courtship-related activity during a 10 min period or until mating occurred. Mating initiation is the time after male flies successfully mounted on female. (B) miR-9a J22 males displayed a unique courtship behavior characterized by bilateral wing vibration. (C) CS males displayed a typical courtship behavior characterized by unilateral wing vibration. (D) Wing vibration types of males. White box represents the percentage of unilateral wing vibration and red box represents the percentage of bilateral wing vibration. In line with these adult locomotion data, third instar larvae of miR-9a mutants showed impaired locomotion (Fig. S2C-E) and exhibited an increased frequency of turning behaviors compared to controls (Fig. S2F and Movies 9-10), indicating that the miR-9a mutation elicits a unique behavioral profile, distinct from a generalized impairment of health. These findings collectively suggest that miR-9a mutation induces a range of sensory-motor-related phenotypes, from larvae to adults, across both sexes. In miR-9a mutant flies, the adult body wall neurons undergo aberrant overgrowth The conservation of miR-9 across evolutionary scales, from flies to humans, at the nucleotide level underscores its functional significance, despite variations in expression patterns ( Leucht et al. 2008 ; Biryukova et al. 2009 ; Coolen et al. 2013 ) . Studies across various model organisms have revealed that miR-9 can influence neurogenesis through its regulatory role in both neural and non-neural cell lineages ( Yuva-Aydemir et al. 2011a ). In Drosophila , miR-9a is essential for the accurate specification of neural progenitor cells in non-neural lineages. For instance, the loss of miR-9a activity leads to the formation of ectopic sensory neurons in embryos, larvae, and adults ( Li et al. 2006 ). To assess whether the female mating rejection phenotype is associated with aberrant sensory neuron development, we analyzed the female abdominal body wall neurons, which derive from the larval sensory neurons that are regulated by miR-9a ( Li et al. 2006 ). Consistent with previous findings, ppk -positive larval body wall sensory neurons in miR-9a mutants exhibit ectopic sensory neurons with exceptionally branched dendrites (Fig. S3A-B). Remarkably, adult body wall neurons also display ectopic sensory neurons with overgrown dendrites in both the ventral and dorsal abdomen ( Fig. 3A-B and Fig. S3C-D). Quantification of neurite morphology revealed a significant increase in the number of branches and junctions in miR-9a mutant body wall neurons ( Fig. 3C-D and Fig. S3E-F), although the average length of the branches is comparable between the mutant and control groups ( Fig. 3E and Fig. S3G). These data show that miR-9a mutants display aberrant adult body wall neuronal growth, consistent with its known roles in neuronal specification. Download figure Open in new tab Figure 3. The adult ventral body wall neurons undergo aberrant overgrowth in miR-9a mutant flies. (A) Location of Drosophila adult ventral neurons. (B) Ventral A6 neurons expressing ppk-GAL4 together with UAS-mCD4GFP in miR-9a J22 / + and miR-9a J22 /miR-9a J22 in adult female. The bottom pictures are skeletonized from the top pictures. Scalebar represent 100 μm. (C-E) Quantification of neurite morphology for miR-9a mutant body wall neurons in branches (C), junctions (D) and branch length (E). (F) Receptivity of virgin females in 20 minutes, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (G-H) Single-cell RNA sequencing (SCOPE scRNA-seq) datasets reveal tissues colored by expression of miR-9a (red), ppk (blue) with sens (green). (I) Schcematic diagram for color code presented in (G-H). miR-9a does not act cell-autonomously within ppk + neurons To test for a cell-autonomous requirement of miR-9a in ppk + neurons, we first overexpressed it in these cells using the ppk-GAL4 driver. This manipulation had no discernible effect on female receptivity compared to controls, arguing against a simple model where miR-9a levels within ppk+ neurons directly dictate mating behavior ( Fig. 3F ). To further probe the spatial relationship between miR-9a and its interactors, we analyzed publicly available single-cell RNA sequencing data (Fly Atlas SCope) ( Li et al. 2022 ). This analysis revealed no significant co-expression between miR-9a and the ppk marker in relevant cell clusters. We then examined the expression of senseless ( sens ), a known co-factor involved in sensory neuron’s function. As previously reported, miR-9a and sens were found to co-express highly, but this overlap was restricted to epithelial cells ( Fig. 3G ). Critically, we could not find any clear co-expression between miR-9a and ppk , or between miR-9a and sens , within any neuronal populations identified in the dataset ( Fig. 3H-I ). Taken together, these genetic and transcriptomic data strongly suggest that miR-9a does not function directly within ppk + neurons. The lack of a behavioral phenotype from neuronal-specific overexpression, combined with the spatial separation of its expression from both ppk and neuronal sens , supports a non-cell-autonomous mode of action. This model, which aligns with previous work ( Li et al. 2006 ; Biryukova et al. 2009 ; Cassidy et al. 2013b ; Wang et al. 2016b ; Gallicchio et al. 2020 ), suggests miR-9a likely acts in other tissues, such as the epithelium, to indirectly influence the function of ppk + neurons and modulate female mating behavior. An epithelial miR-9a/sens interaction non-cell autonomously regulates sensory neuron morphology and behavior It has been reported miR-9a mutants exhibit sensory bristle defects on the notum, and miR-9a interacts genetically with the sens gene ( Li et al. 2006 ). To determine whether the effects of miR-9a mutation on adult body wall neurons involve interaction with the sens gene, we conducted genetic interaction experiments. In a miR-9a J22 homozygous mutant background, the removal of one copy of sens ( sens E58 /+ ) resulted in a significant rescue of the receptivity defects, matching those of control females ( Fig. 4A and Fig. S4A). This genetic rescue of the receptivity phenotype is correlated with the normalization of the adult body wall neuronal phenotype, which displays normal sensory neurons with typical neurite growth ( Fig. 4B-E ). We did not observe differences in the overall number of ppk + sensory neurons in the abdominal body wall (A4–A6) between controls and miR-9a mutants, indicating that the overgrowth phenotype reflects increased branching within existing neurons rather than changes in neuron number (Fig. S4B). Download figure Open in new tab Figure 4. sens and bru2 mutations rescue the phenotypic defects of miR-9a mutant flies. (A) Receptivity of virgin females, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (B) Ventral neurons expressing ppk-GAL4 together with UAS-mCD4GFP in miR-9a J22 / +, sens E58 and miR-9a J22 /miR-9a J22 , E58 female. The bottom pictures are skeletonized from the top pictures. Scalebar represent 10 μm. (C-E) Quantification of neurite morphology for venral body wall neurons in branches (C), junctions (D) and branch length (E). Genotype of experimental animals given above the graph. (F) Receptivity of virgin females in 20 minutes, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (G) Overexpression of sens in body wall sensory neurons via en-GAL4 with ppk-CD4tdGFP . (H) Quantification of neurite morphology for body wall sensory neurons in branches. Genotype of experimental animals given above the graph. (I-K) Single-cell RNA sequencing (SCOPE scRNA-seq) datasets reveal tissues colored by expression of miR-9a (red), en (blue) with sens (green). (K) Schcematic diagram for color code presented in (I-K). To elucidate the non-cell autonomous mechanism by which miR-9a influences sensory neurons, we tested whether its regulatory effect is mediated through sens expression in the adjacent epithelium. We hypothesized that manipulating sens levels exclusively in epithelial cells would be sufficient to replicate the neuronal and behavioral phenotypes observed in miR-9a mutants. To test this, we employed the en-GAL4 driver to specifically overexpress a UAS-sens transgene in the epithelium ( Brower 1986 ; Blagburn 2008 ). This epithelium-specific overexpression of sens successfully phenocopied the miR-9a mutant. We observed a significant increase in the dendritic branching of ppk -positive body wall sensory neurons ( Fig. 4G-H ), mirroring the morphological defects of the miR-9a loss-of-function. Furthermore, this genetic manipulation produced a corresponding behavioral deficit, manifesting as significantly reduced sexual receptivity in female flies ( Fig. 4F ). To confirm the spatial segregation of these components, we analyzed fly SCope single-cell RNA sequencing data. The analysis revealed that miR-9a, sens , and en transcripts are highly co-expressed within a distinct cluster of epithelial cells, separate from the neuronal clusters expressing ppk ( Fig. 4I-K , cf. Fig. 3G-I ). This lack of overlap provides compelling evidence that the en-GAL4 -mediated overexpression of sens in the epithelium affects sensory neuron morphology through a non-cell autonomous pathway. Consistent with previous reports that the miR-9a- sens interaction in the epithelium modulates sensory neuron function ( Li et al. 2006 ; Mullard 2006 ; Cassidy et al. 2013b ; Gallicchio et al. 2020 ), our findings support a model where this regulatory axis is critical for shaping neuronal architecture. We conclude that the epithelial interaction between miR-9a and its target sens modifies the morphology of body wall sensory neurons, which in turn contributes to the regulation of complex behaviors like female receptivity. Spatial transcriptomics reveal an epithelial locus for miR-9a action Through bioinformatic analysis, we identified several miR-9a target genes that contain miR-9a target sequences in their untranslated regions (UTRs) of mRNA ( Kozomara et al. 2019 ). We conducted similar genetic interaction tests as with sens mutant and found that the removal of one copy of bruno2 ( bru2/+ ) completely rescued the miR-9a mutant receptivity phenotype ( Fig. 5A ). To determine the precise cellular locus of these regulatory interactions and to investigate why only a subset of predicted targets genetically modify the miR-9a phenotype, we analyzed publicly available Drosophila scRNA-seq data ( Li et al. 2022 ). This allowed us to map the spatial expression patterns of miR-9a and its targets relative to ppk -expressing neurons. Download figure Open in new tab Figure 5. miR-9a guides sensory neuron development in the adult body wall and modulates virgin female receptivity through target gene regulation. (A-D) Receptivity of virgin females in 20 minutes, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (E) Overexpression of bru2 in body wall sensory neurons via en-GAL4 with ppk-CD4tdGFP . (F) Quantification of neurite morphology for body wall sensory neurons in branches. Genotype of experimental animals given above the graph. (G-H) Single-cell RNA sequencing (SCOPE scRNA-seq) datasets reveal tissues colored by expression of miR-9a (red), en (blue) with sens (green). (I) Schcematic diagram for color code presented in (G-H). (J) Conceptual model for the non-cell-autonomous role of miR-9a in modulating neurodevelopment and behavior. The schematic depicts a pathway where miR-9a , acting in epithelial cells, post-transcriptionally represses its targets sens and bru2 . This repression in the epithelium provides a permissive environment for the correct dendritic patterning of neighboring ppk + neurons. Loss of miR-9a disrupts this intercellular signaling, causing neuronal overgrowth and impairing female receptivity, phenotypes that are rescued by reducing the dosage of sens or bru2 . Consistent with a non-cell-autonomous mechanism, we found that miR-9a is robustly expressed in epithelial cells but is largely absent from neuronal cell clusters marked by ppk expression ( Fig. 3G-I ). This spatial separation makes a direct, cell-intrinsic role for miR-9a in ppk neurons unlikely. We next examined the expression of the targets identified in our genetic screen ( Fig. 5A ). We found that Liprin-α , Liprin-γ , and CadN are expressed in both epithelial and neuronal tissues. However, a clear pattern emerged: in the epithelium, their expression domains showed significant overlap with miR-9a, whereas in neuronal clusters, they did not co-localize with ppk (Fig. S5A-I). In contrast, the predicted target CG4133 was expressed predominantly in neurons, where its expression overlapped with miR-9a but not with ppk (Fig. S5M-O). Finally, another predicted target, Osi21 , showed minimal expression in either epithelial or neuronal lineages in this dataset, suggesting it is not a primary target in this specific context (Fig. S5J-L). Taken together, these transcriptomic data demonstrate a clear spatial segregation: miR-9a and its key genetic interactors, whose loss-of-function rescues the receptivity phenotype, are co-expressed in the epithelium (Supplementary Table 1). The affected ppk -positive neurons, however, constitute a separate cellular domain that lacks significant expression of these key targets. These findings provide strong transcriptomic support for a model in which miR-9a does not function within ppk neurons themselves but rather acts from the surrounding epithelium to control neuronal development and, consequently, female reproductive behavior. An epithelial miR-9a-bru2 interaction non-cell-autonomously modulates sensory neuron function Overexpression of bru2 in sensory neurons did not alter the receptivity phenotype ( Fig. 5B ), indicating that bru2 is not a direct target of miR-9a in sensory neurons. The Drosophila gene bru2 is predicted to facilitate mRNA 3’-UTR binding activity and is involved in the negative regulation of translation ( Öztürk-Çolak et al. 2024 ). Altered expression of sens can change sensory-organ specification ( Li et al. 2006 ), and specific ppk + sensory neurons have been shown to control post-mating and egg-laying behaviors ( Yapici et al. 2008 ; Häsemeyer et al. 2009b ; Lee et al. 2016 ), whereas Bruno-family proteins influence oogenesis and flight-muscle maturation ( Webster et al. 1997 ; Spletter et al. 2015 ), supporting the interpretation that egg-laying and wing-vibration phenotypes may arise indirectly. One of the identified targets, sens , is a well-established miR-9a target during sensory organ development ( Li et al. 2006 ), and its expression in ppk + neurons is consistent with the strong morphological and behavioral effects we observed. We next investigated other predicted targets of miR-9a , such as the RNA-binding protein bru2 . While the function of bru2 in ppk + neurons has not been characterized, potentially explaining the weak or absent phenotypes observed upon its dosage reduction, its role in female receptivity was evident in other tissues. Targeted overexpression of bru2 in the epithelium using en-GAL4 caused a significant reduction in female receptivity compared to controls. Conversely, RNAi-mediated knockdown of bru2 in the same cells did not alter this behavior ( Fig. 5C-D ). Epithelium-specific overexpression of bru2 produced effects highly reminiscent of those obtained with sens. In ppk-positive body wall sensory neurons, this manipulation led to a significant increase in dendritic branching ( Fig. 5E–F ), recapitulating the morphological phenotype of the miR-9a mutant. Consistent with these phenotypic similarities, single-cell transcriptomic analysis revealed that miR-9a, bru2, and en are co-expressed within epithelial clusters but are absent from the neuronal groups expressing ppk ( Fig. 5H–I , cf. Fig. 3G–I ). This asymmetrical outcome is consistent with bru2 functioning as a downstream target of miR-9a regulation. Collectively, these findings indicate that miR-9a guides sensory neuron specification and controls virgin female receptivity by fine-tuning the expression of multiple target genes, including sens and bru2 ( Fig. 5J ). To elucidate the precise cellular context of the miR-9a-bru2 interaction, we analyzed their spatial expression patterns using the Drosophila single-cell transcriptomic atlas, Fly SCope ( Li et al. 2022 ). The data revealed that miR-9a and its target, bru2 , are robustly co-expressed in epithelial cells. In striking contrast, bru2 transcript was found to be largely absent from the ppk -positive sensory neuron population (Fig. S5Q-S). These distinct expression profiles preclude a direct, cell-autonomous role for bru2 regulation by miR-9a within the ppk + neurons themselves. Instead, this finding strongly supports a model of non-cell-autonomous regulation, where the molecular interaction occurs in one cell type (the epithelium) to influence the function of a neighboring cell type (the neuron). To further validate this regulatory relationship, we performed qRT-PCR analysis and found that bru2 mRNA levels were significantly elevated in miR-9a homozygous mutants (Fig. S5P). We therefore propose that miR-9a -mediated repression of bru2 within the epithelium indirectly modulates the physiological function of adjacent ppk + sensory neurons. Given its canonical role in mediating short-range cell-cell communication, particularly between epithelial and neural cells during development, we hypothesize that this non-cell-autonomous effect is propagated via the Notch-Delta signaling pathway ( Artavanis-Tsakonas et al. 1999 ; Hori et al. 2013 ). This proposed mechanism, wherein the genetic interaction in epithelial cells influences neuronal function, is illustrated in our working model ( Fig. 5J ). DISCUSSION Female miR-9a mutants display a pronounced phenotype characterized by increased rejection of courting males, delayed onset of sexual receptivity, and abnormal mating termination behavior. While the post-mating rejection behavior of mated females remains intact, they lay more eggs, suggesting specific effects on egg-laying ( Fig. 1 ). Similar locomotor deficits are observed in both sexes, highlighting the generalized impact of miR-9a mutation on motor function. In male flies, miR-9a mutation leads to reduced courtship activity and the emergence of an abnormal bilateral wing vibration phenotype ( Fig. 2 ). Further investigation of sensory neuron development reveals ectopic overgrowth of sensory neurons in both larval and adult stages, indicating a disruption in neuronal specification and growth ( Fig. 3 ). Genetic interaction experiments with sens and bru2 , genes involved in sensory bristle development and mRNA translation regulation, respectively, demonstrate that removing one copy of these genes in miR-9a mutant backgrounds rescues the receptivity defects and normalizes neuronal morphology ( Fig. 4 and 5 ). As summarized in Fig. 5J , we propose a working model in which miR-9a influences sensory neuron morphology and virgin female receptivity, with sens and bru2 acting as non-cell autonomous genetic modifiers. We note, however, that the roles of these genes in egg-laying and the function of bru2 in body-wall sensory neurons remain to be tested, and thus the schematic should be viewed as a conceptual framework for future studies rather than a definitive pathway. These findings collectively suggest that miR-9a plays a crucial role in regulating the development of sensory neurons and female receptivity by modulating the expression of target genes such as sens and bru2 . This study provides valuable insights into the molecular mechanisms underlying reproductive behaviors and neural development in Drosophila , and potentially in other organisms as well. Although the role of miRNAs in neural development and plasticity is well-documented, their specific contributions to the modulation of sensory hypersensitivity following mating in female insects have not been extensively explored. Studies using genetic tools to manipulate miRNA expression in specific neurons or at specific times after mating could help to elucidate the precise mechanisms by which miRNAs contribute to these complex behavioral and physiological changes. Such studies are poised to elucidate the molecular underpinnings of post-mating sensory adaptations and their implications for reproductive success. Furthermore, the behavioral phenotypes observed in miR-9a mutants could be influenced not only by altered sensory processing but also by broader motor deficits. miR-9a has been implicated in neural development beyond reproductive circuits, and defects in locomotor performance have been reported in assays such as climbing. While our data suggest a strong correlation between sensory neuron overgrowth and changes in female receptivity, we cannot exclude the possibility that motor impairments may also contribute to the observed male courtship and female rejection behaviors. Future studies incorporating detailed analyses of motor circuits and electrophysiological characterization of sensory neuron excitability will be necessary to disentangle the relative contributions of sensory versus motor dysfunctions to these sexual behaviors. While our data show overgrowth of ppk + body wall neurons in miR-9a mutants, the causal role of these neurons in female receptivity remains unresolved. Prior studies of ppk + neurons in the uterus and oviduct indicate that distinct subsets of ppk + neurons mediate post-mating responses ( Häsemeyer et al. 2009b ; Yang et al. 2009b ; Rezával et al. 2012 ). Whether these subsets also overgrow in miR-9a mutants, whether body wall neurons are required for virgin receptivity, and whether their activity changes after copulation are key questions for future work. Addressing these points with cell-type–specific manipulations and functional imaging will be essential to clarify how miR-9a regulates ppk + neuronal subsets and reproductive behaviors. In our investigation, we have elucidated a heretofore unreported target gene of miR-9a , designated bru2 , which, upon deletion of a single allele, can rescue the female rejection phenotype induced by miR-9a mutation. The Drosophila melanogaster bru2 gene is inferred to possess mRNA 3’-UTR binding activity and is proposed to participate in mRNA splice site recognition, the negative regulation of translation, and the regulation of alternative mRNA splicing, mediated through the spliceosome ( Delaunay et al. 2004 ) . Despite these predictions, the precise molecular function of bru2 remains to be fully elucidated. The human orthologs of bru2, CELF1 (CUGBP Elav-like family member 1) and CELF2 (CUGBP Elav-like family member 2), have been implicated in developmental and epileptic encephalopathy 97 ( Itai et al. 2021 ). Notably, a constellation of repressed expression of let-7g , miR-9 , and miR-135a , alongside elevated expression of the RNA splicing factor CELF1, has been correlated with a murine heart model of myotonic dystrophy (MD) ( Misra et al. 2020 ). These findings suggest that the newly characterized genetic interplay between miR-9a and bru2 may serve as a prototypical model for investigating the role of human miR-9 in neuronal specification. Our findings indicate that miR-9a mutations impact reproductive behaviors in both sexes, but with distinct outcomes. In females, miR-9a loss leads to reduced receptivity and increased rejection of courting males, correlating with sensory neuron overgrowth. In males, however, miR-9a mutants exhibit altered courtship performance, suggesting that miR-9a also contributes to the regulation of male-specific circuits underlying sexual display behaviors. These observations highlight that miR-9a exerts sex-specific effects on reproductive behavior, likely through its influence on neural development and circuit function in both male and female nervous systems. Considering these differences provides a more complete view of miR-9a ’s role in behavioral modulation and raises important questions about how microRNAs contribute to sexually dimorphic neural and behavioral traits. Our research revealed that mutation of miR-9a is associated with overgrowth of sensory neurons in adult D. melanogaster females, which correlates with increased rejection of courting males by virgins. While our results suggest a potential link between altered neuronal morphology and hypersensitivity-related behaviors, direct causal evidence of neuronal excitability changes remains to be established. The miR-9a mutant females exhibited a hypersensitivity phenotype attributable to this neuronal overgrowth. The study of hypersensitivity in D. melanogaster is a field of inquiry that holds profound implications for comprehending the foundational mechanisms underpinning sensory perception and neural plasticity. Although we did not perform ppk -restricted miR-9a rescue or ppk -specific miR-9a knockdown in this study, multiple lines of genetic evidence support a substantive role for ppk + body-wall sensory neurons: dendritic overgrowth maps to ppk + cells, and reducing sens or bru2 dosage rescues both morphology and receptivity. We therefore view targeted re-expression and tissue-specific loss-of-function of miR-9a as important next steps to test cell autonomy and temporal requirements. Hypersensitivity in sensory neurons can arise from changes in neural development or plasticity, leading to exaggerated responses to normal stimuli ( Petersen-Felix and Curatolo 2002 ; Latremoliere and Woolf 2009a ; Gangadharan and Kuner 2013 ). This can involve altered gene expression in sensory neurons, changes in the morphology and function of these neurons, and modifications in the way they interact with other cells in the nervous system ( Woolf and Salter 2000 ). In some cases, hypersensitivity can become chronic due to central sensitization, a process where the central nervous system becomes hyper-excitable and develops an increased sensitivity to incoming sensory signals. This can result in long-lasting pain even after the initial injury or inflammation has resolved ( Salter 2010 ). Our study reveals the critical role of miR-9a in regulating reproductive behaviors and neural development in Drosophila melanogaster . Sensory hypersensitivity refers to an exaggerated response to normal stimuli, often manifesting as pain or discomfort in contexts where such sensations would not typically occur ( Latremoliere and Woolf 2009b ; Isaacs and Riordan 2020 ). It is frequently linked to neurological disorders, injury, or inflammation ( Ren and Dubner 2008 ; Pinho-Ribeiro et al. 2017 ). Understanding the mechanisms that drive hypersensitivity in sensory neurons is therefore critical for insights into both normal sensory processing and pathological conditions. In D. melanogaster , post-mating modifications in female behavior encompass enhanced sensory reactivity, a phenomenon considered adaptive as it facilitates the evasion of predators and the selection of appropriate oviposition sites ( Chapman et al. 2003 ; Ram and Wolfner 2007 ; Yapici et al. 2008 ; Gligorov et al. 2013 ; Corbel et al. 2022 ). This augmented sensitivity is correlated with the overgrowth of adult body wall sensory neurons, and alterations in miR-9a expression via genetic manipulations can modulate these responses. The analysis of hypersensitivity in this fly model provides critical insights into the molecular and neural substrates that regulate sensory processing and the evolution of complex behavioral outputs. Our study establishes a correlation between sensory neuron overgrowth and altered virgin female receptivity, but it does not prove causation. It remains possible that an upstream regulatory event independently affects both neuronal morphology and behavior. Future experiments combining electrophysiology with cell-specific manipulations will be essential to determine whether structural changes in body wall neurons directly underlie behavioral phenotypes. Notably, female ppk -positive body wall neurons have been identified as key neurons underlying the heat hypersensitivity phenotype ( Gu et al. 2022 ), suggest that adult body wall neurons contribute to adaptive hypersensitivity, consistent with conserved roles of sensory neurons in mediating heightened sensitivity across species. Our discovery establishes a novel Drosophila genetic model for the investigation of miR-9 family-mediated pathogenesis across various neuronal contexts. Our research identifies a critical role for miR-9a in regulating female receptivity, a complex behavior in Drosophila that is contingent on the proper morphological development of body wall sensory neurons. The central finding of our work is that this regulation occurs through a non-cell-autonomous mechanism. We propose a model where miR-9a acts not within the neuron itself, but within the surrounding epithelial cells, to orchestrate a microenvironment that is permissive for correct neuronal dendritic growth. This finding shifts the understanding of miR-9a ’s role from a direct, intracellular regulator of neuronal architecture to a master regulator of the intercellular signaling that underpins neurodevelopment. The strongest evidence supporting this model comes from our genetic epistasis and phenocopy experiments. While the loss of miR-9a leads to dendritic overgrowth in ppk neurons and a corresponding decrease in female receptivity, we demonstrate that this phenotype is not due to a primary defect within the neuron. Instead, the phenotype can be fully recapitulated by overexpressing miR-9a ’s downstream targets—the transcription factor sens or the RNA-binding protein bru2 —specifically within the epithelium. This crucial result, where manipulating a gene in one cell type (epithelium) produces a phenotype in an adjacent cell type (neuron), is the definitive signature of non-cell-autonomous action. It strongly implies that the primary function of miR-9a in this context is to repress sens and bru2 within the epithelium. In the absence of miR-9a, these targets become derepressed, altering the signaling properties of epithelial cells and leading them to send aberrant growth cues to the neighboring neurons. Our model posits that the epithelial derepression of sens and bru2 is the key molecular event that disrupts epithelial-neuronal communication. Sens is a well-characterized transcription factor essential for peripheral nervous system development, particularly in specifying the fate of sensory organ precursors ( Nolo et al. 2000 ; Li et al. 2006 ; Mullard 2006 ; Cassidy et al. 2013b ; Gallicchio et al. 2020 ). Its misexpression in the broader epithelial tissue could fundamentally alter the identity of these cells, causing them to adopt signaling characteristics that pathologically promote neuronal growth. Bru2 , as an RNA-binding protein involved in translational repression, likely contributes by altering the proteome of epithelial cells ( Chekulaeva et al. 2006 ). The derepression of bru2 could lead to the inappropriate translation of a suite of mRNAs, including those encoding secreted ligands, cell-surface receptors, or components of the extracellular matrix that collectively influence neuronal guidance and growth. The coordinated misregulation of a transcription factor ( sens ) and an RNA-binding protein ( bru2 ) highlights the sophisticated regulatory logic of miRNAs. Rather than targeting a single linear pathway, miR-9a acts as a nodal point to simultaneously control gene expression at both the transcriptional and post-transcriptional levels. This allows for a robust and multi-faceted regulation of the epithelial cell’s signaling output. This work, therefore, adds to a growing body of evidence that the epidermis is not merely a passive scaffold for the nervous system but an active and indispensable signaling center that sculpts neuronal morphology, a concept well-established in the context of dendritic tiling and boundary formation ( Li et al. 2006 ; Mullard 2006 ; Jones 2008 ; Bartel 2009b ; Biryukova et al. 2009 ; Kadener et al. 2009 ; Smalheiser and Lugli 2009b ; Cohen et al. 2011b ; Yuva-Aydemir et al. 2011b ; Cassidy et al. 2013b ; Aksoy-Aksel et al. 2014b ; Søvik et al. 2015 ; Wang et al. 2016b ; Alberti et al. 2018 ; Ridler 2018 ; Xue and Zhang 2018 ; Mohammadi et al. 2022b ). This non-cell-autonomous model provides a robust framework for understanding the link between miR-9a and female receptivity, but it also opens several exciting avenues for future investigation. The most immediate question is the identity of the downstream signaling molecule(s) acting between the epithelium and the neuron. The aberrant epithelial signals initiated by sens and bru2 overexpression could be secreted ligands, cell-adhesion molecules, or changes in the extracellular matrix such as Notch-delta interaction ( Li et al. 2006 ). An unbiased transcriptomic or proteomic screen comparing wild-type and miR-9a mutant epithelial tissue could identify candidate signaling factors. Furthermore, our study primarily focuses on the developmental role of this pathway. It remains an open and intriguing question whether miR-9a continues to function in the adult epithelium to maintain the sensory circuit’s integrity and function. A conditional, adult-stage-specific knockdown of miR-9a or its targets in the epithelium would be a powerful experiment to dissect any ongoing role of this pathway in neuronal maintenance and behavioral plasticity. Answering these questions will not only illuminate the specific mechanism of miR-9a function but also provide deeper insights into the fundamental principles governing tissue-level communication in the development and maintenance of a functional nervous system. METHODS Fly Stocks and Husbandry Drosophila melanogaster were raised on cornmeal-yeast medium at similar densities to yield adults with similar body sizes. Flies were kept in 12 h light: 12 h dark cycles (LD) at 25°C (ZT 0 is the beginning of the light phase, ZT12 beginning of the dark phase) except for some experimental manipulation. Wild-type flies were Canton-S ( CS ) and Cantonized w1118 . Following lines used in this study, Canton-S (#64349), ppk-CD4-tdGFP (# 35842), sens E58 (#5312), bru2 f00171 (#18300), bru2 EY18918 (#22296), bru2 G5819 (#27190), Liprin-γ f01268 (#18421), CadN M1 2 (#229), Liprin-α EY21217 (#22459), Osi21 MB0145 0 (#23186), ppk-GAL4 (#32078), en-GAL4 (#1973) were obtained from the Bloomington Drosophila Stock Center at Indiana University. Osi21 MB01450 (#M2L-3116) was obtained from National Institute of Genetics Fly Stocks. We thank Dr. Fen-Biao Gao (Gladstone Institute of Neurological Disease and Department of Neurology, University of California at San Francisco) and Dr. Kweon Yu (KRIBB) for sharing miR-9a J22 , miR-9a E39 , and UAS-miR-9a lines. We thank Dr. Paul M. Macdonal (Department of Molecular Biosciences, Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas, United States of America) for sharing UAS-bru2 line. We thank Dr. Hugo Bellen (Baylor College of Medicine) for sharing UAS-sens line. Receptivity Assay and Egg Laying Assay For receptivity assays, females and males were housed in small groups of 3–4 flies. In order to assess female receptivity, one female was put into a small (1 cm × 1 cm) chamber together with two naive Canton S males. The female was scored as receptive if it mated within 20 min. In the remating assays, a female was mated in a receptivity assay and then again examined in another receptivity assay 24 hours later. Assays were usually performed within the first three hours of the experiment day. Rejection (%) was calculated as the total number of rejection behaviors observed (e.g., abdominal turning, kicking) during the observation period divided by the number of tested females ×100. Because a single female could display multiple rejection behaviors, the rejection percentage could exceed 100%. All experimental procedures were conducted using 36-well plates, and each assay was replicated the specified number of times to ensure statistical robustness. The calculated percentages of receptivity and rejection were then subjected to statistical analysis via Student’s t-test for significance. For egg laying assays, 10 mated females of the appropriate genotype were aged in vials for 4–5 days. Then three or five (as indicated in the figure legends) females were transferred to a vial with grape media and allowed to lay eggs for 24 hours at 25°C. The number of eggs was divided by the number of flies in the vial to give a measure of egg laying. For assays of egg laying by mated females, females of the respective genotype were mated with Canton S males for 2–3 hours on the day before the experiment, with 10 females and 20 males per vial. All data are given as average ± SEM, significance levels were calculated with the Student’s t test. Climbing Assay For climbing assay, we modified the conventional RING assay ( Gargano et al. 2005 ) and reported in our previous reports ( Miao et al. 2024 ; Zhang et al. 2024 ). In brief, 40-50 aged flies were placed in an empty vial and were tapped to the bottom of the tube. We used 5 days old adults. After tapping of flies, we recorded 10 seconds of video clip. This experiment was repeated twice for each group at 5-minute intervals. For analysis, the performance values from the two trials were averaged for each group to obtain a single data point, which was used in statistical comparisons. With recorded video files, we captured the position of flies 10 seconds after tapping the vial. This captured image file was then loaded in ImageJ to perform particle analysis. For quantifying the location of flies inside a vial, we used the “analyze particles” function of ImageJ ( Grishagin 2015 ). The position of pixels was normalized by height of vial then only the particles above the midline (4 cm) of vial were counted. Adult Flight Assay Flies were subjected to a ’flight assay’ to evaluate their escape response from water. 50 flies were gently introduced into a water-filled jar. The jar was then tapped to stimulate the flies, and the number of flies that escaped from the water was counted. The escape ratio was calculated to determine the effectiveness of the flies’ flight response. For visual reference, please check the video files labeled 5-6, which represent the phenotypes of control and mutant flies during the assay. Our experiment was conducted at 25°C under normal light conditions. Courtship Assay The courtship assay was conducted according to established protocols as previously reported ( Lee et al. 2023 ), under standard light conditions in circular courtship arenas with a diameter of 11 mm, between noon and 4 p.m. Courtship latency was defined as the interval from the introduction of the female to the initiation of the first overt male courtship behavior, such as orientation and wing extensions. Following the onset of courtship, the courtship index was determined as the proportion of time the male engaged in courtship-related activities over a 10-minute period or until copulation occurred. Adult Body Wall Neuron Live Imaging Adult body wall was dissected and fixed in 4% paraformaldehyde in PBS for 30–60 min at room temperature, followed by blocking for 30 min in PBS containing 0.3% Triton X-100 and 5% normal goat serum. Tissues were stained with rat anti-mCD8 (1:200; Caltag) and/or mouse anti-armadillo (DSHB; N2 7A1, 1:15). Primary antibodies were detected with Cy2-conjugated goat anti-rat or Cy5-conjugated goat anti-mouse secondary antibodies (Jackson Research). LTM fibers were labeled with phalloidin-TRITC (1:200; Sigma) or Alexa647-phalloidin (1:200; Invitrogen). Images were taken on a Leica TCS SP5 confocal microscope (Leica). As an alternative to antibody staining, we imaged GFP and mCherry fluorescence in living animals by mounting them in silicon oil (Shin-Etsu). Maximum projections of z-stacks were used in all cases. Images were adjusted for brightness and contrast with Adobe Photoshop (Adobe Systems, San Jose, CA) ( Yasunaga et al. 2015 ). For visualization of dendrites, we labeled neurons with ppk-GAL4; UAS-mCD8GFP, ppk-CD4-tdGFP, or ppk-CD4-tdTom and imaged GFP and RFP fluorescence in living animals by mounting them in silicon oil (Shin-Etsu). Maximum projections of Z-stacks were used in all cases. The dendrite length was measured by using the ImageJ. For the quantitative analyses, we focused on the dendrites in segments A4, A5 and A6, since these neurons exhibit similar and consistent dendrite branch lengths and branch points. For quantification of the total branch length and the branch points, we used skeleton analysis as described above. Quantification of Neurite Branching To quantify neurite branching, we utilized the ’skeleton’ function in ImageJ, following a detailed step-by-step process to ensure accurate measurement of branch numbers and lengths. All specimens were imaged under identical conditions. First, images of neurons were imported into ImageJ by launching the software and dragging the image into the workspace. The images were then converted to an 8-bit format by selecting the image, navigating to the “Image” menu, choosing “Type,” and selecting “8-bit.” Next, the images underwent threshold adjustment to separate the neuron branches from the background. This involved selecting “Image” from the menu bar, choosing “Adjust,” and then “Threshold.” The “Dark Background” option was checked, the color was changed to red, and the threshold slider was adjusted until all branches were highlighted in red. After threshold adjustment and branch connection, the images were converted to a binary format. This was done by selecting “Process” from the menu bar, choosing “Binary,” and then “Make Binary,” ensuring that “Threshold pixel to foreground color” and “Remaining pixel to background color” options were checked with a “Black foreground, white background” setting. The binary images were then skeletonized to produce a simplified representation of the neurite branches. This involved selecting “Process” from the menu bar, choosing “Binary,” and then “Skeletonize.” The resulting skeleton images were analyzed using the Analyze Skeleton plugin. This process included selecting “Analyze” from the menu bar, choosing “Skeleton,” and then “Analyze Skeleton.” The settings for the analysis included keeping the “Prune cycle method” set to “None,” unchecking the “Prune ends” and “Exclude ROI from pruning” options, and checking the options to show the longest shortest path, branch labels, junctions, and endpoints. All specimens were imaged under identical conditions. In our skeleton analysis, a branch was defined as a continuous dendritic segment between either a junction and an endpoint or between two junctions. A junction was defined as a branch point where one dendrite splits into two or more daughter dendrites. These definitions were applied consistently across all genotypes. We also counted the total number of sensory neurons in the imaged abdominal segments (A4–A6) to assess whether neuron number was altered. Predicting of miR-9a Targets in Drosophila Genome using bioinformatical anlaysis We used miRBase provided targetscan analysis to identify miR-9a potential targets ( Kozomara et al. 2019 ). The result can be checked with this stable link. https://www.targetscan.org/cgi-bin/targetscan/fly_12/targetscan.cgi?mirg=dme- miR-9a Video Recording of Larval Locomotor Behaviors Video recordings of gross path morphology were made with a digital video (DV) camera (Canon GL1) in an environment room maintained at 25°C and 70% humidity. DV movies were captured with IMOVIE 2.0 on a 500-MHz Apple iMac and digitized with QUICKTIME 4.0 at 29.97 frames per second (fps). Low-magnification videos were recorded for 2 min or until the larva left the 50-cm 2 field of the camera. High-magnification videos (15-cm 2 field) were recorded with an Olympus OLY-200 camera mounted on an Olympus SZX9 microscope connected to a VCR (Samsung VR5599). Peristalsis was recorded until 10 peristaltic waves during linear locomotion were completed. Mutants frequently had discontinuous bouts of peristalsis, and repositioning of the plate was necessary, but this did not affect the motion analysis. VCR recordings were captured with adobe premier 5.0 on a Macintosh G4 at 15 fps. Quantitative real time PCR (qRT-PCR) The expression levels of bru2 gene in wild-type and miR-9a mutant female flies in different conditions were analyzed by quantitative real time PCR (qRT-PCR) with SYBR Green qPCR MasterMix kit (Selleckchem). Primers for amplifying the genes in qRT-PCR were designed following previous reports ( Boutros et al. 2004 ; Hu et al. 2013 ), F: 5’–AAATTCGCCGACACGCAAAA-3’; R: 5’–CCATCGACGGATTGGTACGT–3’. qPCR reactions were performed in triplicate, and the specificity of each reaction was evaluated by dissociation curve analysis. Each experiment was replicated three times. PCR results were recorded as threshold cycle numbers (Ct). The fold change in the target gene expression, normalized to the expression of internal control gene (GAPDH) and relative to the expression at time point 0, was calculated using the 2 −ΔΔCT method as previously described ( Livak and Schmittgen 2001 ). The results are presented as the mean ± SD of three independent experiments. Statistical Analysis Statistical analysis of receptivity assays is similar with mating duration assay was described previously ( Lee et al. 2023 ). More than 10 females for 1 group were used for receptivity assay. Statistical comparisons were made between groups that were control group and experimental group within each experiment. As receptivity assays of females showed normal distribution (Kolmogorov-Smirnov tests, p > 0.05), we used two-sided Student’s t tests. The mean ± standard error (s.e.m) ( **** = p < 0.0001, *** = p < 0.001, ** = p < 0.01, * = p < 0.05 ). All analysis was done in GraphPad (Prism). Individual tests and significance are detailed in figure legends. Besides traditional t-test for statistical analysis, we added estimation statistics for all receptivity assays and two group comparing graphs. In short, ‘estimation statistics’ is a simple framework that—while avoiding the pitfalls of significance testing—uses familiar statistical concepts: means, mean differences, and error bars. More importantly, it focuses on the effect size of one’s experiment/intervention, as opposed to significance testing ( Claridge-Chang and Assam 2016 ). For DBMs (Difference Between Means) plots, the central dot represents the mean difference, and the error bars represent the 95% confidence interval, computed by bootstrap resampling in the estimation statistics framework. In comparison to typical NHST plots, estimation graphics have the following five significant advantages such as (1) avoid false dichotomy, (2) display all observed values (3) visualize estimate precision (4) show mean difference distribution. And most importantly (5) by focusing attention on an effect size, the difference diagram encourages quantitative reasoning about the system under study ( Ho et al. 2019 ). Thus, we conducted a reanalysis of all of our two group data sets using both standard t tests and estimate statistics. In 2019, the Society for Neuroscience journal eNeuro instituted a policy recommending the use of estimation graphics as the preferred method for data presentation ( Bernard 2021 ). DATA AVAILABILITY STATEMENT The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. CONFLICT OF INTERESTS The authors declare no competing interests. DECLARATION OF GENERATIVE AI AND AI-ASSISTED TECHNOLOGIES IN THE WRITING PROCESS During the creation of this work, the author(s) utilized DeepSeek AI ( https://chat.deepseek.com/ ) to rephrase English sentences and verify English grammar, as none of the authors of this paper are native English speakers. After using this tool/service, the author(s) reviewed and edited the content as needed and take(s) full responsibility for the content of the publication. Figure S1. miR-9a mutations lead to a specific increase in rejection behavior among virgin females. (A-B) Receptivity of virgin females in 20 minutes, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (C) The temporal pattern of virgin female receptivity to males courtship across the duration of the observation period. (D) Rejection of mated females, with the score for rejection behavior as well as genotype of experimental animals given above the graph. (E) Egg laying. For each assay, five females of the indicated group were allowed to lay eggs in a vial with grape media at 25℃. Eggs were counted after 24 hours and the number of eggs in each vial was divided by five. n=15 assays for all genotypes, error bars indicate SEM, ∗p < 0.05, ∗∗∗p < 0.0005, Student’s t test. Figure S2. miR-9a mutants exhibit locomotor defects among larvae and adult. (A) Climbing assays. (B) Flight assays of females. For each assay, fifty flies were gently introduced into a water-filled jar. The jar was then tapped to stimulate the flies, and the number of flies that escaped from the water was counted. The escape ratio was calculated to determine the effectiveness of the flies’ flight response. (C) 3 rd instar larvae of miR-9a J22 /+ fly. (D) 3 rd instar larvae of miR-9a J22 /miR-9a J22 fly. (E) Speed of 3 rd instar larvae crawling. (F) Turn number of 3 rd instar larvae crawling. Figure S3. miR-9a guides sensory neuron development in the adult and larvae dorsal body wall. (A) Location of Drosophila larvae ventral body wall neurons. (B) Ventral neurons expressing ppk-GAL4 together with UAS-mCD4GFP in miR-9a J22 / + and miR-9a J22 /miR-9a J22 in larvae. Scalebar represent 50 μm. (C) Location of Drosophila adult dorsal neurons. (D) Dorsal A5 neurons expressing ppk-GAL4 together with UAS-mCD4GFP in miR-9a J22 / + and miR-9a J22 /miR-9a J22 in adult female. The bottom pictures are skeletonized from the top pictures. Scalebar represent 100 μm. (E-G) Quantification of neurite morphology for dorsal body wall neurons in branches (C), junctions (D) and branch length (E). Genotype of experimental animals given above the graph. Figure S4. sens E58 /+ rescued the receptivity defects in a miR-9a J22 homozygous mutant background. (A) Receptivity of virgin females in 20 minutes, with the score for receptivity behavior as well as genotype of experimental animals given above the graph. (B) ppk+ sensory neurons in the abdominal body wall (A4–A6) expressing ppk-CD4tdGFP in wCS and miR-9a J22 /miR-9a J22 in adult female. Figure S5. Epithelial localization of miR-9a targets supports non-cell-autonomous regulation. (A-O) SCOPE scRNA-seq datasets and schcematic diagram reveal tissues colored by expression of miR-9a (red), ppk (green) with (blue) (A-C) Liprin-γ , (D-F) CadN , (G-I) Liprin-α , (J-L) Osi21 , and (M-O) CG4133 . (P) The results of qRT-PCR for bru2 gene expression. Genotype of experimental animals given above the graph. The y-axis depicts the relative expression level of SIFaR, normalized to the expression of the GAPDH gene. “Rltv. Gene Exp” denotes relative gene expression. (Q-R) SCOPE scRNA-seq datasets reveal tissues colored by expression of miR-9a (red), ppk (blue) with bru2 (green). (S) Schcematic diagram for color code presented in (Q-R). Supplementary Movie Descriptions Movie 1-2. Receptivity in wild-type females. A wCS virgin female is courted by wCS males. The female accepts the male and copulation proceeds normally. This represents typical receptivity in controls (related to Fig. 1A–B ). Movie 3-4. Rejection behavior in miR-9a mutant females. A virgin miR-9a J22 /miR-9a J22 female is courted by wCS males. The female repeatedly rejects the courting males by turning and kicking. This illustrates the elevated rejection phenotype (related to Fig. 1D ). Movie 5. Flight assay in control flies. Fifty Canton-S adults are tapped into a water-filled jar. Most rapidly escape by flying, reflecting normal flight ability (related to Fig. 1I ). Movie 6. Flight assay in miR-9a mutant flies. Fifty miR-9a J22 /miR-9a J22 adults are tapped into a water-filled jar. Many fail to escape, reflecting impaired flight ability (related to Fig. 1I ). Movie 7. Courtship display in miR-9a mutant males. A miR-9a J22 /miR-9a J22 male courts a Canton-S virgin female using abnormal bilateral wing vibration instead of the typical unilateral display. This phenotype is quantified in Fig. 2B, D . Movie 8. Courtship display in control males. A Canton-S male courts a virgin female using normal unilateral wing vibration. This serves as a control for Movie 7 (related to Fig. 2C, D ). Movie 9. Locomotion in control larvae. A Canton-S third instar larva crawls forward smoothly with normal peristaltic waves. This represents typical larval locomotor behavior (related to Fig. S2C–E). Movie 10. Locomotion in miR-9a mutant larvae. A miR-9a J22 /miR-9a J22 third instar larva exhibits impaired locomotion with increased turning and disrupted peristalsis. This illustrates the larval locomotor phenotype (related to Fig. S2E–F). ACKNOWLEDGEMENTS We are very appreciative to the colleagues who supplied us with several fly strains. We thank Dr. Fen-Biao Gao (Gladstone Institute of Neurological Disease and Department of Neurology, University of California at San Francisco) and Dr. Kweon Yu (KRIBB) for sharing miR-9a J22 , miR-9a E39 , and UAS-miR-9a lines. We thank Dr. Paul M. Macdonal (Department of Molecular Biosciences, Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas, United States of America) for sharing UAS-bru2 line. We thank Dr. Hugo Bellen (Baylor College of Medicine) for sharing UAS-sens line. We extend our gratitude to Drs. Yuh Nung and Lily Jan (UCSF) for their invaluable support and engagement in discussions pertaining to this project. This research was supported by a Startup funds from HIT Center for Life Science to WJK. Footnotes TZ: 22B928013{at}stu.hit.edu.cn HM: 20210125L{at}stu.hit.edu.cn XZ: 20210124l{at}stu.hit.edu.cn JB: joshuaabagley{at}gmail.com YH: 2021110372{at}stu.hit.edu.cn AUTHOR CONTRIBUTIONS TZ and HM designed and performed revision experiments and revised manuscript. JB designed and performed experiments. XZ and YH supported additional revision experiments. WJK designed and performed experiments, wrote, and revised manuscript, analyzed data, and performed image analysis. REFERENCES 1. ↵ Bath E et al. 2017 . Sperm and sex peptide stimulate aggression in female Drosophila . Nat Ecol Evol . 1 ( 6 ): 0154 . doi: 10.1038/s41559-017-0154 OpenUrl CrossRef PubMed 2. ↵ Yang C et al. 2009a . Control of the Postmating Behavioral Switch in Drosophila Females by Internal Sensory Neurons . Neuron . 61 ( 4 ): 519 – 526 . doi: 10.1016/j.neuron.2008.12.021 OpenUrl CrossRef PubMed Web of Science 3. ↵ Zhu EY et al. 2014 . Egg-Laying Demand Induces Aversion of UV Light in Drosophila Females . Curr Biol . 24 ( 23 ): 2797 – 2804 . doi: 10.1016/j.cub.2014.09.076 OpenUrl CrossRef PubMed 4. ↵ Hussain A et al. 2016 . Neuropeptides Modulate Female Chemosensory Processing upon Mating in Drosophila . PLoS Biol . 14 ( 5 ): e1002455 . doi: 10.1371/journal.pbio.1002455 OpenUrl CrossRef PubMed 5. ↵ Hollis B et al. 2019 . Sexual conflict drives male manipulation of female postmating responses in Drosophila melanogaster . Proc Natl Acad Sci United States Am . 116 ( 17 ): 8437 – 8444 . doi: 10.1073/pnas.1821386116 OpenUrl Abstract / FREE Full Text 6. ↵ Bartel DP . 2009a . MicroRNAs: Target Recognition and Regulatory Functions . Cell . 136 ( 2 ): 215 – 233 . doi: 10.1016/j.cell.2009.01.002 OpenUrl CrossRef PubMed Web of Science 7. ↵ Brodersen P , Voinnet O . 2009 . Revisiting the principles of microRNA target recognition and mode of action . Nat Rev Mol Cell Biol . 10 ( 2 ): 141 – 148 . doi: 10.1038/nrm2619 OpenUrl CrossRef PubMed Web of Science 8. ↵ Ye Y , Xu H , Su X , He X . 2016 . Role of MicroRNA in Governing Synaptic Plasticity . Neural Plast . 2016 : 4959523 . doi: 10.1155/2016/4959523 OpenUrl CrossRef PubMed 9. ↵ Mohammadi AH et al. 2022a . MicroRNAs and Synaptic Plasticity: From Their Molecular Roles to Response to Therapy . Mol Neurobiol . 59 ( 8 ): 5084 – 5102 . doi: 10.1007/s12035-022-02907-2 OpenUrl CrossRef PubMed 10. ↵ Aksoy-Aksel A , Zampa F , Schratt G . 2014a . MicroRNAs and synaptic plasticity—a mutual relationship . Philos Trans R Soc B: Biol Sci . 369 ( 1652 ): 20130515 . doi: 10.1098/rstb.2013.0515 OpenUrl CrossRef PubMed 11. ↵ Cohen JE et al. 2011a . MicroRNA regulation of homeostatic synaptic plasticity . Proc Natl Acad Sci . 108 ( 28 ): 11650 – 11655 . doi: 10.1073/pnas.1017576108 OpenUrl Abstract / FREE Full Text 12. ↵ Smalheiser NR , Lugli G . 2009a . microRNA Regulation of Synaptic Plasticity . NeuroMolecular Med . 11 ( 3 ): 133 – 140 . doi: 10.1007/s12017-009-8065-2 OpenUrl CrossRef PubMed Web of Science 13. ↵ Suh YS et al. 2015 . Genome-wide microRNA screening reveals that the evolutionary conserved miR-9a regulates body growth by targeting sNPFR1/NPYR . Nat Commun . 6 ( 1 ): 7693 . doi: 10.1038/ncomms8693 OpenUrl CrossRef PubMed 14. ↵ Cassidy JJ et al. 2013a . miR-9a Minimizes the Phenotypic Impact of Genomic Diversity by Buffering a Transcription Factor . Cell . 155 ( 7 ): 1556 – 1567 . doi: 10.1016/j.cell.2013.10.057 OpenUrl CrossRef PubMed Web of Science 15. ↵ Subramanian M et al. 2021 . UBE4B, a microRNA-9 target gene, promotes autophagy-mediated Tau degradation . Nat Commun . 12 ( 1 ): 3291 . doi: 10.1038/s41467-021-23597-9 OpenUrl CrossRef PubMed 16. ↵ Katti P , Thimmaya D , Madan A , Nongthomba U . 2017 . Overexpression of miRNA-9 Generates Muscle Hypercontraction Through Translational Repression of Troponin-T in Drosophila melanogaster Indirect Flight Muscles . G3: Genes, Genomes, Genet . 7 ( 10 ): 3521 – 3531 . doi: 10.1534/g3.117.300232 OpenUrl Abstract / FREE Full Text 17. ↵ Li Z , Lu Y , Xu X-L , Gao F-B . 2013 . The FTD/ALS-associated RNA-binding protein TDP-43 regulates the robustness of neuronal specification through microRNA-9a in Drosophila . Hum Mol Genet . 22 ( 2 ): 218 – 225 . doi: 10.1093/hmg/dds420 OpenUrl CrossRef PubMed 18. ↵ Cassidy JJ , Straughan AJ , Carthew RW . 2015 . Differential Masking of Natural Genetic Variation by miR-9a in Drosophila . Genetics . 202 ( 2 ): 675 – 687 . doi: 10.1534/genetics.115.183822 OpenUrl Abstract / FREE Full Text 19. ↵ Yatsenko AS , Shcherbata HR . 2014 . Drosophila miR-9a Targets the ECM Receptor Dystroglycan to Canalize Myotendinous Junction Formation . Dev Cell . 28 ( 3 ): 335 – 348 . doi: 10.1016/j.devcel.2014.01.004 OpenUrl CrossRef PubMed 20. ↵ Daniel SG et al. 2017 . miR-9a mediates the role of Lethal giant larvae as an epithelial growth inhibitor in Drosophila . Biol Open . 7 ( 1 ): bio027391 . doi: 10.1242/bio.027391 OpenUrl Abstract / FREE Full Text 21. ↵ Li Y , Wang F , Lee J-A , Gao F-B . 2006 . MicroRNA-9a ensures the precise specification of sensory organ precursors in Drosophila . Gene Dev . 20 ( 20 ): 2793 – 2805 . doi: 10.1101/gad.1466306 OpenUrl Abstract / FREE Full Text 22. ↵ Biryukova I , Asmar J , Abdesselem H , Heitzler P . 2009 . Drosophila mir-9a regulates wing development via fine-tuning expression of the LIM only factor, dLMO . Dev Biol . 327 ( 2 ): 487 – 496 . doi: 10.1016/j.ydbio.2008.12.036 OpenUrl CrossRef PubMed Web of Science 23. ↵ Gallicchio L , Griffiths-Jones S , Ronshaugen M . 2020 . Single-cell visualization of mir-9a and Senseless co-expression during Drosophila melanogaster embryonic and larval peripheral nervous system development . G3 . 11 ( 1 ): jkaa010 . doi: 10.1093/g3journal/jkaa010 OpenUrl CrossRef 24. ↵ Parrish JZ , Kim MD , Jan LY , Jan YN . 2006 . Genome-wide analyses identify transcription factors required for proper morphogenesis of Drosophila sensory neuron dendrites . Genes Dev . 20 ( 7 ): 820 – 835 . doi: 10.1101/gad.1391006 OpenUrl Abstract / FREE Full Text 25. ↵ Wang Y , Wang H , Li X , Li Y . 2016a . Epithelial microRNA-9a regulates dendrite growth through Fmi-Gq signaling in Drosophila sensory neurons . Dev Neurobiol . 76 ( 2 ): 225 – 237 . doi: 10.1002/dneu.22309 OpenUrl CrossRef PubMed 26. ↵ Häsemeyer M , Yapici N , Heberlein U , Dickson BJ . 2009a . Sensory Neurons in the Drosophila Genital Tract Regulate Female Reproductive Behavior . Neuron . 61 ( 4 ): 511 – 518 . doi: 10.1016/j.neuron.2009.01.009 OpenUrl CrossRef PubMed Web of Science 27. ↵ Kubli E . 2003 . Sex-peptides: seminal peptides of the Drosophila male . Cell Mol Life Sci Cmls . 60 ( 8 ): 1689 – 1704 . doi: 10.1007/s00018-003-3052 OpenUrl CrossRef PubMed Web of Science 28. ↵ Chapman T et al. 2003 . The sex peptide of Drosophila melanogaster: Female post-mating responses analyzed by using RNA interference . Proc National Acad Sci . 100 ( 17 ): 9923 – 9928 . doi: 10.1073/pnas.1631635100 OpenUrl Abstract / FREE Full Text 29. ↵ Yapici N , Kim Y-J , Ribeiro C , Dickson BJ . 2008 . A receptor that mediates the post-mating switch in Drosophila reproductive behaviour . Nature . 451 ( 7174 ): 33 – 37 . doi: 10.1038/nature06483 OpenUrl CrossRef PubMed Web of Science 30. ↵ Leucht C et al. 2008 . MicroRNA-9 directs late organizer activity of the midbrain-hindbrain boundary . Nat Neurosci . 11 ( 6 ): 641 – 648 . doi: 10.1038/nn.2115 OpenUrl CrossRef PubMed Web of Science 31. ↵ Coolen M , Katz S , Bally-Cuif L . 2013 . miR-9: a versatile regulator of neurogenesis . Front Cell Neurosci . 7 : 220 . doi: 10.3389/fncel.2013.00220 OpenUrl CrossRef PubMed 32. ↵ Yuva-Aydemir Y , Simkin A , Gascon E , Gao F-B . 2011a . MicroRNA-9 . RNA Biol . 8 ( 4 ): 557 – 564 . doi: 10.4161/rna.8.4.16019 OpenUrl CrossRef PubMed Web of Science 33. ↵ Li H et al. 2022 . Fly Cell Atlas: A single-nucleus transcriptomic atlas of the adult fruit fly . Science . 375 ( 6584 ): eabk2432 . doi: 10.1126/science.abk2432 OpenUrl CrossRef PubMed 34. ↵ Cassidy JJ et al. 2013b . miR-9a Minimizes the Phenotypic Impact of Genomic Diversity by Buffering a Transcription Factor . Cell . 155 ( 7 ): 1556 – 1567 . doi: 10.1016/j.cell.2013.10.057 OpenUrl CrossRef PubMed Web of Science 35. ↵ Wang Y , Wang H , Li X , Li Y . 2016b . Epithelial microRNA-9a regulates dendrite growth through Fmi-Gq signaling in Drosophila sensory neurons . Dev Neurobiol . 76 ( 2 ): 225 – 237 . doi: 10.1002/dneu.22309 OpenUrl CrossRef PubMed 36. ↵ Blagburn JM . 2008 . Engrailed expression in subsets of adult Drosophila sensory neurons: an enhancer-trap study . Invertebr Neurosci . 8 ( 3 ): 133 – 146 . doi: 10.1007/s10158-008-0074-6 OpenUrl CrossRef PubMed 37. ↵ Brower DL . 1986 . Engrailed gene expression in Drosophila imaginal discs . EMBO J . 5 ( 10 ): 2649 – 2656 . doi: 10.1002/j.1460-2075.1986.tb04547.x OpenUrl CrossRef PubMed 38. ↵ Mullard A . 2006 . MicroRNA knocks some sense into senseless . Nat Rev Mol Cell Biol . 7 ( 12 ): 882 – 882 . doi: 10.1038/nrm2074 OpenUrl CrossRef 39. ↵ Kozomara A , Birgaoanu M , Griffiths-Jones S . 2019 . miRBase: from microRNA sequences to function . Nucleic Acids Res . 47 ( D1 ): D155 – D162 . doi: 10.1093/nar/gky1141 OpenUrl CrossRef PubMed 40. ↵ Öztürk-Çolak A et al. 2024 . FlyBase: updates to the Drosophila genes and genomes database . GENETICS . 227 ( 1 ): iyad211 . doi: 10.1093/genetics/iyad211 OpenUrl CrossRef PubMed 41. ↵ Häsemeyer M , Yapici N , Heberlein U , Dickson BJ . 2009b . Sensory Neurons in the Drosophila Genital Tract Regulate Female Reproductive Behavior . Neuron . 61 ( 4 ): 511 – 518 . doi: 10.1016/j.neuron.2009.01.009 OpenUrl CrossRef PubMed Web of Science 42. ↵ Lee H et al. 2016 . A Pair of Oviduct-Born Pickpocket Neurons Important for Egg-Laying in Drosophila melanogaster . Mol Cells . 39 ( 7 ): 573 – 579 . doi: 10.14348/molcells.2016.0121 OpenUrl CrossRef PubMed 43. ↵ Webster PJ et al. 1997 . Translational repressorbruno plays multiple roles in development and is widely conserved . Genes Dev . 11 ( 19 ): 2510 – 2521 . doi: 10.1101/gad.11.19.2510 OpenUrl Abstract / FREE Full Text 44. ↵ Spletter ML et al. 2015 . The RNA-binding protein Arrest (Bruno) regulates alternative splicing to enable myofibril maturation in Drosophila flight muscle . EMBO Rep . 16 ( 2 ): 178 – 191 . doi: 10.15252/embr.201439791 OpenUrl Abstract / FREE Full Text 45. ↵ Artavanis-Tsakonas S , Rand MD , Lake RJ . 1999 . Notch Signaling: Cell Fate Control and Signal Integration in Development . Science . 284 ( 5415 ): 770 – 776 . doi: 10.1126/science.284.5415.770 OpenUrl Abstract / FREE Full Text 46. ↵ Hori K , Sen A , Artavanis-Tsakonas S . 2013 . Notch signaling at a glance . J Cell Sci . 126 ( 10 ): 2135 – 2140 . doi: 10.1242/jcs.127308 OpenUrl Abstract / FREE Full Text 47. ↵ Yang C et al. 2009b . Control of the Postmating Behavioral Switch in Drosophila Females by Internal Sensory Neurons . Neuron . 61 ( 4 ): 519 – 526 . doi: 10.1016/j.neuron.2008.12.021 OpenUrl CrossRef PubMed Web of Science 48. ↵ Rezával C et al. 2012 . Neural Circuitry Underlying Drosophila Female Postmating Behavioral Responses . Curr Biol . 22 ( 13 ): 1155 – 1165 . doi: 10.1016/j.cub.2012.04.062 OpenUrl CrossRef PubMed 49. ↵ Delaunay J et al. 2004 . The Drosophila Bruno paralogue Bru-3 specifically binds the EDEN translational repression element . Nucleic Acids Res . 32 ( 10 ): 3070 – 3082 . doi: 10.1093/nar/gkh627 OpenUrl CrossRef PubMed Web of Science 50. ↵ Itai T et al. 2021 . De novo variants in CELF2 that disrupt the nuclear localization signal cause developmental and epileptic encephalopathy . Hum Mutat . 42 ( 1 ): 66 – 76 . doi: 10.1002/humu.24130 OpenUrl CrossRef PubMed 51. ↵ Misra C et al. 2020 . Aberrant Expression of a Non-muscle RBFOX2 Isoform Triggers Cardiac Conduction Defects in Myotonic Dystrophy . Dev Cell . 52 ( 6 ): 748 – 763 .e6. doi: 10.1016/j.devcel.2020.01.037 OpenUrl CrossRef PubMed 52. ↵ Petersen-Felix S , Curatolo M . 2002 . Neuroplasticity - an important factor in acute and chronic pain . Swiss Méd Wkly . 132 ( 2122 ): 273 – 278 . doi: 10.4414/smw.2002.09913 OpenUrl CrossRef PubMed 53. ↵ Latremoliere A , Woolf CJ . 2009a . Central Sensitization: A Generator of Pain Hypersensitivity by Central Neural Plasticity . J Pain . 10 ( 9 ): 895 – 926 . doi: 10.1016/j.jpain.2009.06.012 OpenUrl CrossRef PubMed Web of Science 54. ↵ Gangadharan V , Kuner R . 2013 . Pain hypersensitivity mechanisms at a glance . Dis Model Mech . 6 ( 4 ): 889 – 895 . doi: 10.1242/dmm.011502 OpenUrl Abstract / FREE Full Text 55. ↵ Woolf CJ , Salter MW . 2000 . Neuronal Plasticity: Increasing the Gain in Pain . Science . 288 ( 5472 ): 1765 – 1768 . doi: 10.1126/science.288.5472.1765 OpenUrl Abstract / FREE Full Text 56. ↵ Salter MW . 2010 . The Neurobiology of Central Sensitization . J Musculoskelet Pain . 10 ( 1–2 ): 23 – 33 . doi: 10.1300/j094v10n01_03 OpenUrl CrossRef 57. ↵ Isaacs D , Riordan H . 2020 . Sensory hypersensitivity in Tourette syndrome: A review . Brain Dev . 42 ( 9 ): 627 – 638 . doi: 10.1016/j.braindev.2020.06.003 OpenUrl CrossRef PubMed 58. ↵ Latremoliere A , Woolf CJ . 2009b . Central Sensitization: A Generator of Pain Hypersensitivity by Central Neural Plasticity . J Pain . 10 ( 9 ): 895 – 926 . doi: 10.1016/j.jpain.2009.06.012 OpenUrl CrossRef PubMed Web of Science 59. ↵ Ren K , Dubner R . 2008 . Neuron–glia crosstalk gets serious: role in pain hypersensitivity . Curr Opin Anaesthesiol . 21 ( 5 ): 570 – 579 . doi: 10.1097/aco.0b013e32830edbdf OpenUrl CrossRef PubMed 60. ↵ Pinho-Ribeiro FA , Verri WA , Chiu IM . 2017 . Nociceptor Sensory Neuron–Immune Interactions in Pain and Inflammation . Trends Immunol . 38 ( 1 ): 5 – 19 . doi: 10.1016/j.it.2016.10.001 OpenUrl CrossRef PubMed 61. ↵ Gligorov D et al. 2013 . A Novel Function for the Hox Gene Abd-B in the Male Accessory Gland Regulates the Long-Term Female Post-Mating Response in Drosophila . Plos Genet . 9 ( 3 ): e1003395 . doi: 10.1371/journal.pgen.1003395 OpenUrl CrossRef PubMed 62. ↵ Corbel Q , Londoño-Nieto C , Carazo P . 2022 . Does perception of female cues modulate male short-term fitness components in Drosophila melanogaster? Ecol Evol . 12 ( 9 ): e9287 . doi: 10.1002/ece3.9287 OpenUrl CrossRef PubMed 63. ↵ Ram KR , Wolfner MF . 2007 . Sustained Post-Mating Response in Drosophila melanogaster Requires Multiple Seminal Fluid Proteins . Plos Genet . 3 ( 12 ): e238 . doi: 10.1371/journal.pgen.0030238 OpenUrl CrossRef PubMed 64. ↵ Gu P et al. 2022 . Nociception and hypersensitivity involve distinct neurons and molecular transducers in Drosophila . Proc Natl Acad Sci . 119 ( 12 ): e2113645119 . doi: 10.1073/pnas.2113645119 OpenUrl CrossRef PubMed 65. ↵ Nolo R , Abbott LA , Bellen HJ . 2000 . Senseless, a Zn Finger Transcription Factor, Is Necessary and Sufficient for Sensory Organ Development in Drosophila . Cell . 102 ( 3 ): 349 – 362 . doi: 10.1016/s0092-8674(00)00040-4 OpenUrl CrossRef PubMed Web of Science 66. ↵ Chekulaeva M , Hentze MW , Ephrussi A . 2006 . Bruno Acts as a Dual Repressor of oskar Translation, Promoting mRNA Oligomerization and Formation of Silencing Particles . Cell . 124 ( 3 ): 521 – 533 . doi: 10.1016/j.cell.2006.01.031 OpenUrl CrossRef PubMed Web of Science 67. ↵ Kadener S et al. 2009 . A role for microRNAs in the Drosophila circadian clock . Genes Dev . 23 ( 18 ): 2179 – 2191 . doi: 10.1101/gad.1819509 OpenUrl Abstract / FREE Full Text 68. ↵ Alberti C et al. 2018 . Cell-type specific sequencing of microRNAs from complex animal tissues . Nat Methods . 15 ( 4 ): 283 – 289 . doi: 10.1038/nmeth.4610 OpenUrl CrossRef PubMed 69. ↵ Xue Y , Zhang Y . 2018 . Emerging roles for microRNA in the regulation of Drosophila circadian clock . BMC Neurosci . 19 ( 1 ): 1 . doi: 10.1186/s12868-018-0401-8 OpenUrl CrossRef PubMed 70. ↵ Søvik E , Bloch G , Ben-Shahar Y . 2015 . Function and evolution of microRNAs in eusocial Hymenoptera . Frontiers Genetics . 6 : 193 . doi: 10.3389/fgene.2015.00193 OpenUrl CrossRef 71. ↵ Ridler C . 2018 . MicroRNA from dying neurons triggers astrocytosis in ALS . Nat Rev Neurol . 14 ( 10 ): 572 – 572 . doi: 10.1038/s41582-018-0052-5 OpenUrl CrossRef 72. ↵ Jones WD . 2008 . MicroRNA mutant turns back the evolutionary clock for fly olfaction . Bioessays . 30 ( 7 ): 621 – 623 . doi: 10.1002/bies.20780 OpenUrl CrossRef PubMed Web of Science 73. ↵ Smalheiser NR , Lugli G . 2009b . microRNA Regulation of Synaptic Plasticity . NeuroMolecular Med . 11 ( 3 ): 133 – 140 . doi: 10.1007/s12017-009-8065-2 OpenUrl CrossRef PubMed Web of Science 74. ↵ Cohen JE et al. 2011b . MicroRNA regulation of homeostatic synaptic plasticity . Proc Natl Acad Sci . 108 ( 28 ): 11650 – 11655 . doi: 10.1073/pnas.1017576108 OpenUrl Abstract / FREE Full Text 75. ↵ Yuva-Aydemir Y , Simkin A , Gascon E , Gao F-B . 2011b . MicroRNA-9 . RNA Biol . 8 ( 4 ): 557 – 564 . doi: 10.4161/rna.8.4.16019 OpenUrl CrossRef PubMed Web of Science 76. ↵ Bartel DP . 2009b . MicroRNAs: Target Recognition and Regulatory Functions . Cell . 136 ( 2 ): 215 – 233 . doi: 10.1016/j.cell.2009.01.002 OpenUrl CrossRef PubMed Web of Science 77. ↵ Aksoy-Aksel A , Zampa F , Schratt G . 2014b . MicroRNAs and synaptic plasticity—a mutual relationship . Philos Trans R Soc B: Biol Sci . 369 ( 1652 ): 20130515 . doi: 10.1098/rstb.2013.0515 OpenUrl CrossRef PubMed 78. ↵ Mohammadi AH et al. 2022b . MicroRNAs and Synaptic Plasticity: From Their Molecular Roles to Response to Therapy . Mol Neurobiol . 59 ( 8 ): 5084 – 5102 . doi: 10.1007/s12035-022-02907-2 OpenUrl CrossRef PubMed 79. ↵ Gargano JW , Martin I , Bhandari P , Grotewiel MS . 2005 . Rapid iterative negative geotaxis (RING): a new method for assessing age-related locomotor decline in Drosophila . Exp Gerontol . 40 ( 5 ): 386 – 95 . doi: 10.1016/j.exger.2005.02.005 OpenUrl CrossRef PubMed Web of Science 80. ↵ Miao H et al. 2024 . Glia-specific expression of neuropeptide receptor Lgr4 regulates development and adult physiology in Drosophila . J Neurosci Res . 102 ( 1 ). doi: 10.1002/jnr.25271 OpenUrl CrossRef 81. ↵ Zhang X et al. 2024 . The astrocyte-enriched gene deathstar plays a crucial role in the development, locomotion, and lifespan of D. melanogaster . Fly . 18 ( 1 ): 2368336 . doi: 10.1080/19336934.2024.2368336 OpenUrl CrossRef PubMed 82. ↵ Grishagin IV . 2015 . Automatic cell counting with ImageJ . Anal Biochem . 473 : 63 – 65 . doi: 10.1016/j.ab.2014.12.007 OpenUrl CrossRef PubMed 83. ↵ Lee SG et al. 2023 . Taste and pheromonal inputs govern the regulation of time investment for mating by sexual experience in male Drosophila melanogaster . PLOS Genet . 19 ( 5 ): e1010753 . doi: 10.1371/journal.pgen.1010753 OpenUrl CrossRef PubMed 84. ↵ Yasunaga K et al. 2015 . Adult Drosophila sensory neurons specify dendritic territories independently of dendritic contacts through the Wnt5–Drl signaling pathway . Genes Dev . 29 ( 16 ): 1763 – 1775 . doi: 10.1101/gad.262592.115 OpenUrl Abstract / FREE Full Text 85. ↵ Boutros M et al. 2004 . Genome-Wide RNAi Analysis of Growth and Viability in Drosophila Cells . Science . 303 ( 5659 ): 832 – 835 . doi: 10.1126/science.1091266 OpenUrl Abstract / FREE Full Text 86. ↵ Hu Y et al. 2013 . FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents . G3: Genes, Genomes, Genet . 3 ( 9 ): 1607 – 1616 . doi: 10.1534/g3.113.007021 OpenUrl Abstract / FREE Full Text 87. ↵ Livak KJ , Schmittgen TD . 2001 . Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔC T Method . Methods . 25 ( 4 ): 402 – 408 . doi: 10.1006/meth.2001.1262 OpenUrl CrossRef PubMed Web of Science 88. ↵ Claridge-Chang A , Assam PN . 2016 . Estimation statistics should replace significance testing . Nat Methods . 13 ( 2 ): 108 – 109 . doi: 10.1038/nmeth.3729 OpenUrl CrossRef PubMed 89. ↵ Ho J et al. 2019 . Moving beyond P values: data analysis with estimation graphics . Nat Methods . 16 ( 7 ): 565 – 566 . doi: 10.1038/s41592-019-0470-3 OpenUrl CrossRef PubMed 90. ↵ Bernard C . 2021 . Estimation Statistics, One Year Later . eNeuro . 8 ( 2 ):ENEURO.0091-21.2021. doi: 10.1523/eneuro.0091-21.2021 OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted September 12, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster Tianmu Zhang , Hongyu Miao , Xiaoli Zhang , Joshua Bagley , Yongwen Huang , Woo Jae Kim bioRxiv 2025.09.09.675227; doi: https://doi.org/10.1101/2025.09.09.675227 Share This Article: Copy Citation Tools The role of miR-9a in modulating sensory neuron morphology and mating behavior in Drosophila melanogaster Tianmu Zhang , Hongyu Miao , Xiaoli Zhang , Joshua Bagley , Yongwen Huang , Woo Jae Kim bioRxiv 2025.09.09.675227; doi: https://doi.org/10.1101/2025.09.09.675227 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41937) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15156) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)