First Report of a Sudden Death Syndrome in Boer Goats Associated with FMD and Clostridium perfringens Co-infection.

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract In December 2021, an outbreak of sudden death occurred among Boer kids on a commercial farm housing 200 adult goats and 30 kids. The purpose of this study was to elucidate the underlying cause and the associated hematobiochemical alterations. The medical history indicated that 17 newborn kids succumbed shortly after exhibiting signs of apathy, while the adults remained clinically healthy. An outbreak of Foot-and-mouth disease (FMD) occurred concurrently on nearby cattle farms that prompt collection of buccal and nasal swabs from the affected kids to detect the FMD virus (FMDV) via RT-PCR. A comprehensive VP1 sequencing was performed to characterize the circulating FMDV. Blood samples were obtained from the survived kids to evaluate hematobiochemical changes. Post-mortem examinations were conducted on eight carcasses, and swabs of internal organs and intestinal contents were collected for bacteriological analysis and histopathological examination on tissue samples. The presence of the FMDV type O was confirmed exhibiting significant mutations in the G-H loop. Phylogenetic analysis revealed it`s relatedness to the Egyptian 2021 strain. C. perfringens was confirmed through DNA sequencing. Intravascular hemolysis was detected indicative of CPA toxins. This study underscores the role of clostridial infection as a complication of FMD in Boer kids. This is the first report of co-infection of Boer goats with C. perfringens and FMD. These findings could enhance our understanding of the clinical presentation of complicated FMD infection cases in Boer goats under natural conditions and highlight the importance of including small ruminants in the vaccination program against FMD in Egypt.
Full text 105,972 characters · extracted from preprint-html · click to expand
First Report of a Sudden Death Syndrome in Boer Goats Associated with FMD and Clostridium perfringens Co-infection. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article First Report of a Sudden Death Syndrome in Boer Goats Associated with FMD and Clostridium perfringens Co-infection. Maged El-Ashker, Shady Shalaby, Amal Awad, Fatma Abdelhamid, Engy Risha, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7609439/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In December 2021, an outbreak of sudden death occurred among Boer kids on a commercial farm housing 200 adult goats and 30 kids. The purpose of this study was to elucidate the underlying cause and the associated hematobiochemical alterations. The medical history indicated that 17 newborn kids succumbed shortly after exhibiting signs of apathy, while the adults remained clinically healthy. An outbreak of Foot-and-mouth disease (FMD) occurred concurrently on nearby cattle farms that prompt collection of buccal and nasal swabs from the affected kids to detect the FMD virus (FMDV) via RT-PCR. A comprehensive VP1 sequencing was performed to characterize the circulating FMDV. Blood samples were obtained from the survived kids to evaluate hematobiochemical changes. Post-mortem examinations were conducted on eight carcasses, and swabs of internal organs and intestinal contents were collected for bacteriological analysis and histopathological examination on tissue samples. The presence of the FMDV type O was confirmed exhibiting significant mutations in the G-H loop. Phylogenetic analysis revealed it`s relatedness to the Egyptian 2021 strain. C. perfringens was confirmed through DNA sequencing. Intravascular hemolysis was detected indicative of CPA toxins. This study underscores the role of clostridial infection as a complication of FMD in Boer kids. This is the first report of co-infection of Boer goats with C. perfringens and FMD. These findings could enhance our understanding of the clinical presentation of complicated FMD infection cases in Boer goats under natural conditions and highlight the importance of including small ruminants in the vaccination program against FMD in Egypt. Boer goats C. perfringens CPA toxin FMD Molecular diagnosis Pneumonia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Introduction Foot-and-mouth disease (FMD) is an economically important, highly contagious disease caused by genus Aphthovirus vesiculae of the Picornaviridae family. Sheep and goats are important livestock species in several areas of the world, including Egypt, but are not usually included in prophylactic FMD vaccination programs (Madhanmohan et al. 2012). Although the clinical diagnosis of FMD is confirmed in cattle and buffalo, the situation in adult sheep and goats is rather vague as it may be present in a mild or subclinical form (Saravanan et al. 2020). There are few studies on the role of small ruminants in the epidemiology of FMD despite endemic nature of FMD in Egypt with types O, A, and SAT2 (Abd El Rahman et al. 2020; El-Kenawy et al. 2017). Furthermore, information on the clinical presentation of FMD infection in sheep and goats under field conditions is still limited (Jaisree et al. 2016). Alpha-toxin (CPA) is produced by all Clostridium (C.) perfringens strains and is considered a classic example of a toxin that modifies cell membranes by enzymatic activity. The role of CPA toxin in intestinal diseases in sheep and goats is still controversial and poorly documented (Uzal et al. 2014). Furthermore, the detection of CPA toxin in goats with FMD infection has not yet been evaluated. The purpose of this study was to uncover the underlying cause of sudden death syndrome in Boer goats at an organized farm in Dakahlia governorate, Egypt, and to investigate the associated hematobiochemical changes. Materials and Methods In December 2021, an outbreak of disease occurred on a commercial farm in the Aga district of Dakahlia Governorate, Egypt (30.909479158397485, 31.282111538214995). The farm housed 200 Boer goats and their newborn kids ( n =30), with no other mixed breeds present. The issue was the sudden deaths occurred among the newborn kids ( n = 17), with no apparent clinical signs in the adult goats. The farm owner reported that this scenario occurred over a week, during which neither diagnosis nor response to treatment was achieved by the resident veterinarian. Vaccinations against Peste des petits ruminants, bluetongue, and Pasteurella, as well as deworming, were regularly administered to the goats on the farm, but they had not received the FMD vaccine. Samples of venous blood were taken from all affected kids and placed in tubes containing EDTA or plain tubes for whole blood or serum, respectively. Duplicate buccal and nasal swabs were also taken from all kids either on virus transport media or using sterile cotton swabs moistened with tryptone soy broth (TSB) and stored in tubes containing 10 ml TSB. The samples were kept in ice coolers and immediately transported to the laboratory for further investigations. Buccal mucosal swabs were combined and spun at 2000 rpm for 10 minutes, as specified in the World Organization of Animal Health (WOAH) manual for FMD diagnosis (Knowles et al. 2016). The sample's supernatant was utilized for viral RNA extraction using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA). A one-step RT-PCR was then carried out using the Topscript RT-PCR Master Mix (Cat. RT4105, Enzynomics, South Korea) according to the method described previously (El-Kenawy et al. 2017). Further typing trials were executed according to the previously described protocol (Knowles et al. 2016). The utilized primers are listed in table-1. Serotype O specific full VP1 PCR product was purified and sequenced using DNA Sequencer (ABI, 3500, USA). Sequences were aligned using Clustal W implemented in Bioedit 7.7 and the phylogenetic trees were conducted using the maximum Likelihood method ( Tamura–Nei model) with 1,000 Bootstrap replicates. Swabs from the lung, liver, brain, spleen, kidney and intestinal contents, were used for C. perfringens isolation. Bacterial isolates were used for genomic DNA extraction, followed by PCR amplification of 279-bp fragment of the 16S rDNA (Elgioushy et al. 2018). PCR products were sequenced and deposited in GenBank under accession number OM616931. Further amplification and sequencing of CPA toxin was performed as previously by Yoo et al. (1997). A complete blood count was performed using an electronic cell counter and the measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Human, Wiesbaden, Germany), lactate dehydrogenase (LDH), and total protein and albumin were conducted using a spectrophotometer (Spectrophotometer, BM, Germany, 5010) according to the manufacturer’s guidelines. Myocardial creatine kinase band (CK-MB) was determined using ELISA kits from Kamiya Biomedical Company (Seattle, WA, USA). Eight kid carcasses were subjected to post-mortem examination. Heart, trachea, lungs, liver, spleen, kidneys, intestines, and brain were collected and fixed in 10% neutral buffered formalin. The samples were routinely processed and stained with hematoxylin and eosin (H&E) . Medical management was adopted to thirteen kids at the following therapeutic regimen: Ceftiofur crystalline free acid (Excede, Zoetis Inc., USA) at a dosage of 6.6 mgKg -1 ; meloxicam (Metacam, Boehringer Ingelheim VetMedica GmbH, Germany) at a dosage of 0.5 mgKg -1 given subcutaneously and repeated after 72 hours; Acyclovir (Zovirax, Glaxo Operations UK Ltd.) administered thrice daily for 10 days at a dose of 20 mg/kg as subcutaneous injection; Oreganum oil 20% (Ropadiar, Ropapharm International BV, The Netherlands) administered daily as an oral infusion at a dose of 2 ml/head. Data were statistically analysed using Graph Pad Prism software (Graph Pad Software Inc, San Diego). Data tested for normality using the Shapiro–Wilk test and P values were not significant. Hence, means and standard deviations (SD) were estimated for haematological and biochemical variables. Data before and after treatment were statistically tested for significant differences (p < 0.05) using Student’s t-test. Results and Discussion FMD was first was substantially identified based on reported cases, subtle symptoms in adult goats, and newborn goats' sudden deaths, while solid diagnosis reached by detecting a circulating FMDV serotype 'O' and C. perfringens . To the best of our knowledge, this is the first study to report this phenomenon. Two factors contributed significantly to the diagnosis and explained the persistent viral activity and clinical course of FMD in the studied goats: (1) FMD co-occurred with large ruminants in the study region, and (2) sheep and goats were not included in the regular vaccination program in Egypt. To our knowledge, this is the first study to report Clostridium infection as a complication of FMD in Boer goats. The findings described here were consistent with a previous report documenting the ability of C. perfringens to affect the respiratory system by causing either severe acute pulmonary edema, particularly in the interlobular septa of calves (Uzal et al. 2014), or bronchopneumonia in cattle and buffaloes (Elgioushy et al. 2018); but in general, natural cases of C. perfringens -related spontaneous pneumonia have rarely been described in the medical literature (Palmacci et al. 2009),. In the present study, affected kids ( n = 30) showed sudden attacks of apathy followed by recumbency and died within a short time (minutes to several hours) (Supplementary file 1). Physical examinations of survived kids revealed tachycardia, tachypnoea and pyrexia compared to the reference intervals (Table 2). The heart rates, respiratory rates and rectal temperature decreased significantly (P < 0.05) in animals received medical therapy. Adult goats showed minimal clinical signs, including lameness that lasted several days with no need for medical interference. Unlike to the findings reported here, an unanticipated outbreak of serotype “O” FMD in sheep and goats was reported in India with marked clinical symptoms (Jaisree et al. 2016). Similarly, goats exposed to the SAT1 serotype displayed symptoms including fever, nasal discharge, ulcerative oral lesions, and foot lesions (Lazarus et al. 2019). In another experimental study, sheep and goats challenged with the O serotype exhibited classical clinical signs of FMD (including inappetence, panting, pyrexia, and lameness) (Muthukrishnan et al., 2020). In field epidemics involving both species, goats generally experienced milder symptoms (Stenfeldt et al. 2025). Despite the distinctive hematobiochemical alterations (Table 3, 4) combined with clinical settings, diagnosis was not conclusive. For hematology, erythrocyte counts (10 6 /µl) were lower than reference values, with no statistically significant change (p = 0.193) after treatment. Changes in the erythrocytic indices could likely indicate an intravascular hemolysis caused by the CPA toxin; while, leukocytosis and lymphocytosis observed particularly after treatment, could indicate an ongoing systemic inflammation. These findings were consistent with those reported in sheep with enterotoxaemia (Hassanein et al. 2017). It has also been proposed that granulopoiesis may enhance the innate immune system of the host to protect it against bacterial infections (Fu et al. 2022). The increase in serum total protein and globulin levels and decrease in serum albumin levels in the affected kids (table 4) could indicate an ongoing systemic inflammation. These findings were different from those previously reported in sheep and goats with an outbreak of FMDV serotype “O” in India (Jaisree et al. 2016). Several other studies have reported hypoproteinaemia, hypoalbuminemia, and increased ALT and AST activities in cattle with FMD infection (Ghanem et al. 2010) and in sheep with enterotoxaemia caused by C. perfringens (Hassanein et al. 2017) Microbiological (figures 1, 2,3,4&5), post-mortem (Figure 6) and histopathological investigations (Figure 7-13) were necessary to confirm diagnosis. A distinct band, at the expected 328 bp, indicated the presence of FMDV (Figure 3). Further typing revealed a band at 1124 bp using the primer pair O-1C283F /EUR-2B52R, confirming the type O strain (Figure 4). Full FMDV VP1 was sequenced and was given the accession number (PX236833). Initial analysis of the sequence using open FMD/FMD type webtool revealed that the sequence is closest to Egyptian type O FMD/un-detected topotype and FMDV/O/EA-3 topotype. Amino acid alignment revealed that the critical G-H loop (141-160 aa) in the VP1 had three mutations; A141E, T142A, K157R (Figure 1). The sequenced sample has clustered with other 2022 FMD samples from Egypt as in (Figure 2). On the other side, bacteriological examinations revealed seven isolates of C. perfringens recovered from lung, liver, brain, spleen, kidney, and intestine of all necropsied animal (Figure 6) and confirmed as C. perfringens by sequencing of the DNA products (Figure 5). FMD-infected goats with bacterial infections, such as C. perfringens , may experience complications due to a decrease in body immunity associated with viral infection. This suggestion aligns with the findings of a previous study (Francoz et al. 2015). However, the cause of systemic clostridial dispersion in affected kids remains unknown. CPA toxin gene was also detected in all isolates and matched the finding observed by Elgioushy et al. (2018) who detected CPA toxin gene in Egyptian cattle and buffalo herds that exhibit panting and nasal discharge symptoms due to FMD infection. Postmortem examination of non-survived kids indicated that the carcasses were in fair condition up on gross examination. Foot and oral lesions were not seen. Pneumonic lesions involving both lung lobes were seen in all cases. Lung lobes were congested and revealed moderate consolidation with no froth in the airways (Figure 6a). A slightly congested heart, liver, and swollen intestinal loops with yellowish discoloration were also noticed (Figure 6b). Microscopic examination revealed various pathological lesions in the lungs, liver, heart, spleen, intestine, kidneys, and brain (Figures 7–13). Lung sections showed pneumonic areas characterized by alveoli plugged with eosinophilic fluid, neutrophils and macrophages (Figure 7a-e). A microscopicexamination of the trachea showed no pathognomonic lesions. Liver sections showed dilated and congested sinusoids, vacuolar degeneration of hepatocytes with many of apoptotic hepatocytes (Figure 8 a&b). Heart sections showed congested blood vessels, oedema, infiltration of lymphocytes, macrophages and polymorphs around blood vessels and in the interstitial tissue in auricles and ventricles (Figure 9 a-d). Spleen sections showed congested red pulp, few small and ill-defined lymphoid follicles (Figure 10 a&b). Intestinal sections showed congested blood vessels in jejunum, loss of ileal villi, oedema in submucosa, and leukocytic cells infiltrating ileal serosa (Figure 11 a-d). Kidney sections showed congested blood vessels, slightly edematous Bowman's capsule, and mildly degenerated tubular epithelium (Figure 12 a&b). Brain sections also revealed marked perineural edema, congested blood vessels with perivascular edema in cerebral cortex, and congested blood vessels in cerebellum (Figure 13 a-c). Surprisingly, the histopathological results of the heart tissue of the affected animals did not show hyaline degeneration or coagulative necrosis, which is indicative of myocarditis. These findings are not consistent with reports previously described in lambs with FMDV- type O in Turkey (Gulbahar et al. 2007), and in lambs & goats with type O FMDV in India (Hemanth et al. 2014). This finding could align with the CK-MB values, which showed minor changes compared to the reference intervals. It seems that boer kids appeared to have less damage to their cardiac tissue when infected with FMD. A previous report suggested that certain breeds of calves, such as Malnad Gidda, might have fewer cardiac abnormalities due to FMD than others, like Hallikar and HF cross-calves (Saravanan et al. 2020). Therefore, further studies are necessary to investigate cardiac changes in Boer kids infected with FMD under natural conditions. Although this is the first report to look at Clostridium infections as a cause of death in Boer kids with FMD, the study has its own limitations, including a small sample size and the lack of a control group, which may preclude a firm conclusion. Conclusion This study is the first to report an outbreak of sudden deaths in Boer goats on an organized farm in Dakahlia Governorate, Egypt, attributed to FMD infection with C. perfringens . Boer goats could be a potential carrier for the transmission of FMD to cattle and buffaloes. The present results would improve our understanding of the clinical presentation of FMD infections in goats under natural conditions. Based on the study results, goats should be included in regular FMD vaccination programs to prevent future outbreaks. Declarations Ethics Approval and Consent to Participate The study complies with the rules and guidelines of the Institutional Animal Care and Use Committee (IACUC) of Mansoura University and is approved by its ethics committee. The animals were enrolled in the study with the informed consent of their owner and were provided with a document containing information on the definition of the disease, its economic impact and possible clinical consequences. Consent for publication Not Applicable Availability of Data and Materials The datasets generated and/or analysed during the current study are available in the National Centre for Biotechnology Information (NCBI) at the following link: https://www.ncbi.nlm.nih.gov, accession numbers OM616931 and PX236833. Competing Interest The authors have no relevant financial or non-financial interests to disclose. Funding The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Authors' contributions MEA conceived and designed the study, undertook the clinical investigations, interpreted the data and wrote the manuscript. R.K, S.A.E.R, N.Y performed virological investigations, S.S and W.A performed pathological investigations, A.A performed bacteriological investigations, F.A and E.R performed the clinicopathological data. All authors contributed to the draft of the manuscript, revised it and approved the final version of the manuscript. Acknowledgements The authors thank the farm owner for supplying all facilities and information needed to carry out the study. References Abd El Rahman S, Hoffmann B, Karam R, El-Beskawy M, Hamed MF, Forth LF, Hoper D, Eschbaumer M. (2020) Sequence Analysis of Egyptian Foot-and-Mouth Disease Virus Field and Vaccine Strains: Intertypic Recombination and Evidence for Accidental Release of Virulent Virus. Viruses 12:https://doi.org/[10.3390/v12090990] El-Kenawy AA, E. YE, Fakhry HMF, Karam R. (2017) MOLECULAR DETECTION AND SEROTYPING OF FOOT AND MOUTH DISEASE VIRUS IN TONGUE EPITHELIUM SAMPLES. Mansoura veterinary medical journal 18:397-404. Elgioushy M, Rizk MA, El-Adl M, Elhadidy M, El-Khodery S. (2018) The first molecular detection of Clostridium perfringens from pneumonic cases associated with foot and mouth disease in cattle and buffalo in Egypt. Tropical Animal Health and Production 51:847-52. https://doi.org/[10.1007/s11250-018-1763-8] Francoz D, Buczinski S, Bélanger AM, Forté G, Labrecque O, Tremblay D, Wellemans V, Dubuc J. (2015) Respiratory Pathogens in Québec Dairy Calves and Their Relationship with Clinical Status, Lung Consolidation, and Average Daily Gain. Journal of Veterinary Internal Medicine 29:381-7. https://doi.org/[https://doi.org/10.1111/jvim.12531] Fu Y, Alenezi T, Sun X. (2022) Clostridium perfringens-Induced Necrotic Diseases: An Overview. Immuno 2:387-407. https://doi.org/[10.3390/immuno2020024] Ghanem MM, Abdel-Hamid OM. (2010) Clinical, haematological and biochemical alterations in heat intolerance (panting) syndrome in Egyptian cattle following natural foot-and-mouth disease (FMD). Tropical Animal Health and Production 42:1167-73. https://doi.org/[10.1007/s11250-010-9543-0] Gulbahar MY, Davis WC, Guvenc T, Yarim M, Parlak U, Kabak YB. (2007) Myocarditis Associated with Foot-and-Mouth Disease Virus Type O in Lambs. vet pathol 44:589–99. Hassanein KMA, Sayed MM, Hassan AM. (2017) Pathological and biochemical studies on enterotoxemia in sheep. Comparative Clinical Pathology 26:513-8. https://doi.org/[10.1007/s00580-017-2407-5] Hemanth I, Amaravathi P, Babu NS, Kumar AA, Sailaja N. (2014) Malignant form of foot and mouth disease outbreak in sheep and goat with reference to cytological and histopathlogical findings. Indian Journal of Veterinary Pathology 38:https://doi.org/[10.5958/0973-970x.2014.01143.2] Jaisree S, Hemaltha S, Mahaprabhu R, Roy P, Murali N, Arun L, Kumanan K. (2016) Outbreak of Foot and Mouth Disease in an Organized Sheep and Goat Farm. Indian Vet J 93:31-3. Knowles NJ, Wadsworth J, Bachanek-Bankowska K, King DP. (2016) VP1 sequencing protocol for foot and mouth disease virus molecular epidemiology. Rev Sci Tech 35:741-55. https://doi.org/[10.20506/rst.35.3.2565] Lazarus DD, Mutowembwa PB, Sirdar MM, Rametse TM, Heath L, Opperman PA, Burroughs REJ, Fosgate GT. (2019) Clinical presentation of FMD virus SAT1 infections in experimentally challenged indigenous South African goats. Small Ruminant Research 180:15-20. https://doi.org/[10.1016/j.smallrumres.2019.09.014] Madhanmohan M, Nagendrakumar SB, Kumar R, Anilkumar J, Manikumar K, Yuvaraj S, Srinivasan VA. (2012) Clinical protection, sub-clinical infection and persistence following vaccination with extinction payloads of O1 Manisa Foot-and-Mouth Disease monovalent vaccine and challenge in goats and comparison with sheep. Res Vet Sci 93:1050-9. https://doi.org/[10.1016/j.rvsc.2011.10.006] Muthukrishnan M, Singanallur Balasubramanian N, Villuppanoor Alwar S. (2020) Experimental Infection of Foot and Mouth Disease in Indian Sheep and Goats. Frontiers in Veterinary Science 7:https://doi.org/[10.3389/fvets.2020.00356] Palmacci C, Antocicco M, Bonomo L, Maggi F, Cocchi A, Onder G. (2009) Necrotizing pneumonia and sepsis due to Clostridium perfringens: a case report. Cases Journal 2:https://doi.org/[10.1186/1757-1626-2-50] Saravanan S, Umapathi V, Priyanka M, Hosamani M, Sreenivasa BP, Patel BHM, Narayanan K, Sanyal A, Basagoudanavar SH. (2020) Hematological and serum biochemical profile in cattle experimentally infected with foot-and-mouth disease virus. Veterinary World 13:426-32. https://doi.org/[10.14202/vetworld.2020.426-432] Stenfeldt C, Eschbaumer M, Humphreys J, Medina GN, Arzt J. (2025) The pathogenesis of foot-and-mouth disease virus: current understandings and knowledge gaps. Vet Res 56:119. https://doi.org/[10.1186/s13567-025-01545-5] Uzal FA, Vidal JE, McClane BA, Gurjar AA. (2014) Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. NIH Public Access 24-42. Yoo HS, Lee SU, Park KY, Park YH. (1997) Molecular Typing and Epidemiological Survey of Prevalence of Clostridium perfringens Types by Multiplex PCR. JOURNAL OF CLINICAL MICROBIOLOGY 35:228-32. Tables Table 1 Primers used for typing Foot and Mouth Disease virus Primer Sequence (5ʹ – 3ʹ) Genome direction Gene Product size Serotype O O–1C244F GCAGCAAAACACATGTCAAACACCTT + VP3 1,165 O–1C283F GCCCAGTACTACACACAGTACAG + VP3 1,124 Serotype A A–1C562F TACCAAATTACACACGGGAA + VP3 866 A–1C612F TAGCGCCGGCAAAGACTTTGA + VP3 814 Serotypes O/A/C/Asia 1 EUR–2B52R GACATGTCCTCCTGCATCTGGTTGAT – 2B Serotype SAT 2 SAT2–1C445F TGGGACACMGGIYTGAACTC + VP3 1,145 SAT2–P1–1223F TGAACTACCACTTCATGTACACAG + VP3 1,279 Serotypes SAT 1–3 SAT–2B208R ACAGCGGCCATGCACGACAG – 2B Table 2 Mean values ± SD of rectal temperature (°C), heart rate (beats/min) and respiratory rate (breaths/min) in newborn Boer goats with foot-and-mouth disease complicated by Clostridium perfringens strain B1 Groups Variables P - value Reference range * After treatment ( n = 8) Before treatment ( n = 13) 0.001 38.8–40.2 39.12 ± 0.70 40.5 ± 0.93 Rectal temperature (°C) 0.0001 100–120 105 ± 6.02 125 ± 7.07 Heart rate (beats/min) 0.0001 20–40 26 ± 4.27 36.8 ± 5.57 Respiratory rate (breaths/min) * Jackson, P., & Cockcroft, P. (2008). Clinical examination of farm animals . John Wiley & Sons. Blackwell Science Ltd pp 301 Table 3 Mean values ± SD of haematological variables in newborn Boer goats with foot-and-mouth disease complicated by Clostridium perfringens strain B1 Groups Variables P - value Reference values * Reference range ** After treatment ( n = 8) Before treatment ( n = 13) 0.193 13.4 ± 3.3 8.0–18.0 2.72 ± 0.94 3.53 ± 01.03 RBCs (10 6 /µL) 0.154 8.4 ± 0.9 8.0–12.0 9.75 ± 1.92 10.90 ±0.51 Hb (g/dl) 0.238 25.1 ± 3.4 22.0–38.0 29.63 ±5.69 32.43 ±1.62 PCV (%) 0.002 9.24 ± 2.42 4.0–13.0 14.50 ±1.94 10.48 ±1.52 TLC (10 3 /µL) 0.232 3.02 ± 0.2 1.20–7.20 4.12 ±1.73 2.99 ± 0.78 Neutrophil (10 3 /µL) 0.010 5.77 ± 0.22 2.0–9.0 10.38 ± 1.27 7.42± 1.57 Lymphocyte (10 3 /µL) 0.173 0.19 ± 0.01 0.00 – 0.50 0.00 ± 0.00 0.05± 0.09 Monocyte (10 3 /µL) * Holman, H. H., & Dew, S. M. (1965). The Blood Picture of the Goat: III.—Changes in Haemoglobin Concentration and Physical Measurements Occurring with Age. Research in Veterinary Science , 6 (2), 245-255. 1 month Old ** Radostits, O.M., Gay, C.C., Blood, D.C. and Hinchcliff, K.W. (2000) Veterinary Medicine , 9th edn, W.B. Saunders, London, pp. 1819–1822. Table 4 Mean values ± SD of serum biochemical variables in newborn Boer goats with foot-and-mouth disease complicated by Clostridium perfringens strain B1 Groups Variables P - value Reference range * After treatment ( n = 8) Before Treatment ( n = 13) 0.036 - 30.88 ± 12.37 52.67 ±2.68 ALT (U/L) 0.003 0–300 39.97 ± 7.69 59.52 ±1.71 AST (U/L) 0.049 0-400 216.50 ±1.29 247.25 ±19.27 LDH (U/L) 0.039 0-100 21.50 ± 1.29 26.00 ±3.16 CK-MB (U/L) 0.456 6.2–7.9 8.88±0.26 9.08 ±0.43 Total protein (g/dl) 0.143 2.9–4.3 2.15 ±0.48 2.76 ±0.54 Albumin (g/dl) 0.244 3.3-3.6 6.72 ±0.65 6.14 ±0.46 Globulin (g/dl) 0.166 0.87-1.19 0.34 ±0.09 0.46 ±0.12 A/g ratio * Matthews, J. (1999) Diseases of the Goat, Blackwell Science, Oxford, p. 332. Supplementary Files supplementaryfile1tropical.docx Supplementary file 1: Showing apathy just before the onset of sudden death in affected kids. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7609439","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":527558530,"identity":"63a5b340-8d35-4722-86ee-360be66336cc","order_by":0,"name":"Maged El-Ashker","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Maged","middleName":"","lastName":"El-Ashker","suffix":""},{"id":527558531,"identity":"3604893b-80b6-423e-a803-e6ddd3866cfd","order_by":1,"name":"Shady Shalaby","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shady","middleName":"","lastName":"Shalaby","suffix":""},{"id":527558532,"identity":"9cca27d4-48ea-42d3-aca2-31423b174302","order_by":2,"name":"Amal Awad","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Amal","middleName":"","lastName":"Awad","suffix":""},{"id":527558533,"identity":"0d979138-c482-4134-b3a8-6d177726d058","order_by":3,"name":"Fatma Abdelhamid","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Fatma","middleName":"","lastName":"Abdelhamid","suffix":""},{"id":527558534,"identity":"88add22a-71ce-4b46-97d9-8f81350b1c87","order_by":4,"name":"Engy Risha","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Engy","middleName":"","lastName":"Risha","suffix":""},{"id":527558535,"identity":"8c450009-adb7-4f3a-9ac8-a0cbb073ee3f","order_by":5,"name":"Walaa Awadin","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Walaa","middleName":"","lastName":"Awadin","suffix":""},{"id":527558536,"identity":"2976ccd5-1cba-4b69-a548-d4c7df8bceee","order_by":6,"name":"Sahar Abd El Rahman","email":"","orcid":"","institution":"Mansoura University Faculty of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sahar","middleName":"Abd El","lastName":"Rahman","suffix":""},{"id":527558537,"identity":"2710fd78-5fa0-40ab-99d5-24cd51e32228","order_by":7,"name":"Nahed Yehia","email":"","orcid":"","institution":"AHRI: Animal Health Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Nahed","middleName":"","lastName":"Yehia","suffix":""},{"id":527558538,"identity":"bb5286d8-b92f-44bf-98d1-b8aa8bf94cce","order_by":8,"name":"Reham Karam","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYFACHhAhByIYH0CFDIjRYgwimGFKidfCJkGUFvP23oOfbjAYyJu3H79WdaPmjj0De/M2CYaKWpxaZM6cS5bOYTAwnHMmp+x2zrFniQ08x8okGM4cx6lFQiLHAKjlD+MMhpy02zlshxMYJHLMJBjbjuHWIv/G+DfQFvsZ/G/SinP+HbZnkH8D1PIPjxYJHjOQwxJnSKQfY85tO8zYABSRYGyowa2FJ8fMGqgleYbEG2bp3L7DiW08acUWCccO4NbCfsb4NlCL7Qz+9Iefc74dtudnP7zxxoeaOpxawIDxH4jkgUQHG4hIYDiMXwsEsD9A5hGwZRSMglEwCkYSAAC+5E49ebfKXQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5126-0895","institution":"Mansoura University","correspondingAuthor":true,"prefix":"","firstName":"Reham","middleName":"","lastName":"Karam","suffix":""}],"badges":[],"createdAt":"2025-09-13 20:59:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7609439/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7609439/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93246170,"identity":"bcfa15f2-6940-468f-892f-c107169c24b5","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1179694,"visible":true,"origin":"","legend":"","description":"","filename":"figures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/2f1632b70c0c5e5b84e04037.docx"},{"id":93246856,"identity":"10826715-62a7-4311-834f-ef1aba2a9798","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37750,"visible":true,"origin":"","legend":"","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/0684bc04a3dc9fa38156ab5e.docx"},{"id":93246850,"identity":"297aafca-8cf7-43de-a3dc-a1117aac8116","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12923,"visible":true,"origin":"","legend":"","description":"","filename":"tropTROPD2501762.xml","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/87a8e7ae957673850abc97d1.xml"},{"id":93246164,"identity":"5983e75b-bfef-4dca-bf2d-64e65778c74a","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1168,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD250176251499.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/117f62130876cfa1dca1a978.xml"},{"id":93246176,"identity":"5d588030-8fc8-4bf9-b8f8-4493b21a01f0","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":934,"visible":true,"origin":"","legend":"","description":"","filename":"TROPD2501762Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/6f5c564e663f18f1895fb1e9.xml"},{"id":93246160,"identity":"e2a27ac5-dccf-47bd-a3a5-3282e1e5cc3b","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":146515,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of full VP1 amino acids sequences confirming the presence of FMDV type O strain and showing\u003cstrong\u003e \u003c/strong\u003emmutations in the critical G-H loop in our sequence compared to the reference and vaccine strains\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/e0305411e9961c87a73a9bc6.jpg"},{"id":93247756,"identity":"33687772-deb0-474e-9584-432fd9ffee9c","added_by":"auto","created_at":"2025-10-10 15:28:00","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":136988,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis revealed our sequence relatedness to the Egyptian FMDV 2021 strains.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/7595a2cac37d17f572a7670a.jpg"},{"id":93246852,"identity":"cc438aa7-8526-4dfb-9f1d-7c90483ca61b","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":43609,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis represents a clear band at 328 bp in S lane while, -ve in control negative lane and +ve indicates control positive RNA, L; 100bp ladder from (100bp to 1500bp).\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/f306d7654701a43e08824cc2.jpg"},{"id":93246897,"identity":"f94d8e3c-074b-47ab-aa1b-4588c9cc3093","added_by":"auto","created_at":"2025-10-10 15:20:21","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":43216,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis represents a clear band at 1124 bp represent pooled sample with primer pair (O-1C283F /EUR 2B52R) in sample lane, positive control and -ve in control negative sample and L; is the 100 to 1500 bp ladder.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/dc39201aa196cd164f288779.jpg"},{"id":93246853,"identity":"05bae428-d7d1-411c-809b-89fde796065b","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":72409,"visible":true,"origin":"","legend":"\u003cp\u003eDepicts a clear band at 279-bp representing \u003cem\u003eC. perfringens\u003c/em\u003e using species-specific primers; P: positive control; N: negative control; L: 100bp Ladder\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/ed4d740723ffc4e311ccba5f.jpg"},{"id":93246168,"identity":"8afa6d49-e7ca-40c0-b038-c153d969bc8c","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":130637,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u0026amp;b: \u003c/strong\u003eGross pictures of a necropsied kid showing pneumonic lesions (thin arrow) (a), slightly congested liver (thick white arrow) and swollen intestinal loops with yellowish discoloration (thin arrows) (b).\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/61c80a26647130993f8ab637.jpg"},{"id":93246855,"identity":"40765515-dcab-4188-983f-94e86cea22df","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":248548,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea-e:\u003c/strong\u003e Microscopic pictures of H\u0026amp;E-stained lung sections showing pneumonic areas (thick black arrows) consisted of filling of alveoli with eosinophilic fluid, neutrophils and macrophages \u003cstrong\u003ea\u0026amp;c \u003c/strong\u003emagnification X: 100 bar 100. Higher magnification \u003cstrong\u003eb, d, e\u003c/strong\u003e X: 400 bar 50 showing neutrophils (arrowheads), macrophages (thin yellow arrows) and eosinophilic fluid (thin black arrows).\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/45f4b06b574f59f41927efee.jpg"},{"id":93246854,"identity":"b276d78a-81d0-4414-b187-ef42a74afd50","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":125220,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u0026amp;b: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained liver sections showing dilated and congested sinusoids (thick black arrows) \u003cstrong\u003ea \u003c/strong\u003e(magnification X: 100 bar 100). Higher magnification showing vacuolar degeneration of hepatocytes (thin black arrows) with many of apoptotic hepatocytes (arrowheads) \u003cstrong\u003eb\u003c/strong\u003e. X: 400 bar 50.\u003c/p\u003e","description":"","filename":"8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/65143e09d77fc8e56f165fdc.jpg"},{"id":93246175,"identity":"ad0db7f5-b931-4de6-a9a3-ab0f5e5ca568","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":224876,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea-d: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained heart sections showing congested blood vessels (thick red arrows), edema (thick black arrows), infiltration of lymphocytes, macrophages and polymorphs around blood vessels and in interstitial tissue (thin black arrows) in auricles \u003cstrong\u003ea\u0026amp;b\u003c/strong\u003e and ventricles \u003cstrong\u003ec\u0026amp;d\u003c/strong\u003e. Low magnification X: 100 bar 100 and high magnification X: 400 bar 50.\u003c/p\u003e","description":"","filename":"9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/31de8c277759bca30bf09cc2.jpg"},{"id":93246171,"identity":"895b49e6-6188-49af-9029-625e84c7bd52","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":181179,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea-c: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained spleen sections showing congested red pulp (thick red arrows), few small and ill-defined lymphoid follicles (thick black arrows). Low magnification X: 100 bar 100 and high magnification X: 400 bar 50\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/45979a5f9e0052dfcf7bdc13.jpg"},{"id":93246857,"identity":"83b98ee8-2109-44c8-9a81-ab2106ba5558","added_by":"auto","created_at":"2025-10-10 15:20:00","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":220093,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea-d: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained intestinal sections showing congested blood vessels in jejunum (thick red arrows), loss of ileal villi in \u003cstrong\u003eb-d\u003c/strong\u003e, edema in submucosa (*) in \u003cstrong\u003ec\u003c/strong\u003e, leukocytic cells infiltration in ileal serosa (thin black arrows) in \u003cstrong\u003eb\u0026amp;c\u003c/strong\u003e. Low magnification X: 100 bar 100.\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/12d6f0e5d2043df58e3987db.jpg"},{"id":93246172,"identity":"5fed497e-c960-4765-8037-7f4a1db759ca","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":117522,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u0026amp;b: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained kidney sections showing congested blood vessels (thick red arrows), edematous Bowman's capsule (thick black arrows), mildly degenerated tubular epithelium (thin black arrows). Low magnification X: 100 bar 100 and high magnification X: 400 bar 50.\u003c/p\u003e","description":"","filename":"12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/1153ae9961ab8ef18cbbdd64.jpg"},{"id":93246178,"identity":"0e8cecb8-e5a6-457d-ba46-1ebced5c8aab","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"jpg","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":128484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea-c: \u003c/strong\u003eMicroscopic pictures of H\u0026amp;E-stained brain sections showing marked perineural edema (thin black arrows), congested blood vessels with perivascular edema (thin red arrows) in cerebral cortex \u003cstrong\u003ea\u0026amp;b\u003c/strong\u003e, congested blood vessels (thick red arrows) in cerebellum c. Low magnification X: 100 bar 100 and high magnification X: 400 bar 50.\u003c/p\u003e","description":"","filename":"13.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/b01b110ffbdbba4a18fecf41.jpg"},{"id":96927262,"identity":"e996271e-4c26-44bb-9726-c648623971e4","added_by":"auto","created_at":"2025-11-27 14:27:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2606899,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/0cd91b9f-69ee-4d2b-9fc9-697f728e3926.pdf"},{"id":93246163,"identity":"73c7652a-6f55-4bf5-8ff3-f7b12eefecff","added_by":"auto","created_at":"2025-10-10 15:12:00","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15667,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary file 1: Showing apathy just before the onset of sudden death in affected kids.\u003c/p\u003e","description":"","filename":"supplementaryfile1tropical.docx","url":"https://assets-eu.researchsquare.com/files/rs-7609439/v1/3440872504b1ab5eed095067.docx"}],"financialInterests":"","formattedTitle":"First Report of a Sudden Death Syndrome in Boer Goats Associated with FMD and Clostridium perfringens Co-infection.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFoot-and-mouth disease (FMD) is an economically important, highly contagious disease caused by genus \u003cem\u003eAphthovirus vesiculae\u003c/em\u003e of the \u003cem\u003ePicornaviridae\u003c/em\u003e family. Sheep and goats are important livestock species in several areas of the world, including Egypt, but are not usually included in prophylactic FMD vaccination programs (Madhanmohan et al. 2012). Although the clinical diagnosis of FMD is confirmed in cattle and buffalo, the situation in adult sheep and goats is rather vague as it may be present in a mild or subclinical form (Saravanan et al. 2020). There are few studies on the role of small ruminants in the epidemiology of FMD despite endemic nature of FMD in Egypt with types O, A, and SAT2 (Abd El Rahman et al. 2020; El-Kenawy et al. 2017). Furthermore, information on the clinical presentation of FMD infection in sheep and goats under field conditions is still limited (Jaisree et al. 2016). Alpha-toxin (CPA) is produced by all \u003cem\u003eClostridium (C.) perfringens \u003c/em\u003estrains and is considered a classic example of a toxin that modifies cell membranes by enzymatic activity. The role of CPA toxin in intestinal diseases in sheep and goats is still controversial and poorly documented (Uzal et al. 2014). Furthermore, the detection of CPA toxin in goats with FMD infection has not yet been evaluated. The purpose of this study was to uncover the underlying cause of sudden death syndrome in Boer goats at an organized farm in Dakahlia governorate, Egypt, and to investigate the associated hematobiochemical changes.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eIn December 2021, an outbreak of disease occurred on a commercial farm in the Aga district of Dakahlia Governorate, Egypt (30.909479158397485, 31.282111538214995). The farm housed 200 Boer goats and their newborn kids (\u003cem\u003en\u003c/em\u003e =30), with no other mixed breeds present. The issue was the sudden deaths occurred among the newborn kids (\u003cem\u003en\u003c/em\u003e = 17), with no apparent clinical signs in the adult goats. The farm owner reported that this scenario occurred over a week, during which neither diagnosis nor response to treatment was achieved by the resident veterinarian. Vaccinations against Peste des petits ruminants, bluetongue, and Pasteurella, as well as deworming, were regularly administered to the goats on the farm, but they had not received the FMD vaccine. \u003c/p\u003e\n\u003cp\u003eSamples of venous blood were taken from all affected kids and placed in tubes containing EDTA or plain tubes for whole blood or serum, respectively. Duplicate buccal and nasal swabs were also taken from all kids either on virus transport media or using sterile cotton swabs moistened with tryptone soy broth (TSB) and stored in tubes containing 10 ml TSB. The samples were kept in ice coolers and immediately transported to the laboratory for further investigations. Buccal mucosal swabs were combined and spun at 2000 rpm for 10 minutes, as specified in the World Organization of Animal Health (WOAH) manual for FMD diagnosis (Knowles et al. 2016). The sample\u0026apos;s supernatant was utilized for viral RNA extraction using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA). A one-step RT-PCR was then carried out using the Topscript RT-PCR Master Mix (Cat. RT4105, Enzynomics, South Korea) according to the method described previously (El-Kenawy et al. 2017). Further typing trials were executed according to the previously described protocol (Knowles et al. 2016). The utilized primers are listed in table-1. Serotype O specific full VP1 PCR product was purified and sequenced using DNA Sequencer (ABI, 3500, USA). Sequences were aligned using Clustal W implemented in Bioedit 7.7 and the phylogenetic trees were conducted using the maximum Likelihood method (\u003cem\u003eTamura\u0026ndash;Nei \u003c/em\u003emodel) with 1,000 Bootstrap replicates. \u003c/p\u003e\n\u003cp\u003eSwabs from the lung, liver, brain, spleen, kidney and intestinal contents, were used for \u003cem\u003eC. perfringens \u003c/em\u003eisolation. Bacterial isolates were used for genomic DNA extraction, followed by PCR amplification of 279-bp fragment of the 16S rDNA (Elgioushy et al. 2018). PCR products were sequenced and deposited in GenBank under accession number OM616931. Further amplification and sequencing of CPA toxin was performed as previously by Yoo et al. (1997).\u003c/p\u003e\n\u003cp\u003eA complete blood count was performed using an electronic cell counter and the measurement of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Human, Wiesbaden, Germany), lactate dehydrogenase (LDH), and total protein and albumin were conducted using a spectrophotometer (Spectrophotometer, BM, Germany, 5010) according to the manufacturer\u0026rsquo;s guidelines. Myocardial creatine kinase band (CK-MB) was determined using ELISA kits from Kamiya Biomedical Company (Seattle, WA, USA). \u003c/p\u003e\n\u003cp\u003eEight kid carcasses were subjected to post-mortem examination. Heart, trachea, lungs, liver, spleen, kidneys, intestines, and brain were collected and fixed in 10% neutral buffered formalin. The samples were routinely processed and stained with hematoxylin and eosin (H\u0026amp;E)\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMedical management was adopted to thirteen kids at the following therapeutic regimen: Ceftiofur crystalline free acid (Excede, Zoetis Inc., USA) at a dosage of 6.6 mgKg\u003csup\u003e-1\u003c/sup\u003e; meloxicam (Metacam, Boehringer Ingelheim VetMedica GmbH, Germany) at a dosage of 0.5 mgKg\u003csup\u003e-1\u003c/sup\u003e given subcutaneously and repeated after 72 hours; Acyclovir (Zovirax, Glaxo Operations UK Ltd.) administered thrice daily for 10 days at a dose of 20 mg/kg as subcutaneous injection; Oreganum oil 20% (Ropadiar, Ropapharm International BV, The Netherlands) administered daily as an oral infusion at a dose of 2 ml/head.\u003c/p\u003e\n\u003cp\u003eData were statistically analysed using Graph Pad Prism software (Graph Pad Software Inc, San Diego). Data tested for normality using the Shapiro\u0026ndash;Wilk test and P values were not significant. Hence, means and standard deviations (SD) were estimated for haematological and biochemical variables. Data before and after treatment were statistically tested for significant differences (p \u0026lt; 0.05) using Student\u0026rsquo;s t-test.\u003c/p\u003e"},{"header":"Results and Discussion","content":"\u003cp\u003eFMD was first was substantially identified based on reported cases, subtle symptoms in adult goats, and newborn goats\u0026apos; sudden deaths, while solid diagnosis reached by detecting a circulating FMDV serotype \u0026apos;O\u0026apos; and \u003cem\u003eC. perfringens\u003c/em\u003e. To the best of our knowledge, this is the first study to report this phenomenon. Two factors contributed significantly to the diagnosis and explained the persistent viral activity and clinical course of FMD in the studied goats: (1) FMD co-occurred with large ruminants in the study region, and (2) sheep and goats were not included in the regular vaccination program in Egypt. \u003c/p\u003e\n\u003cp\u003eTo our knowledge, this is the first study to report Clostridium infection as a complication of FMD in Boer goats. The findings described here were consistent with a previous report documenting the ability of \u003cem\u003eC. perfringens\u003c/em\u003e to affect the respiratory system by causing either severe acute pulmonary edema, particularly in the interlobular septa of calves (Uzal et al. 2014), or bronchopneumonia in cattle and buffaloes (Elgioushy et al. 2018); but in general, natural cases of \u003cem\u003eC. perfringens\u003c/em\u003e-related spontaneous pneumonia have rarely been described in the medical literature (Palmacci et al. 2009),. In the present study, affected kids (\u003cem\u003en \u003c/em\u003e= 30) showed sudden attacks of apathy followed by recumbency and died within a short time (minutes to several hours) (Supplementary file 1). \u003c/p\u003e\n\u003cp\u003ePhysical examinations of survived kids revealed tachycardia, tachypnoea and pyrexia compared to the reference intervals (Table 2). The heart rates, respiratory rates and rectal temperature decreased significantly (P \u0026lt; 0.05) in animals received medical therapy. Adult goats showed minimal clinical signs, including lameness that lasted several days with no need for medical interference. Unlike to the findings reported here, an unanticipated outbreak of serotype \u0026ldquo;O\u0026rdquo; FMD in sheep and goats was reported in India with marked clinical symptoms (Jaisree et al. 2016). Similarly, goats exposed to the SAT1 serotype displayed symptoms including fever, nasal discharge, ulcerative oral lesions, and foot lesions (Lazarus et al. 2019). In another experimental study, sheep and goats challenged with the O serotype exhibited classical clinical signs of FMD (including inappetence, panting, pyrexia, and lameness) (Muthukrishnan et al., 2020). In field epidemics involving both species, goats generally experienced milder symptoms (Stenfeldt et al. 2025).\u003c/p\u003e\n\u003cp\u003eDespite the distinctive hematobiochemical alterations (Table 3, 4) combined with clinical settings, diagnosis was not conclusive. For hematology, erythrocyte counts (10\u003csup\u003e6\u003c/sup\u003e/\u0026micro;l) were lower than reference values, with no statistically significant change (p = 0.193) after treatment. Changes in the erythrocytic indices could likely indicate an intravascular hemolysis caused by the CPA toxin; while, leukocytosis and lymphocytosis observed particularly after treatment, could indicate an ongoing systemic inflammation. These findings were consistent with those reported in sheep with enterotoxaemia (Hassanein et al. 2017). It has also been proposed that granulopoiesis may enhance the innate immune system of the host to protect it against bacterial infections (Fu et al. 2022). The increase in serum total protein and globulin levels and decrease in serum albumin levels in the affected kids (table 4) could indicate an ongoing systemic inflammation. These findings were different from those previously reported in sheep and goats with an outbreak of FMDV serotype \u0026ldquo;O\u0026rdquo; in India (Jaisree et al. 2016). Several other studies have reported hypoproteinaemia, hypoalbuminemia, and increased ALT and AST activities in cattle with FMD infection (Ghanem et al. 2010) and in sheep with enterotoxaemia caused by \u003cem\u003eC. perfringens\u003c/em\u003e (Hassanein et al. 2017)\u003c/p\u003e\n\u003cp\u003eMicrobiological (figures 1, 2,3,4\u0026amp;5), post-mortem (Figure 6) and histopathological investigations (Figure 7-13) were necessary to confirm diagnosis. \u003c/p\u003e\n\u003cp\u003eA distinct band, at the expected 328 bp, indicated the presence of FMDV (Figure 3). Further typing revealed a band at 1124 bp using the primer pair O-1C283F /EUR-2B52R, confirming the type O strain (Figure 4). Full FMDV VP1 was sequenced and was given the accession number (PX236833). Initial analysis of the sequence using open FMD/FMD type webtool revealed that the sequence is closest to Egyptian type O FMD/un-detected topotype and FMDV/O/EA-3 topotype. Amino acid alignment revealed that the critical G-H loop (141-160 aa) in the VP1 had three mutations; A141E, T142A, K157R (Figure 1). The sequenced sample has clustered with other 2022 FMD samples from Egypt as in (Figure 2). On the other side, bacteriological examinations revealed seven isolates of \u003cem\u003eC. perfringens\u003c/em\u003e recovered from lung, liver, brain, spleen, kidney, and intestine of all necropsied animal (Figure 6) and confirmed as \u003cem\u003eC. perfringens\u003c/em\u003e by sequencing of the DNA products (Figure 5). FMD-infected goats with bacterial infections, such as \u003cem\u003eC. perfringens\u003c/em\u003e, may experience complications due to a decrease in body immunity associated with viral infection. This suggestion aligns with the findings of a previous study (Francoz et al. 2015). However, the cause of systemic clostridial dispersion in affected kids remains unknown. \u003cem\u003eCPA\u003c/em\u003e toxin gene was also detected in all isolates and matched the finding observed by Elgioushy et al. (2018) who detected \u003cem\u003eCPA \u003c/em\u003etoxin gene in Egyptian cattle and buffalo herds that exhibit panting and nasal discharge symptoms due to FMD infection.\u003c/p\u003e\n\u003cp\u003ePostmortem examination of non-survived kids indicated that the carcasses were in fair condition up on gross examination. Foot and oral lesions were not seen. Pneumonic lesions involving both lung lobes were seen in all cases. Lung lobes were congested and revealed moderate consolidation with no froth in the airways (Figure 6a). A slightly congested heart, liver, and swollen intestinal loops with yellowish discoloration were also noticed (Figure 6b). Microscopic examination revealed various pathological lesions in the lungs, liver, heart, spleen, intestine, kidneys, and brain (Figures 7\u0026ndash;13). Lung sections showed pneumonic areas characterized by alveoli plugged with eosinophilic fluid, neutrophils and macrophages (Figure 7a-e). A microscopicexamination of the trachea showed no pathognomonic lesions. Liver sections showed dilated and congested sinusoids, vacuolar degeneration of hepatocytes with many of apoptotic hepatocytes (Figure 8 a\u0026amp;b). Heart sections showed congested blood vessels, oedema, infiltration of lymphocytes, macrophages and polymorphs around blood vessels and in the interstitial tissue in auricles and ventricles (Figure 9 a-d). Spleen sections showed congested red pulp, few small and ill-defined lymphoid follicles (Figure 10 a\u0026amp;b). Intestinal sections showed congested blood vessels in jejunum, loss of ileal villi, oedema in submucosa, and leukocytic cells infiltrating ileal serosa (Figure 11 a-d). Kidney sections showed congested blood vessels, slightly edematous Bowman\u0026apos;s capsule, and mildly degenerated tubular epithelium (Figure 12 a\u0026amp;b). Brain sections also revealed marked perineural edema, congested blood vessels with perivascular edema in cerebral cortex, and congested blood vessels in cerebellum (Figure 13 a-c). \u003c/p\u003e\n\u003cp\u003eSurprisingly, the histopathological results of the heart tissue of the affected animals did not show hyaline degeneration or coagulative necrosis, which is indicative of myocarditis. These findings are not consistent with reports previously described in lambs with FMDV- type O in Turkey (Gulbahar et al. 2007), and in lambs \u0026amp; goats with type O FMDV in India (Hemanth et al. 2014). This finding could align with the CK-MB values, which showed minor changes compared to the reference intervals. It seems that boer kids appeared to have less damage to their cardiac tissue when infected with FMD. A previous report suggested that certain breeds of calves, such as Malnad Gidda, might have fewer cardiac abnormalities due to FMD than others, like Hallikar and HF cross-calves (Saravanan et al. 2020). \u003c/p\u003e\n\u003cp\u003eTherefore, further studies are necessary to investigate cardiac changes in Boer kids infected with FMD under natural conditions. Although this is the first report to look at Clostridium infections as a cause of death in Boer kids with FMD, the study has its own limitations, including a small sample size and the lack of a control group, which may preclude a firm conclusion.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study is the first to report an outbreak of sudden deaths in Boer goats on an organized farm in Dakahlia Governorate, Egypt, attributed to FMD infection with \u003cem\u003eC. perfringens\u003c/em\u003e. Boer goats could be a potential carrier for the transmission of FMD to cattle and buffaloes. The present results would improve our understanding of the clinical presentation of FMD infections in goats under natural conditions. Based on the study results, goats should be included in regular FMD vaccination programs to prevent future outbreaks.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study complies with the rules and guidelines of the Institutional Animal Care and Use Committee (IACUC) of Mansoura University and is approved by its\u0026nbsp;ethics committee. The animals were enrolled in the study with the informed consent of their owner and were provided with a document containing information on the definition of the disease, its economic impact and possible clinical consequences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analysed during the current study are available in the National Centre for Biotechnology Information (NCBI) at the following link: https://www.ncbi.nlm.nih.gov, accession numbers OM616931 and PX236833.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMEA conceived and designed the study, undertook the clinical investigations, interpreted the data and wrote the manuscript. R.K, S.A.E.R, N.Y performed virological investigations, S.S and W.A performed pathological investigations, A.A performed bacteriological investigations, F.A and E.R performed the clinicopathological data. All authors contributed to the draft of the manuscript, revised it and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the farm owner for supplying all facilities and information needed to carry out the study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbd El Rahman S, Hoffmann B, Karam R, El-Beskawy M, Hamed MF, Forth LF, Hoper D, Eschbaumer M. (2020) Sequence Analysis of Egyptian Foot-and-Mouth Disease Virus Field and Vaccine Strains: Intertypic Recombination and Evidence for Accidental Release of Virulent Virus. Viruses 12:https://doi.org/[10.3390/v12090990] \u003c/li\u003e\n\u003cli\u003eEl-Kenawy AA, E. YE, Fakhry HMF, Karam R. (2017) MOLECULAR DETECTION AND SEROTYPING OF FOOT AND MOUTH DISEASE VIRUS IN TONGUE EPITHELIUM SAMPLES. Mansoura veterinary medical journal 18:397-404. \u003c/li\u003e\n\u003cli\u003eElgioushy M, Rizk MA, El-Adl M, Elhadidy M, El-Khodery S. (2018) The first molecular detection of Clostridium perfringens from pneumonic cases associated with foot and mouth disease in cattle and buffalo in Egypt. Tropical Animal Health and Production 51:847-52. https://doi.org/[10.1007/s11250-018-1763-8] \u003c/li\u003e\n\u003cli\u003eFrancoz D, Buczinski S, B\u0026eacute;langer AM, Fort\u0026eacute; G, Labrecque O, Tremblay D, Wellemans V, Dubuc J. (2015) Respiratory Pathogens in Qu\u0026eacute;bec Dairy Calves and Their Relationship with Clinical Status, Lung Consolidation, and Average Daily Gain. Journal of Veterinary Internal Medicine 29:381-7. https://doi.org/[https://doi.org/10.1111/jvim.12531] \u003c/li\u003e\n\u003cli\u003eFu Y, Alenezi T, Sun X. (2022) Clostridium perfringens-Induced Necrotic Diseases: An Overview. Immuno 2:387-407. https://doi.org/[10.3390/immuno2020024] \u003c/li\u003e\n\u003cli\u003eGhanem MM, Abdel-Hamid OM. (2010) Clinical, haematological and biochemical alterations in heat intolerance (panting) syndrome in Egyptian cattle following natural foot-and-mouth disease (FMD). Tropical Animal Health and Production 42:1167-73. https://doi.org/[10.1007/s11250-010-9543-0] \u003c/li\u003e\n\u003cli\u003eGulbahar MY, Davis WC, Guvenc T, Yarim M, Parlak U, Kabak YB. (2007) Myocarditis Associated with Foot-and-Mouth Disease Virus Type O in Lambs. vet pathol 44:589\u0026ndash;99. \u003c/li\u003e\n\u003cli\u003eHassanein KMA, Sayed MM, Hassan AM. (2017) Pathological and biochemical studies on enterotoxemia in sheep. Comparative Clinical Pathology 26:513-8. https://doi.org/[10.1007/s00580-017-2407-5] \u003c/li\u003e\n\u003cli\u003eHemanth I, Amaravathi P, Babu NS, Kumar AA, Sailaja N. (2014) Malignant form of foot and mouth disease outbreak in sheep and goat with reference to cytological and histopathlogical findings. Indian Journal of Veterinary Pathology 38:https://doi.org/[10.5958/0973-970x.2014.01143.2] \u003c/li\u003e\n\u003cli\u003eJaisree S, Hemaltha S, Mahaprabhu R, Roy P, Murali N, Arun L, Kumanan K. (2016) Outbreak of Foot and Mouth Disease in an Organized Sheep and Goat Farm. Indian Vet J 93:31-3. \u003c/li\u003e\n\u003cli\u003eKnowles NJ, Wadsworth J, Bachanek-Bankowska K, King DP. (2016) VP1 sequencing protocol for foot and mouth disease virus molecular epidemiology. Rev Sci Tech 35:741-55. https://doi.org/[10.20506/rst.35.3.2565] \u003c/li\u003e\n\u003cli\u003eLazarus DD, Mutowembwa PB, Sirdar MM, Rametse TM, Heath L, Opperman PA, Burroughs REJ, Fosgate GT. (2019) Clinical presentation of FMD virus SAT1 infections in experimentally challenged indigenous South African goats. Small Ruminant Research 180:15-20. https://doi.org/[10.1016/j.smallrumres.2019.09.014] \u003c/li\u003e\n\u003cli\u003eMadhanmohan M, Nagendrakumar SB, Kumar R, Anilkumar J, Manikumar K, Yuvaraj S, Srinivasan VA. (2012) Clinical protection, sub-clinical infection and persistence following vaccination with extinction payloads of O1 Manisa Foot-and-Mouth Disease monovalent vaccine and challenge in goats and comparison with sheep. Res Vet Sci 93:1050-9. https://doi.org/[10.1016/j.rvsc.2011.10.006] \u003c/li\u003e\n\u003cli\u003eMuthukrishnan M, Singanallur Balasubramanian N, Villuppanoor Alwar S. (2020) Experimental Infection of Foot and Mouth Disease in Indian Sheep and Goats. Frontiers in Veterinary Science 7:https://doi.org/[10.3389/fvets.2020.00356] \u003c/li\u003e\n\u003cli\u003ePalmacci C, Antocicco M, Bonomo L, Maggi F, Cocchi A, Onder G. (2009) Necrotizing pneumonia and sepsis due to Clostridium perfringens: a case report. Cases Journal 2:https://doi.org/[10.1186/1757-1626-2-50] \u003c/li\u003e\n\u003cli\u003eSaravanan S, Umapathi V, Priyanka M, Hosamani M, Sreenivasa BP, Patel BHM, Narayanan K, Sanyal A, Basagoudanavar SH. (2020) Hematological and serum biochemical profile in cattle experimentally infected with foot-and-mouth disease virus. Veterinary World 13:426-32. https://doi.org/[10.14202/vetworld.2020.426-432] \u003c/li\u003e\n\u003cli\u003eStenfeldt C, Eschbaumer M, Humphreys J, Medina GN, Arzt J. (2025) The pathogenesis of foot-and-mouth disease virus: current understandings and knowledge gaps. Vet Res 56:119. https://doi.org/[10.1186/s13567-025-01545-5] \u003c/li\u003e\n\u003cli\u003eUzal FA, Vidal JE, McClane BA, Gurjar AA. (2014) Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. NIH Public Access 24-42. \u003c/li\u003e\n\u003cli\u003eYoo HS, Lee SU, Park KY, Park YH. (1997) Molecular Typing and Epidemiological Survey of Prevalence of Clostridium perfringens Types by Multiplex PCR. JOURNAL OF CLINICAL MICROBIOLOGY 35:228-32. \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1\u003c/p\u003e\n\u003cp\u003ePrimers used for typing Foot and Mouth Disease virus\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"737\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003ePrimer\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eSequence (5ʹ \u0026ndash; 3ʹ)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eGenome direction\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eGene\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eProduct size\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 737px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSerotype O\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eO\u0026ndash;1C244F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eGCAGCAAAACACATGTCAAACACCTT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e1,165\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eO\u0026ndash;1C283F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eGCCCAGTACTACACACAGTACAG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e1,124\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 737px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSerotype A\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eA\u0026ndash;1C562F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eTACCAAATTACACACGGGAA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e866\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eA\u0026ndash;1C612F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eTAGCGCCGGCAAAGACTTTGA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e814\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 737px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSerotypes O/A/C/Asia 1\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eEUR\u0026ndash;2B52R\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eGACATGTCCTCCTGCATCTGGTTGAT\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026ndash;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e2B\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 737px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSerotype SAT 2\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eSAT2\u0026ndash;1C445F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eTGGGACACMGGIYTGAACTC\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e1,145\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eSAT2\u0026ndash;P1\u0026ndash;1223F\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eTGAACTACCACTTCATGTACACAG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e+\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eVP3\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e1,279\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 737px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSerotypes SAT 1\u0026ndash;3\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 128px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eSAT\u0026ndash;2B208R\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 350px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003eACAGCGGCCATGCACGACAG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026ndash;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 68px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e2B\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 97px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMean values \u0026plusmn; SD of rectal temperature (\u0026deg;C), heart rate (beats/min) and respiratory rate (breaths/min) in newborn Boer goats with foot-and-mouth disease complicated by \u003cem\u003eClostridium perfringens\u003c/em\u003e strain B1\u003c/p\u003e\n\u003ctable dir=\"rtl\" border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"725\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"3\" valign=\"top\" style=\"width: 416px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eVariables\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u0026nbsp;\u003cem\u003eP - value\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 133px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eReference range\u003csup\u003e*\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eAfter treatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 8)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 160px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eBefore treatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 13)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 133px;\"\u003e\n \u003cp dir=\"LTR\"\u003e38.8\u0026ndash;40.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e39.12 \u0026plusmn; 0.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 160px;\"\u003e\n \u003cp dir=\"LTR\"\u003e40.5 \u003cspan dir=\"LTR\"\u003e\u0026plusmn; 0.93\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp dir=\"LTR\"\u003eRectal temperature (\u0026deg;C)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 133px;\"\u003e\n \u003cp dir=\"LTR\"\u003e100\u0026ndash;120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e105 \u0026plusmn; 6.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 160px;\"\u003e\n \u003cp dir=\"LTR\"\u003e125 \u0026plusmn; 7.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp dir=\"LTR\"\u003eHeart rate (beats/min)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 92px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 133px;\"\u003e\n \u003cp dir=\"LTR\"\u003e20\u0026ndash;40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"LTR\"\u003e26 \u0026plusmn; 4.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 160px;\"\u003e\n \u003cp dir=\"LTR\"\u003e36.8 \u0026plusmn; 5.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 217px;\"\u003e\n \u003cp dir=\"LTR\"\u003eRespiratory rate (breaths/min)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e*\u003c/sup\u003eJackson, P., \u0026amp; Cockcroft, P. (2008). \u003cem\u003eClinical examination of farm animals\u003c/em\u003e. John Wiley \u0026amp; Sons.\u0026nbsp;Blackwell Science Ltd pp 301\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMean values \u0026plusmn; SD of haematological variables in newborn Boer goats with foot-and-mouth disease complicated by \u003cem\u003eClostridium perfringens\u003c/em\u003e strain B1\u003c/p\u003e\n\u003ctable dir=\"rtl\" border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"733\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 485px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eVariables\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u0026nbsp;\u003cem\u003eP - value\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eReference values\u003c/strong\u003e\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eReference range\u003csup\u003e**\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eAfter treatment (\u003cem\u003en\u003c/em\u003e = 8)\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eBefore treatment (\u003cem\u003en\u003c/em\u003e = 13)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.193\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e13.4\u0026nbsp;\u0026plusmn; 3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e8.0\u0026ndash;18.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.72 \u0026plusmn; 0.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e3.53 \u0026plusmn; 01.03\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eRBCs (10\u003csup\u003e6\u003c/sup\u003e/\u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.154\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e8.4\u0026nbsp;\u0026plusmn; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e8.0\u0026ndash;12.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e9.75 \u0026plusmn; 1.92\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e10.90 \u0026plusmn;0.51\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eHb (g/dl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.238\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e25.1\u0026nbsp;\u0026plusmn; 3.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e22.0\u0026ndash;38.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e29.63 \u0026plusmn;5.69\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e32.43 \u0026plusmn;1.62\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003ePCV (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.002\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e9.24\u0026nbsp;\u0026plusmn; 2.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e4.0\u0026ndash;13.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e14.50 \u0026plusmn;1.94\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e10.48 \u0026plusmn;1.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eTLC (10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.232\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e3.02\u0026nbsp;\u0026plusmn; 0.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e1.20\u0026ndash;7.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e4.12 \u0026plusmn;1.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.99 \u0026plusmn; 0.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eNeutrophil (10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e5.77\u0026nbsp;\u0026plusmn; 0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.0\u0026ndash;9.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e10.38 \u0026plusmn; 1.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e7.42\u0026plusmn; 1.57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eLymphocyte (10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 1px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 108px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.19\u0026nbsp;\u0026plusmn; 0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 102px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.00 \u0026ndash; 0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.00 \u0026plusmn; 0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.05\u0026plusmn; 0.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 162px;\"\u003e\n \u003cp dir=\"LTR\"\u003eMonocyte (10\u003csup\u003e3\u003c/sup\u003e/\u0026micro;L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003csup\u003e*\u003c/sup\u003eHolman, H. H., \u0026amp; Dew, S. M. (1965). The Blood Picture of the Goat: III.\u0026mdash;Changes in Haemoglobin Concentration and Physical Measurements Occurring with Age. \u003cem\u003eResearch in Veterinary Science\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e(2), 245-255.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e1 month\u003c/p\u003e\n\u003cp\u003eOld\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e**\u003c/sup\u003eRadostits, O.M., Gay, C.C., Blood, D.C. and Hinchcliff, K.W. (2000) \u003cem\u003eVeterinary Medicine\u003c/em\u003e, 9th edn, W.B. Saunders, London, pp. 1819\u0026ndash;1822.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMean values \u0026plusmn; SD of serum biochemical variables in newborn Boer goats with foot-and-mouth disease complicated by \u003cem\u003eClostridium perfringens\u003c/em\u003e strain B1\u003c/p\u003e\n\u003cdiv align=\"right\"\u003e\n \u003ctable dir=\"rtl\" border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"736\" style=\"margin-right: calc(0%); width: 100%;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 64.8136%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 11.5502%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eVariables\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cem\u003eP - value\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eReference range\u003csup\u003e*\u003c/sup\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eAfter treatment\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 8)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003eBefore Treatment\u003c/strong\u003e\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 13)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.036\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e30.88 \u0026plusmn; 12.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e52.67 \u0026plusmn;2.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eALT (U/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0\u0026ndash;300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e39.97 \u0026plusmn; 7.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e59.52 \u0026plusmn;1.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eAST (U/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.049\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0-400\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e216.50 \u0026plusmn;1.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e247.25 \u0026plusmn;19.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eLDH (U/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.039\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0-100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e21.50 \u0026plusmn; 1.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e26.00 \u0026plusmn;3.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eCK-MB (U/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.456\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e6.2\u0026ndash;7.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e8.88\u0026plusmn;0.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e9.08 \u0026plusmn;0.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eTotal protein (g/dl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.9\u0026ndash;4.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.15 \u0026plusmn;0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e2.76 \u0026plusmn;0.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eAlbumin (g/dl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.244\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e3.3-3.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e6.72 \u0026plusmn;0.65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e6.14 \u0026plusmn;0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eGlobulin (g/dl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 9.7284%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.166\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 17.1826%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.87-1.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.3196%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.34 \u0026plusmn;0.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.5831%;\"\u003e\n \u003cp dir=\"LTR\"\u003e0.46 \u0026plusmn;0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 15.6665%;\"\u003e\n \u003cp dir=\"LTR\"\u003eA/g ratio\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003e*\u003c/sup\u003eMatthews, J. (1999) Diseases of the Goat, Blackwell Science, Oxford, p. 332.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Boer goats, C. perfringens, CPA toxin, FMD, Molecular diagnosis, Pneumonia","lastPublishedDoi":"10.21203/rs.3.rs-7609439/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7609439/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"In December 2021, an outbreak of sudden death occurred among Boer kids on a commercial farm housing 200 adult goats and 30 kids. The purpose of this study was to elucidate the underlying cause and the associated hematobiochemical alterations. The medical history indicated that 17 newborn kids succumbed shortly after exhibiting signs of apathy, while the adults remained clinically healthy. An outbreak of Foot-and-mouth disease (FMD) occurred concurrently on nearby cattle farms that prompt collection of buccal and nasal swabs from the affected kids to detect the FMD virus (FMDV) via RT-PCR. A comprehensive VP1 sequencing was performed to characterize the circulating FMDV. Blood samples were obtained from the survived kids to evaluate hematobiochemical changes. Post-mortem examinations were conducted on eight carcasses, and swabs of internal organs and intestinal contents were collected for bacteriological analysis and histopathological examination on tissue samples. The presence of the FMDV type O was confirmed exhibiting significant mutations in the G-H loop. Phylogenetic analysis revealed it`s relatedness to the Egyptian 2021 strain. C. perfringens was confirmed through DNA sequencing. Intravascular hemolysis was detected indicative of CPA toxins. This study underscores the role of clostridial infection as a complication of FMD in Boer kids. This is the first report of co-infection of Boer goats with C. perfringens and FMD. These findings could enhance our understanding of the clinical presentation of complicated FMD infection cases in Boer goats under natural conditions and highlight the importance of including small ruminants in the vaccination program against FMD in Egypt.","manuscriptTitle":"First Report of a Sudden Death Syndrome in Boer Goats Associated with FMD and Clostridium perfringens Co-infection.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-10 15:11:55","doi":"10.21203/rs.3.rs-7609439/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7ef51a99-950d-4433-90c7-87dee48863dd","owner":[],"postedDate":"October 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-27T14:24:52+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-10 15:11:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7609439","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7609439","identity":"rs-7609439","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-27T02:00:06.600101+00:00
License: CC-BY-4.0