The title Development of a multiplex RT‑PCR assay for simultaneous detection of Areca palm velarivirus 1, Areca palm necrotic ringspot virus and Areca plam necrotic spindle-spot virus

The title Development of a multiplex RT‑PCR assay for simultaneous detection of Areca palm velarivirus 1, Areca palm necrotic ringspot virus and Areca plam necrotic spindle-spot virus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The title Development of a multiplex RT‑PCR assay for simultaneous detection of Areca palm velarivirus 1, Areca palm necrotic ringspot virus and Areca plam necrotic spindle-spot virus Siyu Wan, Kexin Sun, Li Zhang, Zemu Li, Peng Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7118616/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV) are major viral pathogens that cause significant economic losses in areca palm cultivation. Rapid and reliable detection methods are essential for the early diagnosis and management of these viruses in affected regions. In this study, a one-step multiplex reverse transcription-polymerase chain reaction (multiplex RT-PCR) assay was developed for the simultaneous detection of APV1, ANRSV, and ANSSV. Three pairs of specific primers were designed from conserved genomic regions of each virus, generating amplification products of 938 bp for APV1, 527 bp for ANRSV, and 250 bp for ANSSV. The PCR products were clearly distinguishable by 2% agarose gel electrophoresis. Optimal amplification conditions were determined to be 53.4 °C for annealing temperature and 35 cycles. Subsequently, the established multiplex RT-PCR detection method was applied to areca leaf samples collected from the main areca planting areas in Hainan. This method enabled efficient and accurate identification of single and mixed infections in field samples. Virus detection in areca samples from Hainan Island revealed clear regional differences in disease incidence, with higher rates in the eastern and central regions—particularly Baoting, Lingshui, Wanning, and Qionghai—averaging 46.73%. A decreasing trend in severity was observed from east to west, with milder symptoms in areas like Danzhou and Baisha. Together, these results demonstrate that the developed multiplex RT-PCR is a sensitive and practical tool for the routine molecular diagnosis and epidemiological investigation of APV1, ANRSV, and ANSSV in areca palms. Areca palm Multiplex RT-PCR APV1 ANRSV ANSSV Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Areca catechu L. (Arecaceae), commonly known as areca palm, is widely cultivated in South and Southeast Asia[12]. In recent years, with the development of the areca planting industry and related processing sectors, the cultivation area of areca palm has expanded steadily. This expansion has been accompanied by an increase in viral disease incidence, posing serious threats to both yield and quality[19]. Currently, the main viral pathogens infecting areca palm include Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV)[3, 27]. APV1-infected plants typically exhibit yellowing starting from the leaf tips, which gradually spreads across the entire leaf, accompanied by a reduction in crown width[4]. As the symptoms progress, plant growth is suppressed, newly emerging leaves are underdeveloped, and individual leaves become shorter[21]. ANSSV causes chlorosis in the upper leaves and spindle-shaped necrotic lesions on the middle and lower leaves[13, 24]. Infections with ANRSV are characterized by necrotic ring spots on the leaves, sparse foliage, drooping basal leaves, and elongated internodes compared to healthy plants[25]. These viruses may occur as single or mixed infections, leading to substantial economic losses due to decreased fruit quality and commercial value. Because the symptoms caused by different viruses often overlap and are not always diagnostic, there is an urgent need to establish a rapid, sensitive, and specific detection method for the simultaneous identification of APV1, ANRSV, and ANSSV in field samples[28]. Currently, several techniques have been developed to detect viruses[2, 18, 20]. LAMP, simplex RT-PCR, uniplex real time RT-PCR, and ELISA have been developed for the detection of areca viruses[17, 30]. Multiplex RT-PCR amplifying multiple nucleic acid fragments in one reaction enables rapid and sensitive identification of several viruses simultaneously in a single assay[1, 9, 22], which greatly reduces cost and increases the effciency of viral surveys[5, 10]. To date, multiplex RT-PCR has been widely used to detect viruses in wheat, maize, soybeans, and rice[7, 16, 23, 29]. In this study, three specific primer pairs that can amplify DNA fragments of different sizes were designed according to genomic sequences of APV1, ANRSV and ANSSV. After optimizing RT-PCR conditions, an efficient multiplex RT-PCR assay was established and validated for the simultaneous of APV1, ANRSV and ANSSV infecting areca plants. Materials and methods Plant materials Fresh leaves from Areca grown in greenhouses at the Hainan University (Hai Nan, China), which were confirmed to be co-infected with APV1, ANRSV and ANSSV by RT-PCR and sequencing were used to set up and optimize the multiplex RT-PCR assay. RNA extraction and reverse transcription Total RNA was isolated from the areca leaf samples as described before[ 6 ]. First strand cDNA was synthesized from 5 µg total RNA using a RevertAi (#K1622) reverse transcription kit (Thermo Fisher Scientific, Shanghai, China) in a 20 µL reaction mixture with random primers, according to the manufacturer,s protocol. Design of virus‑specific primers The genomic sequences of APV1 (accession numbers: OM687513.1, MK956940.2, MW316024.1, MW316023.1, MW316022.1, MW316019.1, MW316013.1, NC_027121.1, and KR349464.1), ANRSV (accession numbers: MZ209276.1, MW282956.1, NC_055501.1, MH425894.1, MH425890.1, MH395393.1, MH395380.1, MH395376.1, and MH395371.1), and ANSSV (accession numbers: MH330686.1) were obtained from GenBank. Nucleotide sequence alignment was performed using ClustalW implemented in MEGA X[ 14 , 15 ], and conserved regions of each virus were identified. Virus-specific primers were designed based on the identified conserved regions of each virus using Primer Premier 5.0 software (Premier Bio-soft International, Palo Alto, CA). Evaluation of primer specificity To evaluate the specificity of each primer pair, uniplex RT-PCR assays were conducted using the Multi PCR Kit (Sangon Biotech, Shanghai, China). Each reaction was performed in a total volume of 50 µL containing 2.0 µL of each primer (2 µM), 2 µL of cDNA template, 25 µL of 2× SanTaq PCR Mix, and 21 µL of double-distilled water. The thermal cycling conditions were as follows: initial denaturation at 94°C for 5 min; followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 60 s, and extension at 72°C for 60 s; with a final extension at 72°C for 8 min. PCR products were electrophoresed on a 2% agarose gel in 0.5× TBE buffer and visualized under UV illumination. To further verify the specificity of each primer set, selected PCR products were purified and cloned into the pMD19-T vector (TaKaRa, Dalian, China) for sequencing. The obtained sequences were aligned with reference sequences in the GenBank database using DNAMAN 5.0 software (Lynnon Biosoft, San Ramon, CA, USA). Optimization of multiplex RT‑PCR assay The multiplex RT-PCR assay was optimized by adjusting the annealing temperature and the number of amplification cycles. A range of annealing temperatures (53.4°C, 54.3°C, 55.2°C, 56.3°C, 57.3°C, 58.2°C, 58.9°C, and 59.5°C) was tested to determine the optimal condition for simultaneous amplification. Additionally, different cycle numbers (20, 25, 30, 35, and 40) were evaluated. The PCR products were analyzed by agarose gel electrophoresis as described above. The conditions yielding distinct, non-overlapping bands of expected sizes were selected for the final multiplex RT-PCR protocol. Table 1 Primers for uniplex RT-PCR assay and multiplex RT-PCR assay Virus Primer Primer sequence (5′–3′) Length (nt) Tm (℃) GC% Position(nt) Products (bp) Target gene APV1 APV1-F ATCGCTAAATATTATGGATAGACTT 25 52 28 12768–12792 938 CP APV1-R TATTCAGAAGCATAAGATTGTGACA 26 54 31 13681–13705 ANRSV ANRSV-F CAAGTGAAAGCCTGGG 16 53 56 8705–8720 527 CP ANRSV-R CCATGTTCATACTCACTAACATC 23 53 39 9209–9231 ANSSV ANSSV-F CAGCAACAGAAGACCAAG 18 53 50 8691–8708 250 CP ANSSV-R TTCCTCAATCCAACTGACT 19 53 42 8922–8940 Sensitivity of multiplex PCR assay To compare the sensitivity of the multiplex RT-PCR assay with that of uniplex RT-PCR, 10-fold serial dilutions of cDNA derived from areca samples co-infected with APV1, ANRSV, and ANSSV were prepared and used as templates. The amplification reactions were performed under the optimized conditions. PCR products were analyzed by 2% agarose gel electrophoresis in 0.5× TBE buffer, as described above. Survey of areca viruses by multiplex RT‑PCR assay A total of 414 areca palm leaf samples were collected from different regions of China and analyzed using the developed multiplex RT-PCR assay for the detection of Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV) (Table 2 ). Results Specificity and compatibility of primer pairs In the uniplex RT-PCR assays, each primer pair specifically amplified a single fragment of the expected size corresponding to APV1, ANRSV, or ANSSV without any non-specific products (Fig. 1 A–C). In the multiplex RT-PCR assay, all three target fragments were successfully amplified in a single reaction using the mixed primer set, and no non-specific amplification was observed (Fig. 1 D).To further verify the specificity and compatibility of the designed primer pairs, the amplified fragments were individually cloned and sequenced. Sequence alignment analysis revealed that the amplicons shared high nucleotide identity with the corresponding reference sequences of APV1, ANRSV, and ANSSV in the GenBank database. No amplification product was observed in the negative control, indicating the absence of non-specific amplification and confirming the reliability of the assay. These results confirmed that the primers were specific and compatible, and could be reliably used for the simultaneous identification of the three areca-associated viruses in the developed multiplex RT-PCR system. Optimization of multiplex RT-PCR conditions and evaluation of primer concentrations To improve amplification efficiency and balance band intensities among target fragments, primer concentrations were adjusted based on the brightness of specific bands observed after electrophoresis. The final optimized primer volumes per 25 µL reaction were 0.5 µL for both APV1-F and APV1-R, 0.4 µL for both ANRSV-F and ANRSV-R, and 1.0 µL for both ANSSV-F and ANSSV-R. The multiplex RT-PCR conditions were further optimized by adjusting the annealing temperature and the number of amplification cycles. Eight annealing temperatures (53.4°C, 54.3°C, 55.2°C, 56.3°C, 57.3°C, 58.2°C, 58.9°C, and 59.5°C) were tested in gradient PCR assays. As shown in Fig. 2 , amplification performed at temperatures between 53.4°C and 57.3°C consistently yielded three distinct, virus-specific bands. However, notable differences in band intensities were observed across the temperature range for individual targets, with 53.4°C producing the most balanced and robust signal. Additionally, five different cycle numbers (20, 25, 30, 35, and 40) were evaluated to determine the optimal number of amplification cycles (Fig. 3 ). Amplified products from 35 and 40 cycles clearly exhibited the three expected bands without non-specific amplification, suggesting that 35 cycles provided a suitable balance between sensitivity and amplification efficiency. The final reaction system for the multiplex RT-PCR was 25 µL, comprising 15 µL of Premix Taq (TaKaRa Taq Version 2.0 plus dye), virus-specific primers at the optimized concentrations (APV1-F/R: 0.5 µL each; ANRSV-F/R: 0.4 µL each; ANSSV-F/R: 1.0 µL each), 3 µL of cDNA, and ddH₂O to bring the total volume to 25 µL. The optimized thermal cycling conditions were as follows: 94°C for 5 min; followed by 35 cycles of 94°C for 30 s, 53.4°C for 60 s (annealing and extension), and a final extension at 72°C for 10 min. A 6 µL aliquot of each amplified product was subjected to electrophoresis on a 2% agarose gel in 0.5× TBE buffer. Sensitivity of the multiplex RT-PCR assay To evaluate the detection sensitivity of the multiplex RT-PCR assay, cDNA derived from areca samples co-infected with APV1, ANRSV, and ANSSV was subjected to 10-fold serial dilutions (from 10 0 to 10 − 7 ), and both uniplex and multiplex RT-PCR assays were performed. PCR products were analyzed by agarose gel electrophoresis as described above. The results showed that APV1 could be detected at a dilution of 10 − 3 , while ANRSV and ANSSV were detectable up to 10 − 2 (Fig. 4 ). These findings indicate that the developed multiplex RT-PCR assay has high sensitivity, comparable to that of the corresponding uniplex RT-PCR assays. Application of multiplex RT‑PCR assay in survey of areca viruses To investigate the epidemiological characteristics of Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV) in areca-growing areas of Hainan Province.A total of 414 areca palm leaf samples exhibiting typical viral disease symptoms were collected from major cultivation areas in Hainan Province (Fig. 5 ). Laboratory testing using the established multiplex RT-PCR assay revealed the detection rates of the three viruses, as well as the occurrence of mixed infections (Table 2 ). Representative electrophoresis results are shown in Fig. 6 , clearly demonstrating the specific amplification bands for each virus.To evaluate the applicability of the established multiplex RT-PCR assay, 414 areca palm samples collected from different regions of Hainan Province were tested for the presence of APV1, ANRSV, and ANSSV. In addition, a total of 414 areca palm samples were analyzed using the multiplex RT-PCR method to detect APV1, ANRSV, and ANSSV. The results showed that 98 samples (23.67%) were infected with at least one virus. Among them, APV1 was the most prevalent, detected in 94 samples (22.71%), followed by ANRSV in 16 samples (3.86%) and ANSSV in 1 samples (0.2%) (Table 2 ).Further analysis revealed that 92 samples (22.22%) were infected with a single virus, while mixed infections involving two or three v iruses were found in 6 samples (3.86%). Table 2 Detection of three viruses in areca plants from different geographic regions of Hainan using multiplex RT-PCR assay Location NO. of samples No. of positive samples and positive rate (%) APV1 ANRSV ANSSV Sanya 23 7(30.00) 0(00.00) 0(00.00) Lingshui 23 12(52.17) 0(0.00) 0(00.00) Baoting 23 12(52.17) 4(17.39) 1(04.34) Ledong 23 4(17.39) 0(00.00) 0(0.00) Dongfang 23 3(13.04) 0(00.00) 0(00.00) Wanning 23 9(39.13) 6(26.09) 0(00.00) Qionghai 23 6(26.09) 3(13.00) 0(00.00) Qiongzhong 23 7(30.00) 0(00.00) 0(00.00) Tunchang 23 8(34.78) 0(00.00) 0(00.00) Wenchang 23 7(30.00) 0(00.00) 0(00.00) Dingan 23 8(34.78) 3(13.04) 0(00.00) Wuzhishan 23 3(13.04) 0(00.00) 0(00.00) Haikou 23 1(08.69) 0(00.00) 0(00.00) Chengmai 23 1(04.34) 0(00.00) 0(00.00) Lingao 23 1(04.34) 0(00.00) 0(00.00) Danzhou 23 0(00.00) 0(00.00) 0(00.00) Baisha 23 1(04.34) 0(00.00) 0(00.00) Changjiang 23 0(00.00) 0(00.00) 0(00.00) Discussion Designing and selecting appropriate primer combinations is critical for establishing an efficient multiplex RT-PCR detection system[ 8 , 11 ]. In this study, virus-specific primers were designed based on highly conserved genomic regions of each virus. The final primer set successfully amplified distinguishable products of the expected sizes—938 bp for APV1, 527 bp for ANRSV, and 250 bp for ANSSV. The size differences of over 100 bp enabled clear separation of the three bands on a 2% agarose gel, with no visible non-specific amplification. A lower agarose concentration would reduce resolution and potentially hinder detection sensitivity; thus, a 2% agarose gel was used to ensure clear differentiation of target amplicons. Given the potential inhibitory effect of multiple primer sets within a single reaction on amplification efficiency and specificity, PCR conditions were optimized to improve assay performance. Optimization of annealing temperature and cycling number revealed that the highest amplification efficiency for all three targets occurred at 53.4°C, and no additional gain was observed beyond 35 cycles (Figs. 2 and 3 ). Accordingly, 53.4°C and 35 cycles were adopted as the optimal conditions for the multiplex RT-PCR assay. Assay sensitivity is another key criterion for evaluating the performance of multiplex systems. Sensitivity testing showed that the detection limits of the multiplex RT-PCR assay were generally comparable to those of uniplex RT-PCR. Although there was a 10-fold reduction in sensitivity for APV1 detection in the multiplex setting, this modest decline is consistent with results reported in similar studies[ 26 ]. This discrepancy may be partly due to competition in multiplex RT-PCR assay for key reactants, such as Taq polymerase and dNTPs. Viral infection represents a major constraint in areca palm cultivation. Using the developed multiplex RT-PCR assay, a total of 414 areca leaf samples collected from different regions of Hainan were tested. The results indicated that 98 samples (23.67%) were infected with at least one of the three viruses, and 3.86% showed coinfection. In this study, one areca sample was found to be simultaneously infected with APV1, ANRSV, and ANSSV. Given that previous studies have suggested a very low likelihood of ANRSV and ANSSV co-infecting the same leaf tissue, this result appears to be unusual. The corresponding PCR bands were relatively faint, indicating the possibility of a false positive, although low-level co-infection cannot be entirely ruled out. This observation highlights the need for further validation and offers a new perspective for investigating mixed infections among areca-associated viruses. Virus detection results from areca samples indicated significant regional variation in the incidence of areca yellowing disease across Hainan Island. The disease is currently spreading in major areca-producing areas such as Wanning, Lingshui, and Qionghai, with higher infection rates observed in the eastern and central regions. Baoting, Lingshui, Wanning, and Qionghai showed the highest infection levels, with an average incidence of 46.73%. Spatially, the severity of the disease decreases from east to west, with milder cases reported in western areas such as Danzhou and Baisha. Previous studies have shown that APV1 was transmitted by both Ferrisia virgata and Pseudococcus cryptus mealybugs and caused YLD symptoms in betel palm seedlings The warmer and more humid climate in the eastern and central regions is more conducive to the reproduction of mealybug populations and the spread of the virus. Moreover, these regions have a longer history and larger scale of areca cultivation, which may further contribute to the higher disease incidence. Although areca cultivation has expanded in the western regions in recent years, the overall planting area remains smaller compared to the east and central areas, potentially reducing the risk of disease transmission. Notably, with the rapid expansion of areca cultivation in Hainan, yellowing disease and other viral infections are becoming increasingly severe, posing a significant threat to the industry. The spread of these diseases has emerged as a critical bottleneck restricting the sustainable development of the areca industry. The high infection rate may be attributed to the widespread use of virus-infected seedlings for propagation and the lack of effective virus management strategies. To mitigate the spread and impact of areca-associated viruses, it is essential to adopt virus-free planting materials, cultivate resistant or tolerant varieties, and implement sensitive detection methods for routine surveillance. The multiplex RT-PCR assay developed in this study provides a rapid, reliable, and cost-effective tool for the simultaneous detection of APV1, ANRSV, and ANSSV, and holds promise for future epidemiological investigations and disease control programs in areca cultivation. Conclusions In this study, a reliable and efficient multiplex RT-PCR assay was developed for the simultaneous detection of three economically important areca-associated viruses: Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV). Virus-specific primers targeting conserved genomic regions were carefully designed, and reaction conditions—including primer concentrations, annealing temperature, and cycle number—were systematically optimized. The final assay demonstrated high specificity and sensitivity, with clear and distinguishable amplification products for each virus. Field application of the multiplex RT-PCR system revealed a high incidence of single and mixed infections in symptomatic areca samples collected from major growing regions in China. These findings highlight the widespread occurrence of viral pathogens in areca plantations and underscore the urgent need for effective disease monitoring and management strategies. The optimized and field-validated multiplex RT-PCR assay established in this study enables rapid and accurate detection of three major areca viruses. This method provides an efficient and reliable tool for virus monitoring and disease management in areca cultivation. Declarations Competing interests The authors declare no competing interests. Ethics approval This article does not contain any studies with human participants or animals performed by any of the authors. Consent to participate Informed consent was obtained from all individual participants included in the study. Consent to publish This manuscript has not been published or presented elsewhere in part or in entirety, and is not under consideration by another journal. All the authors have approved the manuscript and agree with submission to your esteemed journal. Funding This research was funded by the Sanya Yalong Bay Elite Talent Project (grant no. RZ2300007007). Authors’ contributions SYW conceived and designed the experiment; Conduct experiments among SYW, KXS, LZ, LZ, and PZ. SYW and KXS. Analyze the data; KXS Write a thesis; SYW and LZ revised the paper. All the authors discussed the results and contributed to the final manuscript. Acknowledgements This research was funded by the Sanya Yalong Bay Elite Talent Project (Grant No. RZ2300007007), which provided essential support for the completion of this work. We also extend our sincere gratitude to the colleagues and technical staff who contributed to the experimental setup and data collection. Their assistance, while not qualifying for authorship, was invaluable to the success of this study. Data availability Availability of data and materials The complete APV1、ANRSV and ANSSV genome sequences were deposited in GenBank with respective accession numbers MW316004–MW316024、MZ209276.1-MH395371.1、MH330686.1and the datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Baggio F, Hetzel U, Prähauser B, Dervas E, Michalopoulou E, Thiele T, Kipar A, Hepojoki J (2023) A Multiplex RT-PCR Method for the Detection of Reptarenavirus Infection. Viruses 15 Boonham N, Kreuze J, Winter S, van der Vlugt R, Bergervoet J, Tomlinson J, Mumford R (2014) Methods in virus diagnostics: from ELISA to next generation sequencing. Virus Res 186:20-31 Cao X, Zhao R, Wang H, Zhang H, Zhao X, Khan LU, Huang X (2021) Genomic diversity of Areca Palm Velarivirus 1 (APV1) in Areca palm (Areca catechu) plantations in Hainan, China. BMC Genomics 22:725 Cao X, Gao B, Lu J, Wang H, Zhao R, Huang X (2024) Areca palm velarivirus 1 infection caused disassembly of chloroplast and reduction of photosynthesis in areca palm. Frontiers in Microbiology 15 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33:e179 Chen S, Zhou Y, Ye T, Hao L, Guo L, Fan Z, Li S, Zhou T (2014) Genetic variation analysis of apple chlorotic leaf spot virus coat protein reveals a new phylogenetic type and two recombinants in China. Arch Virol 159:1431-1438 Cho SY, Jeong RD, Yoon YN, Lee SH, Shin DB, Kang HW, Lee BC (2013) One-step multiplex reverse transcription-polymerase chain reaction for the simultaneous detection of three rice viruses. J Virol Methods 193:674-678 Di Serio F, Ambrós S, Sano T, Flores R, Navarro B (2018) Viroid Diseases in Pome and Stone Fruit Trees and Koch's Postulates: A Critical Assessment. Viruses 10 Faggioli F, Luigi M (2022) Multiplex RT-PCR. Methods Mol Biol 2316:163-179 Goto Y, Fukunari K, Tada S, Ichimura S, Chiba Y, Suzuki T (2023) A multiplex real-time RT-PCR system to simultaneously diagnose 16 pathogens associated with swine respiratory disease. J Appl Microbiol 134 Hao L, Xie J, Chen S, Wang S, Gong Z, Ling KS, Guo L, Fan Z, Zhou T (2016) A multiple RT-PCR assay for simultaneous detection and differentiation of latent viruses and apscarviroids in apple trees. J Virol Methods 234:16-21 Heatubun CD, Dransfield J, Flynn T, Tjitrosoedirdjo SS, Mogea JP, Baker WJ (2012) A monograph of the betel nut palms (Areca: Arecaceae) of East Malesia. Botanical Journal of the Linnean Society 168:147-173 Khan LU, Zhao R, Wang H, Huang X (2023) Recent advances of the causal agent of yellow leaf disease (YLD) on areca palm (Areca catechu L.). Tropical Plants 2:0-0 Kumar S, Stecher G, Peterson D, Tamura K (2012) MEGA-CC: computing core of molecular evolutionary genetics analysis program for automated and iterative data analysis. Bioinformatics 28:2685-2686 Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35:1547-1549 Li X, Li Y, Hu W, Li Y, Li Y, Chen S, Wang J (2021) Simultaneous multiplex RT-PCR detection of four viruses associated with maize lethal necrosis disease. J Virol Methods 298:114286 Peng W, Liu YJ, Wu N, Sun T, He XY, Gao YX, Wu CJ (2015) Areca catechu L. (Arecaceae): a review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. J Ethnopharmacol 164:340-356 Rubio L, Galipienso L, Ferriol I (2020) Detection of Plant Viruses and Disease Management: Relevance of Genetic Diversity and Evolution. Front Plant Sci 11:1092 Salama HS, Zaki FN, Abdel-Razek AS (2009) Ecological and biological studies on the red palm weevilRhynchophorus ferrugineus(Olivier). Archives Of Phytopathology And Plant Protection 42:392-399 Santiago GA, Vázquez J, Courtney S, Matías KY, Andersen LE, Colón C, Butler AE, Roulo R, Bowzard J, Villanueva JM, Muñoz-Jordan JL (2018) Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nat Commun 9:1391 Wang H, Zhao R, Zhang H, Cao X, Li Z, Zhang Z, Zhai J, Huang X (2020) Prevalence of Yellow Leaf Disease (YLD) and its Associated Areca Palm Velarivirus 1 (APV1) in Betel Palm (Areca catechu) Plantations in Hainan, China. Plant Dis 104:2556-2562 Xu Y, Yang L, Zhou J, Yang Y, Lu M, Li S (2019) Multiplex RT-PCR to simultaneously detect three viruses that infect peach. Lett Appl Microbiol 69:318-324 Xue B, Shang J, Yang J, Zhang L, Du J, Yu L, Yang W, Naeem M (2021) Development of a multiplex RT-PCR assay for the detection of soybean mosaic virus, bean common mosaic virus and cucumber mosaic virus in field samples of soybean. J Virol Methods 298:114278 Yang K, Ran M, Li Z, Hu M, Zheng L, Liu W, Jin P, Miao W, Zhou P, Shen W, Cui H (2018) Analysis of the complete genomic sequence of a novel virus, areca palm necrotic spindle-spot virus, reveals the existence of a new genus in the family Potyviridae. Arch Virol 163:3471-3475 Yang K, Shen W, Li Y, Li Z, Miao W, Wang A, Cui H (2019) Areca Palm Necrotic Ringspot Virus, Classified Within a Recently Proposed Genus Arepavirus of the Family Potyviridae, Is Associated With Necrotic Ringspot Disease in Areca Palm. Phytopathology 109:887-894 Yao B, Wang G, Ma X, Liu W, Tang H, Zhu H, Hong N (2014) Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. J Virol Methods 196:113-119 Yu H, Qi S, Chang Z, Rong Q, Akinyemi IA, Wu Q (2015) Complete genome sequence of a novel velarivirus infecting areca palm in China. Arch Virol 160:2367-2370 Yu SS, Che HY, Wang SJ, Lin CL, Lin MX, Song WW, Tang QH, Yan W, Qin WQ (2020) Rapid and Efficient Detection of 16SrI Group Areca Palm Yellow Leaf Phytoplasma in China by Loop-Mediated Isothermal Amplification. Plant Pathol J 36:459-467 Zhang P, Liu Y, Liu W, Massart S, Wang X (2017) Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR. J Virol Methods 249:170-174 Zhao G, Shen W, Tuo D, Cui H, Yan P, Tang Q, Zhu G, Li X, Zhou P, Zhang Y (2020) Rapid detection of two emerging viruses associated with necrotic symptoms in Areca catechu L. by reverse transcription loop-mediated isothermal amplification (RT-LAMP). J Virol Methods 281:113795 Supplementary Files supplementaryfile.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7118616","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":494888270,"identity":"082c9d62-662b-4c70-80a5-3964589face9","order_by":0,"name":"Siyu Wan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzUlEQVRIiWNgGAWjYBACNmbmww8kKtjk+NmbDxCnhY+9Lc3A4gyfsWTPsQTitMjxnFGQqGyRSzS4kWNApMMkchgMbjaYJRgcyPl44w2DnZxuA0EtuQceztyRlid54OxmyzkMycZmBwhqyUswljxzrJjvYO82aR6GA4nbCGvJMZD+2/Y/seEwzzMitfCcMZCQbGNLnHCMh41ILaBAljjDBgxkNmPLOQZE+EW+GRaV8o8f3nhTYSdHUAsKkOAhMmqQtZCqYxSMglEwCkYEAACNnULNCLmy2QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0007-0483-8379","institution":"Hainan University of China Tropical Agriculture: Hainan University","correspondingAuthor":true,"prefix":"","firstName":"Siyu","middleName":"","lastName":"Wan","suffix":""},{"id":494888271,"identity":"95655862-3450-47bc-98f5-3335989eff2a","order_by":1,"name":"Kexin Sun","email":"","orcid":"","institution":"Hainan University of China Tropical Agriculture: Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Kexin","middleName":"","lastName":"Sun","suffix":""},{"id":494888272,"identity":"2b5dd8b1-5f2a-4078-b8b1-badde8494f8b","order_by":2,"name":"Li Zhang","email":"","orcid":"","institution":"Hainan University of China Tropical Agriculture: Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Zhang","suffix":""},{"id":494888273,"identity":"5b86bca2-2566-4ed9-8356-f242a7c38db1","order_by":3,"name":"Zemu Li","email":"","orcid":"","institution":"Hainan University of China Tropical Agriculture: Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Zemu","middleName":"","lastName":"Li","suffix":""},{"id":494888274,"identity":"41438eec-1e0d-4718-ad85-3d831de49b09","order_by":4,"name":"Peng Zhao","email":"","orcid":"","institution":"Hainan University of China Tropical Agriculture: Hainan University","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2025-07-14 08:21:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7118616/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7118616/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88361554,"identity":"fbf4fd8e-817f-4c14-948f-37fd68b33858","added_by":"auto","created_at":"2025-08-05 16:23:53","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":37971,"visible":true,"origin":"","legend":"\u003cp\u003eDetermination of specificity and compatibility of three pairs of primers used for uniplex RT-PCR to detect APV1 (A), ANRSV (B), and ANSSV (C) and three multiplex RT-PCR assays (D). Lane M, 100 bp plus DNA ladder; Lane N, negative control\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/9ea381d7384c3f2218c2a040.jpg"},{"id":88361522,"identity":"75723efe-5188-46c8-9a8e-4289725db7c6","added_by":"auto","created_at":"2025-08-05 16:23:52","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":29541,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization of annealing temperature for multiplex RT-PCR assay to detect APV1, ANRSV, and ANSSV. Lane M, 100 bp plus DNA ladder; Lane N, negative control; Lane 1–8, 53.4 °C; 54.3 °C; 55.2 °C; 56.3 °C; 57.3 °C; 58.2 °C; 58.9 °C; 59.5 °C\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/63afb05ccb5ed5ab497387ed.jpg"},{"id":88361525,"identity":"d7f6628e-c379-473e-bd53-cb011dd0fcf3","added_by":"auto","created_at":"2025-08-05 16:23:52","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":29594,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization of amplification cycle number for multiplex RT-PCR assay to detect APV1, ANRSV, and ANSSV. Lane M, 100 bp plus DNA ladder; Lane N, negative control. Lanes 1–5, 20 cycles;25 cycles; 30 cycles; 35 cycles; 40 cycles\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/fef27ee3bd473e7e1ca9d1b3.jpg"},{"id":88361523,"identity":"4e33467d-4620-4b73-9224-1db3a2497c60","added_by":"auto","created_at":"2025-08-05 16:23:52","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":41226,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the sensitivities of uniplex RT-PCR assays for the detection of APV1 (A), ANRSV (B), and ANSSV (C) and multiplex RT-PCR assay (D). Lane M, 100 bp plus DNA ladder; Lane N, negative control; Lanes100–10−7, ten-fold serial dilutions of cDNA from an areca sample co-infected with three viruses\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/67a512e2fd16a1e54b634487.jpg"},{"id":88361568,"identity":"5e652c7f-a2cb-45db-bee5-3524d005c134","added_by":"auto","created_at":"2025-08-05 16:23:54","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":85016,"visible":true,"origin":"","legend":"\u003cp\u003eSampling locations for the 414 areca leaf samples showing typical viral disease symptoms.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/316b4eb1ad8867f0353b667b.jpg"},{"id":88361451,"identity":"a5b01671-2ad8-4f4d-8864-6c7581d16cac","added_by":"auto","created_at":"2025-08-05 16:23:49","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":119710,"visible":true,"origin":"","legend":"\u003cp\u003eillustrates the detection results of areca-associated viruses in leaf samples from four regions using the multiplex RT-PCR assay described in Example 4 of this study. A total of 23 leaf samples were tested from each region. M: DL2000 DNA marker; N:negative; lanes 1–23: individual areca leaf samples from each group; N: negative control;A: Sanya; B:Lingshui; C:Baoting; D:Ledong; E:Dongfang; F:Wanning; G:Qionghai; H:Qiongzhong; I:Tunchang; J:Wenchang; K:Dingan; L:Wuzhishan; M:Haikou; N:Chengmai; O:Lingao; P:Danzhou; Q:Baisha; R:Changjiang.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/b56659b41ffd74ff021f039d.jpg"},{"id":92020341,"identity":"fdb2b8b0-25b2-40ad-b696-7fb56aceae3c","added_by":"auto","created_at":"2025-09-23 17:35:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1109036,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/6c113037-432d-4fce-993c-79c3cda340e7.pdf"},{"id":88361561,"identity":"8a4792aa-4aaf-4483-8eb3-6a9f112ca196","added_by":"auto","created_at":"2025-08-05 16:23:53","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2799189,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-7118616/v1/c6b1cb160ed80c630d2c4996.docx"}],"financialInterests":"","formattedTitle":"The title Development of a multiplex RT‑PCR assay for simultaneous detection of Areca palm velarivirus 1, Areca palm necrotic ringspot virus and Areca plam necrotic spindle-spot virus","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eAreca catechu\u003c/em\u003e L. (Arecaceae), commonly known as areca palm, is widely cultivated in South and Southeast Asia[12]. In recent years, with the development of the areca planting industry and related processing sectors, the cultivation area of areca palm has expanded steadily. This expansion has been accompanied by an increase in viral disease incidence, posing serious threats to both yield and quality[19]. Currently, the main viral pathogens infecting areca palm include \u003cem\u003eAreca palm velarivirus\u003c/em\u003e 1 (APV1), \u003cem\u003eAreca palm necrotic ringspot virus\u0026nbsp;\u003c/em\u003e(ANRSV), and \u003cem\u003eAreca palm necrotic spindle-spot virus\u003c/em\u003e (ANSSV)[3, 27]. APV1-infected plants typically exhibit yellowing starting from the leaf tips, which gradually spreads across the entire leaf, accompanied by a reduction in crown width[4]. As the symptoms progress, plant growth is suppressed, newly emerging leaves are underdeveloped, and individual leaves become shorter[21]. ANSSV causes chlorosis in the upper leaves and spindle-shaped necrotic lesions on the middle and lower leaves[13, 24]. Infections with ANRSV are characterized by necrotic ring spots on the leaves, sparse foliage, drooping basal leaves, and elongated internodes compared to healthy plants[25]. These viruses may occur as single or mixed infections, leading to substantial economic losses due to decreased fruit quality and commercial value. Because the symptoms caused by different viruses often overlap and are not always diagnostic, there is an urgent need to establish a rapid, sensitive, and specific detection method for the simultaneous identification of APV1, ANRSV, and ANSSV in field samples[28].\u003c/p\u003e\n\u003cp\u003eCurrently, several techniques have been developed to detect viruses[2, 18, 20]. LAMP, simplex RT-PCR, uniplex real time RT-PCR, and ELISA have been developed for the detection of areca viruses[17, 30]. Multiplex RT-PCR amplifying multiple nucleic acid fragments in one reaction enables rapid and sensitive identification of several viruses simultaneously in a single assay[1, 9, 22], which greatly reduces cost and increases the effciency of viral surveys[5, 10]. To date, multiplex RT-PCR has been widely used to detect viruses in wheat, maize, soybeans, and rice[7, 16, 23, 29].\u003c/p\u003e\n\u003cp\u003eIn this study, three specific primer pairs that can amplify DNA fragments of different sizes were designed according to genomic sequences of APV1, ANRSV and ANSSV. After optimizing RT-PCR conditions, an efficient multiplex RT-PCR assay was established and validated for the simultaneous of APV1, ANRSV and ANSSV infecting areca plants.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cb\u003ePlant materials\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFresh leaves from Areca grown in greenhouses at the Hainan University (Hai Nan, China), which were confirmed to be co-infected with APV1, ANRSV and ANSSV by RT-PCR and sequencing were used to set up and optimize the multiplex RT-PCR assay.\u003c/p\u003e\u003cp\u003e\u003cb\u003eRNA extraction and reverse transcription\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was isolated from the areca leaf samples as described before[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. First strand cDNA was synthesized from 5 \u0026micro;g total RNA using a RevertAi (#K1622) reverse transcription kit (Thermo Fisher Scientific, Shanghai, China) in a 20 \u0026micro;L reaction mixture with random primers, according to the manufacturer,s protocol.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDesign of virus‑specific primers\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe genomic sequences of APV1 (accession numbers: OM687513.1, MK956940.2, MW316024.1, MW316023.1, MW316022.1, MW316019.1, MW316013.1, NC_027121.1, and KR349464.1), ANRSV (accession numbers: MZ209276.1, MW282956.1, NC_055501.1, MH425894.1, MH425890.1, MH395393.1, MH395380.1, MH395376.1, and MH395371.1), and ANSSV (accession numbers: MH330686.1) were obtained from GenBank. Nucleotide sequence alignment was performed using ClustalW implemented in MEGA X[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], and conserved regions of each virus were identified. Virus-specific primers were designed based on the identified conserved regions of each virus using Primer Premier 5.0 software (Premier Bio-soft International, Palo Alto, CA).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvaluation of primer specificity\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo evaluate the specificity of each primer pair, uniplex RT-PCR assays were conducted using the Multi PCR Kit (Sangon Biotech, Shanghai, China). Each reaction was performed in a total volume of 50 \u0026micro;L containing 2.0 \u0026micro;L of each primer (2 \u0026micro;M), 2 \u0026micro;L of cDNA template, 25 \u0026micro;L of 2\u0026times; SanTaq PCR Mix, and 21 \u0026micro;L of double-distilled water. The thermal cycling conditions were as follows: initial denaturation at 94\u0026deg;C for 5 min; followed by 35 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 54\u0026deg;C for 60 s, and extension at 72\u0026deg;C for 60 s; with a final extension at 72\u0026deg;C for 8 min. PCR products were electrophoresed on a 2% agarose gel in 0.5\u0026times; TBE buffer and visualized under UV illumination.\u003c/p\u003e\u003cp\u003eTo further verify the specificity of each primer set, selected PCR products were purified and cloned into the pMD19-T vector (TaKaRa, Dalian, China) for sequencing. The obtained sequences were aligned with reference sequences in the GenBank database using DNAMAN 5.0 software (Lynnon Biosoft, San Ramon, CA, USA).\u003c/p\u003e\u003cp\u003e\u003cb\u003eOptimization of multiplex RT‑PCR assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe multiplex RT-PCR assay was optimized by adjusting the annealing temperature and the number of amplification cycles. A range of annealing temperatures (53.4\u0026deg;C, 54.3\u0026deg;C, 55.2\u0026deg;C, 56.3\u0026deg;C, 57.3\u0026deg;C, 58.2\u0026deg;C, 58.9\u0026deg;C, and 59.5\u0026deg;C) was tested to determine the optimal condition for simultaneous amplification. Additionally, different cycle numbers (20, 25, 30, 35, and 40) were evaluated. The PCR products were analyzed by agarose gel electrophoresis as described above. The conditions yielding distinct, non-overlapping bands of expected sizes were selected for the final multiplex RT-PCR protocol.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers for uniplex RT-PCR assay and multiplex RT-PCR assay\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"9\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVirus\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePrimer sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLength (nt)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTm (℃)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGC%\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePosition(nt)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eProducts (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003eTarget gene\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eAPV1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAPV1-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATCGCTAAATATTATGGATAGACTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e52\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e12768\u0026ndash;12792\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e938\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAPV1-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTATTCAGAAGCATAAGATTGTGACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e31\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e13681\u0026ndash;13705\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eANRSV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eANRSV-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAAGTGAAAGCCTGGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e56\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e8705\u0026ndash;8720\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e527\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eANRSV-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCATGTTCATACTCACTAACATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e39\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e9209\u0026ndash;9231\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eANSSV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eANSSV-F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCAACAGAAGACCAAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e18\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e8691\u0026ndash;8708\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e250\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eCP\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eANSSV-R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCCTCAATCCAACTGACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e8922\u0026ndash;8940\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e\u003cb\u003eSensitivity of multiplex PCR assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo compare the sensitivity of the multiplex RT-PCR assay with that of uniplex RT-PCR, 10-fold serial dilutions of cDNA derived from areca samples co-infected with APV1, ANRSV, and ANSSV were prepared and used as templates. The amplification reactions were performed under the optimized conditions. PCR products were analyzed by 2% agarose gel electrophoresis in 0.5\u0026times; TBE buffer, as described above.\u003c/p\u003e\u003cp\u003e\u003cb\u003eSurvey of areca viruses by multiplex RT‑PCR assay\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA total of 414 areca palm leaf samples were collected from different regions of China and analyzed using the developed multiplex RT-PCR assay for the detection of Areca palm velarivirus 1 (APV1), Areca palm necrotic ringspot virus (ANRSV), and Areca palm necrotic spindle-spot virus (ANSSV) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv class=\"BlockQuote\"\u003e\n \u003cp\u003e\u003cstrong\u003eSpecificity and compatibility of primer pairs\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eIn the uniplex RT-PCR assays, each primer pair specifically amplified a single fragment of the expected size corresponding to APV1, ANRSV, or ANSSV without any non-specific products (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA\u0026ndash;C). In the multiplex RT-PCR assay, all three target fragments were successfully amplified in a single reaction using the mixed primer set, and no non-specific amplification was observed (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD).To further verify the specificity and compatibility of the designed primer pairs, the amplified fragments were individually cloned and sequenced. Sequence alignment analysis revealed that the amplicons shared high nucleotide identity with the corresponding reference sequences of APV1, ANRSV, and ANSSV in the GenBank database. No amplification product was observed in the negative control, indicating the absence of non-specific amplification and confirming the reliability of the assay. These results confirmed that the primers were specific and compatible, and could be reliably used for the simultaneous identification of the three areca-associated viruses in the developed multiplex RT-PCR system.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eOptimization of multiplex RT-PCR conditions and evaluation of primer concentrations\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo improve amplification efficiency and balance band intensities among target fragments, primer concentrations were adjusted based on the brightness of specific bands observed after electrophoresis. The final optimized primer volumes per 25 \u0026micro;L reaction were 0.5 \u0026micro;L for both APV1-F and APV1-R, 0.4 \u0026micro;L for both ANRSV-F and ANRSV-R, and 1.0 \u0026micro;L for both ANSSV-F and ANSSV-R.\u003c/p\u003e\n \u003cp\u003eThe multiplex RT-PCR conditions were further optimized by adjusting the annealing temperature and the number of amplification cycles. Eight annealing temperatures (53.4\u0026deg;C, 54.3\u0026deg;C, 55.2\u0026deg;C, 56.3\u0026deg;C, 57.3\u0026deg;C, 58.2\u0026deg;C, 58.9\u0026deg;C, and 59.5\u0026deg;C) were tested in gradient PCR assays. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, amplification performed at temperatures between 53.4\u0026deg;C and 57.3\u0026deg;C consistently yielded three distinct, virus-specific bands. However, notable differences in band intensities were observed across the temperature range for individual targets, with 53.4\u0026deg;C producing the most balanced and robust signal.\u003c/p\u003e\n \u003cp\u003eAdditionally, five different cycle numbers (20, 25, 30, 35, and 40) were evaluated to determine the optimal number of amplification cycles (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Amplified products from 35 and 40 cycles clearly exhibited the three expected bands without non-specific amplification, suggesting that 35 cycles provided a suitable balance between sensitivity and amplification efficiency.\u003c/p\u003e\n \u003cp\u003eThe final reaction system for the multiplex RT-PCR was 25 \u0026micro;L, comprising 15 \u0026micro;L of Premix Taq (TaKaRa Taq Version 2.0 plus dye), virus-specific primers at the optimized concentrations (APV1-F/R: 0.5 \u0026micro;L each; ANRSV-F/R: 0.4 \u0026micro;L each; ANSSV-F/R: 1.0 \u0026micro;L each), 3 \u0026micro;L of cDNA, and ddH₂O to bring the total volume to 25 \u0026micro;L. The optimized thermal cycling conditions were as follows: 94\u0026deg;C for 5 min; followed by 35 cycles of 94\u0026deg;C for 30 s, 53.4\u0026deg;C for 60 s (annealing and extension), and a final extension at 72\u0026deg;C for 10 min. A 6 \u0026micro;L aliquot of each amplified product was subjected to electrophoresis on a 2% agarose gel in 0.5\u0026times; TBE buffer.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSensitivity of the multiplex RT-PCR assay\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo evaluate the detection sensitivity of the multiplex RT-PCR assay, cDNA derived from areca samples co-infected with APV1, ANRSV, and ANSSV was subjected to 10-fold serial dilutions (from 10\u003csup\u003e0\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e), and both uniplex and multiplex RT-PCR assays were performed. PCR products were analyzed by agarose gel electrophoresis as described above. The results showed that APV1 could be detected at a dilution of 10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003e, while ANRSV and ANSSV were detectable up to 10\u003csup\u003e\u0026minus;\u0026thinsp;2\u003c/sup\u003e (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). These findings indicate that the developed multiplex RT-PCR assay has high sensitivity, comparable to that of the corresponding uniplex RT-PCR assays.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"BlockQuote\"\u003e\n \u003cp\u003e\u003cstrong\u003eApplication of multiplex RT‑PCR assay in survey of areca viruses\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo investigate the epidemiological characteristics of \u003cem\u003eAreca palm velarivirus 1\u003c/em\u003e (APV1), \u003cem\u003eAreca palm necrotic ringspot virus\u003c/em\u003e (ANRSV), and \u003cem\u003eAreca palm necrotic spindle-spot virus\u003c/em\u003e (ANSSV) in areca-growing areas of Hainan Province.A total of 414 areca palm leaf samples exhibiting typical viral disease symptoms were collected from major cultivation areas in Hainan Province (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). Laboratory testing using the established multiplex RT-PCR assay revealed the detection rates of the three viruses, as well as the occurrence of mixed infections (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eRepresentative electrophoresis results are shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, clearly demonstrating the specific amplification bands for each virus.To evaluate the applicability of the established multiplex RT-PCR assay, 414 areca palm samples collected from different regions of Hainan Province were tested for the presence of APV1, ANRSV, and ANSSV. In addition, a total of 414 areca palm samples were analyzed using the multiplex RT-PCR method to detect APV1, ANRSV, and ANSSV. The results showed that 98 samples (23.67%) were infected with at least one virus. Among them, APV1 was the most prevalent, detected in 94 samples (22.71%), followed by ANRSV in 16 samples (3.86%) and ANSSV in 1 samples (0.2%) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).Further analysis revealed that 92 samples (22.22%) were infected with a single virus, while mixed infections involving two or three v iruses were found in 6 samples (3.86%).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab2\" border=\"1\" class=\"fr-table-selection-hover\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDetection of three viruses in areca plants from different geographic regions of Hainan using multiplex RT-PCR assay\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eLocation\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eNO. of samples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo. of positive samples and positive rate (%)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAPV1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eANRSV\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eANSSV\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSanya\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7(30.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLingshui\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e12(52.17)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(0.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBaoting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e12(52.17)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4(17.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1(04.34)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLedong\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4(17.39)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(0.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDongfang\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3(13.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWanning\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e9(39.13)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6(26.09)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eQionghai\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6(26.09)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3(13.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eQiongzhong\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7(30.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTunchang\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8(34.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWenchang\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7(30.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDingan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e8(34.78)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3(13.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eWuzhishan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3(13.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHaikou\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1(08.69)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChengmai\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1(04.34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLingao\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1(04.34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDanzhou\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBaisha\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1(04.34)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eChangjiang\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0(00.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDesigning and selecting appropriate primer combinations is critical for establishing an efficient multiplex RT-PCR detection system[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In this study, virus-specific primers were designed based on highly conserved genomic regions of each virus. The final primer set successfully amplified distinguishable products of the expected sizes\u0026mdash;938 bp for APV1, 527 bp for ANRSV, and 250 bp for ANSSV. The size differences of over 100 bp enabled clear separation of the three bands on a 2% agarose gel, with no visible non-specific amplification. A lower agarose concentration would reduce resolution and potentially hinder detection sensitivity; thus, a 2% agarose gel was used to ensure clear differentiation of target amplicons.\u003c/p\u003e\u003cp\u003eGiven the potential inhibitory effect of multiple primer sets within a single reaction on amplification efficiency and specificity, PCR conditions were optimized to improve assay performance. Optimization of annealing temperature and cycling number revealed that the highest amplification efficiency for all three targets occurred at 53.4\u0026deg;C, and no additional gain was observed beyond 35 cycles (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Accordingly, 53.4\u0026deg;C and 35 cycles were adopted as the optimal conditions for the multiplex RT-PCR assay. Assay sensitivity is another key criterion for evaluating the performance of multiplex systems. Sensitivity testing showed that the detection limits of the multiplex RT-PCR assay were generally comparable to those of uniplex RT-PCR. Although there was a 10-fold reduction in sensitivity for APV1 detection in the multiplex setting, this modest decline is consistent with results reported in similar studies[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This discrepancy may be partly due to competition in multiplex RT-PCR assay for key reactants, such as Taq polymerase and dNTPs.\u003c/p\u003e\u003cp\u003eViral infection represents a major constraint in areca palm cultivation. Using the developed multiplex RT-PCR assay, a total of 414 areca leaf samples collected from different regions of Hainan were tested. The results indicated that 98 samples (23.67%) were infected with at least one of the three viruses, and 3.86% showed coinfection. In this study, one areca sample was found to be simultaneously infected with APV1, ANRSV, and ANSSV. Given that previous studies have suggested a very low likelihood of ANRSV and ANSSV co-infecting the same leaf tissue, this result appears to be unusual. The corresponding PCR bands were relatively faint, indicating the possibility of a false positive, although low-level co-infection cannot be entirely ruled out. This observation highlights the need for further validation and offers a new perspective for investigating mixed infections among areca-associated viruses. Virus detection results from areca samples indicated significant regional variation in the incidence of areca yellowing disease across Hainan Island. The disease is currently spreading in major areca-producing areas such as Wanning, Lingshui, and Qionghai, with higher infection rates observed in the eastern and central regions. Baoting, Lingshui, Wanning, and Qionghai showed the highest infection levels, with an average incidence of 46.73%. Spatially, the severity of the disease decreases from east to west, with milder cases reported in western areas such as Danzhou and Baisha.\u003c/p\u003e\u003cp\u003ePrevious studies have shown that APV1 was transmitted by both Ferrisia virgata and Pseudococcus cryptus mealybugs and caused YLD symptoms in betel palm seedlings The warmer and more humid climate in the eastern and central regions is more conducive to the reproduction of mealybug populations and the spread of the virus. Moreover, these regions have a longer history and larger scale of areca cultivation, which may further contribute to the higher disease incidence. Although areca cultivation has expanded in the western regions in recent years, the overall planting area remains smaller compared to the east and central areas, potentially reducing the risk of disease transmission. Notably, with the rapid expansion of areca cultivation in Hainan, yellowing disease and other viral infections are becoming increasingly severe, posing a significant threat to the industry. The spread of these diseases has emerged as a critical bottleneck restricting the sustainable development of the areca industry.\u003c/p\u003e\u003cp\u003eThe high infection rate may be attributed to the widespread use of virus-infected seedlings for propagation and the lack of effective virus management strategies. To mitigate the spread and impact of areca-associated viruses, it is essential to adopt virus-free planting materials, cultivate resistant or tolerant varieties, and implement sensitive detection methods for routine surveillance. The multiplex RT-PCR assay developed in this study provides a rapid, reliable, and cost-effective tool for the simultaneous detection of APV1, ANRSV, and ANSSV, and holds promise for future epidemiological investigations and disease control programs in areca cultivation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, a reliable and efficient multiplex RT-PCR assay was developed for the simultaneous detection of three economically important areca-associated viruses: \u003cem\u003eAreca palm velarivirus\u003c/em\u003e 1 (APV1), \u003cem\u003eAreca palm necrotic ringspot virus\u003c/em\u003e (ANRSV), and \u003cem\u003eAreca palm necrotic spindle-spot virus\u003c/em\u003e (ANSSV). Virus-specific primers targeting conserved genomic regions were carefully designed, and reaction conditions\u0026mdash;including primer concentrations, annealing temperature, and cycle number\u0026mdash;were systematically optimized. The final assay demonstrated high specificity and sensitivity, with clear and distinguishable amplification products for each virus.\u003c/p\u003e\u003cp\u003eField application of the multiplex RT-PCR system revealed a high incidence of single and mixed infections in symptomatic areca samples collected from major growing regions in China. These findings highlight the widespread occurrence of viral pathogens in areca plantations and underscore the urgent need for effective disease monitoring and management strategies. The optimized and field-validated multiplex RT-PCR assay established in this study enables rapid and accurate detection of three major areca viruses. This method provides an efficient and reliable tool for virus monitoring and disease management in areca cultivation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis article does not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInformed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis manuscript has not been published or presented elsewhere in part or in entirety, and is not under consideration by another journal. All the authors have approved the manuscript and agree with submission to your esteemed journal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Sanya Yalong Bay Elite Talent Project (grant no. RZ2300007007).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSYW conceived and designed the experiment; Conduct experiments among SYW, KXS, LZ, LZ, and PZ. SYW and KXS. Analyze the data; KXS Write a thesis; SYW and LZ revised the paper. All the authors discussed the results and contributed to the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by the Sanya Yalong Bay Elite Talent Project (Grant No. RZ2300007007), which provided essential support for the completion of this work. We also extend our sincere gratitude to the colleagues and technical staff who contributed to the experimental setup and data collection. Their assistance, while not qualifying for authorship, was invaluable to the success of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials The complete APV1、ANRSV and ANSSV genome sequences were deposited in GenBank with respective accession numbers MW316004\u0026ndash;MW316024、MZ209276.1-MH395371.1、MH330686.1and the datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBaggio F, Hetzel U, Pr\u0026auml;hauser B, Dervas E, Michalopoulou E, Thiele T, Kipar A, Hepojoki J (2023) A Multiplex RT-PCR Method for the Detection of Reptarenavirus Infection. Viruses 15\u003c/li\u003e\n\u003cli\u003eBoonham N, Kreuze J, Winter S, van der Vlugt R, Bergervoet J, Tomlinson J, Mumford R (2014) Methods in virus diagnostics: from ELISA to next generation sequencing. Virus Res 186:20-31\u003c/li\u003e\n\u003cli\u003eCao X, Zhao R, Wang H, Zhang H, Zhao X, Khan LU, Huang X (2021) Genomic diversity of Areca Palm Velarivirus 1 (APV1) in Areca palm (Areca catechu) plantations in Hainan, China. BMC Genomics 22:725\u003c/li\u003e\n\u003cli\u003eCao X, Gao B, Lu J, Wang H, Zhao R, Huang X (2024) Areca palm velarivirus 1 infection caused disassembly of chloroplast and reduction of photosynthesis in areca palm. Frontiers in Microbiology 15\u003c/li\u003e\n\u003cli\u003eChen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res 33:e179\u003c/li\u003e\n\u003cli\u003eChen S, Zhou Y, Ye T, Hao L, Guo L, Fan Z, Li S, Zhou T (2014) Genetic variation analysis of apple chlorotic leaf spot virus coat protein reveals a new phylogenetic type and two recombinants in China. Arch Virol 159:1431-1438\u003c/li\u003e\n\u003cli\u003eCho SY, Jeong RD, Yoon YN, Lee SH, Shin DB, Kang HW, Lee BC (2013) One-step multiplex reverse transcription-polymerase chain reaction for the simultaneous detection of three rice viruses. J Virol Methods 193:674-678\u003c/li\u003e\n\u003cli\u003eDi Serio F, Ambr\u0026oacute;s S, Sano T, Flores R, Navarro B (2018) Viroid Diseases in Pome and Stone Fruit Trees and Koch\u0026apos;s Postulates: A Critical Assessment. Viruses 10\u003c/li\u003e\n\u003cli\u003eFaggioli F, Luigi M (2022) Multiplex RT-PCR. Methods Mol Biol 2316:163-179\u003c/li\u003e\n\u003cli\u003eGoto Y, Fukunari K, Tada S, Ichimura S, Chiba Y, Suzuki T (2023) A multiplex real-time RT-PCR system to simultaneously diagnose 16 pathogens associated with swine respiratory disease. J Appl Microbiol 134\u003c/li\u003e\n\u003cli\u003eHao L, Xie J, Chen S, Wang S, Gong Z, Ling KS, Guo L, Fan Z, Zhou T (2016) A multiple RT-PCR assay for simultaneous detection and differentiation of latent viruses and apscarviroids in apple trees. J Virol Methods 234:16-21\u003c/li\u003e\n\u003cli\u003eHeatubun CD, Dransfield J, Flynn T, Tjitrosoedirdjo SS, Mogea JP, Baker WJ (2012) A monograph of the betel nut palms (Areca: Arecaceae) of East Malesia. Botanical Journal of the Linnean Society 168:147-173\u003c/li\u003e\n\u003cli\u003eKhan LU, Zhao R, Wang H, Huang X (2023) Recent advances of the causal agent of yellow leaf disease (YLD) on areca palm (\u0026lt;i\u0026gt;Areca catechu\u0026lt;/i\u0026gt; L.). Tropical Plants 2:0-0\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Peterson D, Tamura K (2012) MEGA-CC: computing core of molecular evolutionary genetics analysis program for automated and iterative data analysis. Bioinformatics 28:2685-2686\u003c/li\u003e\n\u003cli\u003eKumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol 35:1547-1549\u003c/li\u003e\n\u003cli\u003eLi X, Li Y, Hu W, Li Y, Li Y, Chen S, Wang J (2021) Simultaneous multiplex RT-PCR detection of four viruses associated with maize lethal necrosis disease. J Virol Methods 298:114286\u003c/li\u003e\n\u003cli\u003ePeng W, Liu YJ, Wu N, Sun T, He XY, Gao YX, Wu CJ (2015) Areca catechu L. (Arecaceae): a review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. J Ethnopharmacol 164:340-356\u003c/li\u003e\n\u003cli\u003eRubio L, Galipienso L, Ferriol I (2020) Detection of Plant Viruses and Disease Management: Relevance of Genetic Diversity and Evolution. Front Plant Sci 11:1092\u003c/li\u003e\n\u003cli\u003eSalama HS, Zaki FN, Abdel-Razek AS (2009) Ecological and biological studies on the red palm weevilRhynchophorus ferrugineus(Olivier). Archives Of Phytopathology And Plant Protection 42:392-399\u003c/li\u003e\n\u003cli\u003eSantiago GA, V\u0026aacute;zquez J, Courtney S, Mat\u0026iacute;as KY, Andersen LE, Col\u0026oacute;n C, Butler AE, Roulo R, Bowzard J, Villanueva JM, Mu\u0026ntilde;oz-Jordan JL (2018) Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nat Commun 9:1391\u003c/li\u003e\n\u003cli\u003eWang H, Zhao R, Zhang H, Cao X, Li Z, Zhang Z, Zhai J, Huang X (2020) Prevalence of Yellow Leaf Disease (YLD) and its Associated Areca Palm Velarivirus 1 (APV1) in Betel Palm (Areca catechu) Plantations in Hainan, China. Plant Dis 104:2556-2562\u003c/li\u003e\n\u003cli\u003eXu Y, Yang L, Zhou J, Yang Y, Lu M, Li S (2019) Multiplex RT-PCR to simultaneously detect three viruses that infect peach. Lett Appl Microbiol 69:318-324\u003c/li\u003e\n\u003cli\u003eXue B, Shang J, Yang J, Zhang L, Du J, Yu L, Yang W, Naeem M (2021) Development of a multiplex RT-PCR assay for the detection of soybean mosaic virus, bean common mosaic virus and cucumber mosaic virus in field samples of soybean. J Virol Methods 298:114278\u003c/li\u003e\n\u003cli\u003eYang K, Ran M, Li Z, Hu M, Zheng L, Liu W, Jin P, Miao W, Zhou P, Shen W, Cui H (2018) Analysis of the complete genomic sequence of a novel virus, areca palm necrotic spindle-spot virus, reveals the existence of a new genus in the family Potyviridae. Arch Virol 163:3471-3475\u003c/li\u003e\n\u003cli\u003eYang K, Shen W, Li Y, Li Z, Miao W, Wang A, Cui H (2019) Areca Palm Necrotic Ringspot Virus, Classified Within a Recently Proposed Genus Arepavirus of the Family Potyviridae, Is Associated With Necrotic Ringspot Disease in Areca Palm. Phytopathology 109:887-894\u003c/li\u003e\n\u003cli\u003eYao B, Wang G, Ma X, Liu W, Tang H, Zhu H, Hong N (2014) Simultaneous detection and differentiation of three viruses in pear plants by a multiplex RT-PCR. J Virol Methods 196:113-119\u003c/li\u003e\n\u003cli\u003eYu H, Qi S, Chang Z, Rong Q, Akinyemi IA, Wu Q (2015) Complete genome sequence of a novel velarivirus infecting areca palm in China. Arch Virol 160:2367-2370\u003c/li\u003e\n\u003cli\u003eYu SS, Che HY, Wang SJ, Lin CL, Lin MX, Song WW, Tang QH, Yan W, Qin WQ (2020) Rapid and Efficient Detection of 16SrI Group Areca Palm Yellow Leaf Phytoplasma in China by Loop-Mediated Isothermal Amplification. Plant Pathol J 36:459-467\u003c/li\u003e\n\u003cli\u003eZhang P, Liu Y, Liu W, Massart S, Wang X (2017) Simultaneous detection of wheat dwarf virus, northern cereal mosaic virus, barley yellow striate mosaic virus and rice black-streaked dwarf virus in wheat by multiplex RT-PCR. J Virol Methods 249:170-174\u003c/li\u003e\n\u003cli\u003eZhao G, Shen W, Tuo D, Cui H, Yan P, Tang Q, Zhu G, Li X, Zhou P, Zhang Y (2020) Rapid detection of two emerging viruses associated with necrotic symptoms in Areca catechu L. by reverse transcription loop-mediated isothermal amplification (RT-LAMP). J Virol Methods 281:113795\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Areca palm, Multiplex RT-PCR, APV1, ANRSV, ANSSV","lastPublishedDoi":"10.21203/rs.3.rs-7118616/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7118616/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003eAreca palm velarivirus 1 \u003c/em\u003e(APV1), \u003cem\u003eAreca palm necrotic ringspot virus \u003c/em\u003e(ANRSV), and \u003cem\u003eAreca palm necrotic spindle-spot virus \u003c/em\u003e(ANSSV) are major viral pathogens that cause significant economic losses in areca palm cultivation. Rapid and reliable detection methods are essential for the early diagnosis and management of these viruses in affected regions.\u003c/p\u003e\n\u003cp\u003eIn this study, a one-step multiplex reverse transcription-polymerase chain reaction (multiplex RT-PCR) assay was developed for the simultaneous detection of APV1, ANRSV, and ANSSV. Three pairs of specific primers were designed from conserved genomic regions of each virus, generating amplification products of 938 bp for APV1, 527 bp for ANRSV, and 250 bp for ANSSV. The PCR products were clearly distinguishable by 2% agarose gel electrophoresis. Optimal amplification conditions were determined to be 53.4 °C for annealing temperature and 35 cycles.\u003c/p\u003e\n\u003cp\u003eSubsequently, the established multiplex RT-PCR detection method was applied to areca leaf samples collected from the main areca planting areas in Hainan. This method enabled efficient and accurate identification of single and mixed infections in field samples. Virus detection in areca samples from Hainan Island revealed clear regional differences in disease incidence, with higher rates in the eastern and central regions—particularly Baoting, Lingshui, Wanning, and Qionghai—averaging 46.73%. A decreasing trend in severity was observed from east to west, with milder symptoms in areas like Danzhou and Baisha.\u003c/p\u003e\n\u003cp\u003eTogether, these results demonstrate that the developed multiplex RT-PCR is a sensitive and practical tool for the routine molecular diagnosis and epidemiological investigation of APV1, ANRSV, and ANSSV in areca palms.\u003c/p\u003e","manuscriptTitle":"The title Development of a multiplex RT‑PCR assay for simultaneous detection of Areca palm velarivirus 1, Areca palm necrotic ringspot virus and Areca plam necrotic spindle-spot virus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-05 16:23:26","doi":"10.21203/rs.3.rs-7118616/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"78b08a0c-f38a-4e1b-a666-1bd96f303938","owner":[],"postedDate":"August 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-23T17:27:07+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-05 16:23:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7118616","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7118616","identity":"rs-7118616","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}