Escherichia coli Promotes Myofibroblast Differentiation in Urethral Fibrosis Urethral Stricture in vivo and vitro via regulating TGFβ/Smad Signaling Pathway

Escherichia coli Promotes Myofibroblast Differentiation in Urethral Fibrosis Urethral Stricture in vivo and vitro via regulating TGFβ/Smad Signaling Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Escherichia coli Promotes Myofibroblast Differentiation in Urethral Fibrosis Urethral Stricture in vivo and vitro via regulating TGFβ/Smad Signaling Pathway Xin Wang, Zhenhua Zhang, Yong Guan, Jianghua Zhan, Ming Dong This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6821103/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Urethral stricture in children is a challenging condition to treat, with a high rate of postoperative recurrence. Previous studies based on 16S rRNA and transcriptomic analyses have suggested a positive correlation between urethral stricture and Escherichia coli (E. coli), as well as the transforming growth factor-β (TGF-β)/Smad signaling pathway. Notably, even E. coli strains that do not cause typical urinary tract infection symptoms may still contribute to fibrotic stricture formation. In this study, we employed both in vitro cell culture and in vivo animal experiments to investigate the role of non-pathogenic E. coli in this process.Our results demonstrated that non-pathogenic E. coli promoted local production of TGF-β1 in urethral fibroblasts and rat urethral tissue, altered the ratio of transcription factors Smad2 and Smad3, and induced the release of inflammatory cytokines. This cascade facilitated the transformation of fibroblasts, ultimately leading to urethral stricture.We conclude that the presence of E. coli contributes to urethral fibrosis and stricture by promoting the release of inflammatory cytokines and activating the TGF-β1 signaling cascade, thereby enhancing the activation and proliferation of myofibroblasts responsible for scar formation. Modulation of the microbiota may represent a potential future direction for the prevention and treatment of urethral stricture. urethral stricture hypospadias Escherichia coli fibrosis TGFβ Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Urethral stricture is one of the oldest known urological conditions, characterized by scar formation due to damage to the urethral epithelium or spongy stromal tissue, leading to narrowing of the urethra and difficulty in urination [ 1 ] . In children, urethral stricture is commonly caused by postoperative complications of hypospadias repair, which are relatively difficult to treat. Current treatment approaches include urethral dilation, endoscopic internal urethrotomy, and urethral reconstruction surgery, all of which are associated with a high recurrence rate. Furthermore, the success rate of treating recurrent urethral stricture decreases over time [ 2 ] . Many studies have explored the causes of urethral stricture and the factors contributing to its recurrence, such as the type of initial surgery, stricture length, surgical techniques, and urinary tract infections [ 3 ] . However, even when these clinical factors are controlled, urethral stricture may still occur, suggesting the presence of other contributing factors. Historically, the urethra was considered a sterile environment. However, over the past decade, high-throughput molecular DNA sequencing has proven otherwise: urine, even in the absence of a urinary tract infection, is not a sterile biofluid. It contains a variable microbial profile, and dysbiosis of the urethral microbiome has been implicated in various urological diseases [ 4 ] . Previous research has shown that the microbiome of children with meatal stenosis differs from that of children without stenosis, particularly in cases caused by lichen sclerosus [ 5 ] . Hypospadias-related urethral stricture is the most common cause of pediatric urethral stricture and is more complex to treat, with a high recurrence rate after surgical intervention. However, few studies have explored the role of microbial changes in this condition. In our previous study, we combined 16S rRNA sequencing and transcriptomic analysis to examine the microbial and genetic characteristics of urethral stricture cases following hypospadias surgery. We found that E.coli and the TGFβ/Smad signaling pathway might be associated with the development of urethral stricture. Even non-pathogenic E. coli strains, which did not cause symptoms of urinary tract infection, were able to influence the TGF-β/Smad signaling pathway and ultimately induce fibrosis. Therefore the present study aims to validate these findings through in vivo and in vitro experiments to investigate the mechanisms underlying postoperative urethral stricture in children with hypospadias Methods Bacterial strains The commensal E.coli C600 [ 6 ] (BeNa culture Biotech, HeNan, CHN, BNCC362520)was grown in Tianjin children hospital Laboratory broth statically overnight at 37°C. Cultures were centrifuged for 10 min at 7,500 g at 4°C before being resuspended in sterile phosphate-buffered saline (PBS) to a density of ~ 4 × 10 8 colony‐forming units (CFU)/ml. Isolation and culture of UFs Primary urethral fibroblasts (UFs) were isolated from the urethral submucosa tissues of SD rats as previously described [ 7 ] . Briefly, the urethral mucosa tissues were isolated, washed in phosphate-buffered saline (PBS), cut into 1 mm 3 pieces, seeded in the culture flask and maintained at 37°C in a humidified incubator with 5% CO 2 for 4 h. After full adherence, the culture flask was added with 5 mL of Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Gibco). The culture medium was changed every 3 days. When the cells reached 80% confluency, they were isolated by trypsinization and further passaged. The UFs at passages 3–5 was used for subsequent experiments. Animals Male Sprague Dawley (SD) rats (8–9 weeks, 260–320 g) were housed under standard conditions (temperature 23 ± 2°C, humidity 50–65%, 12-h light/dark cycle) with free access to food and water. The animals were allowed for 1 week acclimation before the experiments. All animal experiments were conducted following the NIH Guide for the Care and Use of Laboratory Animals and approved by the Ethics Committee of Tianjin children hospital. Each effort was made to minimize animals' suffering. After anesthesia with intravenous pentobarbital (30 mg/kg), rats were randomly divided into (A)sham, saline injection to urethra and treated with PBS(Surgery + PBS, n = 5); (B) urethral fibrosis group, TGFβ 10µg injection to urethra and treated with PBS༈Surgery + TGFβ, n = 5༉;(C) urethral fibrosis treated with E.coli group (Surgery + TGFβ + E.coli, n = 5) for the study. Urethral fibrosis was induced in rats with PBS and TGFβ1 local injection and partial incisions as described previously [ 8 ] . The method of intraurethral administered E.coli in rat model was described previously [ 9 ] . All the rats were sacrificed after 4 weeks and the urethral tissues were harvested for further analysis. Establishment of coculture of cells and E.coli The co-culture of cells and E.coli was described previously [ 10 ] . Briefly, prepared a concentration of 3.0×10 6 cells/ml cell suspension in the six well cell culture plate, discard the cell culture medium, add PBS solution for three times, and then put the 0.4 µM Transwell in the well of the culture plate. Then each well was divided into the upper chamber and the lower chamber. The upper chamber is the upper chamber, and the lower chamber is the inner chamber of the culture plate. Add new cell culture medium in the lower chamber. It is appropriate to just contact the basement membrane of the Transwell cell, which is about 2 ml. Add E.coli diluted with the cell culture medium in the upper chamber, with a final concentration of 10 12 CFU/ml at 37 ℃, 5% CO 2 , and co culture for 4 h, 12 and 24 h, respectively. Then removed Transwell cell, collected the bacterial suspension, centrifuge at 12,000 R/min for 10 min, discard the supernatant, separate the bacteria, add PBS solution for three times, calculated the final concentration of the bacterial solution. The co-culture cells were divided into (A)control, fibroblasts treated with PBS(fibroblasts + PBS, n = 5); (B) TGFβ group, fibroblasts treated with TGFβ 20ng/ml,༈fibroblasts + TGFβ, n = 5༉;(C) E.coli group, fibroblasts treated with E.coli (fibroblasts + E.coli, n = 5) for the study. CCK-8 and Wound Healing Assay Cell proliferation was measured using the cell counting kit-8 (CCK-8) assay (Bio sharp, BS350B, China). The CCK-8 reagent (10 µL) was added to each well and incubated for 2h and then transferred to a 96-well plate to measure absorption at 450 nm. Proliferation rates were evaluated at 0, 24, and 48h after co-culturing with sEVs. The migratory ability of cells was measured using the wound healing assay. Fibroblasts were grown in a 12-well plate. After 24 h, a 10µL pipette tip was used to scratch the plates in vertical directions. Cell migration into the scratched area was observed under a microscope at 0, 24, and 48. ELISA assays The samples were then subjected to ELISA Rat TNFα、IL-1、IL-6 immunoassays ELISA Kits (cat. no. D4050, D1300B, DFNAS0, DTA00D, R&D Systems, # MBS761127, BioSource, respectively) Ultrasound assessment Ultrasound was performed on live animals using the Vevo 2100 system [ 11 ] to evaluate signs of fibrosis of the urethra. Scans were performed 4 weeks after surgery. Real time quantitative polymerase chain reaction Total RNA extraction from co-culture cells and rat model tissues was performed using TRIzol reagent (Invitrogen). The iScript cDNA Kit (Bio-Rad) was employed for cDNA preparation. Real time quantitative polymerase chain reaction (RT‐qPCR) was conducted with SYBR Premix Ex TaqTM (Takara) using a Step OnePlus Real‐Time PCR system (Applied Biosystems). Normalized to β-Actin, the relative expression of α-SMA, Collagen I, Smad2, Smad3, Smad4 mRNAs was evaluated using the 2 −ΔΔCt method. Primer sequences are listed in Table 1 . Table 1 Primer sequrences Genes sequence(5’-3’) Size(bp) β-Actin F CCCATCTATGAGGGTTACGC 150 R TTTAATGTCACGCACGATTTC collagen I F CCAGCCGCAAAGAGTCTACA 175 R CAGGTTTCCACGTCTCACCA α-SMA F ACCATCGGGAATGAACGCTT 191 R CTGTCAGCAATGCCTGGGTA Smad2 F GCCGCCCGAAGGGTAGAT 164 R TTCTGTTCTCCACCACCTGC Smad3 F CGAGCTGCCTCTGTGCG 297 R CCATCCAGTGACCTGGGGAT Smad4 F TTCACTGCTCAGCCAGCTAC 161 R TTCACTGCTCAGCCAGCTAC Western blotting Protein isolation from co-culture cells and rat model tissues was conducted using radio immunoprecipitation assay buffer (Solarbio). Protein concentration was quantified with a bicinchoninic acid assay kit (Beyotime). Protein samples (20 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted onto polyvinylidene fluoride membranes (Beyotime). After blocking with 5% defatted milk, the membranes were incubated at 4°C overnight with primary antibodies as follows: anti‐Smad2/3, anti-pSmad2/3, anti-Smad4, anti-αSMA, anti‐collagen I and GAPDH (all from Abcam) followed by incubating with the HRP‐conjugated goat anti‐rabbit secondary antibody (ab7090, Abcam) at room temperature for 2h. Lastly, blot signaling was visualized using an enhanced chemiluminescence kit (Solarbio), and ImageJ software (NIH, Bethesda, MD) was utilized for relative protein expression quantitation. Histological analysis of rat urethral tissue Penile tissues encompassing the sites of incision and injection were harvested, fixed, and further processed for histology. Immunohistology-chemistry (IHC), Masson's trichrome (MT) staining, and hematoxylin and eosin (H&E) procedures were performed according to a standard protocol [ 12 ] . Statistical analysis Organ bacterial loads and IHC quantification were compared using the nonparametric Mann–Whitney U test. All other comparisons were made using an unpaired t test. p values < .05 were considered significant. Result The E. coli promotes myofibroblast differentiation in vivo To determine whether E. coli promote Myofibroblast Differentiation as TGFβ on Rat urethral fibroblasts (UFs), we firstly evaluated TGFβ1 and E. coli effect on cell proliferation. E. coli and TGFβ didn’t suppress cell proliferation of UFs (Fig. 1 A). To examine in more details about the effect of E. coli on fibroblasts, we performed in vitro assays to examine changes in the behavior and biochemical phenotype of these cells. Scratch wound assays demonstrated that fibroblasts of E.coli and TGFβ treatment group exhibited significantly increased cell migration, when compared with those of the control group. Cells of the E.coli group exhibited a significant increase in migration (Fig. 1 B,C). In addition, analysis of fibroblasts culture supernatants by ELISA revealed that levels of secreted TNFα、IL-1 and IL-6 were significantly increased in the E.coli and TGFβ treated group (Fig. 1 D,E,F). The fibrosis model was validated by quantitative Real-time PCR analysis, which demonstrated that TGFβ and E.coli promoted increase in Smad2, Smad3, Smad4, α-SMA and collagen I. (Fig. 2 A). Similarly, this model could be used to examine myofibroblast differentiation. Western blot analysis revealed that the expression of Smad2/3, pSmad2/3, Smad4 and αSMA, collagen I was also significantly up-regulated in fibroblasts of E.coli and TGFβ group, indicating the induction of a myofibroblast phenotype via TGFβ/Smad pathway. (Fig. 2 B) E. coli demonstrate enhanced fibrosis in a rat model of urethral stricture To evaluate the role of E. coli in the regulation of urethral stricture formation during wound healing, we used a TGFβ1-dependent rat model of urethral stricture disease. In this model, animals have surgical incisions made to the urethra and treated with TGFβ and PBS. The E.coli group rat was intraurethral administered by E.coli. Using this model, we compared the effects of E.coli on the pathogenesis of urethral stricture in vivo. We evaluated the degree of urethral stricture by urethral ultrasound. 4 weeks after treatment, compared with the PBS group, urethral stricture was more severe in the TGFβ1 and E.coli groups (Fig. 3 ). Next, we performed a histological assessment of urethral tissue sections obtained from rats with PBS, TGFβ and E.coli-induced urethral stricture. H&E (Fig. 4 A) and MT (Fig. 4 B) staining of urethral tissues also reveal the presence of dense collagen fibers in the spongious urethra of animals in the TGFβ and E.coli group. In contrast, there was only mild submucosal urethral fibrosis in tissues of the PBS treated group. We assessed the expression of αSMA by IHC and found a significant increase in the expression of this protein in the urethral tissues of animals in the TGFβ treated group and E.coli treated group when compared with those in the PBS treated group (Fig. 4 C). E.coli promotes myofibroblast differentiation and inflammation in rats via regulating TGFβ/Smad To test whether E. coli contributes to the fibrosis and inflammation. The ELISA analysis confirmed that TNF-α, IL-6, IL-1 expression was significantly decreased in rat model with PBS, when compared with TGFβ group and E.coli group in vivo. And the expression was significant increase in rat model with E.coli when compared TGFβ group (Fig. 5A). The real-time PCR analysis confirmed that the collagen I、Smad2、Smad3、Smad4、α-SMA mRNA expression was significantly decreased in Rat model with PBS, when compared with TGFβ group and E.coli group in vivo (Fig. 5B). And the PBS group protein expression of α-SMA, Collagen I, Smad2/3、pSmad2/3 was significant decrease than TGFβ and E.coli group in vivo. (Fig. 5C) Discussion In previous studies, it has been well established that co-culturing fibroblasts with bacteria induces fibrosis, and this method is now widely applied [ 10 ] . Based on this, we established a co-culture model of E.coli and rat urethral fibroblasts in this study to explore the role and mechanisms of bacterial-induced fibrosis. In the scratch assay, the cell migration ability of both the TGF-β-induced fibrosis group and the E. coli group was significantly higher than that of the control group, suggesting that E. coli influences the functional state of fibroblasts. This finding was further confirmed through PCR and Western blot analyses. The results from Real-time PCR showed that, compared to the control group, under the influence of TGF-β, the transcription levels of α-SMA and Collagen I, classical markers of fibrosis were significantly elevated. A similar transcriptional change was observed in the E. coli group. The downstream proteins of TGF-β, particularly Smad family members Smad2, Smad3, and Smad4, exhibited similar patterns, indicating that E. coli may exert its effect through the TGF-β/Smad signaling pathway, influencing the activation of fibroblasts. In the animal experiments, we adopted a urethral microbial infusion model [ 9 ] and a rat post-surgery urethral stricture model, based on previous studies involving TGF-β-induced fibrosis [ 13 ] . We used small animal ultrasound to confirm the urethral stricture, and histological analyses using HE staining, Masson's trichrome staining, and immunohistochemical detection of α-SMA were used to determine the degree of stricture among the different groups. The results showed that the control group had the least severe stricture, while the model group and the E. coli co-culture group had the most severe stricture. ELISA results revealed that the expression levels of TNF-α, IL-6, and IL-1 were positively correlated with the severity of the stricture. These pro-inflammatory cytokines play a crucial role in wound healing. Through PCR and Western blot, we clearly observed the activation of the TGF-β/Smad signaling pathway and tissue fibrosis, consistent with the findings in the cell culture experiments. In previous studies on urethral stricture, the TGF-β/Smad pathway has also been identified as a central pathway in stricture-related fibrosis [ 14 ] . E. coli, a single-cell organism essential to the human body, was first discovered by Escherich in 1885. For a long time, it was considered a non-pathogenic bacterium and part of the normal intestinal microbiota. However, by the mid-20th century, it was recognized that certain serotypes of E. coli could be pathogenic to both humans and animals. Previous reports have indicated that pathogenic E.coli can cause lower urinary tract symptoms and prostatic fibrosis [ 15 ] , which also involves the TGF-β/Smad signaling pathway. This suggests that certain E.coli species or their components may trigger the activation of the TGF-β/Smad signaling pathway, leading to fibrosis. In another study on epididymal fibrosis caused by epididymitis, researchers co-cultured epididymal cells with both pathogenic and non-pathogenic E. coli , and both groups led to varying degrees of fibrosis. Moreover, pro-inflammatory cytokines TNF-α, IL-6, and IL-1 were elevated compared to the control group [ 16 ] . This demonstrates that non-pathogenic Escherichia species can also affect host immune function, cytokine release, and fibrosis. In our study, both in vivo and in vitro experiments showed increased levels of pro-inflammatory cytokines TNF-α, IL-6, and IL-1 in the E. coli group. These cytokines play key roles in the processes of wound healing and fibrosis. Therefore, it can be concluded that specific bacterial species (such as Escherichia coli ) or their components may, to some extent, activate urethral inflammation and TGF-β/Smad-induced fibrosis, ultimately leading to urethral stricture. Even non-pathogenic Escherichia coli strains that do not cause symptoms, or commensal gut bacteria, may lead to fibrosis and urethral stricture once they invade the urethra. This conclusion suggests that, during diagnosis and treatment, the preventive use of antibiotics could be considered to reduce the risk of such events—though further clinical research is needed to support this approach. Additionally, measures can be taken to prevent the migration of gut bacteria to the urethra, such as proper use of diapers to avoid cross-contamination of microbiota. Future studies may also explore the potential role of probiotics in preventing urethral fibrosis and stricture. This study adds to the understanding of possible triggers for urethral stricture fibrosis and offers new perspectives for addressing this type of disease. Conclusion This study demonstrates that E.coli can enhance inflammatory responses and fibroblast activation, thereby significantly increase urethral tissue fibrosis and urethral stricture. Mechanistically, E.coli plays an important role in TGFβ/Smad signal pathway mediated tissue fibrosis. Our current findings highlight potential new targets for the clinical treatment of stenosis and recurrence after urethrotomy. Declarations Acknowledge: Author contributions Xin Wang performed research, analyzed data, and wrote the manuscript; Zhenhua Zhang performed research, wrote and edited the manuscript; Yong Guan establish the animal model. Jianghua Zhan and Ming Dong coordinated the project. All authors gave final approval of the manuscript. Data availability statement All data generated or analyzed during the present study are included in this article. Ethical statement All animal experiments were conducted under animal ethical respect and were authorized by the Tianjin Children Hospital of Tianjin University. Funding Statement This work was supported by the Tianjin Science and Technology Program (21JCYBJC01310) to Xin Wang, Tianjin Youth Medical New Talent Project (TJSQNYXXR-D2-069) to Xin Wang, and the Tianjin Key Medical Discipline (Specialty) Construction Project (TJYXZDXK-040A). Beijing science and technology innovation medical development foundation (KC2023-JX-0288-PQ87) to Ming Dong, Conflict of interests All authors declare that they have no conflict of interests. References DORNBIER R A, KIRSHENBAUM E J, NELSON M H, et al. Socioeconomic and patient-related factors for the management of male urethral stricture disease [J]. World J Urol, 2019, 37(11): 2523-31. KAPLAN G W. Urethral strictures in children [J]. Curr Opin Urol, 2012, 22(6): 462-6. ISSACK F H, HASSEN S M, TEFERA A T, et al. Short-term recurrence rate of male urethral stricture and its predictors after treatment with optical internal urethrotomy: Prospective Cohort Study at a tertiary center in Ethiopia [J]. Ann Med Surg (Lond), 2023, 85(10): 4715-9. MAGISTRO G, STIEF C G. The Urinary Tract Microbiome: The Answer to All Our Open Questions? [J]. Eur Urol Focus, 2019, 5(1): 36-8. JAMIL M L, PERECMAN A, SHERMAN A, et al. Urinary microbiome differences between lichen sclerosus induced and non-lichen sclerosus induced urethral stricture disease [J]. World J Urol, 2023, 41(9): 2495-501. APPLEYARD R K. Segregation of New Lysogenic Types during Growth of a Doubly Lysogenic Strain Derived from Escherichia Coli K12 [J]. Genetics, 1954, 39(4): 440-52. AN N, PENG J, HE G, et al. Involvement of Activation of Mitogen-Activated Protein Kinase (MAPK)/Extracellular Signal-Regulated Kinase (ERK) Signaling Pathway in Proliferation of Urethral Plate Fibroblasts in Finasteride-Induced Rat Hypospadias [J]. Med Sci Monit, 2018, 24: 8984-92. SANGKUM P, GOKCE A, TAN R B, et al. Transforming Growth Factor-beta1 Induced Urethral Fibrosis in a Rat Model [J]. J Urol, 2015, 194(3): 820-7. ASAHARA T, NOMOTO K, WATANUKI M, et al. Antimicrobial activity of intraurethrally administered probiotic Lactobacillus casei in a murine model of Escherichia coli urinary tract infection [J]. Antimicrob Agents Chemother, 2001, 45(6): 1751-60. JU Z, PAN H, QU C, et al. Lactobacillus rhamnosus GG ameliorates radiation-induced lung fibrosis via lncRNASNHG17/PTBP1/NICD axis modulation [J]. Biol Direct, 2023, 18(1): 2. HAKIM L, ENDO M, FEOLA A, et al. High-frequency micro-ultrasound: a novel method to assess external urethral sphincter function in rats following simulated birth injury [J]. Neurourol Urodyn, 2015, 34(3): 264-9. CASTIGLIONE F, HEDLUND P, VAN DER AA F, et al. Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie's disease [J]. Eur Urol, 2013, 63(3): 551-60. ZHOU L, YANG T, ZHAO F, et al. Effect of uncultured adipose-derived stromal vascular fraction on preventing urethral stricture formation in rats [J]. Sci Rep, 2022, 12(1): 3573. ISALI I, WONG T R, WU C W, et al. Genomic Risk Factors for Urethral Stricture: A Systematic Review and Gene Network Analysis [J]. Urology, 2024, 184: 251-8. RUIZ-ROSADO J D, ROBLEDO-AVILA F, CORTADO H, et al. Neutrophil-Macrophage Imbalance Drives the Development of Renal Scarring during Experimental Pyelonephritis [J]. J Am Soc Nephrol, 2021, 32(1): 69-85. MICHEL V, DUAN Y, STOSCHEK E, et al. Uropathogenic Escherichia coli causes fibrotic remodelling of the epididymis [J]. J Pathol, 2016, 240(1): 15-24. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 29 Oct, 2025 Reviews received at journal 18 Sep, 2025 Reviewers agreed at journal 17 Sep, 2025 Reviews received at journal 14 Sep, 2025 Reviewers agreed at journal 25 Aug, 2025 Reviewers invited by journal 25 Aug, 2025 Editor assigned by journal 09 Jun, 2025 Submission checks completed at journal 09 Jun, 2025 First submitted to journal 04 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6821103","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":508431796,"identity":"ed2ed787-2cf3-4aaa-ad4b-591c51b31328","order_by":0,"name":"Xin Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIie2RP0oEMRSHEwJj85a0BhWvkKl2hdW9ysjCVh4iYyCV9tnSG0wl2r2QYhtx2pVp3AMIM50WolkWsTKmFMxXveL38f4Rksn8RRghuKto/dy/ToFzlawwXS6vFofCYnK/PXMAhZ9KVcVzcgUlvt354zG/McJCC5Ig7YeLiOJBuusHX97bjZ70kw7GTDGxvP1ZEbqocGQ62qxd/WShgxOFBRv9orh3082CosIujyCxiiucMfShy3nT1pdBwUTlyHzMmzXdHnkOwjod3aXgTg8vZnHatKtNeOXZjHPt+iGifLNffVVUpeS3I2JiMJPJZP4dn+P6W71UEfHcAAAAAElFTkSuQmCC","orcid":"","institution":"Tianjin Children’s Hospital (Tianjin university children hospital)","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Wang","suffix":""},{"id":508431797,"identity":"8f4eaa77-36a6-4063-91c8-c2e4b4e46b16","order_by":1,"name":"Zhenhua Zhang","email":"","orcid":"","institution":"Tianjin Children’s Hospital (Tianjin university children hospital)","correspondingAuthor":false,"prefix":"","firstName":"Zhenhua","middleName":"","lastName":"Zhang","suffix":""},{"id":508431798,"identity":"8ab01217-d463-4bef-85ba-494b0654a41c","order_by":2,"name":"Yong Guan","email":"","orcid":"","institution":"Tianjin Children’s Hospital (Tianjin university children hospital)","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Guan","suffix":""},{"id":508431799,"identity":"139c914a-aba7-4e83-bf74-fc6696f14d5f","order_by":3,"name":"Jianghua Zhan","email":"","orcid":"","institution":"Tianjin Children’s Hospital (Tianjin university children hospital)","correspondingAuthor":false,"prefix":"","firstName":"Jianghua","middleName":"","lastName":"Zhan","suffix":""},{"id":508431800,"identity":"db618445-ea24-4bae-bf88-6bc0f61735f7","order_by":4,"name":"Ming Dong","email":"","orcid":"","institution":"Tianjin medical university general hospital","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Dong","suffix":""}],"badges":[],"createdAt":"2025-06-04 13:38:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6821103/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6821103/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90464779,"identity":"31a8db84-6baf-4e7d-b35d-81abe5f5bc5a","added_by":"auto","created_at":"2025-09-03 05:11:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":7094964,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Cell Counting Kit (CCK-8) assay was performed to determine the viability of UFs after treatment with E.coli and TGF-β1 (20 ng/ml) for 0h, 24h and 48h.(B,C) Representative images from fibroblast scratch wound assays demonstrating the effects of indicated treatments on wound gap closure at 0h, 24h and 48h. (C) Bar graph summarizing ELISA data of TNF-α，IL‐6 and IL‐1 expression in the culture supernatant.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/914a908efa6957c57caa2305.png"},{"id":90464777,"identity":"00531323-38d3-451f-8fec-7791551b8838","added_by":"auto","created_at":"2025-09-03 05:11:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3922460,"visible":true,"origin":"","legend":"\u003cp\u003e(A）Bar graph summarizing the Reat-time PCR expression data for Smad2, Smad3, Smad4, α-SMA and collagen I mRNA in fibroblasts from the indicated treatment groups. (B) A representative western blot analysis demonstrating the changes in Smad2/3 pSmad2/3 and αSMA, collagen I expression in fibroblasts subjected to the indicated treatments. *P＜0.05 compared with control group.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/2116ba7a833b1c73adfdd409.png"},{"id":90464780,"identity":"4955d042-7d69-4c69-9b1d-167f30690b6d","added_by":"auto","created_at":"2025-09-03 05:11:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1538441,"visible":true,"origin":"","legend":"\u003cp\u003eE.coli demonstrate enhanced fibrosis effects in a rat model of urethral stricture. (A) Typical ultrasound images of the penile urethra from PBS, \u0026nbsp;(B)TGFβ and \u0026nbsp;(C) E.coli treated rat. In the images, ‘1’indicates sites of lower echogenic tissue associated with the normal urethral lumen and ‘2,3,4’ indicates sites of lower echogenic tissue associated with narrow the urethral lumen. (D) The relatively narrow distance of TGFβ group and E.coli group was significantly higher than PBS group. *P＜0.05 compared with PBS group. # P＜0.05 compared with TGFβ group. (Relatively narrow distance = the distance of lower echogenic tissue associated with the narrow urethral lumen - the distance of lower echogenic tissue associated with the normal urethral lumen)\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/ee62715ddb9d042769af97a3.png"},{"id":90464795,"identity":"ed47dca0-2054-4045-98dd-537f0c9abd55","added_by":"auto","created_at":"2025-09-03 05:11:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":30831049,"visible":true,"origin":"","legend":"\u003cp\u003eHistological analysis of rat urethral tissue sections. (A) Corresponding images of H\u0026amp;E staining acquired at x10 magnification. (B) Corresponding images of Masson's trichrome staining for the indicated treatment groups acquired at x40 magnification. (C) Representative images of immunohistochemistry showing αSMA expression x20 magnification.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/07e5531ff49ad4948dd47717.png"},{"id":90464788,"identity":"0b17b732-31c8-4d2a-93c7-a1a0043f9a7c","added_by":"auto","created_at":"2025-09-03 05:11:45","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2842973,"visible":true,"origin":"","legend":"\u003cp\u003eHistological analysis of rat urethral tissue sections. (A) Corresponding images of H\u0026amp;E staining acquired at x10 magnification. (B) Corresponding images of Masson's trichrome staining for the indicated treatment groups acquired at x40 magnification. (C) Representative images of immunohistochemistry showing αSMA expression x20 magnification.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/42c794ecaaeb8c389049310c.png"},{"id":90467329,"identity":"968f1a6c-bef6-448d-a8b6-e312ac74e181","added_by":"auto","created_at":"2025-09-03 05:45:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":43203331,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6821103/v1/591d4aee-b2be-4148-8951-a4bbf9226805.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Escherichia coli Promotes Myofibroblast Differentiation in Urethral Fibrosis Urethral Stricture in vivo and vitro via regulating TGFβ/Smad Signaling Pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eUrethral stricture is one of the oldest known urological conditions, characterized by scar formation due to damage to the urethral epithelium or spongy stromal tissue, leading to narrowing of the urethra and difficulty in urination\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. In children, urethral stricture is commonly caused by postoperative complications of hypospadias repair, which are relatively difficult to treat. Current treatment approaches include urethral dilation, endoscopic internal urethrotomy, and urethral reconstruction surgery, all of which are associated with a high recurrence rate. Furthermore, the success rate of treating recurrent urethral stricture decreases over time \u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Many studies have explored the causes of urethral stricture and the factors contributing to its recurrence, such as the type of initial surgery, stricture length, surgical techniques, and urinary tract infections\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. However, even when these clinical factors are controlled, urethral stricture may still occur, suggesting the presence of other contributing factors. Historically, the urethra was considered a sterile environment. However, over the past decade, high-throughput molecular DNA sequencing has proven otherwise: urine, even in the absence of a urinary tract infection, is not a sterile biofluid. It contains a variable microbial profile, and dysbiosis of the urethral microbiome has been implicated in various urological diseases\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Previous research has shown that the microbiome of children with meatal stenosis differs from that of children without stenosis, particularly in cases caused by lichen sclerosus \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Hypospadias-related urethral stricture is the most common cause of pediatric urethral stricture and is more complex to treat, with a high recurrence rate after surgical intervention. However, few studies have explored the role of microbial changes in this condition.\u003c/p\u003e\u003cp\u003eIn our previous study, we combined 16S rRNA sequencing and transcriptomic analysis to examine the microbial and genetic characteristics of urethral stricture cases following hypospadias surgery. We found that \u003cem\u003eE.coli\u003c/em\u003e and the TGFβ/Smad signaling pathway might be associated with the development of urethral stricture. Even non-pathogenic \u003cem\u003eE. coli\u003c/em\u003e strains, which did not cause symptoms of urinary tract infection, were able to influence the TGF-β/Smad signaling pathway and ultimately induce fibrosis. Therefore the present study aims to validate these findings through in vivo and in vitro experiments to investigate the mechanisms underlying postoperative urethral stricture in children with hypospadias\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eBacterial strains\u003c/h2\u003e\u003cp\u003eThe commensal \u003cem\u003eE.coli\u003c/em\u003e C600\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e(BeNa culture Biotech, HeNan, CHN, BNCC362520)was grown in Tianjin children hospital Laboratory broth statically overnight at 37°C. Cultures were centrifuged for 10 min at 7,500\u003cem\u003eg\u003c/em\u003e at 4°C before being resuspended in sterile phosphate-buffered saline (PBS) to a density of ~ 4 × 10\u003csup\u003e8\u003c/sup\u003e colony‐forming units (CFU)/ml.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eIsolation and culture of UFs\u003c/h3\u003e\n\u003cp\u003ePrimary urethral fibroblasts (UFs) were isolated from the urethral submucosa tissues of SD rats as previously described\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Briefly, the urethral mucosa tissues were isolated, washed in phosphate-buffered saline (PBS), cut into 1 mm\u003csup\u003e3\u003c/sup\u003e pieces, seeded in the culture flask and maintained at 37°C in a humidified incubator with 5% CO\u003csup\u003e2\u003c/sup\u003e for 4 h. After full adherence, the culture flask was added with 5 mL of Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Gibco). The culture medium was changed every 3 days. When the cells reached 80% confluency, they were isolated by trypsinization and further passaged. The UFs at passages 3–5 was used for subsequent experiments.\u003c/p\u003e\n\u003ch3\u003eAnimals\u003c/h3\u003e\n\u003cp\u003eMale Sprague Dawley (SD) rats (8–9 weeks, 260–320 g) were housed under standard conditions (temperature 23 ± 2°C, humidity 50–65%, 12-h light/dark cycle) with free access to food and water. The animals were allowed for 1 week acclimation before the experiments. All animal experiments were conducted following the NIH Guide for the Care and Use of Laboratory Animals and approved by the Ethics Committee of Tianjin children hospital. Each effort was made to minimize animals' suffering.\u003c/p\u003e\u003cp\u003eAfter anesthesia with intravenous pentobarbital (30 mg/kg), rats were randomly divided into (A)sham, saline injection to urethra and treated with PBS(Surgery + PBS, n = 5); (B) urethral fibrosis group, TGFβ 10µg injection to urethra and treated with PBS༈Surgery + TGFβ, n = 5༉;(C) urethral fibrosis treated with E.coli group (Surgery + TGFβ + E.coli, n = 5) for the study. Urethral fibrosis was induced in rats with PBS and TGFβ1 local injection and partial incisions as described previously\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. The method of intraurethral administered E.coli in rat model was described previously\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. All the rats were sacrificed after 4 weeks and the urethral tissues were harvested for further analysis.\u003c/p\u003e\n\u003ch3\u003eEstablishment of coculture of cells and E.coli\u003c/h3\u003e\n\u003cp\u003eThe co-culture of cells and E.coli was described previously\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Briefly, prepared a concentration of 3.0×10\u003csup\u003e6\u003c/sup\u003e cells/ml cell suspension in the six well cell culture plate, discard the cell culture medium, add PBS solution for three times, and then put the 0.4 µM Transwell in the well of the culture plate. Then each well was divided into the upper chamber and the lower chamber. The upper chamber is the upper chamber, and the lower chamber is the inner chamber of the culture plate. Add new cell culture medium in the lower chamber. It is appropriate to just contact the basement membrane of the Transwell cell, which is about 2 ml. Add E.coli diluted with the cell culture medium in the upper chamber, with a final concentration of 10\u003csup\u003e12\u003c/sup\u003e CFU/ml at 37 ℃, 5% CO\u003csup\u003e2\u003c/sup\u003e, and co culture for 4 h, 12 and 24 h, respectively. Then removed Transwell cell, collected the bacterial suspension, centrifuge at 12,000 R/min for 10 min, discard the supernatant, separate the bacteria, add PBS solution for three times, calculated the final concentration of the bacterial solution.\u003c/p\u003e\u003cp\u003eThe co-culture cells were divided into (A)control, fibroblasts treated with PBS(fibroblasts + PBS, n = 5); (B) TGFβ group, fibroblasts treated with TGFβ 20ng/ml,༈fibroblasts + TGFβ, n = 5༉;(C) E.coli group, fibroblasts treated with E.coli (fibroblasts + E.coli, n = 5) for the study.\u003c/p\u003e\n\u003ch3\u003eCCK-8 and Wound Healing Assay\u003c/h3\u003e\n\u003cp\u003eCell proliferation was measured using the cell counting kit-8 (CCK-8) assay (Bio sharp, BS350B, China). The CCK-8 reagent (10 µL) was added to each well and incubated for 2h and then transferred to a 96-well plate to measure absorption at 450 nm. Proliferation rates were evaluated at 0, 24, and 48h after co-culturing with sEVs.\u003c/p\u003e\u003cp\u003eThe migratory ability of cells was measured using the wound healing assay. Fibroblasts were grown in a 12-well plate. After 24 h, a 10µL pipette tip was used to scratch the plates in vertical directions. Cell migration into the scratched area was observed under a microscope at 0, 24, and 48.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eELISA assays\u003c/h2\u003e\u003cp\u003eThe samples were then subjected to ELISA Rat TNFα、IL-1、IL-6 immunoassays ELISA Kits (cat. no. D4050, D1300B, DFNAS0, DTA00D, R\u0026amp;D Systems, # MBS761127, BioSource, respectively)\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eUltrasound assessment\u003c/h3\u003e\n\u003cp\u003eUltrasound was performed on live animals using the Vevo 2100 system\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e to evaluate signs of fibrosis of the urethra. Scans were performed 4 weeks after surgery.\u003c/p\u003e\n\u003ch3\u003eReal time quantitative polymerase chain reaction\u003c/h3\u003e\n\u003cp\u003eTotal RNA extraction from co-culture cells and rat model tissues was performed using TRIzol reagent (Invitrogen). The iScript cDNA Kit (Bio-Rad) was employed for cDNA preparation. Real time quantitative polymerase chain reaction (RT‐qPCR) was conducted with SYBR Premix Ex TaqTM (Takara) using a Step OnePlus Real‐Time PCR system (Applied Biosystems). Normalized to β-Actin, the relative expression of α-SMA, Collagen I, Smad2, Smad3, Smad4 mRNAs was evaluated using the 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e method. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequrences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003esequence(5’-3’)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSize(bp)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eβ-Actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCCATCTATGAGGGTTACGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e150\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTTAATGTCACGCACGATTTC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003ecollagen I\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCAGCCGCAAAGAGTCTACA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e175\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGGTTTCCACGTCTCACCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eα-SMA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCATCGGGAATGAACGCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e191\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGTCAGCAATGCCTGGGTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eSmad2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCCGCCCGAAGGGTAGAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e164\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCTGTTCTCCACCACCTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eSmad3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGAGCTGCCTCTGTGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e297\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCATCCAGTGACCTGGGGAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eSmad4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCACTGCTCAGCCAGCTAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003e161\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTCACTGCTCAGCCAGCTAC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eWestern blotting\u003c/h2\u003e\u003cp\u003eProtein isolation from co-culture cells and rat model tissues was conducted using radio immunoprecipitation assay buffer (Solarbio). Protein concentration was quantified with a bicinchoninic acid assay kit (Beyotime). Protein samples (20 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted onto polyvinylidene fluoride membranes (Beyotime). After blocking with 5% defatted milk, the membranes were incubated at 4°C overnight with primary antibodies as follows: anti‐Smad2/3, anti-pSmad2/3, anti-Smad4, anti-αSMA, anti‐collagen I and GAPDH (all from Abcam) followed by incubating with the HRP‐conjugated goat anti‐rabbit secondary antibody (ab7090, Abcam) at room temperature for 2h. Lastly, blot signaling was visualized using an enhanced chemiluminescence kit (Solarbio), and ImageJ software (NIH, Bethesda, MD) was utilized for relative protein expression quantitation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHistological analysis of rat urethral tissue\u003c/h2\u003e\u003cp\u003ePenile tissues encompassing the sites of incision and injection were harvested, fixed, and further processed for histology. Immunohistology-chemistry (IHC), Masson's trichrome (MT) staining, and hematoxylin and eosin (H\u0026amp;E) procedures were performed according to a standard protocol\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eOrgan bacterial loads and IHC quantification were compared using the nonparametric Mann–Whitney \u003cem\u003eU\u003c/em\u003e test. All other comparisons were made using an unpaired \u003cem\u003et\u003c/em\u003e test. \u003cem\u003ep\u003c/em\u003e values \u0026lt; .05 were considered significant.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Result","content":"\u003ch2\u003eThe E. coli promotes myofibroblast differentiation in vivo\u003c/h2\u003e\n\u003cp\u003eTo determine whether E. coli promote Myofibroblast Differentiation as TGF\u0026beta; on Rat urethral fibroblasts (UFs), we firstly evaluated TGF\u0026beta;1 and E. coli effect on cell proliferation. E. coli and TGF\u0026beta; didn\u0026rsquo;t suppress cell proliferation of UFs (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). To examine in more details about the effect of E. coli on fibroblasts, we performed in vitro assays to examine changes in the behavior and biochemical phenotype of these cells. Scratch wound assays demonstrated that fibroblasts of E.coli and TGF\u0026beta; treatment group exhibited significantly increased cell migration, when compared with those of the control group. Cells of the E.coli group exhibited a significant increase in migration (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB,C). In addition, analysis of fibroblasts culture supernatants by ELISA revealed that levels of secreted TNF\u0026alpha;、IL-1 and IL-6 were significantly increased in the E.coli and TGF\u0026beta; treated group (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD,E,F).\u003c/p\u003e\n\u003cp\u003eThe fibrosis model was validated by quantitative Real-time PCR analysis, which demonstrated that TGF\u0026beta; and E.coli promoted increase in Smad2, Smad3, Smad4, \u0026alpha;-SMA and collagen I. (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Similarly, this model could be used to examine myofibroblast differentiation. Western blot analysis revealed that the expression of Smad2/3, pSmad2/3, Smad4 and \u0026alpha;SMA, collagen I was also significantly up-regulated in fibroblasts of E.coli and TGF\u0026beta; group, indicating the induction of a myofibroblast phenotype via TGF\u0026beta;/Smad pathway. (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB)\u003c/p\u003e\n\u003ch2\u003eE. coli demonstrate enhanced fibrosis in a rat model of urethral stricture\u003c/h2\u003e\n\u003cp\u003eTo evaluate the role of E. coli in the regulation of urethral stricture formation during wound healing, we used a TGF\u0026beta;1-dependent rat model of urethral stricture disease. In this model, animals have surgical incisions made to the urethra and treated with TGF\u0026beta; and PBS. The E.coli group rat was intraurethral administered by E.coli. Using this model, we compared the effects of E.coli on the pathogenesis of urethral stricture in vivo. We evaluated the degree of urethral stricture by urethral ultrasound. 4 weeks after treatment, compared with the PBS group, urethral stricture was more severe in the TGF\u0026beta;1 and E.coli groups (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eNext, we performed a histological assessment of urethral tissue sections obtained from rats with PBS, TGF\u0026beta; and E.coli-induced urethral stricture. H\u0026amp;E (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA) and MT (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB) staining of urethral tissues also reveal the presence of dense collagen fibers in the spongious urethra of animals in the TGF\u0026beta; and E.coli group. In contrast, there was only mild submucosal urethral fibrosis in tissues of the PBS treated group. We assessed the expression of \u0026alpha;SMA by IHC and found a significant increase in the expression of this protein in the urethral tissues of animals in the TGF\u0026beta; treated group and E.coli treated group when compared with those in the PBS treated group (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\n\u003ch2\u003eE.coli promotes myofibroblast differentiation and inflammation in rats via regulating TGF\u0026beta;/Smad\u003c/h2\u003e\n\u003cp\u003eTo test whether E. coli contributes to the fibrosis and inflammation. The ELISA analysis confirmed that TNF-\u0026alpha;, IL-6, IL-1 expression was significantly decreased in rat model with PBS, when compared with TGF\u0026beta; group and E.coli group in vivo. And the expression was significant increase in rat model with E.coli when compared TGF\u0026beta; group (Fig. 5A). The real-time PCR analysis confirmed that the collagen I、Smad2、Smad3、Smad4、\u0026alpha;-SMA mRNA expression was significantly decreased in Rat model with PBS, when compared with TGF\u0026beta; group and E.coli group in vivo (Fig. 5B). And the PBS group protein expression of \u0026alpha;-SMA, Collagen I, Smad2/3、pSmad2/3 was significant decrease than TGF\u0026beta; and E.coli group in vivo. (Fig. 5C)\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn previous studies, it has been well established that co-culturing fibroblasts with bacteria induces fibrosis, and this method is now widely applied\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. Based on this, we established a co-culture model of \u003cb\u003eE.coli\u003c/b\u003e and rat urethral fibroblasts in this study to explore the role and mechanisms of bacterial-induced fibrosis. In the scratch assay, the cell migration ability of both the TGF-β-induced fibrosis group and the \u003cem\u003eE. coli\u003c/em\u003e group was significantly higher than that of the control group, suggesting that \u003cem\u003eE. coli\u003c/em\u003e influences the functional state of fibroblasts. This finding was further confirmed through PCR and Western blot analyses. The results from Real-time PCR showed that, compared to the control group, under the influence of TGF-β, the transcription levels of α-SMA and Collagen I, classical markers of fibrosis were significantly elevated. A similar transcriptional change was observed in the \u003cem\u003eE. coli\u003c/em\u003e group. The downstream proteins of TGF-β, particularly Smad family members Smad2, Smad3, and Smad4, exhibited similar patterns, indicating that \u003cem\u003eE. coli\u003c/em\u003e may exert its effect through the TGF-β/Smad signaling pathway, influencing the activation of fibroblasts.\u003c/p\u003e\u003cp\u003eIn the animal experiments, we adopted a urethral microbial infusion model\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e and a rat post-surgery urethral stricture model, based on previous studies involving TGF-β-induced fibrosis\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. We used small animal ultrasound to confirm the urethral stricture, and histological analyses using HE staining, Masson's trichrome staining, and immunohistochemical detection of α-SMA were used to determine the degree of stricture among the different groups. The results showed that the control group had the least severe stricture, while the model group and the \u003cem\u003eE. coli\u003c/em\u003e co-culture group had the most severe stricture. ELISA results revealed that the expression levels of TNF-α, IL-6, and IL-1 were positively correlated with the severity of the stricture. These pro-inflammatory cytokines play a crucial role in wound healing. Through PCR and Western blot, we clearly observed the activation of the TGF-β/Smad signaling pathway and tissue fibrosis, consistent with the findings in the cell culture experiments. In previous studies on urethral stricture, the TGF-β/Smad pathway has also been identified as a central pathway in stricture-related fibrosis\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e .\u003c/p\u003e\u003cp\u003eE. coli, a single-cell organism essential to the human body, was first discovered by Escherich in 1885. For a long time, it was considered a non-pathogenic bacterium and part of the normal intestinal microbiota. However, by the mid-20th century, it was recognized that certain serotypes of \u003cem\u003eE. coli\u003c/em\u003e could be pathogenic to both humans and animals. Previous reports have indicated that pathogenic \u003cem\u003eE.coli\u003c/em\u003e can cause lower urinary tract symptoms and prostatic fibrosis\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e, which also involves the TGF-β/Smad signaling pathway. This suggests that certain \u003cem\u003eE.coli\u003c/em\u003e species or their components may trigger the activation of the TGF-β/Smad signaling pathway, leading to fibrosis. In another study on epididymal fibrosis caused by epididymitis, researchers co-cultured epididymal cells with both pathogenic and non-pathogenic \u003cem\u003eE. coli\u003c/em\u003e, and both groups led to varying degrees of fibrosis. Moreover, pro-inflammatory cytokines TNF-α, IL-6, and IL-1 were elevated compared to the control group\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. This demonstrates that non-pathogenic \u003cem\u003eEscherichia\u003c/em\u003e species can also affect host immune function, cytokine release, and fibrosis. In our study, both in vivo and in vitro experiments showed increased levels of pro-inflammatory cytokines TNF-α, IL-6, and IL-1 in the \u003cem\u003eE. coli\u003c/em\u003e group. These cytokines play key roles in the processes of wound healing and fibrosis. Therefore, it can be concluded that specific bacterial species (such as \u003cem\u003eEscherichia coli\u003c/em\u003e) or their components may, to some extent, activate urethral inflammation and TGF-β/Smad-induced fibrosis, ultimately leading to urethral stricture. Even non-pathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e strains that do not cause symptoms, or commensal gut bacteria, may lead to fibrosis and urethral stricture once they invade the urethra. This conclusion suggests that, during diagnosis and treatment, the preventive use of antibiotics could be considered to reduce the risk of such events\u0026mdash;though further clinical research is needed to support this approach. Additionally, measures can be taken to prevent the migration of gut bacteria to the urethra, such as proper use of diapers to avoid cross-contamination of microbiota. Future studies may also explore the potential role of probiotics in preventing urethral fibrosis and stricture. This study adds to the understanding of possible triggers for urethral stricture fibrosis and offers new perspectives for addressing this type of disease.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study demonstrates that E.coli can enhance inflammatory responses and fibroblast activation, thereby significantly increase urethral tissue fibrosis and urethral stricture. Mechanistically, E.coli plays an important role in TGFβ/Smad signal pathway mediated tissue fibrosis. Our current findings highlight potential new targets for the clinical treatment of stenosis and recurrence after urethrotomy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledge:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eXin Wang performed research, analyzed data, and wrote the manuscript; Zhenhua Zhang performed research, wrote and edited the manuscript; Yong Guan establish the animal model. Jianghua Zhan and Ming Dong coordinated the project. All authors gave final approval of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during the present study are included in this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were conducted under animal ethical respect and were authorized by the Tianjin Children Hospital of Tianjin University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Tianjin Science and Technology Program (21JCYBJC01310) to Xin Wang, Tianjin Youth Medical New Talent Project (TJSQNYXXR-D2-069) to Xin Wang, and the Tianjin Key Medical Discipline (Specialty) Construction Project (TJYXZDXK-040A). Beijing science and technology innovation medical development foundation (KC2023-JX-0288-PQ87) to Ming Dong,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no conflict of interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eDORNBIER R A, KIRSHENBAUM E J, NELSON M H, et al. Socioeconomic and patient-related factors for the management of male urethral stricture disease [J]. World J Urol, 2019, 37(11): 2523-31.\u003c/li\u003e\n \u003cli\u003eKAPLAN G W. Urethral strictures in children [J]. Curr Opin Urol, 2012, 22(6): 462-6.\u003c/li\u003e\n \u003cli\u003eISSACK F H, HASSEN S M, TEFERA A T, et al. Short-term recurrence rate of male urethral stricture and its predictors after treatment with optical internal urethrotomy: Prospective Cohort Study at a tertiary center in Ethiopia [J]. Ann Med Surg (Lond), 2023, 85(10): 4715-9.\u003c/li\u003e\n \u003cli\u003eMAGISTRO G, STIEF C G. The Urinary Tract Microbiome: The Answer to All Our Open Questions? [J]. Eur Urol Focus, 2019, 5(1): 36-8.\u003c/li\u003e\n \u003cli\u003eJAMIL M L, PERECMAN A, SHERMAN A, et al. Urinary microbiome differences between lichen sclerosus induced and non-lichen sclerosus induced urethral stricture disease [J]. World J Urol, 2023, 41(9): 2495-501.\u003c/li\u003e\n \u003cli\u003eAPPLEYARD R K. Segregation of New Lysogenic Types during Growth of a Doubly Lysogenic Strain Derived from Escherichia Coli K12 [J]. Genetics, 1954, 39(4): 440-52.\u003c/li\u003e\n \u003cli\u003eAN N, PENG J, HE G, et al. Involvement of Activation of Mitogen-Activated Protein Kinase (MAPK)/Extracellular Signal-Regulated Kinase (ERK) Signaling Pathway in Proliferation of Urethral Plate Fibroblasts in Finasteride-Induced Rat Hypospadias [J]. Med Sci Monit, 2018, 24: 8984-92.\u003c/li\u003e\n \u003cli\u003eSANGKUM P, GOKCE A, TAN R B, et al. Transforming Growth Factor-beta1 Induced Urethral Fibrosis in a Rat Model [J]. J Urol, 2015, 194(3): 820-7.\u003c/li\u003e\n \u003cli\u003eASAHARA T, NOMOTO K, WATANUKI M, et al. Antimicrobial activity of intraurethrally administered probiotic Lactobacillus casei in a murine model of Escherichia coli urinary tract infection [J]. Antimicrob Agents Chemother, 2001, 45(6): 1751-60.\u003c/li\u003e\n \u003cli\u003eJU Z, PAN H, QU C, et al. Lactobacillus rhamnosus GG ameliorates radiation-induced lung fibrosis via lncRNASNHG17/PTBP1/NICD axis modulation [J]. Biol Direct, 2023, 18(1): 2.\u003c/li\u003e\n \u003cli\u003eHAKIM L, ENDO M, FEOLA A, et al. High-frequency micro-ultrasound: a novel method to assess external urethral sphincter function in rats following simulated birth injury [J]. Neurourol Urodyn, 2015, 34(3): 264-9.\u003c/li\u003e\n \u003cli\u003eCASTIGLIONE F, HEDLUND P, VAN DER AA F, et al. Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie\u0026apos;s disease [J]. Eur Urol, 2013, 63(3): 551-60.\u003c/li\u003e\n \u003cli\u003eZHOU L, YANG T, ZHAO F, et al. Effect of uncultured adipose-derived stromal vascular fraction on preventing urethral stricture formation in rats [J]. Sci Rep, 2022, 12(1): 3573.\u003c/li\u003e\n \u003cli\u003eISALI I, WONG T R, WU C W, et al. Genomic Risk Factors for Urethral Stricture: A Systematic Review and Gene Network Analysis [J]. Urology, 2024, 184: 251-8.\u003c/li\u003e\n \u003cli\u003eRUIZ-ROSADO J D, ROBLEDO-AVILA F, CORTADO H, et al. Neutrophil-Macrophage Imbalance Drives the Development of Renal Scarring during Experimental Pyelonephritis [J]. J Am Soc Nephrol, 2021, 32(1): 69-85.\u003c/li\u003e\n \u003cli\u003eMICHEL V, DUAN Y, STOSCHEK E, et al. Uropathogenic Escherichia coli causes fibrotic remodelling of the epididymis [J]. J Pathol, 2016, 240(1): 15-24.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"world-journal-of-urology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"wjur","sideBox":"Learn more about [World Journal of Urology](https://link.springer.com/journal/345)","snPcode":"345","submissionUrl":"https://submission.nature.com/new-submission/345/3","title":"World Journal of Urology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"urethral stricture, hypospadias, Escherichia coli, fibrosis, TGFβ","lastPublishedDoi":"10.21203/rs.3.rs-6821103/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6821103/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUrethral stricture in children is a challenging condition to treat, with a high rate of postoperative recurrence. Previous studies based on 16S rRNA and transcriptomic analyses have suggested a positive correlation between urethral stricture and \u003cem\u003eEscherichia coli\u003c/em\u003e (E. coli), as well as the transforming growth factor-β (TGF-β)/Smad signaling pathway. Notably, even \u003cem\u003eE. coli\u003c/em\u003e strains that do not cause typical urinary tract infection symptoms may still contribute to fibrotic stricture formation. In this study, we employed both in vitro cell culture and in vivo animal experiments to investigate the role of non-pathogenic \u003cem\u003eE. coli\u003c/em\u003e in this process.Our results demonstrated that non-pathogenic \u003cem\u003eE. coli\u003c/em\u003e promoted local production of TGF-β1 in urethral fibroblasts and rat urethral tissue, altered the ratio of transcription factors Smad2 and Smad3, and induced the release of inflammatory cytokines. This cascade facilitated the transformation of fibroblasts, ultimately leading to urethral stricture.We conclude that the presence of \u003cem\u003eE. coli\u003c/em\u003e contributes to urethral fibrosis and stricture by promoting the release of inflammatory cytokines and activating the TGF-β1 signaling cascade, thereby enhancing the activation and proliferation of myofibroblasts responsible for scar formation. Modulation of the microbiota may represent a potential future direction for the prevention and treatment of urethral stricture.\u003c/p\u003e","manuscriptTitle":"Escherichia coli Promotes Myofibroblast Differentiation in Urethral Fibrosis Urethral Stricture in vivo and vitro via regulating TGFβ/Smad Signaling Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 05:11:39","doi":"10.21203/rs.3.rs-6821103/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-29T14:07:28+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-18T19:31:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"161803808428889726112543172824163156336","date":"2025-09-17T10:04:10+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-14T22:15:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"101140248997879440380886654930973068232","date":"2025-08-25T11:52:37+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-25T07:36:15+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-09T15:48:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-09T13:20:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"World Journal of Urology","date":"2025-06-04T13:36:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"world-journal-of-urology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"wjur","sideBox":"Learn more about [World Journal of Urology](https://link.springer.com/journal/345)","snPcode":"345","submissionUrl":"https://submission.nature.com/new-submission/345/3","title":"World Journal of Urology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"85baac50-a9e4-4eda-b0c2-aac81e2641ce","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T08:40:57+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 05:11:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6821103","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6821103","identity":"rs-6821103","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}