Effects of STAT Inhibitors in Mouse Models of Endometriosis

other OA: green CC-BY-NC-ND-4.0
AI-generated summary by gemini-2.5-flash-lite, 2026-07-06

A STAT3 inhibitor reduced endometriosis lesion area and altered TGF-β and IL-6 mRNA levels in a mouse model, suggesting potential therapeutic benefits.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

This paper investigated whether inhibiting STAT3 affects the intraperitoneal microenvironment and lesion development in a C57BL/6J mouse model of endometriosis, using daily oral administration of the STAT3 inhibitor Stattic (80 mg/kg) versus phosphate-buffered saline. Endometriosis-like lesions and peritoneal lavage fluid were collected before treatment and at 1, 2, and 3 weeks after initiation; lesion area increased in both groups after week 1, but the treatment group showed significantly reduced lesion areas at weeks 2 and 3 compared with week 1. In ascites cells, TGF-β mRNA was lower at weeks 1 and 2, IL-6 mRNA was higher at week 1 but lower at weeks 2 and 3, and IL-6 mRNA in endometriotic lesions tended to be lower at week 3; the authors conclude STAT inhibition may dampen IL-6 signaling and reduce TGF-β levels. This paper is centrally about endometriosis — it directly tests STAT3 inhibition (Stattic) on lesion progression and inflammatory mediators in a mouse endometriosis model.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

The signal transducer and activator of transcription (STAT) pathway, which regulates cell proliferation and immunity, has been implicated in chronic inflammatory diseases such as rheumatoid arthritis. However, few reports have described the effects of STAT inhibitors on endometriosis, another chronic inflammatory disease. Here, we investigated the intraperitoneal microenvironment and the effects of a STAT inhibitor in a mouse model of endometriosis. In the treatment group, a STAT3 inhibitor (Stattic®, 80 mg/kg) was orally administered three times per week; control animals received orally dosed phosphate-buffered saline. Endometriosis-like lesions and peritoneal lavage fluid were collected before and 1, 2, and 3 weeks after STAT3 inhibitor administration was initiated. The lesion area was significantly increased in both groups after the first week. However, in the treatment group, the lesion areas were significantly reduced at weeks 2 and 3 compared with week 1. Transforming growth factor (TGF)-β messenger RNA (mRNA) levels in ascites cells were significantly lower at weeks 1 and 2 than at week 0. Interleukin (IL)-6 mRNA levels were significantly higher at week 1 than at week 0 but were significantly lower at weeks 2 and 3 than at week 1. Thus, STAT inhibitors appeared to reduce the extent of endometriosis in this mouse model, and may also inhibit the IL-6 signaling pathway and reduce TGF-β levels. This study suggests that STAT inhibitors warrant further exploration for use in the treatment of endometriosis.
Full text 33,794 characters · extracted from oa-pdf · 8 sections · click to expand

Abstract

20 The signal transduction and activator of transcription (STAT) pathway, which regulates cell proliferation 21 and immunity, has been implicated in chronic inflammatory diseases such as rheumatoid arthritis. However, 22 few reports have described the effects of STAT inhibitors in endometriosis, another chronic inflammatory 23 disease. Here, we investigated the intraperitoneal microenvironment and the effects of a STAT inhibitor in 24 a mouse (C57BL/6J) model of endometriosis. In the treatment group, a STAT3 inhibitor (Stattic®, 80 mg/kg) 25 was orally administered daily; control animals received orally dosed phosphate buffered saline . 26 Endometriosis-like lesions and peritoneal lavage fluid were collected before and 1, 2, and 3 weeks after 27 STAT3 inhibitor administration was initiated. The lesion area was significantly increased in both groups 28 after the first week. However, in the treatment group, the lesion areas were significantly reduced at weeks 29 2 and 3 compared with week 1. Transforming growth factor (TGF )-β messenger RNA (mRNA) levels in 30 ascites cells were significantly lower at weeks 1 and 2 than at week 0. Interleukin (IL)-6 mRNA levels were 31 significantly higher at week 1 than at week 0, but significantly lower at weeks 2 and 3 than at week 1. IL -32 6 mRNA levels in the endometriotic lesions also tended to be lower at week 3 than at week 1. Thus, STAT 33 inhibitors appear to reduce the extent of endometriosis in this mouse model. Furthermore, STAT inhibitors 34 may also inhibit the IL -6 signaling pathway and reduce TGF -β levels. This study suggests that STAT 35 inhibitors warrant further exploration for use in the treatment of endometriosis. 36 37 Author statement 38 Conceptualization: Takako Kawakita, Takeshi Kato, and Takeshi Iwasa. 39 Methodology: Takako Kawakita and Takeshi Iwasa. 40 Investigation: Takako Kawakita, Misaki Murayama, Tomotaka Nakagawa, Hikari Sasada, Ayaka Shinohara, 41 Ryousuke Arakaki, Tomohiro Kagawa, and Y uri Kadota. 42 Writing: Hiroaki Inui and Takako Kawakita. 43 Writing – Review & Editing: Hiroaki Inui and Takako Kawakita. 44 Funding Acquisition: Takeshi Iwasa. 45 Supervision: Takeshi Kato, Masato Nishimura, and Takeshi Iwasa. 46 47 Declaration of Competing Interest 48 The authors declare that they have no known competing financial intere sts or personal relationships that 49 could have appeared to influence the work reported in this paper. 50 51

Acknowledgements

52 This study was supported by SupportCenter for Advanced Medical Sciences, Institute of Biomedical 53 Sciences, Tokushima University Graduate School. We thank Edanz (https://jp.edanz.com/ac) for editing a 54 draft of this manuscript. 55 3 56 Funding 57 Beyond the support described in the acknowledgement section, this research did not receive any specific 58 grant from funding agencies in the public, commercial, or not-for-profit sectors. 59 60 61 4

Introduction

62 63 Janus kinase (JAK) and signal transducer and activator of transcription (STAT) signaling pathways regulate 64 cell proliferation, hematopoiesis, and immunity [1, 2]. The JAK/STAT pathway is involved in the induction 65 of inflammatory responses, and dysregulation of this pathway has been implicated in the pathophysiology 66 of chronic inflammatory diseases, such as rheumatoid arthritis and hepatitis [3]. Orally available JAK 67 inhibitors have been used in several studies to treat rheumatoid arthritis and ulcerative colitis [4]. Moreover, 68 analyses of the roles of the STAT family, especially STAT3, are also progressing. Transforming growth 69 factor-β (TGF-β) and interleukin (IL)-6 have been suggested to activate STAT3 signaling in a murine model 70 of liver fibros is, and the administration of STAT3 inhibitors suppresses liver fibrosis [5]. Additionally, 71 STAT3 activation has been positively correlated with disease progression in a murine model of 72 dermatofibrosis; STAT3 inhibition has been demonst rated to reduce dermal fibrosis in the model [6]. 73 Reducing the levels of the protein inhibitor of STAT3 has also been demonstrated to cause abnormal STAT3 74 activity in a baboon model of endometriosis, another chronic inflammatory disease [7]. 75 The inflammation associated with endometriosis not only causes pelvic pain, but it also limits the patient’s 76 fertility [8]. Moreover, the inflammation can elevate endometrial aromatase levels, and these are associated 77 with poor in vitro fertilization outcomes [9]. STAT3 activity has been reported to be involved in the 78 transcription of aromatase [10]. Therefore, modulating STAT3 activity may reduce inflammation and 79 improve fertility in patients with endometriosis. However, few reports have been published regarding the 80 involvement of the JAK/STAT pathway in endometriosis. Thus, we investigated the effects of a STAT3 81 inhibitor in a mouse model of endometriosis. 82 83

Materials and methods

84 85 Ethical approval 86 The study protocol was approved by the Committee of the I nstitute of Clinical Review Board and Animal 87 Experimentation of the University of Tokushima Graduate School (Tokushima, Japan). The conduct of this 88 study was based on Animal Research: Reporting of In Vivo Experiments (ARRIVE) Guidelines for Animal 89 Experimentation. 90 91 Human subjects 92 The human uterine -endometrium and endometriosis samples used to examine STAT3 expression patterns 93 were obtained from patients of Tokushima University Hospital. Written informed consent was obtained in 94 the form of an opt-out option on the Institute of Clinical Review Board website. For experiments examining 95 STAT3 expression patterns in women with endometriosis, the control samples were from women with 96 severe dysplasia, without endometriosis. The samples (5 samples from women with endometriosis and 5 97 5 control samples) were compared using immunohistochemistry (IHC). 98 99 Animals 100 Female C57BL/6J mice (5 weeks old) were purchased from Charles River Japan (Tokushima, Japan). The 101 mice were housed in a dedicated facility with controlled lighting (12- h light–dark cycle) and a constant 102 temperature (24 °C) [11]. 103 104 Creation of endometriotic lesions in mice and treatment 105 The creation of endometriotic lesions was performed as previously described [11] . Estradiol (Sigma -106 Aldrich, Tokyo, Japan) tube implantations were performed under sevoflurane anesthesia. A Silastic® tube 107 (inner diameter, 3 mm; outer diameter, 5 mm; length of filled portion, 7 mm; As One, Tokyo, Japan) filled 108 with crystalline estradiol was implanted into each mouse. Donor mice were euthanized 7 days after the 109 implantation. Both uterine horns were removed and placed in a small, sterile dish containing 1 mL of sterile 110 physiologic (0.9%) saline. The endometrium was gently peeled to de tach the uterine muscle, which was 111 then cut into small pieces. An endometrial fragment, derived from one side of a uterine horn, was suspended 112 in 0.1 mL of sterile 0.9% saline and 0.2 mL of blood collected from the inferior vena cava. This 0.3- mL 113 sample was then administered, via intraperitoneal injection, into the left lower abdomen of the experimental 114 recipient mouse, as previously described [11]. The endometrium from one donor mouse was transplanted 115 into two recipient mice. 116 One week after the surgical procedure, the recipient mice began treatment with a STAT3 inhibitor (Stattic®, 117 Selleck, Tokyo, Japan. 80 mg/kg in phosphate buffered saline [ PBS] in a 0.5 -mL volume, each group has 118 N=7, there are 4 groups) administered by oral gavage; similarly, control mice received 0.5 mL of PBS (each 119 group has N=7, there are 4 groups). The presence of endometriotic lesions was confirmed macroscopically. 120 After removing a cyst -like lesion, its longest length and width were measured (BZ -X800, KEYENCE , 121 Osaka, Japan ) to determine the lesion’s area. The monolayer epithelial cell lining of the lesions was 122 observed microscopically using hematoxylin and eosin-stained specimens. 123 124 IHC 125 Paraffin-embedded uterine tissues were cut into 5 -μm sections, mounted on silane -coated slides, 126 deparaffinized, and rehydrated in a graded alcohol series. The sections were blocked with 10% normal goat 127 serum in PBS (pH 7.5) and incubated with a 1:1000 dilu tion of STAT3 (124H6) mouse monoclonal 128 antibodies (#9139; Abcam, Cambridge, United Kingdom) and a 1:200 dilution of estrogen receptor (ER)-α 129 (sc-542; SANTA CRUZ, Texas, USA). Following overnight incubation at 4°C, the sections were incubated 130 with a secondary antibody conjugated to horseradish peroxidase (VECTASTAIN ABC Kit; Vector 131 Laboratories,CA,USA) for 1 h at room temperature. Immunoreactivity was detected using 132 diaminobenzidine (ImmPACT DAB; Vector Laboratories) with a hematoxylin counterstain [12]. 133 6 Immunostaining was analyzed using microscopy software (BZ-X800, KEYENCE). 134 135 Reverse transcription (RT) and quantitative real-time polymerase chain reaction (qRT-PCR) analysis 136 Lesions and ascites cells were processed for qRT -PCR. Total RNA was extracted using ISOGEN -II 137 (NIPPON GENE, Tokyo, Japan), and complimentary DNA was synthesized using oligo (deoxythymidine) 138 primers at 50 °C in a SuperScript™ III (Invitrogen , Thermo Fisher Scientific, Massachusetts, USA) first-139 strand synthesis system for RT -PCR. RT-PCR was performed using a StepOnePlus™ system (Applied 140 Biosystems, Foster City, CA, USA) and FAST SYBR ® Green (Applied Biosystems). The SYBR Green 141 thermal cycling conditions comprised 1 cycle at 95 °C for 30 s, and 40 cycles of 95 °C for 10 s, 60 °C for 142 10 s, and 72 °C 10 s. The relative mRNA levels were calculated using the standard curve method and were 143 normalized to GAPDH mRNA levels (forward primer, AATGTGTCCGTCGTGGATCTGA; reverse primer, 144 GATGCCTGCTTCACCACCTTCT). Primer sequences for IL -6 (forward, 145 ACAAGCCAGAGCTGTGCAGATG; reverse, GTGCCCATGCTACATTTGCCGA) and TGF-β (forward, 146 ATTCTGGCGTTACCTTGG; reverse, AGCCCTGTATTCCGTCTCCT) were also used. 147 148 IL-6 and TGF-β measurements 149 Peritoneal lavage was performed by infusing PBS (1 mL) into the peritoneal cavity of each 150 mouse(N=7/group). The fluid was recovered and centrifuged at 1000 × g for 20 min; an aliquot of each 151 supernatant was stored at –20 °C until needed for the quantitative assay. Concentrations of IL-6 and (TGF-152 β) were measured using a mouse IL-6 enzyme-linked immunosorbent assay (ELISA) (Cloud-Clone, Texas , 153 USA) and a mouse TGF-β ELISA (Proteintech, Illinois , USA). The absorbance was read immediately on 154 a microplate reader and mean optical density values were converted to concentration values (pg/mL). Each 155 sample was evaluated in triplicate. 156 157 Statistical analysis 158 All results are expressed as means ± standard error of the mean (SEM). Comparisons of the treatment 159 groups were performed using the nonparametric Mann– Whitney U test. mRNA data were analy zed using 160 the Bonferroni multiple comparisons test. Differences with P < 0.05 were considered statistically significant. 161 SPSS Statistics (Version 21; IBM; Armonk, NY , USA) was used for all statistical analyses. 162 163

Results

164 165 STAT3 expression in women with endometriosis 166 STAT3 expression was identified in the glandular epithelium and interstitial tissues (Figs. 1A.1B) and in 167 the ovarian endometriotic cysts (Fig. 1C.1D) of all patients. 168 169 7 STAT3 expression in the murine endometriosis model 170 Endometriotic lesions were macroscopically identified in several model mice (Fig. 2A) using 171 hematoxylin and eosin staining and anti-ERα antibody IHC (Fig. 2B,2C). STAT3 expression was observed 172 in the glandular epithelium and interstitial tissue of the endometriotic lesions in several mice (Figs. 2D and 173 2E). 174 175 Changes in the endometriotic lesion area during STAT inhibitor treatment 176 Compared with week 0, there were no significant differences in the numbers of lesions at any week in 177 either the treatment or control group animals (Figs. 3 panel A and B). However, at week 1, the control group 178 lesion area had significantly increased compared with week 0 (Fig. 3 panel C; P = 0.020). In the STAT3 179 treatment group, the lesion area had also increased significantly by week 1 compared with Week 0. Unlike 180 the control group, however, the lesion area in the treatment group decreased significantly by the second and 181 third weeks, compared with the first week (Fig. 3 panel D; **, P = 0.000). 182 183 Intraperitoneal inflammatory response during STAT inhibitor administration 184 Cytokine levels in the peritoneal lavage and mRNA levels in the ascites cells were measured. The IL -185 6 mRNA levels in the ascites cells increased during the first week, compared with week 0 (P = 0.001). There 186 were no significant differences, compared with week 0, at weeks 2 or 3, but the level of detected mRNA 187 had decreased significantly compared with week 1 (Fig. 4 panel A; P = 0.001 and P = 0.004, respectively). 188 There was no significant change in the IL -6 concentration in the peritoneal lavage over the course of the 189 observation period (Fig. 4 panel C). TGF -β mRNA levels in the ascites cells were significantly lower at 190 weeks 1 and 2 compared with week 0 (Fig. 4 panel B; P = 0.017 and P = 0.042, respectively). A similar 191 significant change was not observed in the TGF-β concentration in the peritoneal lavage fluid over the same 192 observation period (Fig. 4 panel D) 193 194 Cytokine mRNA levels within the lesions 195 Cytokine mRNA levels within the lesions were measured. IL-6 mRNA levels were significantly higher 196 at week 1 compared with week 0 (Fig. 5 panel A, P = 0.001 ).The values tended to be lower at week 3 197 compared with week 1 (Fig. 5 panel A, P = 0.058). There were no significant changes in TGF -β mRNA 198 levels over the course of the observation period (Fig. 5 panel B). 199 200

Discussion

201 In this study, we investigated the effects of a STAT3 inhibitor on endometriosis, as there are few reports 202 on the effects of STAT inhibitors in endometriosis. Moreover, the effects of these inhibitors on the intra-203 abdominal environment have not yet been elucidated. We investigated whether STAT3 expression is 204 observed in clinical specimens recovered from women undergoing surgery, and found its expression in 205 8 both the endometrium and endometriotic lesions. Because similar expression of STAT3 was observed in 206 mouse models, the effects of a STAT3 inhibitor were examined in a mouse model. In this study, treatment 207 with a STAT3 inhibitor did not affect the number of lesions nor did it lead to lesion disappearance. 208 However, after 2 weeks, treatment with the inhibitor was found to reduce the size of the endometriotic 209 lesions. In particular, the extent of the endometriosis was reduced, even with continuous estrogen 210 administration. 211 Endometriosis is a chronic inflammatory disease characterized by increased production of pro -212 inflammatory cytokines, such as IL-6 and TNF-α [13,14]. This inflammation may occur through a 213 variety of mechanisms, including downregulation of regulatory proteins, some of which involve the 214 STAT3 pathway (e.g., protein inhibitor of activated STAT3 [PIAS3]) [15]. 215 The release of cytokines, such as IL-6, that can sustain the activation of STAT3 and other pro-216 inflammatory cytokines is reduced following treatment with the JAK inhibitor tofacitinib. In fibroblasts 217 and fibroblast-like cells, tofacitinib also inhibits production of tumor necrosis factor (TNF)-α, 218 monocyte chemoattractant protein (MCP)-1, and TGF-β1 [16,17]. The same inhibitor has also been 219 reported to reduce endometriosis by inhibiting STAT3 phosphorylation [18]. Recent studies have also 220 shown that the JAK/STAT pathway, especially STAT3 phosphorylation, is upregulated in the orthotopic 221 endometrium of patients with endometriosis [19]. 222 Intraperitoneal immune cells have been reported to influence the onset and progression of endometriosis 223 [20,21]. Macrophages are the most abundant immune cells in the peritoneal cavity and have been reported 224 to be activated by IL-6, macrophage colony-stimulating factor, and prostaglandin E2. This activation 225

Results

in the macrophages differentiating into M2-type macrophages [22] that are able to suppress anti-226 tumor immunity by promoting the production of inflammatory factors, such as IL -10, TGF-β, and 227 prostaglandin E2; enhance the infiltration of regulatory T cells; and produce various angiogenic factors. It 228 has been shown to provide a microenvironment that promotes cell proliferation by inducing the formation 229 of new blood vessels [23]. Increased macrophage activity has also been implicated in endometriosis [24], 230 and increased concentrations of inflammatory cytokines and growth factors within the peritoneal fluid and 231 peritoneal tissue have been associated with endometriotic lesions [25 ] 232 Intraperitoneal immune cells have been reported to influence the onset and progression of endometriosis 233 [22, 23]. Macrophages are the most abundant immune cells in the peritoneal cavity and have been 234 reported to be activated by IL-6, macrophage colony-stimulating factor, and prostaglandin E2. This 235 activation results in the macrophages differentiating into M2-type macrophages [22] that are able to 236 suppress anti-tumor immunity by promoting the production of inflammatory factors, such as IL -10, TGF-237 β, and prostaglandin E2; enhance the infiltration of regulatory T cells; and produce various angiogenic 238 factors. M2-type macrophages has been shown to provide a microenvironment that promotes cell 239 proliferation by inducing the formation of new blood vessels [23]. Increased macrophage activity has also 240 been implicated in endometriosis [24], and increased concentrations of inflammatory cytokines and 241 9 growth factors within the peritoneal fluid and peritoneal tissue have been associated with endometriotic 242 lesions [23]. 243 TGF-β is an inflammatory growth factor that regulates various cellular functions, including cell adhesion, 244 invasion, and angiogenesis, which are essential for the development of endometriotic lesions. 245 Additionally, TGF-β levels have been reported to be increased in the ascites, serum, ectopic endometrium, 246 and peritoneal tissue of women with endometriosis [25–27]. Interestingly, TGF-β-null mice have reduced 247 growth of endometriotic lesions compared with wild-type controls [28], suggesting that TGF-β plays an 248 important role in lesion development. In the present study, we observed a decrease in TGF-β mRNA 249 levels in ascites cells obtained after the first week of STAT3 inhibitor administration. Although the lesion 250 area at week 1 had increased from that observed at week 0, the TGF-β levels in the ascites cells had 251 decreased, suggesting that suppression of TGF-β may have contributed tothe diminishing lesion area that 252 was observed to begin at week 2. 253 The increase in the lesion area also coincided with an increase in IL-6 mRNA levels in the ascites cells 254 and lesions; however, at 3 weeks, IL-6 was also suppressed and the area decreased. Endometriosis is 255 characterized, in part, by increased production of IL-6 [16, 17]. In models of acute lung injury, a small-256 molecule STAT3 inhibitor (LLL12) has been demonstrated to suppress the expression of pro-257 inflammatory genes, such as those for IL-1β, IL-6, and TNF-α, in macrophages and inflammatory cells 258 from tracheal alveolar lavage fluid and serum [29]. In this study, although the lesion area increased 259 temporarily, STAT3 inhibitors decreased IL-6 and the lesion area.. Because IL-6 is involved in the 260 progression and enlargement of endometriotic lesions, it is possible that the lesions decreased in size in 261 conjunction with the reduced IL-6 levels. Thus, the STAT3 inhibitor used in this study may reduce IL-6 262 levels and, thereby, lesion area. Also TGF-β levels were suppressed. This suggests that the STAT3 263 inhibitor not only suppressed IL-6 signaling, but may have also affected macrophages and suppressed 264 TGF-β production. The reason for the absence of a significant difference in the protein levels of these 265 cytokines during the experimental period is thought to be the influence of dilution during the peritoneal 266 lavage. Slight, but impactful, changes in the volume of the intraperitoneal cavities of the experimental 267 animals may not have been detected. However, the mRNA results suggest that these changes in the levels 268 of both cytokines resulted in a significant reduction in lesion area following 3 weeks of treatment. 269 Specifically, IL-6 levels were high at week 1, but tended to be lower by week 3 compared with week 1. 270 This change is consistent with the change in lesion area. 271 No change in TGF-β mRNA levels was observed within the endometriotic lesions. Although TGF-β 272 involvement in lesion enlargement has been suggested, we failed to see any change in TGF-β levels, even 273 during the first week when lesion sizes were increasing. However, TGF-β mRNA levels were 274 significantly decreased in the ascites cells from the first week, suggesting that the microenvironment 275 affects the increase in lesion size. 276 This study showed that a STA T3 inhibitor is effective at reducing endometriotic lesion size in a mouse 277 10 model. Current treatments for endometriosis involve the use of hormonal drugs to reduce estrogen levels. 278 The STAT3 inhibitor used in the present study enables immunomodulation through a different approach. 279 In fact, in this study, the growth of endometriotic lesions was suppressed even with continued estrogen 280 administration.Therefore, an investigation into the use of this and similar inhibitors as a possible future 281 treatment of endometriosis is warranted. In addition, the current study suggests that the tested STAT3 282 inhibitor not only inhibited the IL-6 signal transduction pathway but also reduced TGF-β levels, in 283 association with decreasing lesion sizes. Further investigation of the mechanism of TGF-β reduction is 284 necessary. STAT3 inhibitors are attractive new agents that should be explored further for their potential 285 role in treating endometriosis. 286 287 288

References

289 290 [1] F. Seif, M. Khoshmirsafa, H. Aazami, M. Mohsenzadegan, G. Sedighi, M. Bahar, The role of JAK -291 STAT signaling pathway and its regulators in the fate of T helper cells, Cell Commun 292 Signal .15(2017)23, https://doi.org/10.1186/s12964-017-0177-y 293 [2] A. Ferrajoli, S. Faderl, F. Ravandi, Z. Estrov, The JAK -STAT pathway: a therapeutic target i n 294 hematological malignancies, Curr Cancer Drug Targets. 6(2006):671- 679, https//doi: 295 10.2174/156800906779010227. 296 [3] S. Banerjee, A. Biehl, M. Gadina, S. Hasni, D. M. Schwartz, JAK -STAT Signaling as a Target for 297 Inflammatory and Autoimmune Diseases: Current and Future Prospects, Drugs.77(2017):521- 546, 298 https//doi: 10.1007/s40265-017-0701-9. 299 [4] Akio Morinobu, JAK inhibitors for the treatment of rheumatoid arthritis, Immunol Med. 43(2020):148-300 155, https://doi: 10.1080/25785826.2020.1770948. 301 [5] S. Choi, H. J. Jung, M. W. Kim, J. Kang, D. Shin, Y . Jang, Y . S. Yoon, S. H. Oh, A novel STAT3 inhibitor, 302 STX-0119, attenuates liver fibrosis by inactivating hepatic stellate cells in mice, Biochem Biophys 303 Res Commun. 513(2019)49-55, https://doi:10.1016/j.bbrc.2019.03.156. 304 [6] M. Pedroza, S. To, S. Assassi, M. Wu, D. Tweardy, S. K. Agarwal, Role of STAT3 in skin fibrosis and 305 transforming growth factor beta signaling, Rheumatology . 57(2018) 1838 –1850, https://doi: 306 10.1093/rheumatology/kex347 307 [7] J. Yoo, J. Jeong, A. T. Fazleabas, C. Tayade, S. L. Young, B. A. Lessey, Protein Inhibitor 308 of Activated STAT3 (PIAS3) Is Down -Regulated in Eutopic Endometrium of Women with 309 Endometriosis, Biol Reprod. 95(2016)11, https://doi:10.1095/biolreprod.115.137158.Epub 2016 May 310 25 311 [8] Bul letti C, Coccia ME, Battistoni S, Borini A. Endometriosis and infertility. J Assist Reprod Genet 312 2010;27:441–447 313 11 [9] Brosens J, Verhoeven H, Campo R, Gianaroli L, Gordts S, Hazekamp J, Hagglund L, Mardesic M, 314 Varila E, Zech J et al. High endometrial aroma tase P450 mRNA expression is associated with poor 315 IVF outcome. Hum Reprod 2004;19:352–356 316 [10] Zhao H, Zhou L, Shangguan AJ, Bulun SE. Aromatase expression and regulation in breast and 317 endometrial cancer. J Mol Endocrinol 2016; 57:R19–R33. 318 [11] T. Kawakita, T. Kato, T. Iwasa, O. Erdenebayar, Y Kadota, K. Kasai, K. Yoshida, M. Irahara, Mental 319 stress promotes the proliferation of endometriotic lesions in mice, Cytokines.135(2020) 155222, 320 https://doi.org/10.1016/j.cyto.2020.155222 321 [12] T. Kim, J. Yoo, H. Kim,J. Gilbert,B. Ku, J. Li, G.B. Mills, R. R. Broaddus, J. P. Lydon, J. Lim, H. Yoon, 322 J. Jeong, Mig- 6 suppresses endometrial cancer associated with Pten deficiency and ERK activation, 323 Cancer Res. 74(2014): 7371–7382, https://doi: 10.1158/0008-5472.CAN-14-0794 324 [13Rosengren S, Corr M, Firestein GS, Boyle DL. The JAK inhibitor CP690,550 (tofacitinib) inhibits TNF-325 induced chemokine expression in fibroblast-like synoviocytes: autocrine role of type I interferon. Ann 326 Rheum Dis 2012;71:440–447 327 [14] Mehtap S, Huseiyn A, Ahmet A, Mehmet Erim D, Ali S. The effects of the JAK-STAT signal pathway 328 inhibition on collagen biosynthesis in fibroblast cell culture. Arthritis Rheumatol 329 2018;70:https://acrabstracts.org/abstract/the-effects-of-the-jak-stat-signal-pathway-inhibition-on-330 collagen-biosynthesis-in-fibroblast-cell-culture/. Accessed April 29, 2020 331 [15] Kotlyar AM, Mamillapalli R, Flores V A, Taylor HS. Tofacitinib alters STAT3 signaling and leads to 332 endometriosis lesion regression. Mol Hum Reprod. 2021 Mar 24;27(4):gaab016. doi: 333 10.1093/molehr/gaab016. 334 [16] Lebovic DI, Mueller MD, Taylor RN. Immunobiology of endometriosis. Fertil Steril 2001;75:1–10 335 [17] Weiss G, Goldsmith LT, Taylor RN, Bellet D, Taylor HS. Inflammation in reproductive disorders. 336 Reprod Sci 2009;16:216–229 337 [18] Yoo JY , Jeong JW, Fazleabas AT, Tayade C, Young SL, Lessey BA. Protein inhibitor of activated 338 STAT3 (PIAS3) Is Down -regulated in eutopic endometrium of women with endometriosis. Biol 339 Reprod 2016; 95:11 340 [19] Kim BG, Yoo JY , Kim TH, Shin JH, Langenheim JF, Ferguson SD,Fazleabas AT, Young SL, Lessey 341 BA, Jeong JW. Aberrant activation of signal transducer and activator of transcription- 3 (STAT3) 342 signaling in endometriosis. Hum Reprod 2015;30:1069–10 343 [20] Capobianco A, Rovere-Querini P. Endometriosis, a disease of the macrophage. Front Immunol. 2013 344 Jan 28;4:9. doi: 10.3389/fimmu.2013.00009. eCollection 2013. 345 [21] Halme J, Becker S, Haskill S. Altered maturation and function of peritoneal macrophages: possible 346 role in pathogenesis of endometriosis. Am. J. Obstet. Gynecol. 1987;156:783–789. doi: 10.1016/0002-347 9378(87)90333-4. 348 [22] Ono Y , Kawakita T, Yoshino O, Sato E, Kano K, Ohba M, Okuno T, Ito M, Koga K, Honda M, Furue 349 12 A, Hiraoka T, Wada S, Iwasa T, Yokomizo T, Aoki J, Maeda N, Unno N, Osuga Y , Hirata S. 350 Sphingosine 1-Phosphate (S1P) in the Peritoneal Fluid Skews M2 Macrophage and Contributes to the 351 Development of Endometriosis. Biomedicines. 2021 Oct 22;9(11):1519. doi: 352 10.3390/biomedicines9111519. 353 [23] Young VJ, Brown JK, Saunders PT, Horne AW. The role of the peritoneum in the 354 pathogenesis of endometriosis. Hum Reprod Update 2013;19:558–569 355 [24] Itoh F, Komohara Y , Takaishi H, Honda R, Tashiro H, Kyo S, Katabuchi H, Takeya M. Possible 356 involvement of signal transducer and activator of transcription-3 in cell-cell interactions of peritoneal 357 macrophages and endometrial stromal cells in human endometriosis. Fertil Steril 2013;99:1705–1713. 358 [25] Chegini N, Gold LI, Williams RS. Localization of transforming growth factor beta 359 isoforms TGF-beta 1, TGF -beta 2, and TGF -beta 3 in surgically induced endometriosis in the rat. 360 Obstet Gynecol 1994;83:455–461. 361 [26] Oosterlynck DJ, Meuleman C, Waer M, Koninckx PR. Transforming growth factorbeta activity is 362 increased in peritoneal fluid from women with endometriosis. Obstet Gynecol 1994;83:287–292. 363 [27] Pizzo A, Salmeri FM, Ardita FV , Sofo V , Tripepi M, Marsico S. Behaviour of cytokine 364 levels in serum and peritoneal fluid of women with endometriosis. Gynecol Obstet Invest 2002;54:82–365 87. 366 [28] Hull M, Johan MZ, Hodge WL, Robertson SA, Ingman WV . Host-derived TGFB1 367 deficiency suppresses lesion development in a mouse model of endometriosis. Am J Pathol 368 2012;180:880–887. 369 [29] Zhao J, Yu H, Liu Y , Gibson SA, Yan Z, Xu X, Gaggar A, Li PK, Li C, Wei S, Benveniste EN, Qin H. 370 Protective effect of suppressing STAT3 activity in LPS-induced acute lung injury. Am J Physiol Lung 371 Cell Mol Physiol. 2016 Nov 1;311(5):L868- L880. doi: 10.1152/ajplung.00281.2016. Epub 2016 Sep 372 16. 373 374 375 376 13 Figure Legends 377 378 Fig. 1 Expression of STAT3 in clinical samples from women with endometriosis. 379 Staining (hematoxylin and eosin) of the uterus (A) and ovary (C) of patients with endometriosis . STAT3 380 protein was expressed in the glandular epithelium and interstitial tissue (B, D). Bars of defined lengths 381 are provided to indicate magnification.. STAT3, signal transduction and activator of transcription-3 382 Fig. 2 Cystic lesion in a mouse model of endometriosis. Gross endometriotic lesion (A). The lesion was sectioned and stained with hematoxylin and eosin (B) and for immunohistochemistry using an estrogen receptor -α antibody (C). The same location was also immunohistochemically stained using a STAT3- antibody. (D.E), Bars of defined lengths are provided to indicate magnification STAT3, signal transduction and activator of transcription-3 Fig. 3 Endometriosis lesion numbers and areas. The tissues of mice administered a STAT3 inhibitor (treatment group) or phosphate buffered saline (control group) were harvested after 1, 2, and 3 weeks of daily doses. Data are expressed as the means ± standard error of the mean. The numbers of lesions observed in animals in control (A) and treatment (B) groups are shown. The area of the lesions observed in animals in the control (C) and treatment (D) groups are also shown. STAT3, signal transduction and activator of transcription-3. * P < 0.05 vs. animals at week 0. ** P < 0.05 vs. animals at week 1 Fig. 4 Intraperitoneal inflammatory response during administration of STAT3 inhibitor. Cytokine levels in the peritoneal lavage fluid and messenger RNA (mRNA) levels in ascites cells were measured relative to the levels of glyceraldehyde 3-phosphate dehydrogenase. IL-6 (A) and TGF-β (B) mRNA levels in ascites cells are shown as is the concentration of IL-6 (C) and TGF-β (D) in the peritoneal lavage fluid. Data are expressed as means ± standard error of the mean. * P < 0.05 vs. week 0 results; ** P < 0.05 vs. week 1 results. STAT3, signal transduction and activator of transcription-3; IL, interleukin; TGF, transforming growth factor Fig. 5 Cytokine messenger RNA levels in endometriotic lesions. The levels of interleukin-6 (A) transforming growth factor-β (B) messenger RNA in endometriotic lesions are shown A B C D Fig. 1 Fig. 2 0w 1w 2w 3w A B C D 0w 1w 2w 3w 0w 1w 2w 3w0w 1w 2w 3w (mm2) (mm2) * * ** **** Fig. 3 IL6 mRNA TGF-β mRNA 0w 1w 2w 3w TGF-β concentration Relative to GAPDH Relative to GAPDHIL-6 concentration 0w 1w 2w 3w 0w 1w 2w 3w 0w 1w 2w 3w * * * A B C D ** ** Fig. 4 0 0.5 1 1.5 2 2.5 0 1 2 3 4 5 6 7 0w 1w 2w 3w 0w 1w 2w 3w Relative to GAPDH Relative to GAPDH IL6 mRNA TGF-β mRNAA B Fig. 5

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

MeSH descriptors

Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis Endometriosis

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-09-15T06:16:59.523076+00:00
pubmed
last seen: 2026-09-15T06:16:23.377490+00:00
unpaywall
last seen: 2026-05-14T19:30:52.867331+00:00
License: CC-BY-NC-ND-4.0 · commercial use OK · attribution required
Courtesy of the U.S. National Library of Medicine