High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma

High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma View ORCID Profile Florencia Cidre-Aranaz , Claudia Magrin , Malenka Zimmermann , Jing Li , Anna Lisa Baffa , Matteo Ciccaldo , View ORCID Profile Wolfgang Hartmann , Uta Dirksen , Martina Sola , View ORCID Profile Paolo Paganetti , View ORCID Profile Thomas G P Grünewald , Stéphanie Papin doi: https://doi.org/10.1101/2025.02.10.635652 Florencia Cidre-Aranaz 1 Hopp-Children’s Cancer Center (KiTZ) , Heidelberg, Germany 2 Division of Translational Pediatric Sarcoma Research, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), Heidelberg, Germany 3 National Center for Tumor Diseases (NCT), NCT Heidelberg, a partnership between DKFZ and Heidelberg University Hospital , Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Florencia Cidre-Aranaz Claudia Magrin 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland 5 Faculty of Biomedical Sciences, Università della Svizzera Italiana , Lugano, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Malenka Zimmermann 1 Hopp-Children’s Cancer Center (KiTZ) , Heidelberg, Germany 2 Division of Translational Pediatric Sarcoma Research, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), Heidelberg, Germany 3 National Center for Tumor Diseases (NCT), NCT Heidelberg, a partnership between DKFZ and Heidelberg University Hospital , Germany 7 Pediatrics III, University Hospital Essen, West German Cancer Center, German Cancer Consortium (DKTK) site Essen, National Center for Tumor Diseases (NCT) West , Essen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jing Li 1 Hopp-Children’s Cancer Center (KiTZ) , Heidelberg, Germany 2 Division of Translational Pediatric Sarcoma Research, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), Heidelberg, Germany 3 National Center for Tumor Diseases (NCT), NCT Heidelberg, a partnership between DKFZ and Heidelberg University Hospital , Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Anna Lisa Baffa 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Matteo Ciccaldo 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Wolfgang Hartmann 6 Gerhard-Domagk-Institute of Pathology, Münster University Hospital , Münster, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Wolfgang Hartmann Uta Dirksen 7 Pediatrics III, University Hospital Essen, West German Cancer Center, German Cancer Consortium (DKTK) site Essen, National Center for Tumor Diseases (NCT) West , Essen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Martina Sola 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland 5 Faculty of Biomedical Sciences, Università della Svizzera Italiana , Lugano, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Paolo Paganetti 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland 5 Faculty of Biomedical Sciences, Università della Svizzera Italiana , Lugano, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Paolo Paganetti For correspondence: paolo.paganetti{at}usi.ch t.gruenewald{at}dkfz-heidelberg.de Thomas G P Grünewald 1 Hopp-Children’s Cancer Center (KiTZ) , Heidelberg, Germany 2 Division of Translational Pediatric Sarcoma Research, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), Heidelberg, Germany 3 National Center for Tumor Diseases (NCT), NCT Heidelberg, a partnership between DKFZ and Heidelberg University Hospital , Germany 9 Institute of Pathology, Heidelberg University Hospital , Heidelberg, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Thomas G P Grünewald For correspondence: paolo.paganetti{at}usi.ch t.gruenewald{at}dkfz-heidelberg.de Stéphanie Papin 4 Laboratory for Aging Disorders, Laboratories for Translational Research, Ente Ospedaliero Cantonale , Bellinzona, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The microtubule-associated protein Tau (encoded by the MAPT gene) is linked to a family of neurodegenerative disorders defined as tauopathies, which are characterized by its brain accumulation in neurofibrillary tangles and neuropil threads. Newly described Tau functions comprise DNA protection, chromatin remodeling, p53 regulation and cell fate modulation, suggesting a role of Tau in oncogenesis. Bioinformatic-supported characterization of Tau in cancer reveals robust expression in bone cancer cells, in particular Ewing sarcoma (EwS) cell lines. EwS is an aggressive cancer caused by a fusion of members of the FET and ETS gene families, primarily EWSR1::FLI1 . Here we found that MAPT is a EWSR1::ETS target gene and that higher Tau expression in EwS cells inhibited their migratory and invasive behavior, consistent with a more immobile and proliferative phenotype observed in EwS. Indeed, we report that high Tau expression is associated with improved overall survival of EwS patients. We also show that the sessile but proliferative phenotype of EWSR1::ETS-high cells may result from a modulatory role of Tau on focal adhesion to extracellular matrix proteins. Our data highlight the utility of determining Tau expression as a prognostic factor in EwS as well as the opportunity to target Tau expression as an innovative EwS therapy. Introduction Tauopathies comprise a group of neurodegenerative disorders including Alzheimer’s disease (AD) and are characterized by progressive Tau deposition in neurofibrillary tangles 1 . Autosomal dominant mutations in MAPT encoding for microtubule-associated Tau proteins are responsible for frontotemporal lobar degenerations (FTLD-Tau) 2 – 4 . A prevalent hypothesis for the pathogenesis of tauopathies is that aberrant Tau modification, such as increased phosphorylation and a rigid conformation, contributes to Tau dissociation from microtubules and multimeric β-sheet assembly, which correlates with proteotoxicity, neuronal dysfunction and cell death 5 , 6 . Interestingly, non-canonical functions have been reported for Tau. For instance, Tau translocates to the cell nucleus upon heat or oxidative stress and protects DNA 7 – 11 . Neurons knocked-out for MAPT display enhanced DNA damage 12 , and induced DNA damage correlates with nuclear translocation and dephosphorylation of Tau 13 . Chromosomal abnormalities in AD fibroblasts 14 and frequent DNA damage in AD brains 15 , 16 both reinforce the emerging Tau function in DNA stability. Tau depletion also deregulates DNA damage-induced apoptosis and cell senescence by a mechanism involving MDM2-dependent p53 degradation 17 , 18 . Additional functions of Tau in epigenetic modulation were reported 19 , 20 . Upon histone binding, Tau stabilizes chromatin compaction 19 , 21 – 24 and affects global gene expression during the neurodegenerative process 21 , 22 . All these non-canonical functions hint to an implication of Tau in cancer. In fact, several studies reported a correlation between MAPT mRNA expression and survival in various cancer types 25 – 27 . Whereas a positive correlation is found in neuroblastoma, breast cancer, low grade glioma, kidney clear cell carcinoma, lung adenocarcinoma and pheochromocytoma-paraganglioma, a negative correlation is reported in colon cancer and head and neck cancers, liver hepatocellular carcinoma and uterine corpus endometrial carcinoma 25 , 27 – 29 . A recent bioinformatic study suggests that the implication of Tau in cancer is likely mediated by modulation of three main pathways: epithelial-to-mesenchymal transition (EMT), inflammation, and regulation of the cell cycle 27 . In addition, Tau mutations are associated to an increased cancer risk 30 . Microtubule-related and non-canonical functions of Tau may underlie these observations 17 , 20 , 26 . Here we report that Tau is highly expressed in Ewing sarcoma (EwS) – an aggressive bone or soft tissue cancer mainly affecting children, adolescents, and young adults. EwS is caused by a chromosomal translocation generating a fusion protein with aberrant transcriptional activity composed of members of the FET and ETS gene families, primarily EWSR1::FLI1 31 . We demonstrated that MAPT mRNA expression in EwS tumors positively correlates with survival, possibly mediated by a modulatory role of Tau on EwS cell adhesion, migration, and invasion. Results MAPT is a target gene of the EWSR1::FLI1 fusion protein To first characterize the expression of Tau in different cancer-derived cell lines, we mined the DepMap data collection ( https://depmap.org/portal/ ). As expected, neuroblastoma lines harbored the highest MAPT gene expression. Strikingly, bone-derived cell lines showed the second strongest MAPT expression, while portraying a strong inter-cell line variability ( Fig. 1A ). To better understand this aspect, we explored the MAPT expression in each different bone sarcoma, and observed that EwS cell lines presented a significantly higher MAPT expression than osteosarcoma and chondro­sarcoma cell lines ( Fig. 1B ). These results were further validated using gene expression microarray data derived from a distinct panel of 18 EwS cell lines expressing EWSR1::FLI1 (type 1 or type 2) or EWSR1::ERG 32 . Here again, most cell lines, beside A-673 and CHLA-25, displayed high MAPT transcripts ( Table 1 ). Download figure Open in new tab Figure 1. MAPT mRNA is highly expressed in EwS. A. MAPT transcript in DepMap cell lines originating from the indicated cancer types. TPM = transcript per million. Horizontal bar = median. One-way ANOVA (p<0.0001) and Dunnett’s multiple comparison to EwS (in red). B. MAPT mRNA in bone-derived EwS, osteosarcoma and chondrosarcoma. Horizontal bar = median. One-way ANOVA (p<0.0001) and Tukey’s multiple comparison to EwS (in red). C. MAPT mRNA in patient-derived mouse xenograft derived from the indicated cancer types. Horizontal bar = median. One-way ANOVA (p<0.0001) and Dunnett’s multiple comparison to EwS (in red). We then analyzed MAPT expression in patient-derived xenografts (PDX) from the pediatric preclinical testing consortium 33 . In agreement with our previous observations, EwS PDXs displayed the highest MAPT mRNA levels as compared to all other pediatric tumors ( Fig. 1C ). Thus, EwS cells were characterized by high MAPT gene expression. To better characterize the potential interplay between MAPT and EWSR1::FLI1, we first analyzed single cell transcriptomic data derived from three EwS PDX in comparison with two primary cultures of mesenchymal stem cells (MSC) 34 , a proposed EwS cell-of-origin 35 . Interestingly, the MSC primary cultures showed negligible levels of MAPT mRNA, whereas the three EwS PDXs showed significantly higher MAPT expression ( Fig. 2A ), thus suggesting a potential regulatory role of the EwS fusion protein on MAPT expression. To further explore this interplay, we analyzed data derived from 18 EwS cell lines with a doxycycline-inducible EWSR1::ETS-knock-down (KD) 32 . In the great majority of the lines, EWSR1::FLI1 or EWSR1::ERG-KD reduced MAPT transcripts ( Fig. 2B ) and Tau proteins ( Fig. 2C ). ChIP-Seq data from these EwS cell lines ( http://r2platform.com/escla/ ) revealed a prominent EWS::ETS peak close to the MAPT gene corresponding to a core EWS::ETS site 32 in all cell lines analyzed ( Fig. 2D ). In agreement with the induction of H3K27 acetylation upon EwS fusion proteins binding to DNA 32 , a concomitant H3K27Ac peak was also detected. Overall, these results indicated that EWSR1::FLI1 and EWSR1::ERG induced MAPT expression. Download figure Open in new tab Figure 2. MAPT is a target gene of the EWSR1::FLI1 fusion protein. A. Single cell MAPT mRNA in EwS patient-derived mouse xenografts or in mesenchymal stem cells (MSC). Horizontal bar = median. One-way ANOVA (p<0.0001) and Tukey’s multiple comparison. B. Relative expression of MAPT transcripts in the indicated EwS cell lines upon doxycycline-induced downregulation of the EWSR1::FLI1 fusion protein normalized for non-induced cells. 2way ANOVA (p<0.0001 for cell line and knock-down) and Šídák’s multiple comparison between non-induced and induced for each cell line. C. Relative expression of Tau protein in the indicated EwS cell lines upon induced downregulation of the EWSR1::FLI1 fusion protein normalized for non-induced cells. 2way ANOVA (p<0.0001 for cell line and knock-down) and Šídák’s multiple comparison between non-induced and induced for each cell line. D. Identification of chromatin immunoprecipitation events along the MAPT gene corresponding to EWSR1::FLI1 and H3K27ac binding in the indicated EwS cell lines. Tau-KD affects EwS cell adhesion, migration, and invasion To explore the role of the EWSR1::FLI1-dependent increase in Tau expression for cancer-associated cellular phenotypes, we engineered the EwS cell line TC-32 with inducible inhibition of Tau expression ( Fig. 3A ) and the EwS cell line TC-71 with constitutive inhibition of Tau expression ( Fig. 3B ). For the TC-32 line in particular, Tau downregulation was relatively modest after induction of the Tau shRNA for at least two weeks, perhaps because of the long life of Tau protein 36 . Nonetheless, under these conditions of partial Tau-KD, we observed decreased cell proliferation for both lines ( Fig. 3C-D ), an observation conceivably linked to the microtubule-binding function of Tau during mitosis 37 , 38 . Download figure Open in new tab Figure 3. Tau protein knock-down affects adhesion, migration, and invasion. A. Lysates from biological triplicates from inducible TC-32 Tau-KD cells not (ctrl) or treated (KD) with doxycycline for 2.5 weeks were analyzed by western blot with the mouse Tau13 antibody, the mouse actin antibody, and the rabbit GAPDH antibody, followed by visualization with anti-mouse IgG IRDye 680RD and anti-rabbit IgG IRDye 800CW. Intensity of the Tau and GAPDH signals is reported as ratio Tau/GAPDH (n=15). B. Lysates from biological triplicates were prepared from constitutive TC-71 Tau-KD and analyzed by western blot with Tau13 and GAPDH antibodies visualized with anti-mouse IgG IRDye 680RD and anti-rabbit IgG IRDye 800CW. Signal intensity is reported as ratio Tau/GAPDH (n=6). C. TC-32 Tau-KD cells in MW96 were imaged for confluency at the Incucyte every 2 h and cell proliferation calculated over 72 h starting from time 0 (n=12). D. Same as in C. for TC-71 Tau-KD cells (n=6). E. Adherent TC-32 Tau-KD cells 30 min after plating on laminin (LAM), fibronectrin (FN) or Matrigel (MG) were stained with crystal violet (n=22 for LAM and FN, n=4 for MG). F. TC-32 Tau-KD cells were seeded in transwell inserts without any coating. Cells were imaged with crystal violet on the other side of the filters 2 days later and quantified with ImageJ (n=6). KD data were normalized over ctrl, reported as mean ± SD and analyzed with the Mann-Whitney test. G. As in F. for TC-32 Tau-KD cells seeded in transwell inserts pre-coated with Matrigel. H. A wound was automatically generated on a TC-71 Tau-KD cell monolayer in MW96 and closure of the wound was imaged at the Incucyte every 2 h to determine their migration capabilities (n=12). KD data were normalized over ctrl, reported as mean ± SD and analyzed with the Mann-Whitney test. It is well-accepted that metastasis is a critical factor contributing to cancer malignancy in addition to tumor growth at the primary site 39 . Metastasis may be modelled in vitro by testing cell adhesion, migration and invasion. Intriguingly, TC-32 cell adhesion was found increased by Tau-KD on culture plates coated with the extracellular matrix proteins laminin, fibronectin and matrigel ( Fig. 3E ). Tau-KD also increased migration of TC-32 and TC-71 EwS cells ( Fig. 3F-G ) and enhanced TC-32 cell invasion in a transwell assay ( Fig. 3H ). Concordantly, doxycycline-treatment of TC-32 control cells did not affect these phenotypes ( Suppl. Fig. 1 ). This excluded a nonspecific effect of doxycycline but confirmed the participation of Tau in these cellular mechanisms. Overall, the data obtained showed that high Tau expression in EwS results in an inhibition of the migratory/invasive phenotype in EwS cell lines. Changes in EMT markers and morphology in Tau-KD cells Recent studies reported a possible link between Tau expression and the EMT pathway in cancer 27 . To question the implication of this pathway in the increased adhesion, migration and invasion observed in Tau-KD cells, we determined the phosphorylation status of the focal adhesion kinase (FAK) as a key regulator of these processes 40 , and vimentin as a representative EMT marker 41 . Tau-KD increased both Tyr 397 phosphorylation of FAK (P-FAK) and the expression of vimentin ( Fig. 4A ). No changes in P-FAK and vimentin were found in doxycycline-treated control TC-32 ( Suppl. Fig. 2 ). Immune staining analysis confirmed increased P-FAK in Tau-KD cells ( Fig. 4B ). Whilst the number of focal adhesion foci visualized by phalloidin-staining was unaffected by the expression of Tau, Tau-KD cells displayed qualitatively larger focal adhesion points. In fact, Tau-KD led to more flat, elongated EwS cells displaying a prominent actin network when compared to the characteristic small and round morphology with relatively few actin filaments observed in normal EwS cells ( Fig. 4B ). Download figure Open in new tab Figure 4. Tau-KD leads to change in EMT-like markers and cell morphology. A. Lysates from biological triplicates were prepared from TC-32 Tau-KD not (ctrl) or treated (KD) with doxycycline for 2.5 weeks. Samples were analyzed by western blot with P-FAK, FAK, vimentin and GAPDH antibodies. Primary antibodies were detected with anti-rabbit IgG IRDye 800CW or anti-mouse IgG IRDye 680RD. The intensity of the signal is reported as ratio P-FAK/FAK and vimentin/GAPDH (n=15). B. TC-32 Tau-KD cells were fixed and stained with phalloidin-AF488 and P-FAK antibody followed by secondary anti-rabbit-AF647 and counterstained with DAPI. Images were acquired on a confocal microscope and mean ± sem P-FAK focal adhesion area was quantified with ImageJ (n=738-746 adhesion points). KD data were normalized over ctrl, reported as mean ± SD and analyzed with the Mann-Whitney test. MAPT gene expression positively correlates with overall survival of EwS patients Since our in vitro data suggested that high Tau expression could attenuate the aggressiveness of EwS cells by decreasing their migratory/invasive potential, we next analyzed a patient cohort composed of 166 EwS patients 32 , 42 . In agreement with our in vitro results, this analysis revealed that high MAPT expression was significantly associated with better survival ( p =0.0002) ( Fig. 5A ). To validate these results in a second cohort using a complementary method, we immunohistochemically evaluated Tau protein expression in an EwS tissue microarray containing 50 patient samples. Survival analysis on these samples confirmed the association high Tau expression with better survival in EwS ( Fig. 5B ). Collectively, these results on the association of high MAPT expression with better prognosis suggest a protective role of Tau in EwS. Download figure Open in new tab Figure 5. MAPT mRNA and Tau protein expression in EwS is linked to survival. A. Kaplan-Meier survival curve of an EwS cohort separated on the basis of expression of the MAPT mRNA in the two subgroups high (above mean value) or low (below mean value). Two-sided Log-rank (Mantel-Cox) test. B. as in A. but based on Tau protein expression determined by immunohistochemistry. One-sided Log-rank (Mantel-Cox) test. Discussion We report that in EwS, MAPT is targeted and activated by the aberrant transcription factors EWSR1::ETS. Our data support an active involvement of the MAPT transcript Tau protein in the pathogenesis of EwS. In vitro , high Tau protein in EwS cells was associated with reduced adhesion, migration, invasion, and decreased EMT markers. Concordantly, in clinical samples EwS patient survival positively correlated with MAPT expression. A positive correlation between MAPT mRNA levels and survival was reported also in other cancers such as low-grade glioma, breast cancer, kidney clear cell carcinoma, lung adenocarcinoma, and pheochromocytoma/paraganglioma 27 , 43 . In contrast, Tau expression negatively correlates with survival in colorectal adenocarcinoma and skin melanoma 27 , 43 . Among the Tau-associated genes linked to the correlation between Tau expression and patient’s survival 27 , several encode for structural proteins and extracellular matrix components, which are involved in cell adhesion, migration, and the EMT 44 , 45 . A direct role of Tau in its positive correlation with survival has been explored in different glioma models 46 . In human glioblastoma LN229 cells, Tau overexpression impaired cell migration and invasion without altering cellular proliferation 47 . In contrast, Tau-KD in glioblastoma U87 cells increased Rho/ROCK signaling and inhibited cell migration 48 , 49 . The full understanding of the Tau-dependent mechanisms mediating migration and invasion requires further investigation. A strong clue comes from the regulatory function of the microtubule-associated protein Tau on the organization of microtubules (MT) and the cytoskeleton 50 . Cell motility and mitosis are MT-orchestrated processes. It is therefore likely that Tau-dependent remodeling of the cytoskeleton impacts on disease in EwS, which is a highly metastatic cancer associated with exacerbated cell migration, as reported in glioma cells 46 , 48 , 49 . Compellingly, the increase in migration and invasion in EwS cells with Tau-KD resembles the phenotype of EwS cells with low EWSR1::FLI1 expression. These correlate with a more aggressive metastasis spread when compared to cells with high EWSR1::FLI1 expression, that in turn are characterized by highly active proliferation but reduced invasiveness 51 . In fact, decreased EWSR1::FLI1 expression leads to major changes in effectors of actin cytoskeleton and adhesion process dynamics with a shift from cell-to-cell to cell-matrix adhesion 51 . Reciprocally, analysis of focal adhesion architecture and actin cytoskeletal organization revealed that cells expressing high level of EWSR1::FLI1 present with a loss of actin stress fibers and reduced size and number of focal adhesions, structural changes that likely account for the functional deficit in cell adhesion, an important step in the final colonization of metastatic cells 52 . Corresponding changes in cellular morphology have also been observed following expression of EWSR1::FLI1 in human mesenchymal stem cells, which causes the conversion of a well-spread, fibroblast-like shape to a rounded cell morphology 52 . In summary, these changes in the case of a low EWSR1:FLI1 expression are associated with a dramatic increase of in vivo cell migration and invasion potential 51 and it is believed that this cell-to-cell variation of EWSR1::FLI1 expression levels may constitute a critical component of the early metastatic process occurring in EwS 52 . It is important to note that classical models of metastasis are derived from study of epithelial-derived tumor cells, which undergo an EMT during acquisition of metastatic potential. Non-epithelial tumors, such as sarcomas, may follow a different metastasis process. Sarcomas are mesenchymal tumors, and whether an EMT-equivalent process occurs, allowing for increased cellular adhesion, migration, and invasion, is unknown 53 . Still, given the similarities in the phenotypes of Tau-KD and EWSR1::FLI1-KD cells, we may hypothesize that Tau expression may participate in driving the morphologic and migration/invasion characteristics associated to EWSR1::FLI1 expression, which would suggest a key role of Tau in the metastatic processes highly predominant in EwS. It is therefore plausible that Tau may act on survival through the modulation of these pathways. Materials and methods Data and code availability Cancer cell RNAseq data were downloaded from https://depmap.org/portal/ . RNAseq data from PDXs were downloaded from https://www.cbioportal.org/ . Gene expression microarray and proteomic data associated to the 18 EwS cell lines were already published 32 and are deposited under accession code: GSE176190. Publicly available and pre-processed ChIP-Seq data from EwS cells corresponding to EWSR1::ETS and H3K27Ac were retrieved, analyzed and displayed using R2 genomics analysis and visualization platform ( http://r2platform.com/escla/ ) 32 for the MAPT locus. Single cell data of MSCs and EwS PDXs is publicly available under accession code GSE130025 34 . Any additional information required to reanalyze the data reported in this work paper is available upon request. Survival analysis Kaplan-Meier survival analyses of mRNA expression data were carried out in 166 EwS patients whose molecularly confirmed and retrospectively collected primary tumors were profiled at the mRNA level by gene expression microarrays in previous studies 42 . To that end, microarray data generated on Affymetrix HG-U133Plus2.0, Affymetrix HuEx-1.0-st or Amersham/GE Healthcare CodeLink microarrays of the 166 EwS tumors (Gene Expression Omnibus (GEO) accession codes: GSE63157, GSE12102, GSE17618, GSE34620 provided with clinical annotations were normalized separately as previously described 54 . Only genes that were represented on all microarray platforms were kept for further analysis. Batch effects were removed using the ComBat algorithm 55 . Data processing was done in R. The validation cohort was previously described 42 . In Kaplan-Meier survival analyses, statistical differences between the groups were assessed by both the Mantel-Cox test. Immunohistochemistry For the detection of Tau by IHC on xenografts and EwS patients’ tumors, 4-μm paraffin sections were incubated 1 h at 65°C and rehydrated using Ottix Plus and Ottix Shaper solutions according to manufacturer’s instructions (DiaPath X0076, X0096). Sections were subsequently washed 10 min in PBS 1X and incubated for 5 min at RT in 3% H 2 O 2 to block peroxidase activity. Following two washes in PBS 1×, an antigen retrieval step was performed through incubation of the sections in 10 mM citrate buffer (pH 6) in a microwave (5 min at 730 W, 5 min at 400 W, 5 min at 520 W). After cooling down and two washes in PBS, blocking was achieved through a 1-h incubation at RT with normal horse serum (VECTASTAIN Elite ABC Universal PLUS Kit, Vector laboratories PK8200). The anti-Tau antibody Tau 13 (sc-21796, SantCruz Biotechnology) was then incubated at 2 μg/ml for 1 h at RT and the sections was then washed two times in PBS and incubated with biotinylated secondary antibodies for 1 h at RT (VECTASTAIN Elite ABC Universal PLUS Kit, Vector laboratories PK8200).Following two washes in PBS, the section was incubated in ABC solution (VECTASTAIN Elite ABC Universal PLUS Kit, Vector laboratories PK8200) for 30 min at RT, washed two times and incubated with DAB (DAB substrate kit, Vector laboratories SK-4100) until the section has become brown. The reaction was stopped washing the section in ddH 2 O, the tissues were counterstained with hematoxylin, washed and dehydrated using Ottix Shaper and Ottix Plus according to manufacturer’s instructions. The section was then mounted with glycerol. Images were acquired with a Zeiss Axio Lab.A1 Microscope (AxioCam ERc 5 s, Oberkochen, Germany). The intensity of marker immune reactivity was determined (grade 0=none, grade 1=low, grade 2=moderate and grade 3=strong). Generation of pseudolentiviral particles To generate the inducible Tau-KD, we used an inducible lentiviral plasmid system: pLKO-Tet-On all-in-one vector (Addgene, 21915) containing a tetracycline-regulated promotor driving the expression of shRNA. The shRNA (shRNA-75) cloned in the inducible vector target the third repeat of the microtubule domain of Tau (5’- CCGGGTGTGGCTCATTAGGCAACATCTCGAGATGTTGCCTAATGAGCCACACTTTTTG-3’). For the constitutive downregulation of Tau, the Tau-specific shRNA 3127 (5’-GATCCAGCAGACGATGTCAACCTTGTGCTTCCTGTCAGACACAAGGTTGACA TCGTCTGCCTTTTTG-3’) was inserted in the pGreenPuro vector (SI505A-1, System Biosciences). Pseudo-lentiviral particles were produced in HEK-293 cells (HEK 293TN, System Biosciences) with the pPACKH1 kit (LV500A-1, System Biosciences) by the calcium phosphate transfection method. Particles were harvested 48–72 h later, concentrated on a centrifugal filter (MWCO 30 kDa, UFC903024, Amicon), aliquoted and stored at −80 °C until use. Cell culture and lentiviral transduction EwS cell lines TC-32 and TC-71 originated from the Childhood Cancer Repository ( https://www.cccells.org ). Cells are cultured in RPMI 1640 medium (ThermoFisher Scientific, 11875093) supplemented with 10% Fetal Bovine Serum without Tetracycline (FBS, 10270106, Gibco), 1% Penicillin-Streptomycin (PS, Gibco, 15140122), 1% Non-Essential Amino acids (NEAA, Gibco, 11140035). Cells were grown at 37 °C in saturated humidity and 5% CO2 and maintained in culture for less than one month. For the generation of Tau-KD cells, parental TC-32 and TC-71 cells (1×10 5 ) were seeded into a 24-well plate coated with poly-D-lysine (P6407, Sigma-Aldrich) one day before pseudo-lentiviral particle transduction. One day after transduction, cells were supplemented with fresh complete medium and selected in the presence of 2.5 μg/mL puromycin (P8833, Sigma-Aldrich) for two weeks. To induce the downregulation of Tau expression, TC-32 cells were incubated in the presence or absence of 0.5 μg/mL doxycycline (D9891, Sigma-Aldrich) for at least 2 weeks. Western blot Cells (7×10 5 ) were seeded into 6-well plates coated with poly-D-lysine (P6407, Sigma-Aldrich) in presence or absence of doxycycline. Two days after plating, total lysates were prepared in 100 μL of SDS-PAGE sample buffer (1.5% SDS, 8.3% glycerol, 0.005% bromophenol blue, 1.6% β-mercaptoethanol and 62.5 mM Tris pH 6.8) and incubated for 10 min at 100°C. 5 or 15 μL of the sample per lane was loaded on 10% SDS-polyacrylamide gels (SDS-PAGE). After SDS-PAGE, PVDF membranes with transferred proteins were incubated with the primary antibodies indicated in the figures: 0.2 μg/mL Tau13 (sc-21796 AF680, Santa-Cruz Biotechnology), 0.25 μg/mL rabbit monoclonal vimentin (ab92547, Abcam), 0.2 μg/mL FAK (ab76496, Abcam), 0.25 μg/ml P-FAK (611723, BD Transduction Lab) or 0.5 μg/mL GAPDH (ab181602, Abcam) antibody. Primary antibodies were revealed with anti-mouse IgG coupled to IRDye 680RD or anti-rabbit IgG coupled to IRDye 800CW (Licor Biosciences, 926–68070 & 926–32211) on a dual infrared imaging scanner (Licor Biosciences, Odyssey CLx 9140). Immune reactive bands were quantified with the software provided (Licor Biosciences, Image Studio V5.0.21, 9140–500). Immunostaining For immune staining, cells (5×10 4 ) were grown on poly-D-lysine coated 8-well microscope slides (80826-IBI, Ibidi). Cells were fixed in 4% paraformaldehyde and stained 13 with primary antibodies: 2 μg/mL P-FAK antibody (ab81298, Abcam), 0.2 μg/mL paxillin antibody (AHO0492, Invitrogen). Detection by fluorescent laser confocal microscopy (Nikon C2 microscope) was done with 2 μg/mL secondary antibody anti-rabbit IgG-Alexa 647 (A21245, Thermo Fisher Scientific). Nuclei were counterstained with 0.5 μg/mL DAPI (D9542, Sigma-Aldrich). Phalloidin-iFluor488 (ab176753, Abcam) was incubated for 1 hour at RT according to manufacturer’s instruction. Images were acquired by sequential excitations (line-by-line scan) with the 405 nm laser (464/40 emission filter), the 488 nm laser (525/50 nm filter), the 561 nm laser (561/LP nm filter) and the 650 nm laser (594/633 emission filter). ImageJ was used for all image quantifications. Cell adhesion assay 96-well plates were coated with fibronectin (F4759, Sigma-Aldrich), laminin (L2020, Sigma-Aldrich) or Matrigel (CLS356234-1EA, Sigma-Aldrich) for 1 h at 37°C. Plates were washed twice with PBS 1X and RPMI complemented with 10% FBS for 1 h at 37°C, blocked with 1% BSA in 1X PBS for 1 h at RT. Following blocking, 5×10 4 cells/well were added to plates in replicates of 4 to 6 per group. Plates were incubated at 37 °C for 30 min. Plates were washed with complete medium and fixed with methanol prior to staining with 0.05% crystal violet (HT90132, Sigma-Aldrich) in 20% ethanol for 20 min. Plates were washed with water and the dye was solubilized in 100% methanol. Absorbance per well was measured at 590 nm on a Tecan microplate reader. IncuCyte cell growth and wound healing assay Cell growth was measured using IncuCyte Zoom (Essen Biosciences) Live-Cell Analysis Platform. 5×10 3 TC-32 or 1×10 4 TC-71 cells were plated in 6 replicates in a 96-well plate and were imaged every 2 h with a 4× objective. The percent confluence of each well at each time point was calculated using IncuCyte Zoom image processing software. All replicate values were obtained over an incubation time of 3 d and normalized over the cell density at DIV 0 for TC-32 and DIV1 for TC-71. To measure cell migration, TC-71 cells were plated at a density of 7×10 5 cells/well. After 2 d, an open wound area was created in the cell monolayer using the IncuCyte® Wound Maker tool, washed with PBS and subsequently incubated with complete medium and wound closure was followed through image acquisition every 2 h. Transwell migration and invasion assays Transwell migration assays were performed in Transwell 8 μm pore size (3422-48, Chemie Brunschwig AG)). TC-32 cells were seeded at 6×10 5 cells/200 μL serum free-RPMI medium in the upper chamber. The lower chamber was filled with RPMI supplemented with 10% FBS. After 48-h incubation, the chambers were removed and fixed in 4% PFA for 10 min at RT, then washed with PBS 1×. The cells on the upper surface were removed using cotton swabs. Cells on the lower surface that migrated through the membrane were stained with 1% crystal violet in 2% Ethanol for 20 min at RT, washed thoroughly with water and air dried. Images (five per replicate) acquired at 10× magnification were quantified using ImageJ. This protocol is also followed for invasion assays except for the addition of 80 µl Matrigel (CLS356234-1EA, Sigma-Aldrich) diluted to 1 mg/ml in serum-free media) to the top of each insert 2 h at 37°C prior to adding cells. Statistics and reproducibility Statistical analysis was performed with GraphPad Prism version 8.4 using the method specified in the legend of each figure. Exact p -values are specified in the figures. All quantifications were performed based on at least three independent biological replicates. Sample size, number of replicates and how they are defined is specified in the figure legends. When indicated, western blots and microscopic images are shown as representative data. Fundings The laboratory of PP would like to thanks the following institutions for their financial support: the Fondazione Ticinese per la Ricerca sul Cancro, the Synapsis Foundation, the Gelu Foundation, the Mecri Foundation and the Gabriele Foundation. The laboratory of TGPG acknowledges support from the Matthias-Lackas foundation, the Dr. Leopold und Carmen Ellinger foundation, Dr. Rolf M. Schwiete foundation (2021-007; 2022-031), the German Cancer Aid (DKH-7011411, DKH-70115315, DKH-70115914), the Ministry of Education and Research (BMBF; SMART-CARE and HEROES-AYA), the KiKa foundation, and the Barbara and Wilfried Mohr foundation. The laboratory of TGPG is co-funded by the European Union (ERC, CANCER-HARAKIRI, 101122595). Views and opinions expressed are however those of the authors only and do not necessarily reflect those of the European Union or the European Research Council. Neither the European Union nor the granting authority can be held responsible for them. MZ was supported by scholarships of the Kind-Philipp foundation and the German Academic Scholarship Foundation. Author contributions Conceptualization: CM, SP, PP, FCA, TGPG Methodology: FCA, MZ, JL, CM Investigation: FCA, MZ, JL, CM, ALB, MC, MS, WH, UD Supervision: SP, PP, TGPG Writing: SP, PP, FCA, TGPG, MZ, JL Competing interests all authors declare they have no competing interest. Data and materials availability all data generated or analyzed during this study are included in this published article and its supplementary information files. Supplementary Figure Legends Supplementary Figure 1. Effect of doxycycline-treatment of parental TC-32 cells on adhesion, migration, and invasion. A. Lysates from biological triplicates were prepared from parental TC-32 cells not (ctrl) or treated (mock) with doxycycline for 2.5 weeks. Samples were analyzed by western blot with mouse Tau13 and rabbit GAPDH antibodies, followed by visualization with anti-mouse IgG IRDye 680RD and anti-rabbit IgG IRDye 800CW. Intensity of the signals is reported as ratio Tau/GAPDH (n=9). B. Parental TC-32 cells in MW96 were imaged for surface covered at the Incucyte every 2 h and cell proliferation calculated over 72 h starting from time 0 (n=12). C. Adherent parental TC-32 cells on the indicated cell substrates 30 min after plating and stained with crystal violet (OD590 nm normalized over ctrl (n= 4). D. TC-32 Tau-KD cells were seeded in transwell inserts without any coating (migration) or pre-coated with Matrigel (invasion). Cells were imaged on the other side of the filters 2 d later upon staining with crystal violet and quantified with ImageJ (n=3). Mock data were normalized over ctrl, reported as mean ± SD and analyzed with the Mann-Whitney test. Supplementary Figure 2. Changes in P-FAK and vimentin are not artefacts of doxycycline treatment. Lysates from biological triplicates were prepared from parental TC-32 not (ctrl) or treated (mock) or with doxycycline for 2.5 weeks. Samples were resolved on SDS-PAGE and analyzed by western blot with mouse P-FAK and rabbit FAK antibodies, the rabbit vimentin antibody, and the rabbit GAPDH antibody. Primary antibodies were detected using anti-rabbit IgG IRDye 800CW or anti-mouse IgG IRDye 680RD. Signal intensity was quantified and reported as ratio P-FAK/FAK or vimentin/GAPDH (n=9). Mock data were normalized over ctrl, reported as mean ± SD and analyzed with the Mann-Whitney test. Acknowledgments We thank the whole laboratory for support and advice during this study. The laboratory of TGPG thanks its technicians Nadine Gmelin, Stefanie Kutschmann, Sabrina Knoth, and Felina Zahnow for excellent technical assistance. We thank Prof. Daniel Baumhoer for providing histological samples. Footnotes ↵ $ co-first authors ↵ £ co-senior authors References 1. ↵ Long , J. M. & Holtzman , D. M . Alzheimer Disease: An Update on Pathobiology and Treatment Strategies . Cell 179 , 312 – 339 ( 2019 ). OpenUrl CrossRef PubMed 2. ↵ Hutton , M. et al. Association of missense and 5’-splice-site mutations in tau with the inherited dementia FTDP-17 . Nature 393 , 702 – 705 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 3. Spillantini , M. G. et al. Mutation in the tau gene in familial multiple system tauopathy with presenile dementia . Proc. Natl. Acad. Sci. U. S. A . 95 , 7737 – 7741 ( 1998 ). OpenUrl Abstract / FREE Full Text 4. ↵ Josephs , K. A . Rest in peace FTDP-17 . Brain J. Neurol . 141 , 324 – 331 ( 2018 ). OpenUrl CrossRef PubMed 5. ↵ Jeganathan , S. , von Bergen , M. , Mandelkow , E.-M. & Mandelkow , E . The natively unfolded character of tau and its aggregation to Alzheimer-like paired helical filaments . Biochemistry 47 , 10526 – 10539 ( 2008 ). OpenUrl CrossRef PubMed 6. ↵ Ludolph , A. C. et al. Tauopathies with parkinsonism: clinical spectrum, neuropathologic basis, biological markers, and treatment options . Eur. J. Neurol . 16 , 297 – 309 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ Loomis , P. A. , Howard , T. H. , Castleberry , R. P. & Binder , L. I . Identification of nuclear tau isoforms in human neuroblastoma cells . Proc. Natl. Acad. Sci. U. S. A . 87 , 8422 – 8426 ( 1990 ). OpenUrl Abstract / FREE Full Text 8. Greenwood , J. A. & Johnson , G. V . Localization and in situ phosphorylation state of nuclear tau . Exp. Cell Res . 220 , 332 – 337 ( 1995 ). OpenUrl CrossRef PubMed Web of Science 9. Cross , D. , Tapia , L. , Garrido , J. & Maccioni , R. B . Tau-like proteins associated with centrosomes in cultured cells . Exp. Cell Res . 229 , 378 – 387 ( 1996 ). OpenUrl CrossRef PubMed 10. Thurston , V. C. , Zinkowski , R. P. & Binder , L. I . Tau as a nucleolar protein in human nonneural cells in vitro and in vivo . Chromosoma 105 , 20 – 30 ( 1996 ). OpenUrl CrossRef PubMed Web of Science 11. ↵ Sultan , A. et al. Nuclear tau, a key player in neuronal DNA protection . J. Biol. Chem . 286 , 4566 – 4575 ( 2011 ). OpenUrl Abstract / FREE Full Text 12. ↵ Violet , M. et al. A major role for Tau in neuronal DNA and RNA protection in vivo under physiological and hyperthermic conditions . Front. Cell. Neurosci . 8 , 84 ( 2014 ). OpenUrl CrossRef PubMed 13. ↵ Ulrich , G. et al. Phosphorylation of nuclear Tau is modulated by distinct cellular pathways . Sci. Rep . 8 , 17702 ( 2018 ). OpenUrl CrossRef PubMed 14. ↵ Rossi , G. et al. A new function of microtubule-associated protein tau: involvement in chromosome stability . Cell Cycle Georget. Tex 7 , 1788 – 1794 ( 2008 ). OpenUrl CrossRef 15. ↵ Mullaart , E. , Boerrigter , M. E. , Ravid , R. , Swaab , D. F. & Vijg , J . Increased levels of DNA breaks in cerebral cortex of Alzheimer’s disease patients . Neurobiol. Aging 11 , 169 – 173 ( 1990 ). OpenUrl CrossRef PubMed Web of Science 16. ↵ Lovell , M. A. & Markesbery , W. R . Oxidative DNA damage in mild cognitive impairment and late-stage Alzheimer’s disease . Nucleic Acids Res . 35 , 7497 – 7504 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 17. ↵ Sola , M. et al. Tau affects P53 function and cell fate during the DNA damage response. Commun . Biol . 3 , 245 ( 2020 ). OpenUrl 18. ↵ Sola , M. et al. Tau protein binds to the P53 E3 ubiquitin ligase MDM2 . Sci. Rep . 13 , 10208 ( 2023 ). OpenUrl CrossRef PubMed 19. ↵ Rico , T. et al. Tau Stabilizes Chromatin Compaction . Front. Cell Dev. Biol . 9 , 740550 ( 2021 ). OpenUrl CrossRef PubMed 20. ↵ Magrin , C. et al. Tau protein modulates an epigenetic mechanism of cellular senescence in human SH-SY5Y neuroblastoma cells . Front. Cell Dev. Biol . 11 , 1232963 ( 2023 ). OpenUrl CrossRef PubMed 21. ↵ Frost , B. , Hemberg , M. , Lewis , J. & Feany , M. B . Tau promotes neurodegeneration through global chromatin relaxation . Nat. Neurosci . 17 , 357 – 366 ( 2014 ). OpenUrl CrossRef PubMed 22. ↵ Klein , H.-U. et al. Epigenome-wide study uncovers large-scale changes in histone acetylation driven by tau pathology in aging and Alzheimer’s human brains . Nat. Neurosci . 22 , 37 – 46 ( 2019 ). OpenUrl CrossRef PubMed 23. Montalbano , M. et al. RNA-binding proteins Musashi and tau soluble aggregates initiate nuclear dysfunction . Nat. Commun . 11 , 4305 ( 2020 ). OpenUrl CrossRef PubMed 24. ↵ Montalbano , M. et al. Tau Modulates mRNA Transcription, Alternative Polyadenylation Profiles of hnRNPs, Chromatin Remodeling and Spliceosome Complexes . Front. Mol. Neurosci . 14 , 742790 ( 2021 ). OpenUrl CrossRef PubMed 25. ↵ Gargini , R. , Segura-Collar , B. & Sánchez-Gómez , P . Novel Functions of the Neurodegenerative-Related Gene Tau in Cancer . Front. Aging Neurosci . 11 , 231 ( 2019 ). OpenUrl CrossRef PubMed 26. ↵ Papin , S. & Paganetti , P . Emerging Evidences for an Implication of the Neurodegeneration-Associated Protein TAU in Cancer . Brain Sci . 10 , ( 2020 ). 27. ↵ Callari , M. et al. Cancer-specific association between Tau (MAPT) and cellular pathways, clinical outcome, and drug response . Sci. Data 10 , 637 ( 2023 ). OpenUrl CrossRef PubMed 28. Zaman , S. , Chobrutskiy , B. I. & Blanck , G . MAPT (Tau) expression is a biomarker for an increased rate of survival in pediatric neuroblastoma . Cell Cycle Georget. Tex 17 , 2474 – 2483 ( 2018 ). OpenUrl CrossRef 29. ↵ Zaman , S. , Chobrutskiy , B. I. , Sikaria , D. & Blanck , G . MAPT (Tau) expression is a biomarker for an increased rate of survival for low-grade glioma . Oncol. Rep . 41 , 1359 – 1366 ( 2019 ). OpenUrl PubMed 30. ↵ Rossi , G. et al. Tau Mutations Serve as a Novel Risk Factor for Cancer . Cancer Res . 78 , 3731 – 3739 ( 2018 ). OpenUrl CrossRef PubMed 31. ↵ Grünewald , T. G. P. et al. Ewing sarcoma . Nat. Rev. Dis. Primer 4 , 5 ( 2018 ). OpenUrl CrossRef 32. ↵ Orth , M. F. et al. Systematic multi-omics cell line profiling uncovers principles of Ewing sarcoma fusion oncogene-mediated gene regulation . Cell Rep . 41 , 111761 ( 2022 ). OpenUrl CrossRef PubMed 33. ↵ Rokita , J. L. et al. Genomic Profiling of Childhood Tumor Patient-Derived Xenograft Models to Enable Rational Clinical Trial Design . Cell Rep . 29 , 1675 – 1689 .e9 ( 2019 ). OpenUrl CrossRef PubMed 34. ↵ Aynaud , M.-M. et al. Transcriptional Programs Define Intratumoral Heterogeneity of Ewing Sarcoma at Single-Cell Resolution . Cell Rep . 30 , 1767 – 1779 .e6 ( 2020 ). OpenUrl CrossRef PubMed 35. ↵ Tirode , F. et al. Mesenchymal stem cell features of Ewing tumors . Cancer Cell 11 , 421 – 429 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 36. ↵ Sato , C. et al. Tau Kinetics in Neurons and the Human Central Nervous System . Neuron 97 , 1284 – 1298 .e7 ( 2018 ). OpenUrl CrossRef PubMed 37. ↵ Bougé , A.-L. & Parmentier , M.-L . Tau excess impairs mitosis and kinesin-5 function, leading to aneuploidy and cell death . Dis. Model. Mech . 9 , 307 – 319 ( 2016 ). OpenUrl Abstract / FREE Full Text 38. ↵ Clementi , L. et al. Mitotic phosphorylation of Tau/MAPT modulates cell cycle progression in prostate cancer cells . J. Cancer Res. Clin. Oncol . 149 , 7689 – 7701 ( 2023 ). OpenUrl CrossRef PubMed 39. ↵ Fares , J. , Fares , M. Y. , Khachfe , H. H. , Salhab , H. A. & Fares , Y . Molecular principles of metastasis: a hallmark of cancer revisited . Signal Transduct. Target. Ther . 5 , 28 ( 2020 ). OpenUrl CrossRef PubMed 40. ↵ Tan , X. et al. Focal adhesion kinase: from biological functions to therapeutic strategies . Exp. Hematol. Oncol . 12 , 83 ( 2023 ). OpenUrl CrossRef PubMed 41. ↵ Usman , S. et al. Vimentin Is at the Heart of Epithelial Mesenchymal Transition (EMT) Mediated Metastasis . Cancers 13 , ( 2021 ). 42. ↵ Volchenboum , S. L. et al. Gene Expression Profiling of Ewing Sarcoma Tumors Reveals the Prognostic Importance of Tumor-Stromal Interactions: A Report from the Children’s Oncology Group . J. Pathol. Clin. Res . 1 , 83 – 94 ( 2015 ). OpenUrl CrossRef PubMed 43. ↵ Gargini , R. et al. The IDH-TAU-EGFR triad defines the neovascular landscape of diffuse gliomas . Sci. Transl. Med . 12 , eaax1501 ( 2020 ). OpenUrl Abstract / FREE Full Text 44. ↵ Kamil , M. et al. High filamin-C expression predicts enhanced invasiveness and poor outcome in glioblastoma multiforme . Br. J. Cancer 120 , 819 – 826 ( 2019 ). OpenUrl CrossRef PubMed 45. ↵ Nissen , N. I. , Karsdal , M. & Willumsen , N . Collagens and Cancer associated fibroblasts in the reactive stroma and its relation to Cancer biology . J. Exp. Clin. Cancer Res. CR 38 , 115 ( 2019 ). OpenUrl CrossRef PubMed 46. ↵ Hedna , R. et al. Tau Protein as Therapeutic Target for Cancer? Focus on Glioblastoma . Cancers 14 , ( 2022 ). 47. ↵ Nakata , S. , Price , A. , Eberhart , C. & Morris , M . Increased Tau Expression Correlates With IDH Mutation in Infiltrating Gliomas and Impairs Cell Migration . J. Neuropathol. Exp. Neurol . 79 , 493 – 499 ( 2020 ). OpenUrl CrossRef PubMed 48. ↵ Breuzard , G. et al. Tau regulates the microtubule-dependent migration of glioblastoma cells via the Rho-ROCK signaling pathway . J. Cell Sci . 132 , jcs222851 ( 2019 ). OpenUrl Abstract / FREE Full Text 49. ↵ Pagano , A. et al. Tau Regulates Glioblastoma Progression, 3D Cell Organization, Growth and Migration via the PI3K-AKT Axis . Cancers 13 , ( 2021 ). 50. ↵ Cabrales Fontela , Y. , et al. Multivalent cross-linking of actin filaments and microtubules through the microtubule-associated protein Tau . Nat. Commun . 8 , 1981 ( 2017 ). OpenUrl CrossRef PubMed 51. ↵ Franzetti , G.-A. et al. Cell-to-cell heterogeneity of EWSR1-FLI1 activity determines proliferation/migration choices in Ewing sarcoma cells . Oncogene 36 , 3505 – 3514 ( 2017 ). OpenUrl CrossRef PubMed 52. ↵ Chaturvedi , A. , Hoffman , L. M. , Welm , A. L. , Lessnick , S. L. & Beckerle , M. C . The EWS/FLI Oncogene Drives Changes in Cellular Morphology, Adhesion, and Migration in Ewing Sarcoma . Genes Cancer 3 , 102 – 116 ( 2012 ). OpenUrl CrossRef PubMed 53. ↵ Sannino , G. , Marchetto , A. , Kirchner , T. & Grünewald , T. G. P . Epithelial-to-Mesenchymal and Mesenchymal-to-Epithelial Transition in Mesenchymal Tumors: A Paradox in Sarcomas? Cancer Res . 77 , 4556 – 4561 ( 2017 ). OpenUrl Abstract / FREE Full Text 54. ↵ Baldauf , M. C. et al. Robust diagnosis of Ewing sarcoma by immunohistochemical detection of super-enhancer-driven EWSR1-ETS targets . Oncotarget 9 , 1587 – 1601 ( 2018 ). OpenUrl CrossRef PubMed 55. ↵ Stein , C. K. et al. Removing batch effects from purified plasma cell gene expression microarrays with modified ComBat . BMC Bioinformatics 16 , 63 ( 2015 ). View the discussion thread. Back to top Previous Next Posted February 12, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma Florencia Cidre-Aranaz , Claudia Magrin , Malenka Zimmermann , Jing Li , Anna Lisa Baffa , Matteo Ciccaldo , Wolfgang Hartmann , Uta Dirksen , Martina Sola , Paolo Paganetti , Thomas G P Grünewald , Stéphanie Papin bioRxiv 2025.02.10.635652; doi: https://doi.org/10.1101/2025.02.10.635652 Share This Article: Copy Citation Tools High Tau Expression Correlates with Reduced Invasion and Prolonged Survival in Ewing Sarcoma Florencia Cidre-Aranaz , Claudia Magrin , Malenka Zimmermann , Jing Li , Anna Lisa Baffa , Matteo Ciccaldo , Wolfgang Hartmann , Uta Dirksen , Martina Sola , Paolo Paganetti , Thomas G P Grünewald , Stéphanie Papin bioRxiv 2025.02.10.635652; doi: https://doi.org/10.1101/2025.02.10.635652 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cancer Biology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17650) Bioengineering (13871) Bioinformatics (41881) Biophysics (21424) Cancer Biology (18566) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13365) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22476) Immunology (17713) Microbiology (40331) Molecular Biology (17148) Neuroscience (88473) Paleontology (666) Pathology (2827) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)