Effective inactivated lumpy skin disease vaccine for cattle using a field viral strain and Montanide 206

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract Lumpy skin disease (LSD) causes significant economic losses to cattle industries. In Mongolia, LSD outbreaks were first reported in 2021, with a few additional cases later that year. The situation has since alleviated due to effective control measures, including the use of live-attenuated vaccines. However, unlike the inactivated vaccine, live-attenuated vaccines carry risks, including genetic recombination and vaccine-associated clinical symptoms and outbreaks. Our research group previously isolated a field strain of LSDV, designated DO-21, from the first outbreak in Mongolia in 2021. Using this laboratory-adapted strain, we developed an inactivated vaccine by treating it with binary ethyleneimine and formulating it with Montanide ISA 206, a water-in-oil-water adjuvant. Safety was confirmed in mice and cattle using administrations of 3- and 7-fold higher doses of the inactivated vaccine, respectively. In the challenge experiments, all rabbits and cattle were fully protected by day 14 post-booster vaccination following a severe homologous challenge with same field strain (DO-21) without any clinical signs. On the same day, all five vaccinated rabbits showed seroconversion, while all five immunised calves exhibited seroconversion and neutralising antibodies, with interferon-gamma release detected in their blood samples following viral exposure. In addition, seroconversion persisted in all three vaccinated rabbits for at least 120 days post-prime vaccination, while both seroconversion and neutralising antibodies were maintained in all nine cattle for 120 days post-prime vaccination. In conclusion, inactivated vaccines are alternatives to live-attenuated vaccines, particularly in countries with sporadic cases of LSD or in non-endemic countries bordering endemic regions.
Full text 124,186 characters · extracted from preprint-html · click to expand
Effective inactivated lumpy skin disease vaccine for cattle using a field viral strain and Montanide 206 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effective inactivated lumpy skin disease vaccine for cattle using a field viral strain and Montanide 206 Yondonjamts Enkhmandakh, Myagmarsuren Odonchimeg, Arinubold Munkhtsetseg, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6728676/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Lumpy skin disease (LSD) causes significant economic losses to cattle industries. In Mongolia, LSD outbreaks were first reported in 2021, with a few additional cases later that year. The situation has since alleviated due to effective control measures, including the use of live-attenuated vaccines. However, unlike the inactivated vaccine, live-attenuated vaccines carry risks, including genetic recombination and vaccine-associated clinical symptoms and outbreaks. Our research group previously isolated a field strain of LSDV, designated DO-21, from the first outbreak in Mongolia in 2021. Using this laboratory-adapted strain, we developed an inactivated vaccine by treating it with binary ethyleneimine and formulating it with Montanide ISA 206, a water-in-oil-water adjuvant. Safety was confirmed in mice and cattle using administrations of 3- and 7-fold higher doses of the inactivated vaccine, respectively. In the challenge experiments, all rabbits and cattle were fully protected by day 14 post-booster vaccination following a severe homologous challenge with same field strain (DO-21) without any clinical signs. On the same day, all five vaccinated rabbits showed seroconversion, while all five immunised calves exhibited seroconversion and neutralising antibodies, with interferon-gamma release detected in their blood samples following viral exposure. In addition, seroconversion persisted in all three vaccinated rabbits for at least 120 days post-prime vaccination, while both seroconversion and neutralising antibodies were maintained in all nine cattle for 120 days post-prime vaccination. In conclusion, inactivated vaccines are alternatives to live-attenuated vaccines, particularly in countries with sporadic cases of LSD or in non-endemic countries bordering endemic regions. Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Lumpy skin disease (LSD) is a viral disease caused by a Capripoxvirus lumpyskinpox species, double-stranded DNA virus, belonging to the Capripoxvirus genus in the Poxviridae family ( https://ictv.global/taxonomy ). The Capripoxvirus genus includes LSD virus (LSDV), sheeppox virus (SPV), and goatpox virus (GPV) [ 1 ]. LSDV is transmittable through contaminated feed, water, saliva, skin lesions, blood, semen from infected animals, and mechanical vectors such as bloodsucking flies [ 2 – 5 ]. Clinical symptoms include fever, skin nodules, emaciation, and lesions, causing significant economic impacts on the cattle industries by negatively affecting milk and meat production, the wholeness of the skin, cattle fertility, and sometimes leading to death [ 2 , 3 , 6 , 7 ]. Morbidity rate is estimated to be 3 to 85% worldwide, while mortality rates is 1% [ 6 ]. The first case of LSDV was confirmed in Africa in 1929, and then cases have been reported as global emergence [ 3 ]. Since 2019, outbreaks of the disease have been reported in several Asian countries, including China [ 8 ], Bangladesh [ 9 ], India [ 10 ], Vietnam [ 11 ], Cambodia [ 12 ], Malaysia [ 13 ], Mongolia [ 14 ], and South Korea [ 15 ]. In Mongolia, outbreaks occurred during the summer months (August to November) of 2021, the active season for mechanical vectors such as bloodsucking flies [ 14 ]. In 2022, a few cases were documented in Mongolia, according to data from Mongolian General Authority for Veterinary Services ( https://vet.gov.mn ) and no case have been reported since. During the first outbreak in Mongolia, a live attenuated Perego strain of sheeppox vaccine, produced by Mongolian vaccine manufacture named “Biocombinat LLC”, was used as a heterologous vaccine for cattle at a 10-fold higher dose than the recommended amount for sheep due to limited availability of homologous vaccine in 2021, in Mongolia due to transportation issue and official agreement. It is note that toxic side effects of heterologous vaccine at high dose in cattle have been reported previously in Jordan [ 16 ]. From 2022 to 2024, a commercial live attenuated Neethling strain-based homologous vaccines were used in cattle immunization in Mongolia. Notably, previous studies have reported that the live attenuated Neethling strain has been associated with the development of clinical symptoms, including temporary fever, lumps at the vaccination site, and a reduction of milk production [ 17 , 18 ]. Although field and vaccine strains have been differentiated after attenuated vaccine immunization in previous studies based on GPCR, RPO30, and partial LSDV126/LSDV127 gene analyses, whole-genome analysis is crucial for determining whether clinical symptoms are caused by the vaccine or a field strain [ 19 ]. However, whole-genome sequencing is often costly and not readily available in every region. In addition to safety concerns regarding the vaccine, Neethling vaccine strain-like recombinant field strains have also been reported [ 20 – 23 ]. On the other hand, inactivated vaccines serve as an alternative option for combating LSD [ 2 , 24 ]. Especially in non-endemic countries, inactivated vaccines are a suitable strategy for controlling LSD emergence, as they are safer than attenuated vaccine, which carry risks as genetic recombination between vaccine and field strains, as well as vaccine-associated clinical symptoms and outbreaks. In the present study, we developed and evaluated an inactivated vaccine containing a virulent LSDV field strain (DO-21) isolated from the first outbreak in Mongolia, as reported in our previous study [ 14 ]. Montanide 206, an adjuvant, was used to enhance the vaccine’s potency in inducing protective immunity in cattle. Materials and methods Cultivation and inactivation of virus Madin-Darby Bovine Kidney (MDBK) cells were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, New York, USA) supplemented with 5 % Fetal bovine serum (FBS) until reaching 80-90 % confluence. The MDBK cells were then inoculated with the field strain at a multiplicity of infection (MOI) of 0.1 and incubated in the complete DMEM medium with 2 % FBS at 37 °C for 4-5 days until cytopathic effects (CPE) were observed. When apparent CPE was observed in almost 80 % of cells, cultures were frizzed and thawed in triplicate for the harvesting supernatant containing virus. A half Tissue Culture Infectious Dose (TCID 50 ) assay was used to quantify the virus concentration based on its ability to induce CPE in cells, following the Reed-Muench method [25]. A 100 mM Binary Ethyleneimine (BEI) stock solution was prepared by dissolving 0.1 M 2-bromoethylamine HBr (Sigma-Aldrich, Steinheim, Germany) in 0.175 N NaOH (Xilong Scientific, Shantou, China) at 37 °C for 1 hour, as described previously [26]. Virus-containing supernatant, with a TCID 50 of at least 1 × 10 6.0 /mL up to 1 × 10 7.0 /mL, was incubated with final BEI concentrations of 0, 2, 5, and 8 mM for the viral inactivation. During inactivation, the virus-BEI mixture was shaken vertically at 130 rpm for 24 hours. The complete inactivation was examined at various time points: 6, 10, 12, and 24 hours after adding a stop solution (1 M sodium thiosulfate, Sigma-Aldrich, Steinheim, Germany) at a 10-fold lower concentration than the BEI concentrations used, and the mixture was stored at 4 °C until use. A 0.5 mL of the mixture was inoculated in a 25 mL flask containing MDBK cells with 80-90 % confluence. After 1 hour incubation, the mixture was discarded, and complete DMEM medium with 2 % FBS was added to the cells. A non-treated MDBK cells served as the control. It was blindly passaged three times, and CPE was monitored in each passage to assess complete inactivation. Vaccine and immunization The fully inactivated virus was emulsified with Montanide ISA 206 Veterinary Grade Water-in-Oil-Water adjuvant (Montanide 206, Seppic, La Garenne-Colombes, France) at a 1:1 (v/v) ratio. The inactivated and formulated vaccine was subjected to rigorous validation processes according to quality control specifications, ensuring sterility, stability, and appropriate viscosity in compliance with vaccine production standards. The vaccine was administered intramuscularly to rabbits (at dose of 1 mL) and cattle (at dose of 2 mL). A booster vaccine was given 21 days post-prime vaccination (p.p.v) in both challenge and long-term immunity experiments in animals, except in the long-term immunity experiment in cattle, where the booster was administered 28 days p.p.v. Assessment of vaccine safety Twenty BALB/c mice, aged 6 to 8 weeks and weighing 19 to 22 grams, were randomly divided in two groups. A 0.6 mL aliquot of the inactivated vaccine, the highest dose likely applicable to a mouse, was administered subcutaneously at two injection sites (0.3 mL per site) in the tested group ( n = 10), while the remaining 10 mice served as controls. Apparent adverse effects were monitored for up to 30 days post-administration. Six indigenous calves, aged 14 to 18 months and weighing 100 to 150 kilograms, were divided in two groups. A 14 mL aliquot of the inactivated vaccine, as recommended by the World Organisation for Animal Health [27], was administered intramuscularly at 2 injection sites (7 mL per site) in the tested group ( n = 3). The remaining 3 unadministered calves served as controls. Apparent adverse effects were monitored for up to 30 days post-administration. Challenge and long-term immunity experiments In the challenge experiments, 10 rabbits, aged 3 to 4 months and weighing 1.4 to 2.3 kilograms, or 10 indigenous calves, aged 6 to 9 months and weighing 80 to 100 kilograms, were divided into 2 groups, each 5 animals (Fig. 1 and Fig. S1, upper panels). A test group was vaccinated intramuscularly with 1 mL for rabbit and 2 mL for calf, and then same volume of the vaccine as a booster vaccination was administered on day 21 p.p.v. The remaining unvaccinated control group served as control. On day 21 post-booster vaccination, the field strain was injected intravenously to all animals by 1 mL (3.16 × 10 5 TICD 50 /mL) for rabbit into two sites and 4 mL (1 × 10 6.3 TICD 50 /mL) for calf. As previously described [28], clinical symptoms of rabbits and calves were monitored for up to day 21 and day 18 post-challenge (p.c), respectively. In the long-term immunity experiments, 3 rabbits, aged and weighing the same as described above, and 9 indigenous cattle, aged 6 months to 9 years and weighing 80 to 400 kilograms, were intramuscularly immunized with the same volume of prime-vaccination used in the challenge experiments in both rabbits and cattle, followed by the booster vaccination on days 21 and 28 p.p.v, respectively (Fig. 1 and Fig. S1, lower panels). Immune responses were then evaluated for up to 120 and 240 days in the rabbit and cattle experiments, respectively. Assessment of seroconversion after vaccination Blood samples were collected from animals in the challenge experiment in rabbits on days 0, 7, 14, 21, 28, 35, and 42 p.p.v (Fig. S1, upper panel), and in the long-term immunity experiment in rabbits on days 0, 7, 14, 21, 28, 35, 42, 60, 90, and 120 p.p.v (Fig. S1, lower panel). Similarly, in the cattle experiments, blood samples were collected in the challenge and the long-term experiments, on days 0, 21, 28, 35, and 42 (Fig. 1, upper panel), and on days 0, 14, 28, 60, 90, 120, 150, 180, 210, and 240 (Fig. 1, lower panel) p.p.v, respectively. The titre of antibodies was measured using an Enzyme linked immunosorbent assay (ELISA), ID Screen® Capripox Double Antigen Multi-species ELISA kit (Innovative Diagnostics, Garbels, France), followed by the manufacturer’s instructions. Measurement of interferon gamma production levels On days 4, 6, 11, 16, 21, and 35 days, and 8 months p.p.v, the production levels of interferon gamma (IFN-γ) were measured in the challenge and long-term immunity experiments in cattle, respectively, using the ID Screen Ruminant IFN-g sandwich ELISA Kit (Innovative Diagnostics). To induce IFN- γ, cattle blood samples were collected (Fig. 1) and incubated overnight with the inactivated LSDV strain in a 5 % CO 2 atmosphere at 37 °C. Pokeweed Mitogen (PWM) and phosphate-buffered saline (PBS) served as positive and negative controls, respectively. After the induction, blood and the inactivated virus, PWM, or PBS mixtures were centrifugated at 500 × g for 10 min at room temperature to extract plasma. The plasma was then subjected to the IFN-γ measurement according to the manufacturer’s instructions. The IFN-γ production levels of each sample were measured in triplicate, and those of the controls in duplicate. Evaluation of the virus-neutralising antibody titres after vaccination To evaluate neutralising antibody titres, blood samples were collected from cattle in the challenge experiment on day 21 post-booster vaccination (or day 42 p.p.v), and from cattle in the long-term experiment on days 0, 32, 62, 92, 122, and 152 post-booster vaccination (or days 28, 60, 90, 120, 150 and 180 p.p.v) (Fig. 1). Sera were obtained from the blood samples of cattle and then inactivated at 56 °C for 30 minutes. Sera were then diluted by a serial dilution (ranging from 1:2, 1:4, 1:8, 1:16, 1:32, to 1:64) using the DMEM with 100 Unit of Penicillin and 100 µg/mL of Streptomycin (PenStrep, Gibco, New York, USA) and without FBS. The diluted sera were added in the suspension of the field strain (1 × 10 2 TCID 50 /mL) incubated for 1 hour at 37 °C. After incubation, 100 µL of a cell suspension (4 × 10 5 cells/mL) was added to each well. The culture plates were then incubated at 37°C in a humidified environment with 5 % CO 2 for up to 5-7 days. The results were monitored using an inverted microscope (Nikon TMS, New York, U.S.A). The microtiter plates were examined daily starting on day 2 or 3, continuing for up to 7 days, for signs of CPE. Blood cell counting After both vaccinated and unvaccinated cattle were challenged with the field strain, blood was collected in Ethylenediaminetetraacetic acid (EDTA)-vacutainer tubes on days 4, 7, 11, and 14 p.c (or days 46, 49, 53, and 56 p.p.v) (Fig. 1). Prior to measurement of blood parameters, the blood samples were thoroughly mixed by gently inversion and then directly applied to an Automated Hematology Analyzer, pocH-100iv Diff (Sysmex Corporation, Kobe, Japan), according to the manufacturer’s user manual. Statistical analyses A p -value of less than 0.05 considered statistically significant between tested and control groups [29], except for antibody levels in the long-term immunity experiments, where day 0 was compared to subsequent time points. The statistical analyses were performed using an ANOVA with post-hoc Tukey HSD test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/). Results Vaccine safety LSDV was not inactivated after incubation with 2 mM BEI for up to 24 hours (Table S1). Although incubation with 5 mM BEI for 6 and 10 hours did not result in inactivation, complete inactivation was observed after at least 12 hours of incubation at this concentration. A higher concentration of BEI (8 mM) showed complete inactivation for at least 10 hours of incubation. Therefore, we selected 5 mM BEI with an incubation time of at least 14–16 hours as the condition used for vaccine formulation. After inactivated virus emulsified with Montanide 206, pH, and colour of formulated vaccine was ranged at 8.0–8.5 and light pink, respectively. After centrifugation at 3,000 rpm for 10 min, approximately 0.3–0.5 mm supernatant of 10 mL vaccine was segregated in the 15 mL falcon tube as considered to be good stably. Additionally, no bacteria, fungi, or yeast were detected in our formulated vaccine using meat extract casein peptone broth, agar, or sabouraud dextrose agar plates. A 0.6 mL aliquot of the vaccine was non-toxic to BALB/c mice ( n = 10) (Table S2). In cattle ( n = 3), a 14 mL dose of the vaccine did not cause any toxic side effects, except for mild swelling at the injection site observed from days 4 to 20 (Table S3). The swelling was spontaneously cured thereafter. All animals were survived after the high-dose vaccination (Figs. S2 and S3). Challenge and long-term immunity in rabbits After prime and booster vaccinations (1 mL per dose), antibody levels in vaccinated rabbits increased from day 14 p.p.v (Figs. S4 and S5). Statistically significant differences ( p -value <0.05) were calculated on days 14 and 60 p.p.v between the vaccinated and control groups in the challenge experiment (Fig. S4), and between pre- and post-vaccination time points in the long-term immunity experiment (Fig. S5), respectively. No adverse effects, including fever, loss of appetite, salivation, nasal discharge, conjunctival hyperaemia, skin nodules, or swelling at the injection site, were observed in vaccinated rabbits (data not shown). After vaccinated and unvaccinated rabbits challenged with the virulent field strain, vaccinated rabbits did not show any clinical symptoms, including fever, skin nodules, emaciation, and lesions, whereas unvaccinated rabbits developed fever and loss of appetite from on days 5 and 9 post challenge, respectively (Table S4). By day 21, clinical symptoms began to resolve spontaneously (Table S4). Notably, in the long-term immunity experiment in rabbits, antibody levels did not decline until day 120 p.p.v (Fig. S5). These findings warrant further experiments in cattle. Challenge and long-term immunity in cattle In the challenge experiment in cattle, antibody levels increased after prime and booster vaccinations, with significant differences ( p -value < 0.05) between vaccinated calves and unvaccinated controls observed on day 28 at a titre of 21 % ± 15.9, which is below positive the threshold of 30 %. Significantly high titres (sample to positive ratio, S/P %: 138 % ± 67.9 and 185 % ± 79.3) were observed on days 35, and 42 p.p.v (Fig. 2A and Table S5). Meantime, IFN-γ levels began to rise significantly in the vaccinated calves compared to controls on day 35 p.p.v (Fig. 2B and Table S6). In addition, neutralising antibody titres above the positive threshold of 1:8 titre were detected in all vaccinated calves on day 42 p.p.v (Fig. 2C). The significantly elevated IFN-γ levels, high levels of total antibodies, and the presence of neutralising antibodies in the vaccinated calves supported the decision to challenge the vaccinated calves with a virulent field strain (DO-21) on day 42 p.p.v. Their control calves were also challenged. In the vaccinated calves, body temperatures did not rise as high as those in controls from days 5 to 19 p.c (Fig. S6). Significant differences were calculated between the body temperatures of the vaccinated and controls on day 4, and from days 6 to 19 p.c, while no significant differences were observed between the blood parameters of vaccinated and controls (Figs. S7 and S8). In contrast, the vaccinated calves did not show any clinical signs, while all unvaccinated control calves exhibited fever, eye discharge, loss of appetite, and weakness (Fig. 3 and Table 1). In details, 4 of the 5 unvaccinated control calves had nasal discharge (Fig. 3D), 2 developed skin nodules on the neck (Fig. 3E–I), one calf had swelling at injection site, and one calf died on day 5 p.c. To prevent any possible transmission risk, all vaccinated and unvaccinated calves were slaughtered and incinerated on day 18 p.c, in accordance with the guidelines of Biocombinat LLC and the regulations of the Control Ethics Committee of the Mongolian University of Life Science and Research Institute of Veterinary Medicine for the Use of Experimental Animals. Tissue samples were obtained from the skin nodule of the unvaccinated calves, washed once with 1 × PBS containing the mixture PenStrep (Gibco), and then homogenized in the PBS with the PenStrep mixture to prepare a suspension. Total genomic DNA was extracted from the suspension using the WizPrep Viral DNA/RNA Mini kit (Wizbiosoultions, Seongnam-si, Republic of Korea), following manufacturer’s instructions. An LSDV P32 gene (1181 base pair) amplicon was detected in the genomic DNA using AccuPower Taq PCR PreMix (BIONEER, Daejeon, Republic of Korea), according to the manufacturer’s instructions, with forward (ATGGCAGATATCCCATT) and reverse (TTACCACAGGCTATTAGAAG) primers. An aliquot (200 µL) of suspension was inoculated into MDBK cell line, which showed CPE at 48 hours, while 1 × 10 6.5 TCID 50 /mL was measured on day 4 post-inoculation. These results suggest that the field strain is highly virulent and induces clinical symptoms in the unvaccinated control calves, while the vaccinated calves were fully protected from the lethal infection. In the long-term immunity experiment, antibody levels in vaccinated cattle began to rise from day 60 p.p.v (Fig. 4A and Table S7). The average of antibody levels across all cattle remained above the seropositivity threshold (S/P % ≥ 30) until the end of the experiment, while 89 %, 100 %, 100 %, 78 %, 56 %, 44 % and 33 % of vaccinated cattle had an S/P % above 30 on days 60, 90, 120, 150, 180, 210, and 240 p.p.v, respectively (Table S7). Significant differences were observed between pre- and post-vaccinated antibody levels in vaccinated cattle on days 60, 90, 120, and 150 p.p.v (Fig. 4A). Additionally, neutralising antibody titres were detected on day 28 at titre of 1:4, which is below positive threshold of 1:8, then increased from day 60 and then gradually decreased overtime (Fig. 4B). Percentage of cattle with neutralising antibodies above positive threshold were observed on days 60, 90, and 120 p.p.v (Table S8). No adverse effects, including fever, loss of appetite, salivation, eye discharge, nasal discharge, and skin nodule, were observed in any of the cattle in the long-term immunity experiment. Notably, 7 of the 9 vaccinated cattle were adult female, and 3 of 7 cows delivered calves that grew normally. When antibody levels and neutralising antibodies were measured in the 3 cows and their calves, S/P was ranged between 20 % to 149 %, using ELISA, while serum dilution from 1:4 to 1:64 exhibited neutralising activity against LSDV, as evidenced by the absence of CPE on MDBK cells (Table 2). Overall, these results indicate that our vaccine induces long-term humoral immunity in some cattle for at least 8 months, as well as maternal immunity in the calves born to vaccinated cows. Because this is a field study, conducting a challenge experiment to assess long-term protective immunity was limited. To assess cellular immunity, blood samples from 9 cattle and 3 calves were stimulated with the inactivated field strain, and IFN-γ levels were measured and average S/P ratios from triplicate measurements were 2 %, 6 %, 1 %, 3 %, 9 % in 5 of 9 vaccinated cattle on day 240 p.p.v, all below positivity threshold (< 35 %). IFN-γ was not detected in the remaining 4 cattle or any of the 3 calves. It is note that cellular immunity is not typically passed from mother to calves. Discussion Previously studies suggest that inactivated vaccines against SPV and LSDV is considered to be safe and effective alternative methods to live attenuated vaccines [ 2 , 24 , 30 , 31 ]. Unlike live attenuated vaccines, inactivated vaccines do not lead risks, including transmission, reversion to pathogenicity, and genetic recombination with field strains, that have been previously reported after immunization with live attenuated vaccines [ 17 , 18 , 20 – 23 ]. Based on findings of previous studies, inactivated vaccines should be the preferred method of immunisation in countries experiencing sporadic LSD outbreaks, or border zones of non-endemic countries neighbouring endemic regions. In Mongolia, sporadic LSD outbreaks were reported in 2021 [ 8 , 14 , 32 ] following outbreaks in China and Russia, both of which are neighbouring countries. In 2022, sporadic cases were reported in Mongolia and then no cases have been reported up to date [33, https://vet.gov.mn ]. However, LSD outbreaks have still been reported in Russia and China from 2015 to 2023 [ 32 – 34 ], indicating ongoing circulation of the disease in Asian regions. Therefore, the development and evaluation of a safe and effective vaccine is crucial to ensure readiness for the prevention and control of further LSD outbreaks, as it is a transboundary disease. In the present study, we developed an inactivated vaccine using the field strain (DO-21) formulated with Montanide 206 adjuvant. This inactivated vaccine provided complete protective immunity in rabbits and cattle following a severe homologous challenge with same field strain (DO-21). The efficacy of our vaccine was consistent with that of vaccine tested in previously studies [ 2 , 24 , 31 ]. In contrast, immune reactions, including total antibody levels and neutralising antibody titres above the thresholds, were often observed after booster vaccination in both the challenge and long-term immunity experiments in cattle in our study (Table S5 and S7), as well as in cattle vaccinated with an inactivated Neethling LSD strain in the previous study [ 24 ]. Such responses were found in less than 50% of the inactivated Neethling LSD strain-vaccinated cattle before booster vaccination in other previous studies [ 2 , 31 ]. These findings suggest that booster vaccination is necessary for the induction of cattle immunisation. However, it is important to note that, prior booster vaccination, IFN-γ releases, an indicator of cellular immune responses, were detectable in 20%, 60%, 80%, 40%, and 35% of vaccinated cattle on days 4, 6, 11, 16, and 21 p.p.v, respectively in our study (Table S6), which is consistent with the findings of previous studies [ 35 , 36 ]. At least 14 days post-booster vaccination, all cattle vaccinated with inactivated vaccine were fully protected against lethal infection in the present and previous studies [ 2 , 31 ]. Noteworthy, the percentage of clinically affected cattle among different populations is often variable, depending on the viral strain, as well as the age, immunological status, and breed of the hosts [ 14 , 27 , 33 ]. For instance, a previous study found that clinical symptoms were observed in 83% of cattle experimentally infected with LSDV Nigeria (LSDV-V/281-Nigeria) strain [ 37 ]. In the present study, all unvaccinated control cattle showed clinical signs, whereas no such signs were observed in vaccinated cattle. Taken together, the findings of the present and previous studies suggest that the inactivated vaccine is an effective alternative to the live attenuated vaccine. Compared to an inactivated vaccine, a live attenuated vaccine induces longer-lasting immunity in the cattle [ 36 ]. In the present study, the inactivated LSDV (DO-21) vaccine induces the presence of the specific antibodies against LSDV in all cattle for up to 120 days (Table S7), which is more effective than the findings in the previous study, where 68% of cattle remained antibodies [ 2 ]. This discrepancy might be explained by the larger number of animals used in the previous study [ 2 ] compared to those in the present study. Additionally, 89% of cattle vaccinated with the inactivated LSDV (DO-21) strain retained neutralising antibodies at day 120 p.p.v in the present study (Table S8), however, this was not measured in the previous study [ 2 ]. These observations suggest that the inactivated vaccine can completely protect cattle against LSDV infection for at least four months. Moreover, in a previous study, seroconversion was observed in all cattle using ELISA, and neutralising antibodies were detected in over 80% of those cattle vaccinated with an LSDV-based inactivated vaccine at six months p.p.v, no clinical sings were observed following challenge with the LSD/OA3-Ts.MORAN strain, indicating complete protection [ 36 ]. In this previous study, over 60% and 50% of cattle immunised with the same inactivated vaccine exhibited seroconversion and neutralising antibodies, respectively, at twelve months p.p.v; 67% of these cattle were protected following the above-mentioned challenge infection. In the present study, 56% of cattle vaccinated with the inactivated LSDV (DO-21) strain exhibited seroconversion at six months p.p.v, but did not show neutralising antibodies; nevertheless, they may possibility partially protected by our prime- and booster vaccinations following the challenge infection at six months p.p.v, as similar to the observation in the previous study [ 36 ]. Probably, long-lasting immunity of at least four months is sufficiently contribute to control and prevent LSD outbreaks, particularly as LSD outbreaks often follow spatio-temporal clustering patterns [ 38 ]. This is supported by the observations that outbreaks in a wide-region in Thailand and in Mongolia were brought under control within four months [ 14 , 38 , 39 ]. After control program in these countries, using a vaccination strategy, only a few cases have been reported thereafter in these countries. In conclusion, the inactivated vaccines are safe and capable of inducing effective complete protective immunity in cattle following a severe challenge infection from at least 14 days post-booster vaccination, as well as long-lasting immunity for up to four months. Evaluation of the inactivated vaccine (DO-21 strain) in larger cattle populations and challenge experiments in vaccinated cattle at six months post-prime vaccination are of paramount importance in the further studies. Declarations Funding This study was supported by the Mongolian Foundation for Science and Technology (Project No. ShUTT 2022/290). Acknowledgements We thank the local veterinarian, Batjargal Sumiyabazar, for his assistance with animal management. We also express our gratitude to the local herders, Tsendsuren Batjargal and Dorjkhand Bolormaa for kindly allowing us to conduct our field experiment on their land. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yondonjamts Enkhmandakh, Myagmarsuren Odonchimeg, Arinubold Munkhtsetseg, Enkhbaatar Batmagnai, Davaanyam Nyamtseren, Ochirvaani Bumantsetseg, Gundegmaa Uudamsaikhan, Bumduuren Tuvshintulga and Dashzevge Erdenechimeg. The first draft of the manuscript was written by Yondonjamts Enkhmandakh, Bumduuren Tuvshintulga and Dashzevge Erdenechimeg. All authors read and approved the manuscript. Data Availability The datasets generated during and/or analysed during the current study are available from the corresponding author Dashzevge Erdenechimeg on reasonable request (E-mail: [email protected] ). Ethics approval This study was conducted with the approval of the Control Ethics Committee of the Mongolian University of Life Science and Research Institute of Veterinary Medicine for the Use of Experimental Animals (approval no. 2023/01/23). References King AMQ, Lefkowitz E, Adams MJ et al (2012) Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press; Waltham, MA, USA, pp 291–309. Hamdi J, Boumart Z, Daouam S et al (2020) Development and evaluation of an inactivated lumpy skin disease vaccine for cattle. Vet Microbiol 245:108689. https://doi.org/10.1016/j.vetmic.2020.108689 Tuppurainen E, Alexandrov T, Beltrán-Alcrudo D (2017) Lumpy skin disease field manual – A manual for veterinarians. FAO Animal Production and Health Manual No. 20. Rome. Food and Agriculture Organization of the United Nations (FAO). 60 pages Annandale CH, Holm DE, Ebersohn K, Venter EH (2014) Seminal transmission of lumpy skin disease virus in heifers. Transbound Emerg Dis 61:443–448. https://doi.org/10.1111/tbed.12045 Panel E, Ahaw W (2015) Scientific opinion on lumpy skin disease. EFSA J 13:1–73. https://doi.org/10.2903/j.efsa.2015.3986 Akther M, Akter SH, Sarker S et al (2023) Global burden of lumpy skin disease, outbreaks, and future challenges. Viruses 15:1861. https://doi.org/10.3390/v15091861 Ayelet G, Haftu R, Jemberie S et al (2014) Lumpy skin disease in cattle in central Ethiopia: outbreak investigation and isolation and molecular detection of the virus. Rev Sci Tech 33:877–887. https://doi.org/10.20506/rst.33.3.2325 Wei YR, Ma WG, Wang P et al (2023) Retrospective genomic analysis of the first lumpy skin disease virus outbreak in China (2019). Front Vet Sci 9:1073648. https://doi.org/10.3389/fvets.2022.1073648 Biswas D, Saha SS, Biswas S et al (2020) Outbreak of lumpy skin disease of cattle in south-west part of bangladesh and its clinical management. Vet Sci Res Reviews 6: 100-108. http://dx.doi.org/10.17582/journal.vsrr/2020.6.100.108 Kumar N, Chander Y, Kumar R et al (2021) Isolation and characterization of lumpy skin disease virus from cattle in India. PLoS One 16:e0241022. https://doi.org/10.1371/journal.pone.0241022 Tran HTT, Truong AD, Dang AK et al (2021) Lumpy skin disease outbreaks in Vietnam, 2020. Transbound Emerg Dis 68:977–980. https://doi.org/10.1111/tbed.14022 Porco A, Chea S, Sours S et al (2023) Case report: Lumpy skin disease in an endangered wild banteng ( Bos javanicus ) and initiation of a vaccination campaign in domestic livestock in Cambodia. Front Vet Sci 10: 1228505. https://doi.org/10.3389/fvets.2023.1228505 Khoo CK, Dahlan R, Mat Desa Z et al (2022) Molecular detection of lumpy skin disease virus in Malaysia 2021. Int J Infect Dis 116:S64. https://doi.org/10.1016/j.ijid.2021.12.150 Odonchimeg M, Erdenechimeg D, Tuvshinbayar A et al (2022) Molecular identification and risk factor analysis of the first lumpy skin disease outbreak in cattle in Mongolia. J Vet Med Sci 84:1244–1252. https://doi.org/10.1292/jvms.22-0250 Kim GH, Yoo DS, Chu KS et al (2024) Assessing post-vaccination seroprevalence and enhancing strategies for lumpy skin disease vaccination in korean cattle. Animals (Basel) 14:3236. https://doi.org/10.3390/ani14223236 Abutarbush SM, Tuppurainen ESM (2018) Serological and clinical evaluation of the Yugoslavian RM65 sheep pox strain vaccine use in cattle against lumpy skin disease. Transbound Emerg Dis 65:1657–1663. https://doi.org/10.1111/tbed.12923 Katsoulos PD, Chaintoutis SC, Dovas CI et al (2018) Investigation on the incidence of adverse reactions, viraemia and haematological changes following field immunization of cattle using a live attenuated vaccine against lumpy skin disease. Transbound Emerg Dis 65:174–185. https://doi.org/10.1111/tbed.12646 Tuppurainen ESM, Antoniou SE, Tsiamadis E et al (2020) Field observations and experiences gained from the implementation of control measures against lumpy skin disease in South-East Europe between 2015 and 2017. Prev Vet Med 181:104600. https://doi.org/10.1016/J.PREVETMED.2018.12.006 Flannery J, Shih B, Haga IR et al (2022) A novel strain of lumpy skin disease virus causes clinical disease in cattle in Hong Kong. Transbound Emerg Dis 69:e336–e343. https://doi.org/10.1111/tbed.14304 Sprygin A, Pestova Y, Bjadovskaya O et al (2020) Evidence of recombination of vaccine strains of lumpy skin disease virus with field strains, causing disease. PLoS One 15: e0232584. https://doi.org/10.1371/journal.pone.0232584 Agianniotaki EI, Tasioudi KE, Chaintoutis SC et al (2017) Lumpy skin disease outbreaks in Greece during 2015–16, implementation of emergency immunization and genetic differentiation between field isolates and vaccine virus strains. Vet Microbiol 201:78–84. https://doi.org/10.1016/j.vetmic.2016.12.037 Kononov A, Byadovskaya O, Kononova S et al (2019) Detection of vaccine-like strains of lumpy skin disease virus in outbreaks in Russia in 2017. Arch Virol 164:1575–1585. https://doi.org/10.1007/s00705-019-04229-6 Mathijs E, Vandenbussche F, Nguyen L et al (2021) Coding-complete sequences of recombinant lumpy skin disease viruses collected in 2020 from four outbreaks in Northern Vietnam. Microbiol Resour Announc 10: e0089721. https://doi.org/10.1128/mra.00897-21 Wolff J, Moritz T, Schlottau K et al (2020) Development of a safe and highly efficient inactivated vaccine. Vaccines (Basel) 9:4. https://doi.org/10.3390/vaccines9010004 Reed LJ, Muench H (1938) Journal of hygiene. Am J Hyg 27:493–497. https://doi.org/10.1093/oxfordjournals.aje.a118408 Bahnemann HG (1976) Inactivation of viruses in serum with binary ethyleneimine. J Clin Microbiol 3:209–210. https://doi.org/10.1128/jcm.3.2.209-210.1976 WOAH Terrestrial Manual. Chapter 3.4.12, Lumpy skin disease. Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.04.12_LSD.pdf Carn VM, Kitching RP (1995) The clinical response of cattle experimentally infected with lumpy skin disease (Neethling) virus. Arch Virol 140:503-513. https://doi.org/10.1007/bf01718427 Aickin M, Gensler H (1996) Adjusting for multiple testing when reporting research results: The Bonferroni vs Holm methods. Am J Public Health 86:726–728. https://doi.org/10.2105/AJPH.86.5.726 Boumart Z, Daouam S, Belkourati I et al (2016) Comparative innocuity and efficacy of live and inactivated sheeppox vaccines. BMC Vet Res 12:133. https://doi.org/10.1186/s12917-016-0754-0 Es-sadeqy Y, Bamouh Z, Ennahli A et al (2021) Development of an inactivated combined vaccine for protection of cattle against lumpy skin disease and bluetongue viruses. Vet Microbiol 256:109046. https://doi.org/10.1016/j.vetmic.2021.109046 Byadovskaya O, Prutnikov P, Shalina K et al (2022) The changing epidemiology of lumpy skin disease in Russia since the first introduction from 2015 to 2020. Transbound Emerg Dis 69:e2551–e2562. https://doi.org/10.1111/tbed.14599 Sprygin A, Krotova A, Jun M et al (2025) Whole genome sequencing of lumpy skin disease virus from 2021–2023 in Eastern Eurasia reveals no more recombination signals in the circulating pool of strains. Viruses 17: 468. https://doi.org/10.3390/v17040468 Song Y, Zuo O, Zhang G et al (2024) Emergence of lumpy skin disease virus infection in yaks, cattle-yaks, and cattle on the Qinghai-Xizang Plateau of China. Transbound Emerg Dis 2024:2383886. https://doi.org/10.1155/2024/2383886 Kresic N, Philips W, Haegeman A et al (2025) Evaluation of an interferon-gamma release assay for early detection of lumpy skin disease virus infection and vaccination in cattle. 13:e0293924. https://doi.org/10.1128/spectrum.02939-24 Haegeman A, Leeuw I De, Mostin L et al (2023) Duration of immunity induced after vaccination of cattle with a live attenuated or inactivated lumpy skin disease virus vaccine. Microorganisms 11:210. https://doi.org/10.3390/microorganisms11010210 Wolff J, Tuppurainen E, Adedeji A et al (2022) Characterization of a nigerian lumpy skin disease virus isolate after experimental infection of cattle. Pathogens 11:16. https://doi.org/10.3390/pathogens11010016 Maulana KY, Na-Lampang K, Arjkumpa O et al (2025) Geographical distribution, spatial directional trends, and spatio-temporal clusters of the first rapid and widespread lumpy skin disease outbreaks in Thailand. Transbound Emerg Dis 2025:4900775. https://doi.org/10.1155/tbed/4900775 Sprygin A, Sainnokhoi T, Gombo-Ochir D et al (2022) Genetic characterization and epidemiological analysis of the first lumpy skin disease virus outbreak in Mongolia, 2021. Transbound Emerg Dis 69:3664–3672. https://doi.org/10.1111/tbed.14736 Tables Table 1. Monitoring of clinical signs of vaccinated calves challenged with a virulent field strain. Groups Clinical signs Days post-challenge 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 18 Vaccinated ( n = 5) Below clinical symptoms - - - - - - - - - - - - - - - - Control ( n = 5) Fever - - - - + + ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ Loss of appetite - - - - - - - - - + ++ ++ ++ ++ ++ ++ Salivation - - - - - - - - - - - - - - - - Eye discharge - - - - - - - + ++ ++ ++ ++ ++ ++ ++ ++ Nasal discharge - - - - - - + + ++ ++ ++ ++ ++ ++ ++ ++ Skin nodule - - - - - - - - - - - - - + + A plus sign (+), mild clinical signs; double plus sign (++), severe clinical signs; A minus sign (-), No clinical signs; Control, unvaccinated cattle. Table 2. levels of total antibodies and neutralizing antibodies in vaccinated cows and their calves Number of cattle and their calves Age (years) Levels of total antibodies and neutralizing antibodies Total antibody levels, S/P (%)* Neutralizing antibody levels (average of titers ± std)** On day 210 On day 240 On day 210 On day 240 №4 (cow) 4 122 133 1:64 ± 0 1:7 ± 2 №4 (calf of cow no. 4) 0.1 149 103 16 ± 0 4 ± 0 №12 (cow) 6 114 108 32 ± 0 8 ± 0 №12 (calf of cow no. 12) 0.1 265 161 16 ± 0 5 ± 2 №14 (cow) 7 19 20 16 ± 0 4 ± 0 №14 (calf of cow no. 14) 0.1 76 35 4 ± 0 5 ± 2 An asterisk indicates that total antibody levels were measured in each serum sample using one well of the ID Screen® Capripox Double Antigen Multi-species ELISA kit; a double asterisk indicates that each serum sample was tested in triplicate; std, standard deviation, calculated from the results of the triplicates. Supplementary Files Supplementarymaterials.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 04 Jul, 2025 Reviewers invited by journal 30 May, 2025 Editor assigned by journal 23 May, 2025 First submitted to journal 22 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6728676","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":463996632,"identity":"8f5c846c-6ba0-448d-b686-dff9845d11d6","order_by":0,"name":"Yondonjamts Enkhmandakh","email":"","orcid":"","institution":"Institue of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yondonjamts","middleName":"","lastName":"Enkhmandakh","suffix":""},{"id":463996639,"identity":"83914294-ab5e-4f05-9148-60942f9acdf8","order_by":1,"name":"Myagmarsuren Odonchimeg","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Myagmarsuren","middleName":"","lastName":"Odonchimeg","suffix":""},{"id":463996641,"identity":"3c960b99-51e0-4682-906a-27da1708d85b","order_by":2,"name":"Arinubold Munkhtsetseg","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Arinubold","middleName":"","lastName":"Munkhtsetseg","suffix":""},{"id":463996643,"identity":"85891f9f-7521-46b1-b771-b0b99d2d336a","order_by":3,"name":"Enkhbaatar Batmagnai","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Enkhbaatar","middleName":"","lastName":"Batmagnai","suffix":""},{"id":463996644,"identity":"07f91a86-b43e-4c9d-92d2-91353b29ff4c","order_by":4,"name":"Davaanyam Nyamtseren","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Davaanyam","middleName":"","lastName":"Nyamtseren","suffix":""},{"id":463996646,"identity":"f8f6083f-ab21-4ee3-8e1e-8606096bddce","order_by":5,"name":"Ochirvaani Bumantsetseg","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ochirvaani","middleName":"","lastName":"Bumantsetseg","suffix":""},{"id":463996647,"identity":"2c1aa86c-2f60-41e5-8fac-f97015f304d6","order_by":6,"name":"Gundegmaa Uudamsaikhan","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Gundegmaa","middleName":"","lastName":"Uudamsaikhan","suffix":""},{"id":463996649,"identity":"f3336f83-bddd-4649-8ff7-19854119f9c7","order_by":7,"name":"Bumduuren Tuvshintulga","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Bumduuren","middleName":"","lastName":"Tuvshintulga","suffix":""},{"id":463996650,"identity":"734071b9-c2e6-4f62-aa42-6450d1de0414","order_by":8,"name":"Ayushjav Narantuya","email":"","orcid":"","institution":"General Authority for Veterinary Services","correspondingAuthor":false,"prefix":"","firstName":"Ayushjav","middleName":"","lastName":"Narantuya","suffix":""},{"id":463996653,"identity":"bdd7a0f4-fa76-46ad-85fe-fa686d1c4054","order_by":9,"name":"Byamba Boldbaatar","email":"","orcid":"","institution":"General Authority for Veterinary Services","correspondingAuthor":false,"prefix":"","firstName":"Byamba","middleName":"","lastName":"Boldbaatar","suffix":""},{"id":463996655,"identity":"76c90ad5-686c-4416-ac55-3b8590a533b5","order_by":10,"name":"Bayan Dulamsuren","email":"","orcid":"","institution":"Biocombinat LLC","correspondingAuthor":false,"prefix":"","firstName":"Bayan","middleName":"","lastName":"Dulamsuren","suffix":""},{"id":463996657,"identity":"961e8333-6b1a-464d-86b2-2cd56393cda8","order_by":11,"name":"Yoshihiro Sakoda","email":"","orcid":"","institution":"Faculty of Veterinary Medicine, Hokkaido University","correspondingAuthor":false,"prefix":"","firstName":"Yoshihiro","middleName":"","lastName":"Sakoda","suffix":""},{"id":463996659,"identity":"c6e3eec3-60d0-49a5-98c1-d73bb0a85438","order_by":12,"name":"Badgar Battsetseg","email":"","orcid":"","institution":"Institute of Veterinary Medicine","correspondingAuthor":false,"prefix":"","firstName":"Badgar","middleName":"","lastName":"Battsetseg","suffix":""},{"id":463996660,"identity":"8fa0125a-c426-49a9-b878-ba6d30dc04f2","order_by":13,"name":"Erdenechimeg Dashzevge","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYDACCcYGECXHzw6iDSyI12Is2XMApEWCGC0QKnHDjQQkLj7AP7u5deOXChvGmTOfX93wo0CCgb+9OwG/JXcOtt2WOZPGzC+dU3azB+gwiTNnN+DVYiCR2HZbsu0wm+TsnLQbPEAtBhK5xGj595/H4OaZtJt/iNVy82PDAQmDG+zHbhNli8QNoC0Mx5INJHty2G7LGEjwEPQL/4z0Zzd/1NjV97Mff3bzzR8bOf72XvxaQICZB0zxGIBJgspBgPEHmGJ/QJTqUTAKRsEoGHkAAKJhTDTAmGi+AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-0934-5836","institution":"Institute of veterinary medicine","correspondingAuthor":true,"prefix":"","firstName":"Erdenechimeg","middleName":"","lastName":"Dashzevge","suffix":""}],"badges":[],"createdAt":"2025-05-23 02:46:04","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6728676/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6728676/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83983147,"identity":"75a9d145-6564-42e3-8f1f-875847589702","added_by":"auto","created_at":"2025-06-05 10:26:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":715484,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representations of the challenge and long-term immunity experiments in cattle. Red blood drops indicate the days on which antibody levels were measured. Black syringes indicate vaccination days, and the yellow syringe marks the day of viral challenge. The upper panel illustrates the challenge experiment in five calves were immunized with a prime and booster vaccinations (2 mL dose) and later challenged with the lumpy skin disease virus, a virulent field strain [14]. Five additional calves served as controls. The lower panel illustrates the long-term immunity experiment in nine cattle were immunized with a prime and booster vaccinations (2 mL dose).\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/c9df775a86fc4ef1d717bb18.png"},{"id":83983151,"identity":"babd60ee-95ae-4bf6-bf7f-ed1827dd2633","added_by":"auto","created_at":"2025-06-05 10:26:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":274696,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical illustrations of antibody and interferon-gamma levels, neutralising antibody titres in prime- and booster-vaccinated calves that further subjected to use in a challenge experiment. A booster vaccination was performed on day 21 post-prime vaccination. Asterisks indicate statistically significant differences (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05) between vaccinated and control groups. Control, calves did not receive any vaccines. Each group consisted of five calves. A) Overview of antibody levels, B) Overview of interferon-gamma levels, C) Overview of neutralising antibody titres.\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/fbf5a455ab32a59b20cdaa4a.png"},{"id":83983154,"identity":"1bd1a52d-35e8-4e11-9846-d0d6fcfbec75","added_by":"auto","created_at":"2025-06-05 10:26:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":7609939,"visible":true,"origin":"","legend":"\u003cp\u003eNon- and presence of clinical sings of vaccinated and unvaccinated calves following a severe homologous challenge with same field strain (DO-21). A-C) no clinical signs in vaccinated calves, D) nasal and eye discharges in unvaccinated calves, E-I) skin nodules in unvaccinated calves.\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/7a8dc1466af9925f324b7c56.png"},{"id":83983152,"identity":"1ffe5bb7-c8f7-42a5-8328-7ea544a39efc","added_by":"auto","created_at":"2025-06-05 10:26:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":459252,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical illustrations of antibody levels and neutralising antibody titres in prime- and booster-vaccinated cattle that further subjected to use in a long-term immunity experiment. A booster vaccination was performed on day 28 post-prime vaccination. Asterisks indicate statistically significant differences (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05) between vaccinated group (\u003cem\u003en\u003c/em\u003e = 9) and its control. Sera obtained on day 0 served as controls for comparison to measure the increase in antibody levels. A) Overview of antibody levels, B) Overview of neutralising antibody titres.\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/62267ba5c25841a1bfa0524d.png"},{"id":83983557,"identity":"be663f5b-b71f-4fe7-8a8e-43d19ff247e4","added_by":"auto","created_at":"2025-06-05 10:34:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9453415,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/e9f47525-ca97-4fe3-92ec-3b3985a186e9.pdf"},{"id":83983149,"identity":"937efcbb-9148-478c-8a8c-39aa6b5f8502","added_by":"auto","created_at":"2025-06-05 10:26:01","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":808286,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6728676/v1/1b7367146107f2287b4967a8.pdf"}],"financialInterests":"","formattedTitle":"Effective inactivated lumpy skin disease vaccine for cattle using a field viral strain and Montanide 206","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLumpy skin disease (LSD) is a viral disease caused by a \u003cem\u003eCapripoxvirus lumpyskinpox\u003c/em\u003e species, double-stranded DNA virus, belonging to the \u003cem\u003eCapripoxvirus\u003c/em\u003e genus in the \u003cem\u003ePoxviridae\u003c/em\u003e family (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ictv.global/taxonomy\u003c/span\u003e\u003cspan address=\"https://ictv.global/taxonomy\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The \u003cem\u003eCapripoxvirus\u003c/em\u003e genus includes LSD virus (LSDV), sheeppox virus (SPV), and goatpox virus (GPV) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. LSDV is transmittable through contaminated feed, water, saliva, skin lesions, blood, semen from infected animals, and mechanical vectors such as bloodsucking flies [\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Clinical symptoms include fever, skin nodules, emaciation, and lesions, causing significant economic impacts on the cattle industries by negatively affecting milk and meat production, the wholeness of the skin, cattle fertility, and sometimes leading to death [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Morbidity rate is estimated to be 3 to 85% worldwide, while mortality rates is 1% [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe first case of LSDV was confirmed in Africa in 1929, and then cases have been reported as global emergence [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Since 2019, outbreaks of the disease have been reported in several Asian countries, including China [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], Bangladesh [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], India [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], Vietnam [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], Cambodia [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], Malaysia [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], Mongolia [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and South Korea [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In Mongolia, outbreaks occurred during the summer months (August to November) of 2021, the active season for mechanical vectors such as bloodsucking flies [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In 2022, a few cases were documented in Mongolia, according to data from Mongolian General Authority for Veterinary Services (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://vet.gov.mn\u003c/span\u003e\u003cspan address=\"https://vet.gov.mn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and no case have been reported since.\u003c/p\u003e \u003cp\u003eDuring the first outbreak in Mongolia, a live attenuated Perego strain of sheeppox vaccine, produced by Mongolian vaccine manufacture named \u0026ldquo;Biocombinat LLC\u0026rdquo;, was used as a heterologous vaccine for cattle at a 10-fold higher dose than the recommended amount for sheep due to limited availability of homologous vaccine in 2021, in Mongolia due to transportation issue and official agreement. It is note that toxic side effects of heterologous vaccine at high dose in cattle have been reported previously in Jordan [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. From 2022 to 2024, a commercial live attenuated Neethling strain-based homologous vaccines were used in cattle immunization in Mongolia. Notably, previous studies have reported that the live attenuated Neethling strain has been associated with the development of clinical symptoms, including temporary fever, lumps at the vaccination site, and a reduction of milk production [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Although field and vaccine strains have been differentiated after attenuated vaccine immunization in previous studies based on GPCR, RPO30, and partial \u003cem\u003eLSDV126/LSDV127\u003c/em\u003e gene analyses, whole-genome analysis is crucial for determining whether clinical symptoms are caused by the vaccine or a field strain [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, whole-genome sequencing is often costly and not readily available in every region. In addition to safety concerns regarding the vaccine, Neethling vaccine strain-like recombinant field strains have also been reported [\u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. On the other hand, inactivated vaccines serve as an alternative option for combating LSD [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Especially in non-endemic countries, inactivated vaccines are a suitable strategy for controlling LSD emergence, as they are safer than attenuated vaccine, which carry risks as genetic recombination between vaccine and field strains, as well as vaccine-associated clinical symptoms and outbreaks.\u003c/p\u003e \u003cp\u003eIn the present study, we developed and evaluated an inactivated vaccine containing a virulent LSDV field strain (DO-21) isolated from the first outbreak in Mongolia, as reported in our previous study [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Montanide 206, an adjuvant, was used to enhance the vaccine\u0026rsquo;s potency in inducing protective immunity in cattle.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eCultivation and inactivation of virus\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMadin-Darby Bovine Kidney (MDBK) cells were cultivated in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM, Gibco, New York, USA) supplemented with 5 % Fetal bovine serum (FBS) until reaching 80-90 % confluence. The MDBK cells were then inoculated with the field strain at a multiplicity of infection (MOI) of 0.1 and incubated in the complete DMEM medium with 2 % FBS at 37 \u0026deg;C for 4-5 days until cytopathic effects (CPE) were observed. When apparent CPE was observed in almost 80 % of cells, cultures were frizzed and thawed in triplicate for the harvesting supernatant containing virus. A half Tissue Culture Infectious Dose (TCID\u003csub\u003e50\u003c/sub\u003e) assay was used to quantify the virus concentration based on its ability to induce CPE in cells, following the Reed-Muench method [25].\u003c/p\u003e\n\u003cp\u003eA 100 mM Binary Ethyleneimine (BEI) stock solution was prepared by dissolving 0.1 M 2-bromoethylamine HBr (Sigma-Aldrich, Steinheim, Germany) in 0.175 N NaOH (Xilong Scientific, Shantou, China) at 37 \u0026deg;C for 1 hour, as described previously [26]. Virus-containing supernatant, with a TCID\u003csub\u003e50\u003c/sub\u003e of at least 1 \u0026times; 10\u003csup\u003e6.0\u003c/sup\u003e/mL up to 1 \u0026times; 10\u003csup\u003e7.0\u003c/sup\u003e/mL, was incubated with final BEI concentrations of 0, 2, 5, and 8 mM for the viral inactivation. During inactivation, the virus-BEI mixture was shaken vertically at 130 rpm for 24 hours. The complete inactivation was examined at various time points: 6, 10, 12, and 24 hours after adding a stop solution (1 M sodium thiosulfate, Sigma-Aldrich, Steinheim, Germany) at a 10-fold lower concentration than the BEI concentrations used, and the mixture was stored at 4 \u0026deg;C until use. A 0.5 mL of the mixture was inoculated in a 25 mL flask containing MDBK cells with 80-90 % confluence. After 1 hour incubation, the mixture was discarded, and complete DMEM medium with 2 % FBS was added to the cells. A non-treated MDBK cells served as the control. It was blindly passaged three times, and CPE was monitored in each passage to assess complete inactivation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVaccine and immunization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fully inactivated virus was emulsified with Montanide ISA 206 Veterinary Grade Water-in-Oil-Water adjuvant (Montanide 206, Seppic, La Garenne-Colombes, France) at a 1:1 (v/v) ratio. The inactivated and formulated vaccine was subjected to rigorous validation processes according to quality control specifications, ensuring sterility, stability, and appropriate viscosity in compliance with vaccine production standards. The vaccine was administered intramuscularly to rabbits (at dose of 1 mL) and cattle (at dose of 2 mL). A booster vaccine was given 21 days post-prime vaccination (p.p.v) in both challenge and long-term immunity experiments in animals, except in the long-term immunity experiment in cattle, where the booster was administered 28 days p.p.v.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssessment of vaccine safety\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwenty BALB/c mice, aged 6 to 8 weeks and weighing 19 to 22 grams, were randomly divided in two groups. A 0.6 mL aliquot of the inactivated vaccine, the highest dose likely applicable to a mouse, was administered subcutaneously at two injection sites (0.3 mL per site) in the tested group (\u003cem\u003en\u003c/em\u003e = 10), while the remaining 10 mice served as controls. Apparent adverse effects were monitored for up to 30 days post-administration.\u003c/p\u003e\n\u003cp\u003eSix indigenous calves, aged 14 to 18 months and weighing 100 to 150 kilograms, were divided in two groups. A 14 mL aliquot of the inactivated vaccine, as recommended by the World Organisation for Animal Health [27], was administered intramuscularly at 2 injection sites (7 mL per site) in the tested group (\u003cem\u003en\u003c/em\u003e = 3). The remaining 3 unadministered calves served as controls. Apparent adverse effects were monitored for up to 30 days post-administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChallenge and long-term immunity experiments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the challenge experiments, 10 rabbits, aged 3 to 4 months and weighing 1.4 to 2.3 kilograms, or 10 indigenous calves, aged 6 to 9 months and weighing 80 to 100 kilograms, were divided into 2 groups, each 5 animals (Fig. 1 and Fig. S1, upper panels). A test group was vaccinated intramuscularly with 1 mL for rabbit and 2 mL for calf, and then same volume of the vaccine as a booster vaccination was administered on day 21 p.p.v. The remaining unvaccinated control group served as control. On day 21 post-booster vaccination, the field strain was injected intravenously to all animals by 1 mL (3.16 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e TICD\u003csub\u003e50\u003c/sub\u003e/mL) for rabbit into two sites and 4 mL (1 \u0026times; 10\u003csup\u003e6.3\u003c/sup\u003e TICD\u003csub\u003e50\u003c/sub\u003e/mL) for calf. As previously described [28], clinical symptoms of rabbits and calves were monitored for up to day 21 and day 18 post-challenge (p.c), respectively. In the long-term immunity experiments, 3 rabbits, aged and weighing the same as described above, and 9 indigenous cattle, aged 6 months to 9 years and weighing 80 to 400 kilograms, were intramuscularly immunized with the same volume of prime-vaccination used in the challenge experiments in both rabbits and cattle, followed by the booster vaccination on days 21 and 28 p.p.v, respectively (Fig. 1 and Fig. S1, lower panels). Immune responses were then evaluated for up to 120 and 240 days in the rabbit and cattle experiments, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssessment of seroconversion after vaccination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBlood samples were collected from animals in the challenge experiment in rabbits on days 0, 7, 14, 21, 28, 35, and 42 p.p.v (Fig. S1, upper panel), and in the long-term immunity experiment in rabbits on days 0, 7, 14, 21, 28, 35, 42, 60, 90, and 120 p.p.v (Fig. S1, lower panel). Similarly, in the cattle experiments, blood samples were collected in the challenge and the long-term experiments, on days 0, 21, 28, 35, and 42 (Fig. 1, upper panel), and on days 0, 14, 28, 60, 90, 120, 150, 180, 210, and 240 (Fig. 1, lower panel) p.p.v, respectively. The titre of antibodies was measured using an Enzyme linked immunosorbent assay (ELISA), ID Screen\u0026reg; Capripox Double Antigen Multi-species ELISA kit (Innovative Diagnostics, Garbels, France), followed by the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of interferon gamma production levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn days 4, 6, 11, 16, 21, and 35 days, and 8 months p.p.v, the production levels of interferon gamma (IFN-\u0026gamma;) were measured in the challenge and long-term immunity experiments in cattle, respectively, using the ID Screen Ruminant IFN-g sandwich ELISA Kit (Innovative Diagnostics). To induce IFN- \u0026gamma;, cattle blood samples were collected (Fig. 1) and incubated overnight with the inactivated LSDV strain in a 5 % CO\u003csub\u003e2\u003c/sub\u003e atmosphere at 37 \u0026deg;C. Pokeweed Mitogen (PWM) and phosphate-buffered saline (PBS) served as positive and negative controls, respectively. After the induction, blood and the inactivated virus, PWM, or PBS mixtures were centrifugated at 500 \u0026times; g for 10 min at room temperature to extract plasma. The plasma was then subjected to the IFN-\u0026gamma; measurement according to the manufacturer\u0026rsquo;s instructions. The IFN-\u0026gamma; production levels of each sample were measured in triplicate, and those of the controls in duplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvaluation of the virus-neutralising antibody titres after vaccination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate neutralising antibody titres, blood samples were collected from cattle in the challenge experiment on day 21 post-booster vaccination (or day 42 p.p.v), and from cattle in the long-term experiment on days 0, 32, 62, 92, 122, and 152 post-booster vaccination (or days 28, 60, 90, 120, 150 and 180 p.p.v) (Fig. 1). Sera were obtained from the blood samples of cattle and then inactivated at 56 \u0026deg;C for 30 minutes. Sera were then diluted by a serial dilution (ranging from 1:2, 1:4, 1:8, 1:16, 1:32, to 1:64) using the DMEM with 100 Unit of Penicillin and 100 \u0026micro;g/mL of Streptomycin (PenStrep, Gibco, New York, USA) and without FBS. The diluted sera were added in the suspension of the field strain (1 \u0026times; 10\u003csup\u003e2\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL) incubated for 1 hour at 37 \u0026deg;C. After incubation, 100 \u0026micro;L of a cell suspension (4 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/mL) was added to each well. The culture plates were then incubated at 37\u0026deg;C in a humidified environment with 5 % CO\u003csub\u003e2\u003c/sub\u003e for up to 5-7 days. The results were monitored using an inverted microscope (Nikon TMS, New York, U.S.A). The microtiter plates were examined daily starting on day 2 or 3, continuing for up to 7 days, for signs of CPE.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlood cell counting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter both vaccinated and unvaccinated cattle were challenged with the field strain, blood was collected in Ethylenediaminetetraacetic acid (EDTA)-vacutainer tubes on days 4, 7, 11, and 14 p.c (or days 46, 49, 53, and 56 p.p.v) (Fig. 1). Prior to measurement of blood parameters, the blood samples were thoroughly mixed by gently inversion and then directly applied to an Automated Hematology Analyzer, pocH-100iv Diff (Sysmex Corporation, Kobe, Japan), according to the manufacturer\u0026rsquo;s user manual.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analyses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA \u003cem\u003ep\u003c/em\u003e-value of less than 0.05 considered statistically significant between tested and control groups [29], except for antibody levels in the long-term immunity experiments, where day 0 was compared to subsequent time points. The statistical analyses were performed using an ANOVA with post-hoc Tukey HSD test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eVaccine safety\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLSDV was not inactivated after incubation with 2 mM BEI for up to 24 hours (Table S1). Although incubation with 5 mM BEI for 6 and 10 hours did not result in inactivation, complete inactivation was observed after at least 12 hours of incubation at this concentration. A higher concentration of BEI (8 mM) showed complete inactivation for at least 10 hours of incubation. Therefore, we selected 5 mM BEI with an incubation time of at least 14\u0026ndash;16 hours as the condition used for vaccine formulation. After inactivated virus emulsified with Montanide 206, pH, and colour of formulated vaccine was ranged at 8.0\u0026ndash;8.5 and light pink, respectively. After centrifugation at 3,000 rpm for 10 min, approximately 0.3\u0026ndash;0.5 mm supernatant of 10 mL vaccine was segregated in the 15 mL falcon tube as considered to be good stably. Additionally, no bacteria, fungi, or yeast were detected in our formulated vaccine using meat extract casein peptone broth, agar, or sabouraud dextrose agar plates.\u003c/p\u003e\n\u003cp\u003eA 0.6 mL aliquot of the vaccine was non-toxic to BALB/c mice (\u003cem\u003en\u003c/em\u003e = 10) (Table S2). In cattle (\u003cem\u003en\u003c/em\u003e = 3), a 14 mL dose of the vaccine did not cause any toxic side effects, except for mild swelling at the injection site observed from days 4 to 20 (Table S3). The swelling was spontaneously cured thereafter. All animals were survived after the high-dose vaccination (Figs. S2 and S3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChallenge and long-term immunity in rabbits\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter prime and booster vaccinations (1 mL per dose), antibody levels in vaccinated rabbits increased from day 14 p.p.v (Figs. S4 and S5). Statistically significant differences (\u003cem\u003ep\u003c/em\u003e-value \u0026lt;0.05) were calculated on days 14 and 60 p.p.v between the vaccinated and control groups in the challenge experiment (Fig. S4), and between pre- and post-vaccination time points in the long-term immunity experiment (Fig. S5), respectively. No adverse effects, including fever, loss of appetite, salivation, nasal discharge, conjunctival hyperaemia, skin nodules, or swelling at the injection site, were observed in vaccinated rabbits (data not shown). After vaccinated and unvaccinated rabbits challenged with the virulent field strain, vaccinated rabbits did not show any clinical symptoms, including fever, skin nodules, emaciation, and lesions, whereas unvaccinated rabbits developed fever and loss of appetite from on days 5 and 9 post challenge, respectively (Table S4). By day 21, clinical symptoms began to resolve spontaneously (Table S4). Notably, in the long-term immunity experiment in rabbits, antibody levels did not decline until day 120 p.p.v (Fig. S5). These findings warrant further experiments in cattle.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChallenge and long-term immunity in cattle\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the challenge experiment in cattle, antibody levels increased after prime and booster vaccinations, with significant differences (\u003cem\u003ep\u003c/em\u003e-value \u0026lt; 0.05) between vaccinated calves and unvaccinated controls observed on day 28 at a titre of 21 % \u0026plusmn; 15.9, which is below positive the threshold of 30 %. Significantly high titres (sample to positive ratio, S/P %: 138 % \u0026plusmn; 67.9 and 185 % \u0026plusmn; 79.3) were observed on days 35, and 42 p.p.v (Fig. 2A and Table S5). Meantime, IFN-\u0026gamma; levels began to rise significantly in the vaccinated calves compared to controls on day 35 p.p.v (Fig. 2B and Table S6). In addition, neutralising antibody titres above the positive threshold of 1:8 titre were detected in all vaccinated calves on day 42 p.p.v (Fig. 2C). The significantly elevated IFN-\u0026gamma; levels, high levels of total antibodies, and the presence of neutralising antibodies in the vaccinated calves supported the decision to challenge the vaccinated calves with a virulent field strain (DO-21) on day 42 p.p.v. Their control calves were also challenged. In the vaccinated calves, body temperatures did not rise as high as those in controls from days 5 to 19 p.c (Fig. S6). Significant differences were calculated between the body temperatures of the vaccinated and controls on day 4, and from days 6 to 19 p.c, while no significant differences were observed between the blood parameters of vaccinated and controls (Figs. S7 and S8). In contrast, the vaccinated calves did not show any clinical signs, while all unvaccinated control calves exhibited fever, eye discharge, loss of appetite, and weakness (Fig. 3 and Table 1). In details, 4 of the 5 unvaccinated control calves had nasal discharge (Fig. 3D), 2 developed skin nodules on the neck (Fig. 3E\u0026ndash;I), one calf had swelling at injection site, and one calf died on day 5 p.c. To prevent any possible transmission risk, all vaccinated and unvaccinated calves were slaughtered and incinerated on day 18 p.c, in accordance with the guidelines of Biocombinat LLC and the regulations of the Control Ethics Committee of the Mongolian University of Life Science and Research Institute of Veterinary Medicine for the Use of Experimental Animals. Tissue samples were obtained from the skin nodule of the unvaccinated calves, washed once with 1 \u0026times; PBS containing the mixture PenStrep (Gibco), and then homogenized in the PBS with the PenStrep mixture to prepare a suspension. Total genomic DNA was extracted from the suspension using the WizPrep Viral DNA/RNA Mini kit (Wizbiosoultions, Seongnam-si, Republic of Korea), following manufacturer\u0026rsquo;s instructions. An LSDV \u003cem\u003eP32\u003c/em\u003e gene (1181 base pair) amplicon was detected in the genomic DNA using AccuPower Taq PCR PreMix (BIONEER, Daejeon, Republic of Korea), according to the manufacturer\u0026rsquo;s instructions, with forward (ATGGCAGATATCCCATT) and reverse (TTACCACAGGCTATTAGAAG) primers. An aliquot (200 \u0026micro;L) of suspension was inoculated into MDBK cell line, which showed CPE at 48 hours, while 1 \u0026times; 10\u003csup\u003e6.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL was measured on day 4 post-inoculation. These results suggest that the field strain is highly virulent and induces clinical symptoms in the unvaccinated control calves, while the vaccinated calves were fully protected from the lethal infection.\u003c/p\u003e\n\u003cp\u003eIn the long-term immunity experiment, antibody levels in vaccinated cattle began to rise from day 60 p.p.v (Fig. 4A and Table S7). The average of antibody levels across all cattle remained above the seropositivity threshold (S/P % \u0026ge; 30) until the end of the experiment, while 89 %, 100 %, 100 %, 78 %, 56 %, 44 % and 33 % of vaccinated cattle had an S/P % above 30 on days 60, 90, 120, 150, 180, 210, and 240 p.p.v, respectively (Table S7). Significant differences were observed between pre- and post-vaccinated antibody levels in vaccinated cattle on days 60, 90, 120, and 150 p.p.v (Fig. 4A). Additionally, neutralising antibody titres were detected on day 28 at titre of 1:4, which is below positive threshold of 1:8, then increased from day 60 and then gradually decreased overtime (Fig. 4B). Percentage of cattle with neutralising antibodies above positive threshold were observed on days 60, 90, and 120 p.p.v (Table S8). No adverse effects, including fever, loss of appetite, salivation, eye discharge, nasal discharge, and skin nodule, were observed in any of the cattle in the long-term immunity experiment. Notably, 7 of the 9 vaccinated cattle were adult female, and 3 of 7 cows delivered calves that grew normally. When antibody levels and neutralising antibodies were measured in the 3 cows and their calves, S/P was ranged between 20 % to 149 %, using ELISA, while serum dilution from 1:4 to 1:64 exhibited neutralising activity against LSDV, as evidenced by the absence of CPE on MDBK cells (Table 2). Overall, these results indicate that our vaccine induces long-term humoral immunity in some cattle for at least 8 months, as well as maternal immunity in the calves born to vaccinated cows. Because this is a field study, conducting a challenge experiment to assess long-term protective immunity was limited. To assess cellular immunity, blood samples from 9 cattle and 3 calves were stimulated with the inactivated field strain, and IFN-\u0026gamma; levels were measured and average S/P ratios from triplicate measurements were 2 %, 6 %, 1 %, 3 %, 9 % in 5 of 9 vaccinated cattle on day 240 p.p.v, all below positivity threshold (\u0026lt; 35 %). IFN-\u0026gamma; was not detected in the remaining 4 cattle or any of the 3 calves. It is note that cellular immunity is not typically passed from mother to calves.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePreviously studies suggest that inactivated vaccines against SPV and LSDV is considered to be safe and effective alternative methods to live attenuated vaccines [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Unlike live attenuated vaccines, inactivated vaccines do not lead risks, including transmission, reversion to pathogenicity, and genetic recombination with field strains, that have been previously reported after immunization with live attenuated vaccines [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan additionalcitationids=\"CR21 CR22\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Based on findings of previous studies, inactivated vaccines should be the preferred method of immunisation in countries experiencing sporadic LSD outbreaks, or border zones of non-endemic countries neighbouring endemic regions. In Mongolia, sporadic LSD outbreaks were reported in 2021 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] following outbreaks in China and Russia, both of which are neighbouring countries. In 2022, sporadic cases were reported in Mongolia and then no cases have been reported up to date [33, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://vet.gov.mn\u003c/span\u003e\u003cspan address=\"https://vet.gov.mn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e]. However, LSD outbreaks have still been reported in Russia and China from 2015 to 2023 [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], indicating ongoing circulation of the disease in Asian regions. Therefore, the development and evaluation of a safe and effective vaccine is crucial to ensure readiness for the prevention and control of further LSD outbreaks, as it is a transboundary disease. In the present study, we developed an inactivated vaccine using the field strain (DO-21) formulated with Montanide 206 adjuvant. This inactivated vaccine provided complete protective immunity in rabbits and cattle following a severe homologous challenge with same field strain (DO-21). The efficacy of our vaccine was consistent with that of vaccine tested in previously studies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In contrast, immune reactions, including total antibody levels and neutralising antibody titres above the thresholds, were often observed after booster vaccination in both the challenge and long-term immunity experiments in cattle in our study (Table S5 and S7), as well as in cattle vaccinated with an inactivated Neethling LSD strain in the previous study [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Such responses were found in less than 50% of the inactivated Neethling LSD strain-vaccinated cattle before booster vaccination in other previous studies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. These findings suggest that booster vaccination is necessary for the induction of cattle immunisation. However, it is important to note that, prior booster vaccination, IFN-γ releases, an indicator of cellular immune responses, were detectable in 20%, 60%, 80%, 40%, and 35% of vaccinated cattle on days 4, 6, 11, 16, and 21 p.p.v, respectively in our study (Table S6), which is consistent with the findings of previous studies [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. At least 14 days post-booster vaccination, all cattle vaccinated with inactivated vaccine were fully protected against lethal infection in the present and previous studies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Noteworthy, the percentage of clinically affected cattle among different populations is often variable, depending on the viral strain, as well as the age, immunological status, and breed of the hosts [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. For instance, a previous study found that clinical symptoms were observed in 83% of cattle experimentally infected with LSDV Nigeria (LSDV-V/281-Nigeria) strain [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In the present study, all unvaccinated control cattle showed clinical signs, whereas no such signs were observed in vaccinated cattle. Taken together, the findings of the present and previous studies suggest that the inactivated vaccine is an effective alternative to the live attenuated vaccine.\u003c/p\u003e \u003cp\u003eCompared to an inactivated vaccine, a live attenuated vaccine induces longer-lasting immunity in the cattle [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In the present study, the inactivated LSDV (DO-21) vaccine induces the presence of the specific antibodies against LSDV in all cattle for up to 120 days (Table S7), which is more effective than the findings in the previous study, where 68% of cattle remained antibodies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This discrepancy might be explained by the larger number of animals used in the previous study [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] compared to those in the present study. Additionally, 89% of cattle vaccinated with the inactivated LSDV (DO-21) strain retained neutralising antibodies at day 120 p.p.v in the present study (Table S8), however, this was not measured in the previous study [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These observations suggest that the inactivated vaccine can completely protect cattle against LSDV infection for at least four months. Moreover, in a previous study, seroconversion was observed in all cattle using ELISA, and neutralising antibodies were detected in over 80% of those cattle vaccinated with an LSDV-based inactivated vaccine at six months p.p.v, no clinical sings were observed following challenge with the LSD/OA3-Ts.MORAN strain, indicating complete protection [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In this previous study, over 60% and 50% of cattle immunised with the same inactivated vaccine exhibited seroconversion and neutralising antibodies, respectively, at twelve months p.p.v; 67% of these cattle were protected following the above-mentioned challenge infection. In the present study, 56% of cattle vaccinated with the inactivated LSDV (DO-21) strain exhibited seroconversion at six months p.p.v, but did not show neutralising antibodies; nevertheless, they may possibility partially protected by our prime- and booster vaccinations following the challenge infection at six months p.p.v, as similar to the observation in the previous study [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Probably, long-lasting immunity of at least four months is sufficiently contribute to control and prevent LSD outbreaks, particularly as LSD outbreaks often follow spatio-temporal clustering patterns [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. This is supported by the observations that outbreaks in a wide-region in Thailand and in Mongolia were brought under control within four months [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. After control program in these countries, using a vaccination strategy, only a few cases have been reported thereafter in these countries.\u003c/p\u003e \u003cp\u003eIn conclusion, the inactivated vaccines are safe and capable of inducing effective complete protective immunity in cattle following a severe challenge infection from at least 14 days post-booster vaccination, as well as long-lasting immunity for up to four months. Evaluation of the inactivated vaccine (DO-21 strain) in larger cattle populations and challenge experiments in vaccinated cattle at six months post-prime vaccination are of paramount importance in the further studies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Mongolian Foundation for Science and Technology (Project No. ShUTT 2022/290).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the local veterinarian, Batjargal Sumiyabazar, for his assistance with animal management. We also express our gratitude to the local herders, Tsendsuren Batjargal and Dorjkhand Bolormaa for kindly allowing us to conduct our field experiment on their land.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yondonjamts Enkhmandakh, Myagmarsuren Odonchimeg, Arinubold Munkhtsetseg, Enkhbaatar Batmagnai, Davaanyam Nyamtseren, Ochirvaani Bumantsetseg, Gundegmaa Uudamsaikhan, Bumduuren Tuvshintulga and Dashzevge Erdenechimeg. The first draft of the manuscript was written by Yondonjamts Enkhmandakh, Bumduuren Tuvshintulga and Dashzevge Erdenechimeg. All authors read and approved the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author Dashzevge Erdenechimeg on reasonable request (E-mail: [email protected]). \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted with the approval of the Control Ethics Committee of the Mongolian University of Life Science and Research Institute of Veterinary Medicine for the Use of Experimental Animals (approval no. 2023/01/23).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKing AMQ, Lefkowitz E, Adams MJ et al (2012) Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press; Waltham, MA, USA, pp 291\u0026ndash;309.\u003c/li\u003e\n\u003cli\u003eHamdi J, Boumart Z, Daouam S et al (2020) Development and evaluation of an inactivated lumpy skin disease vaccine for cattle. Vet Microbiol 245:108689. https://doi.org/10.1016/j.vetmic.2020.108689\u003c/li\u003e\n\u003cli\u003eTuppurainen E, Alexandrov T, Beltr\u0026aacute;n-Alcrudo D (2017) Lumpy skin disease field manual \u0026ndash; A manual for veterinarians. FAO Animal Production and Health Manual No. 20. Rome. Food and Agriculture Organization of the United Nations (FAO). 60 pages\u003c/li\u003e\n\u003cli\u003eAnnandale CH, Holm DE, Ebersohn K, Venter EH (2014) Seminal transmission of lumpy skin disease virus in heifers. Transbound Emerg Dis 61:443\u0026ndash;448. https://doi.org/10.1111/tbed.12045 \u003c/li\u003e\n\u003cli\u003ePanel E, Ahaw W (2015) Scientific opinion on lumpy skin disease. EFSA J 13:1\u0026ndash;73. https://doi.org/10.2903/j.efsa.2015.3986\u003c/li\u003e\n\u003cli\u003eAkther M, Akter SH, Sarker S et al (2023) Global burden of lumpy skin disease, outbreaks, and future challenges. Viruses 15:1861. https://doi.org/10.3390/v15091861 \u003c/li\u003e\n\u003cli\u003eAyelet G, Haftu R, Jemberie S et al (2014) Lumpy skin disease in cattle in central Ethiopia: outbreak investigation and isolation and molecular detection of the virus. Rev Sci Tech 33:877\u0026ndash;887. https://doi.org/10.20506/rst.33.3.2325 \u003c/li\u003e\n\u003cli\u003eWei YR, Ma WG, Wang P et al (2023) Retrospective genomic analysis of the first lumpy skin disease virus outbreak in China (2019). Front Vet Sci 9:1073648. https://doi.org/10.3389/fvets.2022.1073648 \u003c/li\u003e\n\u003cli\u003eBiswas D, Saha SS, Biswas S et al (2020) Outbreak of lumpy skin disease of cattle in south-west part of bangladesh and its clinical management. Vet Sci Res Reviews 6: 100-108. http://dx.doi.org/10.17582/journal.vsrr/2020.6.100.108 \u003c/li\u003e\n\u003cli\u003eKumar N, Chander Y, Kumar R et al (2021) Isolation and characterization of lumpy skin disease virus from cattle in India. PLoS One 16:e0241022. https://doi.org/10.1371/journal.pone.0241022\u003c/li\u003e\n\u003cli\u003eTran HTT, Truong AD, Dang AK et al (2021) Lumpy skin disease outbreaks in Vietnam, 2020. Transbound Emerg Dis 68:977\u0026ndash;980. https://doi.org/10.1111/tbed.14022\u003c/li\u003e\n\u003cli\u003ePorco A, Chea S, Sours S et al (2023) Case report: Lumpy skin disease in an endangered wild banteng (\u003cem\u003eBos javanicus\u003c/em\u003e) and initiation of a vaccination campaign in domestic livestock in Cambodia. Front Vet Sci 10: 1228505. https://doi.org/10.3389/fvets.2023.1228505\u003c/li\u003e\n\u003cli\u003eKhoo CK, Dahlan R, Mat Desa Z et al (2022) Molecular detection of lumpy skin disease virus in Malaysia 2021. Int J Infect Dis 116:S64. https://doi.org/10.1016/j.ijid.2021.12.150\u003c/li\u003e\n\u003cli\u003eOdonchimeg M, Erdenechimeg D, Tuvshinbayar A et al (2022) Molecular identification and risk factor analysis of the first lumpy skin disease outbreak in cattle in Mongolia. J Vet Med Sci 84:1244\u0026ndash;1252. https://doi.org/10.1292/jvms.22-0250 \u003c/li\u003e\n\u003cli\u003eKim GH, Yoo DS, Chu KS et al (2024) Assessing post-vaccination seroprevalence and enhancing strategies for lumpy skin disease vaccination in korean cattle. Animals (Basel) 14:3236. https://doi.org/10.3390/ani14223236 \u003c/li\u003e\n\u003cli\u003eAbutarbush SM, Tuppurainen ESM (2018) Serological and clinical evaluation of the Yugoslavian RM65 sheep pox strain vaccine use in cattle against lumpy skin disease. Transbound Emerg Dis 65:1657\u0026ndash;1663. https://doi.org/10.1111/tbed.12923\u003c/li\u003e\n\u003cli\u003eKatsoulos PD, Chaintoutis SC, Dovas CI et al (2018) Investigation on the incidence of adverse reactions, viraemia and haematological changes following field immunization of cattle using a live attenuated vaccine against lumpy skin disease. Transbound Emerg Dis 65:174\u0026ndash;185. https://doi.org/10.1111/tbed.12646 \u003c/li\u003e\n\u003cli\u003eTuppurainen ESM, Antoniou SE, Tsiamadis E et al (2020) Field observations and experiences gained from the implementation of control measures against lumpy skin disease in South-East Europe between 2015 and 2017. Prev Vet Med 181:104600. https://doi.org/10.1016/J.PREVETMED.2018.12.006 \u003c/li\u003e\n\u003cli\u003eFlannery J, Shih B, Haga IR et al (2022) A novel strain of lumpy skin disease virus causes clinical disease in cattle in Hong Kong. Transbound Emerg Dis 69:e336\u0026ndash;e343. https://doi.org/10.1111/tbed.14304 \u003c/li\u003e\n\u003cli\u003eSprygin A, Pestova Y, Bjadovskaya O et al (2020) Evidence of recombination of vaccine strains of lumpy skin disease virus with field strains, causing disease. PLoS One 15: e0232584. https://doi.org/10.1371/journal.pone.0232584\u003c/li\u003e\n\u003cli\u003eAgianniotaki EI, Tasioudi KE, Chaintoutis SC et al (2017) Lumpy skin disease outbreaks in Greece during 2015\u0026ndash;16, implementation of emergency immunization and genetic differentiation between field isolates and vaccine virus strains. Vet Microbiol 201:78\u0026ndash;84. https://doi.org/10.1016/j.vetmic.2016.12.037 \u003c/li\u003e\n\u003cli\u003eKononov A, Byadovskaya O, Kononova S et al (2019) Detection of vaccine-like strains of lumpy skin disease virus in outbreaks in Russia in 2017. Arch Virol 164:1575\u0026ndash;1585. https://doi.org/10.1007/s00705-019-04229-6 \u003c/li\u003e\n\u003cli\u003eMathijs E, Vandenbussche F, Nguyen L et al (2021) Coding-complete sequences of recombinant lumpy skin disease viruses collected in 2020 from four outbreaks in Northern Vietnam. Microbiol Resour Announc 10: e0089721. https://doi.org/10.1128/mra.00897-21 \u003c/li\u003e\n\u003cli\u003eWolff J, Moritz T, Schlottau K et al (2020) Development of a safe and highly efficient inactivated vaccine. Vaccines (Basel) 9:4. https://doi.org/10.3390/vaccines9010004\u003c/li\u003e\n\u003cli\u003eReed LJ, Muench H (1938) Journal of hygiene. Am J Hyg 27:493\u0026ndash;497. https://doi.org/10.1093/oxfordjournals.aje.a118408 \u003c/li\u003e\n\u003cli\u003eBahnemann HG (1976) Inactivation of viruses in serum with binary ethyleneimine. J Clin Microbiol 3:209\u0026ndash;210. https://doi.org/10.1128/jcm.3.2.209-210.1976\u003c/li\u003e\n\u003cli\u003eWOAH Terrestrial Manual. Chapter 3.4.12, Lumpy skin disease. Available online: https://www.woah.org/fileadmin/Home/eng/Health_standards/tahm/3.04.12_LSD.pdf \u003c/li\u003e\n\u003cli\u003eCarn VM, Kitching RP (1995) The clinical response of cattle experimentally infected with lumpy skin disease (Neethling) virus. Arch Virol 140:503-513. https://doi.org/10.1007/bf01718427 \u003c/li\u003e\n\u003cli\u003eAickin M, Gensler H (1996) Adjusting for multiple testing when reporting research results: The Bonferroni vs Holm methods. Am J Public Health 86:726\u0026ndash;728. https://doi.org/10.2105/AJPH.86.5.726 \u003c/li\u003e\n\u003cli\u003eBoumart Z, Daouam S, Belkourati I et al (2016) Comparative innocuity and efficacy of live and inactivated sheeppox vaccines. BMC Vet Res 12:133. https://doi.org/10.1186/s12917-016-0754-0 \u003c/li\u003e\n\u003cli\u003eEs-sadeqy Y, Bamouh Z, Ennahli A et al (2021) Development of an inactivated combined vaccine for protection of cattle against lumpy skin disease and bluetongue viruses. Vet Microbiol 256:109046. https://doi.org/10.1016/j.vetmic.2021.109046 \u003c/li\u003e\n\u003cli\u003eByadovskaya O, Prutnikov P, Shalina K et al (2022) The changing epidemiology of lumpy skin disease in Russia since the first introduction from 2015 to 2020. Transbound Emerg Dis 69:e2551\u0026ndash;e2562. https://doi.org/10.1111/tbed.14599 \u003c/li\u003e\n\u003cli\u003eSprygin A, Krotova A, Jun M et al (2025) Whole genome sequencing of lumpy skin disease virus from 2021\u0026ndash;2023 in Eastern Eurasia reveals no more recombination signals in the circulating pool of strains. Viruses 17: 468. https://doi.org/10.3390/v17040468 \u003c/li\u003e\n\u003cli\u003eSong Y, Zuo O, Zhang G et al (2024) Emergence of lumpy skin disease virus infection in yaks, cattle-yaks, and cattle on the Qinghai-Xizang Plateau of China. Transbound Emerg Dis 2024:2383886. https://doi.org/10.1155/2024/2383886 \u003c/li\u003e\n\u003cli\u003eKresic N, Philips W, Haegeman A et al (2025) Evaluation of an interferon-gamma release assay for early detection of lumpy skin disease virus infection and vaccination in cattle. 13:e0293924. https://doi.org/10.1128/spectrum.02939-24\u003c/li\u003e\n\u003cli\u003eHaegeman A, Leeuw I De, Mostin L et al (2023) Duration of immunity induced after vaccination of cattle with a live attenuated or inactivated lumpy skin disease virus vaccine. Microorganisms 11:210. https://doi.org/10.3390/microorganisms11010210 \u003c/li\u003e\n\u003cli\u003eWolff J, Tuppurainen E, Adedeji A et al (2022) Characterization of a nigerian lumpy skin disease virus isolate after experimental infection of cattle. Pathogens 11:16. https://doi.org/10.3390/pathogens11010016 \u003c/li\u003e\n\u003cli\u003eMaulana KY, Na-Lampang K, Arjkumpa O et al (2025) Geographical distribution, spatial directional trends, and spatio-temporal clusters of the first rapid and widespread lumpy skin disease outbreaks in Thailand. Transbound Emerg Dis 2025:4900775. https://doi.org/10.1155/tbed/4900775 \u003c/li\u003e\n\u003cli\u003eSprygin A, Sainnokhoi T, Gombo-Ochir D et al (2022) Genetic characterization and epidemiological analysis of the first lumpy skin disease virus outbreak in Mongolia, 2021. Transbound Emerg Dis 69:3664\u0026ndash;3672. https://doi.org/10.1111/tbed.14736 \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"18\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003e Monitoring of clinical signs of vaccinated calves challenged with a virulent field strain.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical signs\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"16\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eDays post-challenge\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eVaccinated\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 5)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eBelow clinical symptoms\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"6\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(\u003cem\u003en\u003c/em\u003e = 5)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003eFever\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eLoss of appetite\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSalivation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eEye discharge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eNasal discharge\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e++\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eSkin nodule\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"18\" valign=\"top\"\u003e\n \u003cp\u003eA plus sign (+), mild clinical signs; double plus sign (++), severe clinical signs; A minus sign (-), No clinical signs; Control, unvaccinated cattle.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" style=\"width: 602px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 2.\u0026nbsp;\u003c/strong\u003elevels of total antibodies and neutralizing antibodies in vaccinated cows and their calves\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" style=\"width: 147px;\"\u003e\n \u003cp\u003eNumber of cattle and their calves\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"3\" style=\"width: 80px;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"4\" style=\"width: 375px;\"\u003e\n \u003cp\u003eLevels of total antibodies and neutralizing antibodies\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 150px;\"\u003e\n \u003cp\u003eTotal antibody levels, S/P (%)*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" style=\"width: 225px;\"\u003e\n \u003cp\u003eNeutralizing antibody levels (average of titers\u0026nbsp;\u0026plusmn; std)**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003eOn day 210\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 75px;\"\u003e\n \u003cp\u003eOn day 240\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 113px;\"\u003e\n \u003cp\u003eOn day 210\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 112px;\"\u003e\n \u003cp\u003eOn day 240\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№4 (cow)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e122\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e133\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e1:64 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e1:7 \u0026plusmn; 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№4 (calf of cow no. 4)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e149\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e103\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e16 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e4 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№12 (cow)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e114\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e32 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e8 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№12 (calf of cow no. 12)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e265\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e161\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e16 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e5 \u0026plusmn; 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№14 (cow)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e16 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e4 \u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 147px;\"\u003e\n \u003cp\u003e№14 (calf of cow no. 14)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 80px;\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 75px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e4\u0026nbsp;\u0026plusmn; 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 112px;\"\u003e\n \u003cp\u003e5\u0026nbsp;\u0026plusmn; 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"6\" valign=\"top\" style=\"width: 602px;\"\u003e\n \u003cp\u003eAn asterisk indicates that total antibody levels were measured in each serum sample using one well of the ID Screen\u0026reg; Capripox Double Antigen Multi-species ELISA kit; a double asterisk indicates that each serum sample was tested in triplicate; std, standard deviation, calculated from the results of the triplicates.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6728676/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6728676/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLumpy skin disease (LSD) causes significant economic losses to cattle industries. In Mongolia, LSD outbreaks were first reported in 2021, with a few additional cases later that year. The situation has since alleviated due to effective control measures, including the use of live-attenuated vaccines. However, unlike the inactivated vaccine, live-attenuated vaccines carry risks, including genetic recombination and vaccine-associated clinical symptoms and outbreaks.\u003c/p\u003e \u003cp\u003eOur research group previously isolated a field strain of LSDV, designated DO-21, from the first outbreak in Mongolia in 2021. Using this laboratory-adapted strain, we developed an inactivated vaccine by treating it with binary ethyleneimine and formulating it with Montanide ISA 206, a water-in-oil-water adjuvant. Safety was confirmed in mice and cattle using administrations of 3- and 7-fold higher doses of the inactivated vaccine, respectively. In the challenge experiments, all rabbits and cattle were fully protected by day 14 post-booster vaccination following a severe homologous challenge with same field strain (DO-21) without any clinical signs. On the same day, all five vaccinated rabbits showed seroconversion, while all five immunised calves exhibited seroconversion and neutralising antibodies, with interferon-gamma release detected in their blood samples following viral exposure. In addition, seroconversion persisted in all three vaccinated rabbits for at least 120 days post-prime vaccination, while both seroconversion and neutralising antibodies were maintained in all nine cattle for 120 days post-prime vaccination. In conclusion, inactivated vaccines are alternatives to live-attenuated vaccines, particularly in countries with sporadic cases of LSD or in non-endemic countries bordering endemic regions.\u003c/p\u003e","manuscriptTitle":"Effective inactivated lumpy skin disease vaccine for cattle using a field viral strain and Montanide 206","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-05 10:25:57","doi":"10.21203/rs.3.rs-6728676/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-07-04T04:40:35+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-30T06:52:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-23T07:23:11+00:00","index":"","fulltext":""},{"type":"submitted","content":"Archives of Virology","date":"2025-05-22T22:45:07+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"archives-of-virology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"arvi","sideBox":"Learn more about [Archives of Virology](https://www.springer.com/journal/705)","snPcode":"705","submissionUrl":"https://submission.nature.com/new-submission/705/3","title":"Archives of Virology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2536949c-cf77-498b-b98e-ad9ead28ec83","owner":[],"postedDate":"June 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-02-13T07:55:12+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-05 10:25:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6728676","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6728676","identity":"rs-6728676","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-27T02:00:06.600101+00:00
License: CC-BY-4.0