Taliglucerase Alfa Modulates Aβ Load and Autophagy-Related Pathways in Mouse Hippocampal Neurons Exposed to oAβ1-42

Taliglucerase Alfa Modulates Aβ Load and Autophagy-Related Pathways in Mouse Hippocampal Neurons Exposed to oAβ1-42 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Taliglucerase Alfa Modulates Aβ Load and Autophagy-Related Pathways in Mouse Hippocampal Neurons Exposed to oAβ 1-42 Çağrı Özkurt, Selma Köse, Çimen Karasu, Arjan Kortholt, Pelin Kelicen-Uğur This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7094261/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Intraneuronal amyloid-beta (Aβ) accumulation and autophagic dysfunction are key pathological features of Alzheimer's disease (AD). Mutations in GBA1 , which encodes the lysosomal enzyme β-glucocerebrosidase (GCase), are linked to several neurodegenerative disorders, but the role of GCase in AD is underexplored. We hypothesized that taliglucerase alfa (TAL), a recombinant human GCase, could reduce intracellular Aβ accumulation by modulating autophagy pathways in a neuronal AD model. Endogenous Aβ accumulation was induced in mouse hippocampal neuronal cells (HT-22) by exposure to an oligomeric Aβ fragment (oAβ 1−42 ), followed by treatment with TAL. Using Western blotting, ELISA, and RT-PCR, we evaluated soluble Aβ levels and key proteins in the autophagy-lysosome pathway, including GCase, cathepsin B, p62/sequestosome-1 (p62/ SQSTM1 ), and the mammalian target of rapamycin (mTOR). In this in vitro model, TAL significantly reduced the intracellular load of monomeric Aβ. This reduction was associated with a restoration of autophagic function, marked by the normalization of mTOR signaling and p62 levels, alongside enhanced lysosomal proteolytic capacity. These findings suggest that enhancing lysosomal GCase levels through enzyme replacement therapy represents a promising therapeutic strategy for the treatment of AD. Taliglucerase alfa β-glucocerebrosidase Alzheimer’s disease autophagy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Alzheimer’s disease (AD) is the most prevalent neurodegenerative disorder, defined by the presence of extracellular senile plaques formed by amyloid-beta (Aβ) and intracellular neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau protein. While the extracellular aggregation of Aβ is central to the onset and progression of AD [ 1 ]; recent studies suggest that the intraneuronal accumulation of Aβ, driven by oligomer internalization, is neurotoxic and may play a critical role in advancing the disease [ 2 – 4 ]. Glucocerebrosidase (GCase) is a lysosomal enzyme responsible for catalyzing the hydrolysis of glucosylceramide into glucose and ceramide. Deficiencies in GCase, encoded by the GBA1 gene, have been linked to various neurodegenerative diseases. Homozygous mutations in GBA1 are specifically associated with Gaucher’s disease (GD), a lysosomal storage disorder [ 5 , 6 ]. GD patients typically express less than 15% of functional GCase, which causes accumulation of glucosylceramide and glucosylsphingosine in the cells [ 7 ]. Taliglucerase alfa (TAL), a recombinant human glucocerebrosidase analogue (rhGCase or rhGBA), is produced in genetically modified carrot cells by recombinant DNA technology [ 8 ]. The lysosomal glucosidase GCase is required for hydrolysis of glucosylceramide and is targeted to lysosomes in a mannose-6 phosphate–independent manner by the lysosomal integral membrane protein type-2 (LIMP-2) [ 9 ]. TAL, marketed in the U.S. as ELELYSO® (Pfizer) for injection is indicated for the treatment of patients 4 years and older with confirmed diagnosis of Type 1 GD. It is a monomeric glycoprotein enzyme containing four N-linked glycosylation sites (MW: 60.8 kDA). It differs from native human GCase by two amino acids at the N terminal and up to 7 amino acids at the C terminal. TAL is a glycosylated protein with oligosaccharide chains at the glycosylation sites having terminal mannose sugars. These mannose-terminated oligosaccharide chains of TAL are specifically recognized by endocytic carbohydrate receptors on the cells that accumulate lipid in GD [ 8 ]. The involvement of GCase in the pathogenesis of AD remains largely underexplored. Recently, it was demonstrated that GCase expression and enzyme activity in the brain of AD patients is lowered and that this deficiency could play a role in the development of AD by inducing lysosomal dysfunction. In addition, it was demonstrated that GCase lentivirus (human complementary DNA of GBA1 ) facilitates the clearance of Aβ 1− 42 oligomers and protects against Aβ 1− 42 oligomer-induced neuronal cell death by enhancing lysosomal function [ 10 ]. Lysosomes collaborate with autophagosomes to degrade and recycle misfolded cytoplasmic proteins, such as Aβ, and organelles within the cytoplasm [ 11 , 12 ]. Increased deposition of Aβ is considered a key factor in the pathogenesis of AD [ 13 ], and impaired autophagy has been observed in both animal models of AD and AD patients [ 14 – 16 ]. Thus, strategies targeting autophagy-related proteins to regulate Aβ production, clearance, and aggregation hold significant potential for the treatment of AD [ 17 ]. Autophagy begins with the formation of preautophagosome membrane originating from the endoplasmic reticulum membrane. The elongation of the preautophagosome is driven by the activation of early-stage autophagy-related proteins (Atgs), including Atg5, Atg12, Atg14, Atg16L, and beclin-1. Soluble form of microtubule-associated protein 1 light chain 3-I (LC3-I) is a cytosolic Atg that undergoes post-translational modification into the membrane-bound form LC3-II during autophagosome formation [ 18 ], the preautophagosome closes and matures into an autophagosome. The activation of p62 by the Atg16L-beclin-1 complex facilitates autophagic flux, leading to lysosomal transport. The mature autophagosome membrane fuses with the lysosomal membrane, activating late lysosomal proteins and presenting its contents to lysosomal enzymes (cathepsins B, D, and L) for degradation in the acidic lysosomal environment [ 19 ]. The formation of autophagosomes is also regulated by the mammalian target of rapamycin (mTOR). AMP-activated protein kinases (AMPK; heterotrimeric serine/threonine protein kinases) are key regulators of body metabolism. It is well-established that AMPK activation induces autophagy by suppressing mTOR, the primary inhibitor of autophago-some formation. Studies have shown that AMPK activators enhance autophagy by inhibiting mTOR signaling and trigger Aβ degradation via the lysosomal system. Conversely, Aβ has been found to increase mTOR activity, while reductions in Aβ levels decrease mTOR activity, providing evidence of the reciprocal relationship between mTOR and Aβ [ 20 , 21 ]. Furthermore, the levels of p62/sequestosome-1 (p62/ SQSTM1 ), an autophagic cargo protein and a widely recognized marker of autophagic flux, accumulate during autophagy inhibition and diminish when autophagy is activated [ 22 ]. Additionally, sestrins are highly conserved proteins encoded by stress-responsive genes, such as those activated by DNA damage, oxidative stress, and hypoxia. Among the three sestrin isoforms expressed in mammalian cells (SESN-1, SESN-2, SESN-3) [ 23 ], SESN-2 has been the most extensively studied, with its cytoprotective effects attributed to its antioxidant activity and its role in inducing autophagy [ 24 , 25 ]. SESN-2, which is induced by stress conditions [ 26 ], promotes autophagy induction by activating AMPK and subsequently suppressing mTOR activity [ 27 , 28 ]. To directly investigate the impact of augmenting functional GCase within neuronal lysosomes, we selected TAL for this study over other GCase-enhancing strategies such as small-molecule chaperones (e.g., ambroxol) or substrate-reduction agents (e.g., venglustat). As an enzyme replacement therapy, TAL delivers fully active, well-characterized recombinant GCase, enabling a direct assessment of enzyme supplementation. Furthermore, TAL’s mannose-terminated glycans are designed to promote efficient cellular uptake and lysosomal delivery via mannose receptors, ensuring the enzyme reaches its intended site of action. The availability of GMP-grade TAL also provided high purity and batch-to-batch consistency, crucial for the reproducibility of our mechanistic in vitro investigations. The present study hypothesized that TAL might restore GCase and autophagy function in neuronal cells exposed to oAβ 1−42 , in turn, mitigate Aβ accumulation. To evaluate this hypothesis, we examined the impact of TAL on Aβ accumulation in mouse hippocampal neurons (HT-22 neuronal cells) exposed to oligomeric Aβ 1−42 (oAβ 1−42 ), as well as key markers of the autophagy-lysosome pathway implicated in AD. 2. Results 2.1. Exposure of oAβ 1−42 increased cytotoxicity, and TAL protected HT-22 cells from oAβ 1−42 toxicity Initially, the effective concentrations of TAL were determined based on concentration ranges reported in the literature. In humans, TAL is administered intravenously every two weeks, primarily targeting peripheral effects in Gaucher disease, with a pediatric dose of 30 U/kg and an adult dose of 60 U/kg. After 38 weeks of treatment, the maximum plasma concentrations were reported as 1656 ± 1116 ng/mL in pediatric patients and 5153 ± 3099 ng/mL in adult patients [ 29 ]. In our study, cytotoxicity assays were performed using the lowest median, and highest concentrations within the selected range. TAL was not cytotoxic to HT-22 cells when used at these concentrations for 32 h (F (4,18) = 0.3218, p = 0.8596; Fig. 1 a), therefore we used the highest concentration of 8252 ng/mL for further investigations (p = 0.9165). To evaluate the cytotoxic effect of oligomeric Aβ 1−42 (oAβ 1−42 ), two concentrations and three incubation time points were selected. While 5 µM oAβ 1−42 did not induce cytotoxicity after 24 hours of incubation (p = 0.7765), it did result in cytotoxic effects following 32- and 48-hour incubations (p = 0.0009 and p < 0.0001, respectively). TAL successfully reversed the cytotoxicity induced by 5 µM oAβ at the 32-hour time point (p < 0.0001 compared to the oAβ 1−42 -treated group; p = 0.8250 compared to the control group; Fig. 1 b). In contrast, 10 µM oAβ 1−42 exhibited cytotoxicity at all time points (p < 0.0001), and TAL failed to reverse the cytotoxic effects at any of these time intervals (p = 0.8494 at 24 h, p = 0.9997 at 32 h, and p = 0.0589 at 48 h; Fig. 1 b). Notably, treatment with 8252 ng/mL TAL alone for 24 hours resulted in a moderate increase in cell viability compared to the control group (p < 0.0001). However, prolonged exposure for 32 and 48 hours at the same concentration did not yield a statistically significant difference in viability relative to untreated controls (p = 0.5047 and p = 0.0194, respectively; Fig. 1 b). Based on these observations, subsequent experiments were conducted using 5 µM oAβ 1−42 , 8252 ng/mL TAL, and a 32-hour incubation period as the standardized experimental conditions. 2.2. Treatment with TAL Decreased Intraneuronal Aβ Accumulation and Increased Lysosomal GCase and Cathepsin B Levels Western blot analyses were conducted on HT-22 cell lysates following incubation with TAL and/or oAβ 1−42 . After 32 hours of exposure to 5 µM oAβ 1−42 , a significant elevation was observed in monomeric Aβ (4.5 kDa) (p = 0.0038), while the increase in low molecular weight (LMW) Aβ forms—tetramers, trimers, and dimers—did not reach statistical significance (p = 0.0685; Figs. 2 a, b). Co-treatment with TAL (8252 ng/mL) markedly attenuated the increase in monomeric Aβ levels (p = 0.0083), while levels of LMW Aβ forms remained unaffected (p = 0.1502; Figs. 2 a, b). Additionally, in lysosomal extracts, oAβ 1−42 treatment alone did not alter GCase protein expression relative to the control; however, co-treatment with oAβ 1−42 and TAL, as well as TAL treatment alone, increased GCase protein expression in HT-22 cells (Fig. 2 c). Notably, the lysosomal extracts demonstrated the precursor (pro) form of cathepsin B in control and oAβ 1−42 -treated cells, in contrast to the detection of its active form following treatment with TAL, either independently or together with oAβ 1−42 (Fig. 2 c). 2.3. TAL Modulates Key Proteins in the Autophagy Signaling Pathway To evaluate potential alterations in the autophagy pathway, we performed Western blot analyses on key regulatory proteins in extracts from HT-22 cells exposed to oAβ 1−42 and/or TAL (Fig. 3 ). First, we examined the phosphorylation of mTOR, a primary inhibitor of autophagy initiation. In HT-22 cells, oAβ 1−42 exposure led to a significant increase in the p-mTOR/mTOR ratio compared to control cells (p = 0.0005). This effect was completely reversed by co-treatment with TAL (p = 0.0046 vs. oAβ 1−42 group), which brought the ratio back to control levels (p = 0.5265; Figs. 3 a, b). Next, we assessed the activation state of AMPK, a known upstream regulator of mTOR. Our analysis of the p-AMPK/AMPK ratio revealed no statistically significant differences among any of the treatment groups (F (3,16) = 0.6886, p = 0.5721; Figs. 3 c, d). This suggests that the observed effects on mTOR occur independently of changes in global AMPK activation in this model. We then measured the levels of p62/ SQSTM1 , a cargo receptor that accumulates when autophagic flux is impaired. Consistent with mTOR upregulation, oAβ 1−42 treatment caused a significant increase in p62 levels (p = 0.0456). Co-treatment with TAL successfully reversed this accumulation, significantly reducing p62 levels compared to the oAβ 1−42 group (p = 0.0093; Figs. 3 e, f). Finally, we analyzed the LC3-II/I ratio, a marker of autophagosome formation. While we observed a trend towards a decrease in this ratio with oAβ 1−42 treatment, a one-way ANOVA did not find a statistically significant overall difference among the groups (F (3,18) = 2.906, p = 0.0630; Figs. 3 g, h). Therefore, we could not conclude that TAL provided a statistically significant rescue of this specific marker. 2.4. TAL Treatment Modulated the Gene Expression of Autophagy-Related Markers To further investigate the mechanisms underlying TAL's effects on autophagy, we examined the gene expression of several key autophagy-related markers using RT-PCR (Fig. 4 ). In cells exposed to oAβ 1−42 , we observed a trend towards increased expression of the stress-response gene SESN2 (Fig. 4 a), and a corresponding trend towards decreased expression of the autophagy initiation genes ATG5 (Fig. 4 b) and BECN1 (Fig. 4 c). In all cases, co-treatment with TAL appeared to normalize these expression levels back towards those seen in control cells. It is important to note that these experiments were conducted with a low replicate number (n = 2) and are therefore presented as preliminary findings without claims of statistical significance. 2.5. TAL Does Not Affect pLRRK2/LRRK2 Ratio or Total Endogenous GCase Levels in HT-22 Cells Insights from studies on LRRK2 and GCase interaction led us to examine the potential impact of TAL, a human recombinant GCase analogue, on the pLRRK2/LRRK2 ratio in an in vitro AD model. In HT-22 cells, oAβ 1−42 exposure did not significantly alter p-LRRK2/LRRK2 levels, nor did co-treatment with TAL (8252 ng/mL) and 5 µM oAβ 1−42 impact the p-LRRK2/LRRK2 ratio (F (3,23) = 1.682, p = 0.1986; Figs. 5 a, b). Although TAL at a concentration of 8252 ng/mL increased GCase protein expression in lysosomal extracts (Fig. 2 c), exposure of cells to increasing concentrations of TAL (540, 1656, 3056, 5153 and 8252 ng/mL) did not lead to an increase in GCase levels in total cell extracts compared to the control (F (5,12) = 0.4272, p = 0.8212; Online Resource 1).The amount of GCase protein in PBS extracts of HT-22 cells, as determined by ELISA, remained unaltered following exposure to oAβ 1−42 , TAL, or their co-administration (Fig. 5 c). 3. Discussion The current findings indicate that TAL, a recombinant form of GCase, decreased Aβ accumulation and modulated the expression of autophagy-related proteins in HT-22 cells. These results imply that TAL may influence various pathways that contribute to reduced Aβ deposition, potentially through the optimization of autophagy-regulatory mechanisms. The amyloid hypothesis of AD, which asserts that Aβ plays a central role as the key peptide, has been widely accepted since 1992 [ 30 , 31 ]. Aβ forms soluble, low molecular weight (LMW) oligomers in tetrameric, trimeric, and dimeric structures [ 32 ], which are considered toxic forms of the peptide before they deposit into amyloid plaques [ 33 ]. These oligomeric species are internalized and accumulate within neuronal cells [ 2 – 4 ]. Monomeric forms, however, have the potential to convert into these oligomeric forms. It was suggested that release of Aβ 1−42 monomers or oligomers into the cytoplasm and subsequent aggregation on microtubules may also be critical determinants of neurotoxicity [ 34 , 35 ]. In this study, to assess whether TAL reduces oAβ 1−42 -induced toxicity and Aβ burden, HT-22 cells were treated with TAL at 8252 ng/mL in combination with 5 µM oAβ 1−42 for 32 hours, which led to a reduction in monomeric Aβ load (Figs. 2 a, b). Additionally, cell viability, reduced by 5 µM oAβ 1−42 for 32 hours, returned to control levels in cells treated with TAL at 8252 ng/mL (Fig. 1 b). In the prevalent model of AD, oligomers of Aβ are considered to be the main neurotoxic species; however, in the context of our studies, the monomeric forms of oAβ 1−42 , which are prone to conversion into neurotoxic oligomers, might also contribute to the progression of AD by exerting a partially modulatory effect on autophagy pathways. Based on these results, the observed reduction in monomeric Aβ following TAL treatment likely reflects a multi-pronged impact on Aβ metabolism, extending beyond simple degradation. By enhancing lysosomal GCase activity, TAL improves overall lysosomal function and remodels the local lipid environment [ 10 , 36 ]. Improved lysosomal efficiency can enhance the degradation of Aβ precursors like APP and its C-terminal fragments; this enhanced clearance, in turn, offers a potential route to reduced Aβ production [ 37 ]. Furthermore, altered membrane lipid composition, influenced by GCase activity, may directly modulate the activity of secretase enzymes involved in Aβ generation [ 38 , 39 ]. Simultaneously, enhanced lysosomal activity facilitates the rapid clearance of internalized soluble Aβ monomers [ 40 ]. This efficient removal is critical because endo-lysosomal compartments are key sites for intracellular Aβ accumulation and seeding [ 41 , 42 ]. By reducing monomer concentration and preventing their accumulation within these vesicles, TAL directly disrupts the earliest stages of Aβ aggregation. This mechanism is key to inhibiting the formation of toxic oligomeric seeds before significant oligomerization can occur [ 42 , 43 ]. Thus, TAL's impact on lysosomal health and lipid homeostasis likely contributes by reducing the available Aβ monomer pool and by preventing the initial steps of aggregation. Autophagy and lysosomal function are disrupted in individuals with AD and other neurodegenerative disorders linked to protein aggregation. Autophagic markers, such as Atg5, beclin-1, Atg12, and LC3, are also present in amyloid plaques and neurofibrillary tangles in the brains of AD patients [ 44 , 45 ]. Furthermore, studies have demonstrated that amyloid precursor protein (APP) and Aβ peptides co-localize with LC3-positive autophagosomes in neuroblastoma cells overexpressing APP and in AD mouse models [ 46 , 47 ], suggesting that Aβ may be a substrate for autophagic degradation. Additionally, Aβ has been shown to enhance mTOR signaling, and a reduction in mTOR activity correlates with decreased Aβ levels, indicating a relationship between mTOR signaling and Aβ [ 48 , 49 ]. Due to its hydrophobic carboxyl terminus [ 50 ], Aβ may disrupt intracellular organelle trafficking as well as the trafficking of autophagosomes and their fusion with lysosomes [ 51 – 53 ]. Furthermore, Aβ accumulation within lysosomes [ 54 , 55 ] has been linked to impaired autophagy and lysosomal degradation [ 21 , 56 ]. TAL is a recombinant enzyme analogue used in Gaucher disease (GD), a rare inherited lysosomal storage disorder. In GD, compounds that cannot be degraded, especially lipids, accumulate in the lysosomes, leading to cellular damage and pathological events in the spleen, bone marrow, liver, lungs, and brain. The affected lysosomal enzyme in GD is GCase, which catalyzes the breakdown of glucosylceramide into glucose and ceramide. Homozygous mutations in the GBA1 gene that encodes GCase reduce the lysosomal degradation capacity and cause the accumulation of misfolded proteins. Since lysosomes are also responsible for the degradation of dysfunctional organelles, impaired GCase function leads to the accumulation of damaged organelles within the cell. GCase deficiency and the loss of enzymatic activity have been associated with the pathological progression of AD and increased cell-to-cell spread of Aβ [ 10 ]. Limited information is available regarding the potential impact of GCase deficiency on AD pathology. Given the critical role of Aβ accumulation and lysosomal functionality in AD progression, it is hypothesized that overexpression of GCase could have significant effects in preventing disease progression. Studies have shown a significant reduction in GCase protein levels and enzymatic activity in postmortem hippocampal brain tissue of AD patients and primary neurons exposed to Aβ 1−42 oligomers. Ectopic expression of GCase via lentivirus has corrected the impaired lysosomal activity and accelerated the degradation of Aβ 1−42 oligomers, thereby protecting neurons from Aβ 1−42 -induced toxicity. Notably, the neuronal death caused by Aβ 1−42 oligomers was found to correlate with a decrease in GCase protein levels and enzymatic activity, along with accompanying lysosomal biogenesis and acidification damage [ 10 ]. The increased Aβ aggregation and APP observed in GD mice further highlight the relationship between GCase dysfunction and AD. In addition to the synaptic dysfunction observed in nerve cell death, it is suggested that Aβ 1−42 causes lysosomal membrane permeabilization (LMP) due to a loss of lysosomal acidification and disruption of membrane integrity. In primary neurons exposed to oAβ 1−42 , an increase in intracellular acidification, along with a decrease in lysosome number and size, suggests that LMP plays a role in Aβ toxicity. GCase expression, however has been shown to reverse Aβ oligomer-induced LMP. In AD patients, the expression and enzymatic activity of GCase are reduced, contributing to lysosomal dysfunction and playing a significant role in the development of AD. Gene therapy targeting the GBA1 gene that encodes GCase accelerates Aβ oligomer clearance through increased lysosomal function and protects neurons from Aβ 1−42 -induced cell death [ 10 ]. Pharmacological enzyme replacement therapy aimed at restoring GCase activity or enhancing lysosomal function could be a potential new therapeutic strategy to prevent the progression of AD pathology. However, in our study, total cell extracts showed no increase in GCase protein expression (determined by Western blot) or GCase protein amount (determined by ELISA) in response to rising concentrations of TAL (Online Resource 1; Fig. 5 c). In contrast, the pronounced accumulation of GCase observed in lysosomal extracts suggests that TAL exerts its effect through lysosomal accumulation. Moreover, TAL exposure resulted in the accumulation of GCase protein in lysosomal extracts, and the mature form of cathepsin B was also detected in the lysosomal extracts of HT-22 cells (Fig. 2 c). The lack of a concentration-dependent increase in GCase expression or GCase level in total cell extracts, together with the pronounced accumulation of TAL in lysosomal fractions, supports the interpretation that TAL mediates its effect through lysosomal sequestration. In this study, the autophagy-related proteins p-AMPK/AMPK, p62/ SQSTM1 and LC3-II/I were measured in HT-22 cells, along with the assessment of mTOR, the central regulator of autophagy (Fig. 3 ), which coordinates autophagic activity through sequential actions of Atgs [ 57 ]. The post-translational modification of LC3-I to LC3-II occurs during autophagosome formation and is incorporated into the growing autophagosome. Mutational analyses indicate that cytosolic LC3-I is formed by the removal of the C-terminal 22 amino acids from newly synthesized LC3, followed by the conversion of a portion of LC3-I to LC3-II. The amount of LC3-II correlates with the extent of autophagosome formation, and LC3 is the first mammalian protein specifically associated with autophagosome membranes [ 58 ]. Lysosomal fusion and protease activity are critical for autophagy, and any abnormalities in this phase can impair cargo degradation, even if other steps in the autophagic pathway function normally. p62/ SQSTM1 is an autophagosome cargo protein involved in protein turnover by initiating lysosomal degradation via autophagic flux. The LC3-interacting region of p62/ SQSTM1 promotes selective autophagy by interacting with LC3 [ 59 , 60 ]. Treatment of HT-22 cells with oAβ 1−42 resulted in a significant increase in p-mTOR/mTOR (Figs. 3 a, b) and p62/ SQSTM1 (Figs. 3 e, f) levels, accompanied by a decrease in the LC3-II/I protein levels (Figs. 3 g, h). In addition, treatment with TAL, either alone or in combination with oAβ 1−42 , promoted the conversion of the precursor form of cathepsin B (pro-catB; 43–45 kDa), observed in the lysosomal extracts of control and oAβ 1−42 -treated cells, into the fully active (enzymatically active; mature; 25–27 kDa) double-chain form consisting of heavy and light subunits (Fig. 2 c). Although TAL alone did not induce significant changes in p-mTOR/mTOR, p62, or the LC3-II/I ratio, as shown in Fig. 3 , the combined treatment of TAL at 8252 ng/mL and 5 µM oAβ 1−42 for 32 hours significantly impacted the autophagy regulatory pathway. This resulted in a notable decrease in the oAβ 1−42 -induced elevation of p-mTOR/mTOR and p62 levels (Figs. 3 b, f). However, this treatment did not lead to a statistically significant reversal of the trend towards a reduced LC3-II/I ratio caused by oAβ 1−42 (Fig. 3 h). These findings suggest that TAL, when co-administered with oAβ 1−42 , enhances autophagic flux in HT-22 cells, as evidenced by the clearance of p62. The current results also demonstrate that simultaneous exposure to oAβ 1−42 and TAL prevents the oAβ 1−42 -induced suppression of ATG5 gene expression (Fig. 4 b). These findings further suggest that TAL may partially facilitate Aβ clearance through an autophagy-dependent mechanism. The induction of sestrin-dependent AMPK activation and the suppression of mTORC1 activity are critical for the maintenance of basal autophagy [ 61 ]. Sestrin-mediated inhibition of mTOR is also essential for the autophagic degradation of proteins that inhibit antioxidant genes. Through AMPK activation, SESN2 can inhibit enzymes that produce pathogenic levels of reactive oxygen species (ROS) [ 62 ]. Low levels of oxidative stress stimulate sestrins, reducing oxidative stress and preventing cell death [ 25 , 63 ]. In this way, sestrins function as genetic components involved in cell viability and function, eliminating the inevitable consequences of oxidative stress. Sestrin-mediated mTOR inhibition also plays a key role in the autophagy-dependent degradation of proteins that suppress antioxidant gene expression. In the ischemic-damaged mouse brain, increased expression of SESN-2 has been demonstrated [ 63 , 64 ]. The antioxidant and, particularly, the autophagy-inducing effects of sestrins have increased their relevance in neurodegenerative diseases. Exposure of CHP-134 neuroblastoma cells to Aβ 1−42 increased SESN2 expression [ 65 , 66 ]. In primary rat cortical neuronal cultures, Aβ was observed to cause an increase in SESN2, activating antioxidant and autophagy pathways. In the widely used transgenic AD animal model, the 12-month-old APPswe/PSEN1dE9 mice, an increase in SESN-2 expression was observed in the cortex. A concurrent increase in the autophagosome marker LC3-II was also observed in the same cell culture and animal model. The increase in SESN-2 caused by Aβ was reversed by SESN2 siRNA, and a decrease in LC3-II accompanied this reversal. Additionally, knockdown of SESN2 and pharmacological inhibition of autophagy with bafilomycin A enhanced neuronal damage induced by Aβ. These findings suggest that SESN2 induction or inhibition is closely linked to AD, and autophagy pathways play a crucial role in this relationship [ 67 ]. In our study, however, treatment of HT-22 cells with oAβ 1−42 for 32 hours led to an increase in SESN2 gene expression (Fig. 4 a), as well as elevated p-mTOR/mTOR (Fig. 3 b) and p62 levels (Fig. 3 f), accompanied by a decrease in the LC3-II/I ratio (Fig. 3 h). On the other hand, TAL treatment restored SESN2 gene expression to control levels (Fig. 4 a) and promoted both the initiation and flux of autophagy. These findings suggest that, although oAβ 1−42 induces a compensatory upregulation of SESN2 , this response alone is insufficient to activate autophagy pathways. Moreover, despite the Aβ-induced increase in SESN2 , there was no statistically significant elevation in the p-AMPK/AMPK ratio (Fig. 3 d), indicating that Aβ suppresses autophagic pathways independently of SESN2 -mediated compensation. In contrast, TAL may exert its effects by activating autophagic pathways, thereby partially offsetting the SESN2 upregulation that arises in response to cellular stress. The normalization of SESN2 levels by TAL, concurrent with enhanced autophagic flux despite no significant global AMPK activation, can be understood through several interconnected, AMPK-independent mechanisms. Firstly, SESN2 itself can directly suppress mTORC1 by interacting with the GATOR complex on lysosomes and can also associate with the ULK1 initiation complex and p62/ SQSTM1 to facilitate autophagic clearance [ 67 ]. Secondly, TAL's primary action of restoring GCase activity leads to improved lysosomal function, such as enhanced substrate degradation [ 68 ], which in turn enhances autophagic flux [ 70 ], helps normalize lysosomal pH [ 71 ], and reduces aberrant mTORC1 signaling originating from dysfunctional lysosomes [ 69 ]. By alleviating the Aβ-induced cellular stress (proteotoxic and oxidative) and restoring efficient lysosomal clearance [ 10 ], TAL effectively reduces the upstream stimuli that trigger SESN2 over-expression[ 72 ]. Consequently, with the upstream stimuli reduced, the cell no longer requires a heightened SESN2 stress response, leading to its normalization [ 68 ]. Furthermore, the restored lysosomal environment allows even basal levels of SESN2 to more efficiently regulate mTORC1 [ 68 ] and support the now more effective autophagic machinery [ 69 ]. In conclusion, this study reveals compelling in vitro evidence that TAL effectively modulates autophagic pathways, a consequence of its ability to promote GCase accumulation and activity within lysosomes, significantly enhances autophagic pathways (Fig. 3 ), boosts lysosomal proteolytic capacity via Cathepsin B maturation (Fig. 2 c), and facilitates the degradation of monomeric Aβ species. Consequently, TAL effectively reduces Aβ burden and restores autophagic homeostasis; furthermore, it confers neuroprotection against oAβ 1−42 toxicity in our neuronal model. These findings robustly underscore the therapeutic potential of strategies aimed at augmenting lysosomal GCase function for AD. While these promising results stem from an in vitro system, they underscore the critical need for further in vivo investigations to confirm these neuroprotective effects and to address crucial translational challenges, notably the blood-brain barrier (BBB) penetration of TAL. Should these limitations, including the development of effective brain-targeted delivery systems, be overcome, targeting lysosomal GCase with ERT-like strategies could represent a powerful and innovative avenue for treating AD and other neurodegenerative conditions characterized by compromised autophagy. Limitations of the Study The present study provides valuable insights into the potential neuroprotective mechanisms of TAL in an in vitro model of Aβ toxicity. However, certain limitations should be acknowledged. Firstly, all experiments were conducted using the immortalized mouse hippocampal cell line HT-22. While a well-established model, findings may not fully recapitulate the complex intercellular interactions and microenvironment of the human brain in AD, underscoring the need for future validation in primary neuronal cultures, co-culture systems, or in vivo animal models. Furthermore, a general consideration for in vitro investigations using exogenous recombinant proteins like TAL is the potential for cellular responses independent of the enzyme's primary catalytic activity. Although such off-target effects cannot be definitively ruled out in our HT-22 cell model, the specific enrichment of GCase protein within the lysosomal fraction following TAL treatment (Fig. 2 c), coupled with observed improvements in lysosomal function (e.g., Cathepsin B maturation) and autophagy pathways, provides substantial evidence that the beneficial outcomes reported are predominantly mediated through its intended GCase replacement mechanism. Finally, a critical hurdle for the clinical translation of these promising in vitro findings is the limited ability of large biologic molecules like TAL to cross the BBB. Future research would need to focus on developing effective brain-targeted delivery systems or enzyme modifications to overcome this challenge. 4. Materials and Methods 4.1. Cell culture and treatment Mouse hippocampal neurons (HT-22; passage number 9) were donated by Atlas Biotechnology (Ankara, Turkey). The cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #E0500-160) supplemented with 10% fetal bovine serum (FBS) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #A0500-3210), 1% L-glutamine (200 mM) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #K0100-670) and 1% penicillin/streptomycin (10,000 U/mL) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #P0100-790) at 37°C in an incubator with a humidified CO2 environment of 5%. TAL, a recombinant analog of GCase, is a licensed and patented product of Pfizer [ 73 ], and donated by the company for this study. Cell viability experiments were performed using TAL (ELELYSO®, Pfizer, USA) 1656 and 8252 ng/mL. TAL was administered when cell confluency reached 50% in 96-well plates. For the treatment of HT-22 cells, TAL 8252 ng/mL final concentration was used. Control cells were exposed to the same quantity of artificial cerebrospinal fluid (aCSF). TAL was administered when cell confluency reached 70%-80% in 6-well plates. The cells were exposed to 5 µM oAβ 1− 42 and concomitant TAL incubation for 32 h. Following incubation, the treatment media was removed and the cells were washed 3 times with phosphate-buffered saline (PBS) with pH 7.4 at 37°C to remove residual oAβ 1− 42 . Cells were then lyzed with radioimmunoprecipitation assay (RIPA) buffer (Tris-HCl 50 mM [pH 7.4], NaCl 150 mM, NP-40 1%, sodium deoxycholate 0.5%, SDS 0.1% [Boston Bioproducts, Worchester WA, USA, cat. #BP-115]) supplemented with protease (Complete Protease Inhibitor Cocktail, Roche, Basel, Switzerland, cat. # 11697498001) and phosphatase inhibitors (dithiothreitol DTT, Amresco Inc., Solon, OH, USA, cat. #97061-340), and the protein concentration was determined via Bradford assay. The extracts were stored at -80°C until western blotting. 4.2. Preparation of oAβ 1−42 Aβ 1−42 human peptide (lyophilized, 1 mg) (Novex by Life Technologies, USA, lot #75555483A) was dissolved in sterile water (molecular biology grade) and diluted in Ca 2+ free PBS at a concentration of 2 mM and incubated at 37°C for 24 h. The preparation was centrifuged at 14,000 g for 10 min at 4°C, and the supernatant containing soluble oligomer Aβ 1−42 was transferred to clean tubes and stored at 4°C. oAβ 1−42 was used within 24 h after preparation [ 74 ]. 4.3. Cell viability assay 96-well plates were seeded with 1.5x10 4 cells per well 1 day before treatment and allowed to adhere overnight to reach 50% confluency. This experiment was carried out using a stock solution of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), which was diluted in dimethyl sulfoxide (50 mg/mL) as a 100-fold stock solution [ 75 ]. At the end of TAL and/or oAβ 1−42 treatment, HT-22 cells were incubated in the culture medium with MTT (0.5 mg/mL) in the dark at 37°C for 4 h to allow the living cells to form insoluble formazan precipitates. Following incubation, 150 µL of isopropyl alcohol was added to each well, and the plates were agitated for 5 min to solubilize the crystals. Absorbance at a wavelength of 570 nm was measured using a plate reader (Biotek Instruments Inc., Winooski, VT, USA). 4.4. RT(Q)-PCR studies A total RNA isolation system (Nzytech, Lisboa, Portugal) was used to extract total RNA from HT-22 cells, and the purity of the recovered RNA was validated spectrophotometrically at 260/280 nm. Utilizing an RT-PCR kit, the RNA was reverse-transcribed and used to create complementary DNA (Strata Gene, La Jolla, CA, USA). According to the manufacturer's recommended thermal cycling methodology, quantitative RT-PCR was performed using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich, St. Louis, MO, USA, cat. # S9194-20RXN). β-actin (ACTB) was used as an internal control for mRNA expression. Results represent the fold change in the expression of target genes (relative to the control) calculated using the 2 −ΔΔCt method [ 76 ]. The following oligonucleotides were used: SESN2 : fw 5': 5-tag cctgcagcctcacct at-3, rev 5': tatctgatgccaaagacgca; ATG5 : fw: 5′-gcagatggacagttgcacacac-3′, rev: 5′- gaggtgtttccaacattggctca-3′; BECN1 : fw: 5′-ctggacactcagctcaacgtca-3′, rev: 5′-ctctagtgccagctcctttagc − 3′; ACTB : fw: 5′-caccattggcaatgagcggttc-3′, rev: 5′- aggtctttgcggatgtccacgt-3′. 4.5. Lysosomal Extract Preparation and Western Blotting For lysosomal extract preparation, cells cultured in 6-well plates were washed with cold phosphate-buffered saline (PBS). The culture medium was collected and cleared by centrifugation (2,000 g, 10 min, 4°C), and the supernatant was stored. The cells were lysed directly in the wells with 120 µL of ice-cold RIPA buffer (Boston BioProducts, Ashland, MA, USA; cat. #BP-115) supplemented with protease and phosphatase inhibitors. The cell lysate was collected and subjected to two cycles of freeze-thaw and sonication (5 short bursts on ice) to ensure lysosomal membrane disruption. After a final incubation on ice for 30 minutes, the lysate was clarified by centrifugation at 20,630 g for 10 minutes at 4°C. The supernatant, enriched with lysosomal contents, was collected for analysis. Protein concentrations for both total cell lysates (RIPA) and lysosomal extracts were determined using a BCA protein assay. Equal quantities of protein were separated on 4%-20% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad, Hercules, CA, USA; cat. #4561094) and transferred to Immun-Blot® PVDF membranes (Bio-Rad; cat. #1620177). Membranes were blocked with 5% non-fat dry milk or bovine serum albumin (BSA) in Tris-buffered saline with 0.1% Tween-20 (TBS-T) for 1 hour at room temperature. Membranes were then incubated overnight at 4°C with the following primary antibodies: anti-β-Amyloid (D54D2) XP® Rabbit mAb (1:1000; Cell Signaling Technology, Danvers, MA, USA; cat. #8243S), anti-mTOR (7C10) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #2983S), anti-Phospho-mTOR (Ser2448) (D9C2) XP® Rabbit mAb (1:1000; Cell Signaling Technology; cat. #5536S), anti-AMPKα (D63G4) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #5832), anti-Phospho-AMPKα (Thr172) (D4D6D) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #50081), anti-LRRK2 [MJFF2 (c41-2)] Rabbit mAb (1:1000; Abcam, Cambridge, UK; cat. #ab133474), anti-LRRK2 (phospho S935) [UDD2 10(12)] Rabbit mAb (1:1000; Abcam; cat. #ab133450), anti-GBA [2E2] (1:1000; Abcam; cat. #ab55080), anti-SQSTM1/p62 [2C11] (1:5000; Abcam; cat. #ab56416), anti-LC3B (1:5000; Abcam; cat. #ab48394), and anti-β-Actin (8H10D10) Mouse mAb (1:1000; Cell Signaling Technology; cat. #3700S). After washing in TBS-T, membranes were incubated with the appropriate HRP-conjugated secondary antibodies: Anti-rabbit IgG, HRP-linked Antibody (1:2000; Cell Signaling Technology; cat. #7074S) or Anti-mouse IgG, HRP-linked Antibody (1:2000; Cell Signaling Technology; cat. #7076S). Protein bands were visualized using WesternBright™ Sirius™ HRP substrate (Advansta, San Jose, CA, USA; cat. #K-12043-D10) and imaged on a Kodak Image Station 4000 MM (Carestream, Rochester, NY, USA). β-actin served as the loading control for normalization. The BLUelf™ Prestained Protein Ladder (GeneDireX, Taoyuan City, Taiwan; cat. #PM008-0500) was used to approximate molecular weights. 4.6. ELISA assays The microplate provided in this kit (BT Lab, Wuhan, China; Mouse glucosidase beta; cat. #E0746Mo) has been pre-coated with an antibody specific to GCase. Standards or samples are then added to the appropriate microplate wells with a biotin-conjugated antibody specific to GCase. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After TMB substrate solution is added, only those wells that contain GCase, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a change in color. The enzyme-substrate reaction is terminated by the addition of sulphuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm ± 10 nm. The concentration of Gcase in the samples is then determined by comparing the O.D. of the samples to the standard curve. 4.7. Statistical analysis All statistical analyses were performed using GraphPad Prism version 10.3.1 (GraphPad Software, La Jolla, CA, USA). Data are presented as mean ± standard error of the mean (SEM) unless otherwise noted. The specific statistical tests used are detailed in the corresponding figure legends. In general, comparisons between multiple groups were made using one-way or two-way analysis of variance (ANOVA) as appropriate for the experimental design. Post-hoc tests were selected to appropriately test the specific hypotheses, and included Tukey’s HSD for all-pairs comparisons, Dunnett’s test for comparisons against a single control, and the Holm-Šídák test for pre-planned comparisons. For all analyses, a p-value < 0.05 was considered statistically significant. Declarations Acknowledgments: This study was supported by the Scientific Research Projects Coordination Unit of Hacettepe University (Project ID: THD-2019-17598), and the Scientific and Technological Research Council of Turkey (TUBITAK-1002; Project ID: 122S157). This study is part of the Ph.D. thesis of Çağrı Özkurt. Western blot experiments were conducted at Hacettepe University, School of Pharmacy, Department of Pharmacology. Services were purchased for RT-PCR studies. The authors thank Pfizer for providing Elelyso® (rhGBA; TAL). Additionally, special thanks are given to the Pfizer Turkiye team: Işıl Bayraktar and Ayşe İlay Duru for their valuable assistance in establishing contact with Pfizer Global. 6.1. Funding This work was supported by the Hacettepe University Research Foundation (Grant number THD-2019-17598) and the Scientific and Technological Research Council of Turkey (TÜBİTAK) (Grant number 122S157). 6.2. Competing Interests The authors have no relevant financial or non-financial interests to disclose. 6.3. Author Contributions All authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by Ç. Özkurt and S. Köse. The first draft of the manuscript was written by P. Kelicen-Uğur. Review and editing were performed by Ç. Özkurt, P. Kelicen-Uğur, Ç. Karasu, and A. Kortholt. All authors read and approved the final manuscript. 6.4. Data Availability The datasets generated and/or analysed during the current study are not publicly available as they form part of an ongoing doctoral thesis but are available from the corresponding author on reasonable request. 6.5. Ethics Approval Not applicable. This study did not involve human participants or animals. 6.6. Consent to Participate Not applicable. 6.7. Consent to Publish Not applicable. References Ma L-Y, Lv Y-L, Huo K et al (2017) Autophagy-lysosome dysfunction is involved in Aβ deposition in STZ-induced diabetic rats. Behav Brain Res 320:484–493. https://doi.org/10.1016/j.bbr.2016.10.031 Lai AY, McLaurin J (2011) Mechanisms of Amyloid-Beta Peptide Uptake by Neurons: The Role of Lipid Rafts and Lipid Raft‐Associated Proteins. Int J Alzheimer’s Dis 2011:548380. https://doi.org/10.4061/2011/548380 Mohamed A, De Posse E (2011) A β Internalization by Neurons and Glia. Int J Alzheimer’s Dis 2011:127984. https://doi.org/10.4061/2011/127984 Nazere K, Takahashi T, Hara N et al (2022) Amyloid Beta Is Internalized via Macropinocytosis, an HSPG- and Lipid Raft-Dependent and Rac1-Mediated Process. Front Mol Neurosci 15:804702. https://doi.org/10.3389/fnmol.2022.804702 Desforges JF, Beutler E (1991) Gaucher’s Disease. N Engl J Med 325:1354–1360. https://doi.org/10.1056/NEJM199111073251906 (1993) Treatment of Gaucher’s Disease. N Engl J Med 328:1564–1568. https://doi.org/10.1056/NEJM199305273282112 Grabowski GA (2012) Gaucher disease and other storage disorders. Hematology 2012:13–18. https://doi.org/10.1182/asheducation.V2012.1.13.3797921 Food US, Administration D (2025) ELELYSO (taliglucerase alfa): U.S. Prescribing Information. U.S. Food and Drug Administration. https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/022458s033lbl.pdf . Accessed 25 June 2025 Blanz J, Zunke F, Markmann S et al (2015) Mannose 6-phosphate‐independent Lysosomal Sorting of LIMP ‐2. Traffic 16:1127–1136. https://doi.org/10.1111/tra.12313 Choi S, Kim D, Kam T-I et al (2015) Lysosomal Enzyme Glucocerebrosidase Protects against Aβ1–42 Oligomer-Induced Neurotoxicity. PLoS ONE 10:e0143854. https://doi.org/10.1371/journal.pone.0143854 Mizushima N, Noda T, Yoshimori T et al (1998) A protein conjugation system essential for autophagy. Nature 395:395–398. https://doi.org/10.1038/26506 Correia SC, Resende R, Moreira PI, Pereira CM (2015) Alzheimer’s Disease-Related Misfolded Proteins and Dysfunctional Organelles on Autophagy Menu. DNA Cell Biol 34:261–273. https://doi.org/10.1089/dna.2014.2757 Hardy J, Selkoe DJ (2002) The Amyloid Hypothesis of Alzheimer’s Disease: Progress and Problems on the Road to Therapeutics. Science 297:353–356. https://doi.org/10.1126/science.1072994 Eshraghi M, Ahmadi M, Afshar S et al (2022) Enhancing autophagy in Alzheimer’s disease through drug repositioning. Pharmacol Ther 237:108171. https://doi.org/10.1016/j.pharmthera.2022.108171 Li Q, Liu Y, Sun M (2017) Autophagy and Alzheimer’s Disease. Cell Mol Neurobiol 37:377–388. https://doi.org/10.1007/s10571-016-0386-8 Uddin MS, Stachowiak A, Mamun AA et al (2018) Autophagy and Alzheimer’s Disease: From Molecular Mechanisms to Therapeutic Implications. Front Aging Neurosci 10:04. https://doi.org/10.3389/fnagi.2018.00004 Golde TE (2006) Disease modifying therapy for AD? 1 . J Neurochem 99:689–707. https://doi.org/10.1111/j.1471-4159.2006.04211.x Caccamo A, Majumder S, Richardson A et al (2010) Molecular Interplay between Mammalian Target of Rapamycin (mTOR), Amyloid-β, and Tau. J Biol Chem 285:13107–13120. https://doi.org/10.1074/jbc.M110.100420 Lim Y, Cho H, Kim E-K (2016) Brain metabolism as a modulator of autophagy in neurodegeneration. Brain Res 1649:158–165. https://doi.org/10.1016/j.brainres.2016.02.049 Orr ME, Oddo S (2013) Autophagic/lysosomal dysfunction in Alzheimer’s disease. Alzheimers Res Ther 5:53. https://doi.org/10.1186/alzrt217 Nixon RA (2013) The role of autophagy in neurodegenerative disease. Nat Med 19:983–997. https://doi.org/10.1038/nm.3232 Bjørkøy G, Lamark T, Pankiv S et al (2009) Chap. 12 Monitoring Autophagic Degradation of p62/SQSTM1. Methods in Enzymology. Elsevier, pp 181–197 Peeters H, Debeer P, Bairoch A et al (2003) PA26 is a candidate gene for heterotaxia in humans: identification of a novel PA26-related gene family in human and mouse. Hum Genet 112:573–580. https://doi.org/10.1007/s00439-003-0917-5 Lee JH, Budanov AV, Karin M (2013) Sestrins Orchestrate Cellular Metabolism to Attenuate Aging. Cell Metab 18:792–801. https://doi.org/10.1016/j.cmet.2013.08.018 Budanov AV, Sablina AA, Feinstein E et al (2004) Regeneration of Peroxiredoxins by p53-Regulated Sestrins, Homologs of Bacterial AhpD. Science 304:596–600. https://doi.org/10.1126/science.1095569 Velasco-Miguel S, Buckbinder L, Jean P et al (1999) PA26, a novel target of the p53 tumor suppressor and member of the GADD family of DNA damage and growth arrest inducible genes. Oncogene 18:127–137. https://doi.org/10.1038/sj.onc.1202274 Chen C-C, Jeon S-M, Bhaskar PT et al (2010) FoxOs Inhibit mTORC1 and Activate Akt by Inducing the Expression of Sestrin3 and Rictor. Dev Cell 18:592–604. https://doi.org/10.1016/j.devcel.2010.03.008 Budanov AV, Karin M (2008) p53 Target Genes Sestrin1 and Sestrin2 Connect Genotoxic Stress and mTOR Signaling. Cell 134:451–460. https://doi.org/10.1016/j.cell.2008.06.028 Abbas R, Park G, Damle B et al (2015) Pharmacokinetics of Novel Plant Cell-Expressed Taliglucerase Alfa in Adult and Pediatric Patients with Gaucher Disease. PLoS ONE 10:e0128986. https://doi.org/10.1371/journal.pone.0128986 Guo J-P, Arai T, Miklossy J, McGeer PL (2006) Aβ and tau form soluble complexes that may promote self aggregation of both into the insoluble forms observed in Alzheimer’s disease. Proc Natl Acad Sci 103:1953–1958. https://doi.org/10.1073/pnas.0509386103 Hardy JA, Higgins GA (1992) Alzheimer’s Disease: The Amyloid Cascade Hypothesis. Science 256:184–185. https://doi.org/10.1126/science.1566067 Cho E, Youn K, Kwon H et al (2022) Eugenitol ameliorates memory impairments in 5XFAD mice by reducing Aβ plaques and neuroinflammation. Biomed Pharmacother 148:112763. https://doi.org/10.1016/j.biopha.2022.112763 Bolmont T, Clavaguera F, Meyer-Luehmann M et al (2007) Induction of Tau Pathology by Intracerebral Infusion of Amyloid-β-Containing Brain Extract and by Amyloid-β Deposition in APP × Tau Transgenic Mice. Am J Pathol 171:2012–2020. https://doi.org/10.2353/ajpath.2007.070403 Takahashi RH, Almeida CG, Kearney PF et al (2004) Oligomerization of Alzheimer’s β-Amyloid within Processes and Synapses of Cultured Neurons and Brain. J Neurosci 24:3592–3599. https://doi.org/10.1523/JNEUROSCI.5167-03.2004 Kravenska Y, Nieznanska H, Nieznanski K et al (2020) The monomers, oligomers, and fibrils of amyloid-β inhibit the activity of mitoBKCa channels by a membrane-mediated mechanism. Biochim Biophys Acta BBA - Biomembr 1862:183337. https://doi.org/10.1016/j.bbamem.2020.183337 McNeill A, Magalhaes J, Shen C et al (2014) Ambroxol improves lysosomal biochemistry in glucocerebrosidase mutation-linked Parkinson disease cells. Brain 137:1481–1495. https://doi.org/10.1093/brain/awu020 Xiao Q, Yan P, Ma X et al (2015) Neuronal-Targeted TFEB Accelerates Lysosomal Degradation of APP, Reducing Aβ Generation and Amyloid Plaque Pathogenesis. J Neurosci 35:12137–12151. https://doi.org/10.1523/JNEUROSCI.0705-15.2015 Grimm MOW, Mett J, Grimm HS, Hartmann T (2017) APP Function and Lipids: A Bidirectional Link. Front Mol Neurosci 10. https://doi.org/10.3389/fnmol.2017.00063 Yamaguchi T, Yamauchi Y, Furukawa K et al (2016) Expression of B4GALNT1, an essential glycosyltransferase for the synthesis of complex gangliosides, suppresses BACE1 degradation and modulates APP processing. Sci Rep 6:34505. https://doi.org/10.1038/srep34505 Miners JS, Barua N, Kehoe PG et al (2011) Aβ-Degrading Enzymes: Potential for Treatment of Alzheimer Disease. J Neuropathol Exp Neurol 70:944–959. https://doi.org/10.1097/NEN.0b013e3182345e46 Hu X, Crick SL, Bu G et al (2009) Amyloid seeds formed by cellular uptake, concentration, and aggregation of the amyloid-beta peptide. Proc Natl Acad Sci 106:20324–20329. https://doi.org/10.1073/pnas.0911281106 Schützmann MP, Hasecke F, Bachmann S et al (2021) Endo-lysosomal Aβ concentration and pH trigger formation of Aβ oligomers that potently induce Tau missorting. Nat Commun 12:4634. https://doi.org/10.1038/s41467-021-24900-4 Żukowska J, Moss SJ, Subramanian V, Acharya KR (2024) Molecular basis of selective amyloid-β degrading enzymes in Alzheimer’s disease. FEBS J 291:2999–3029. https://doi.org/10.1111/febs.16939 Ma J-F, Huang Y, Chen S, ‐D., Halliday G (2010) Immunohistochemical evidence for macroautophagy in neurones and endothelial cells in Alzheimer’s disease. Neuropathol Appl Neurobiol 36:312–319. https://doi.org/10.1111/j.1365-2990.2010.01067.x Rohn TT, Wirawan E, Brown RJ et al (2011) Depletion of Beclin-1 due to proteolytic cleavage by caspases in the Alzheimer’s disease brain. Neurobiol Dis 43:68–78. https://doi.org/10.1016/j.nbd.2010.11.003 Guglielmotto M, Monteleone D, Piras A et al (2014) Aβ1–42 monomers or oligomers have different effects on autophagy and apoptosis. Autophagy 10:1827–1843. https://doi.org/10.4161/auto.30001 Yu WH, Cuervo AM, Kumar A et al (2005) Macroautophagy—a novel β-amyloid peptide-generating pathway activated in Alzheimer’s disease. J Cell Biol 171:87–98. https://doi.org/10.1083/jcb.200505082 Spilman P, Podlutskaya N, Hart MJ et al (2010) Inhibition of mTOR by Rapamycin Abolishes Cognitive Deficits and Reduces Amyloid-β Levels in a Mouse Model of Alzheimer’s Disease. PLoS ONE 5:e9979. https://doi.org/10.1371/journal.pone.0009979 Cheung ZH, Ip NY (2011) Autophagy deregulation in neurodegenerative diseases – recent advances and future perspectives. J Neurochem 118:317–325. https://doi.org/10.1111/j.1471-4159.2011.07314.x Masters CL, Selkoe DJ (2012) Biochemistry of Amyloid -Protein and Amyloid Deposits in Alzheimer Disease. Cold Spring Harb Perspect Med 2:a006262–a006262. https://doi.org/10.1101/cshperspect.a006262 Kakio A, Yano Y, Takai D et al (2004) Interaction between amyloid β-protein aggregates and membranes. J Pept Sci 10:612–621. https://doi.org/10.1002/psc.570 Murphy RM (2007) Kinetics of amyloid formation and membrane interaction with amyloidogenic proteins. Biochim Biophys Acta BBA - Biomembr 1768:1923–1934. https://doi.org/10.1016/j.bbamem.2006.12.014 Sasahara K, Morigaki K, Shinya K (2013) Effects of membrane interaction and aggregation of amyloid β-peptide on lipid mobility and membrane domain structure. Phys Chem Chem Phys 15:8929. https://doi.org/10.1039/c3cp44517h Ji Z-S, Miranda RD, Newhouse YM et al (2002) Apolipoprotein E4 Potentiates Amyloid β Peptide-induced Lysosomal Leakage and Apoptosis in Neuronal Cells. J Biol Chem 277:21821–21828. https://doi.org/10.1074/jbc.M112109200 Yang AJ, Chandswangbhuvana D, Margol L, Glabe CG (1998) Loss of endosomal/lysosomal membrane impermeability is an early event in amyloid A?1–42 pathogenesis. J Neurosci Res 52:691–698. https://doi.org/10.1002/(SICI)1097-4547(19980615)52:63.0.CO;2-3 Yoon S-Y, Kim D-H (2016) Alzheimer’s disease genes and autophagy. Brain Res 1649:201–209. https://doi.org/10.1016/j.brainres.2016.03.018 Park H, Kang J-H, Lee S (2020) Autophagy in Neurodegenerative Diseases: A Hunter for Aggregates. Int J Mol Sci 21:3369. https://doi.org/10.3390/ijms21093369 Kabeya Y (2000) LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19:5720–5728. https://doi.org/10.1093/emboj/19.21.5720 Salminen A, Kaarniranta K, Haapasalo A et al (2012) Emerging role of p62/sequestosome-1 in the pathogenesis of Alzheimer’s disease. Prog Neurobiol 96:87–95. https://doi.org/10.1016/j.pneurobio.2011.11.005 Ramesh Babu J, Lamar Seibenhener M, Peng J et al (2008) Genetic inactivation of p62 leads to accumulation of hyperphosphorylated tau and neurodegeneration. J Neurochem 106:107–120. https://doi.org/10.1111/j.1471-4159.2008.05340.x Maiuri MC, Tasdemir E, Criollo A et al (2009) Control of autophagy by oncogenes and tumor suppressor genes. Cell Death Differ 16:87–93. https://doi.org/10.1038/cdd.2008.131 Bae SH, Sung SH, Oh SY et al (2013) Sestrins Activate Nrf2 by Promoting p62-Dependent Autophagic Degradation of Keap1 and Prevent Oxidative Liver Damage. Cell Metab 17:73–84. https://doi.org/10.1016/j.cmet.2012.12.002 Budanov AV, Shoshani T, Faerman A et al (2002) Identification of a novel stress-responsive gene Hi95 involved in regulation of cell viability. Oncogene 21:6017–6031. https://doi.org/10.1038/sj.onc.1205877 Budanov AV, Lee JH, Karin M (2010) Stressin’ Sestrins take an aging fight. EMBO Mol Med 2:388–400. https://doi.org/10.1002/emmm.201000097 Hara T, Nakamura K, Matsui M et al (2006) Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441:885–889. https://doi.org/10.1038/nature04724 Kim J-R, Lee S-R, Chung HJ et al (2003) Identification of amyloid β-peptide responsive genes by cDNA microarray technology: Involvement of RTP801 in amyloid β-peptide toxicity. Exp Mol Med 35:403–411. https://doi.org/10.1038/emm.2003.53 Chen Y-S, Chen S-D, Wu C-L et al (2014) Induction of sestrin2 as an endogenous protective mechanism against amyloid beta-peptide neurotoxicity in primary cortical culture. Exp Neurol 253:63–71. https://doi.org/10.1016/j.expneurol.2013.12.009 Lu C, Jiang Y, Xu W, Bao X (2023) Sestrin2: multifaceted functions, molecular basis, and its implications in liver diseases. Cell Death Dis 14:160. https://doi.org/10.1038/s41419-023-05669-4 Peng Y, Liou B, Lin Y et al (2021) Substrate Reduction Therapy Reverses Mitochondrial, mTOR, and Autophagy Alterations in a Cell Model of Gaucher Disease. Cells 10:2286. https://doi.org/10.3390/cells10092286 Magalhaes J, Gegg ME, Migdalska-Richards A et al (2016) Autophagic lysosome reformation dysfunction in glucocerebrosidase deficient cells: relevance to Parkinson disease. Hum Mol Genet 25:3432–3445. https://doi.org/10.1093/hmg/ddw185 Sillence DJ (2013) Glucosylceramide modulates endolysosomal pH in Gaucher disease. Mol Genet Metab 109:194–200. https://doi.org/10.1016/j.ymgme.2013.03.015 Chen S-D, Yang J-L, Hsieh Y-H et al (2021) Potential Roles of Sestrin2 in Alzheimer’s Disease: Antioxidation, Autophagy Promotion, and Beyond. Biomedicines 9:1308. https://doi.org/10.3390/biomedicines9101308 Shaaltiel Y, Baum G, Bartfeld D et al (2011) Human lysosomal proteins from plant cell culture Kasza Á, Penke B, Frank Z et al (2017) Studies for Improving a Rat Model of Alzheimer’s Disease: Icv Administration of Well-Characterized β-Amyloid 1–42 Oligomers Induce Dysfunction in Spatial Memory. Molecules 22:2007. https://doi.org/10.3390/molecules22112007 Yang Y, Ju T, Yang D (2005) Induction of hypoxia inducible factor-1 attenuates metabolic insults induced by 3‐nitropropionic acid in rat C6 glioma cells. J Neurochem 93:513–525. https://doi.org/10.1111/j.1471-4159.2005.03032.x Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 – ∆∆CT Method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262 Additional Declarations No competing interests reported. Supplementary Files OnlineResource.docx UncroppedBlotsSupplementary.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7094261","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":494103856,"identity":"0b82515f-5d00-4491-9226-7a3cdad5f3e4","order_by":0,"name":"Çağrı Özkurt","email":"","orcid":"","institution":"Hacettepe University","correspondingAuthor":false,"prefix":"","firstName":"Çağrı","middleName":"","lastName":"Özkurt","suffix":""},{"id":494103857,"identity":"68455cdd-11be-452c-83c6-341038694734","order_by":1,"name":"Selma Köse","email":"","orcid":"","institution":"Lokman Hekim University","correspondingAuthor":false,"prefix":"","firstName":"Selma","middleName":"","lastName":"Köse","suffix":""},{"id":494103858,"identity":"0f4bf214-1fa6-46b4-b76f-f09d2352e0c6","order_by":2,"name":"Çimen Karasu","email":"","orcid":"","institution":"Gazi University","correspondingAuthor":false,"prefix":"","firstName":"Çimen","middleName":"","lastName":"Karasu","suffix":""},{"id":494103859,"identity":"5b052952-c096-4ac0-8abd-ca1f188940e5","order_by":3,"name":"Arjan Kortholt","email":"","orcid":"","institution":"Suleyman Demirel University, YETEM-Innovative Technologies Application and Research Centre","correspondingAuthor":false,"prefix":"","firstName":"Arjan","middleName":"","lastName":"Kortholt","suffix":""},{"id":494103860,"identity":"82718fec-b5dd-4cdf-991e-ee93bcc5bbab","order_by":4,"name":"Pelin Kelicen-Uğur","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYDACHgbGAwlAml8CVRSvFgawFskZIF6CAVxUAq8WEG1wg1gt5jyHDxx4UGOTZ3y7+eGHjz/+yJmzNzA+eNvGUGfegF2LZW9bwoGEY2nFZneOGUvOSDAwtuw5wGw4t41BQuYAdi0G53kMDiQ2HE7cdiPBjJknwSBxw40ENmleoBZcLjM4z/8BqOV/4uYZ6d+Y/yQY1G+4/4D9N14tZ3sYgFoOJG6QyDFjBno/ARgObMz4tFj2HDMA+iU5ccaNnGLJnjRjw509ic2Sc85JQEIda4glP3z4o8YusX9G+sYPP2zk5M3ZDx/88KbMhh+nw7CIMDYw4ItJbFpGwSgYBaNgFKACAPw6XUT6WGKhAAAAAElFTkSuQmCC","orcid":"","institution":"Hacettepe University","correspondingAuthor":true,"prefix":"","firstName":"Pelin","middleName":"","lastName":"Kelicen-Uğur","suffix":""}],"badges":[],"createdAt":"2025-07-10 14:53:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7094261/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7094261/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88239960,"identity":"a43892df-a75d-4810-a9e0-3420f842ea31","added_by":"auto","created_at":"2025-08-04 11:07:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":353752,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTAL protects HT-22 neurons from oAβ\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e1-42\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e-induced cytotoxicity.\u003c/strong\u003e Cell viability was assessed by MTT assay. Data are presented as mean ± SEM (n=3-5). (a) TAL was not cytotoxic at concentrations up to 8252 ng/mL after a 32-hour exposure. Statistical analysis was performed using a one-way ANOVA with Dunnett's multiple comparisons test against the control group. (b) The time- and concentration-dependent neuroprotective effect of TAL against oAβ\u003csub\u003e1-42\u003c/sub\u003e. Statistical analysis was performed using one-way ANOVAs at each time point, followed by Tukey's multiple comparisons test. Significance is denoted as p \u0026lt; 0.05. * indicates a significant reduction in viability in the oAβ\u003csub\u003e1-42\u003c/sub\u003e group compared to the time-matched Control group. # indicates a significant rescue of viability in the oAβ\u003csub\u003e1-42\u003c/sub\u003e + TAL group compared to the oAβ\u003csub\u003e1-42\u003c/sub\u003e alone group\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/2d2bcd1d4f58a0cf865a0f3d.png"},{"id":88241045,"identity":"b3dddbfa-84fd-434b-a631-ca9790fe214c","added_by":"auto","created_at":"2025-08-04 11:15:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":414622,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTAL selectively reduces intracellular monomeric Aβ and modulates lysosomal protein expression.\u003c/strong\u003e HT-22 cells were treated for 32 hours as indicated. (a) Representative Western blot showing intracellular levels of monomeric (4.5 kDa) and low-molecular-weight (LMW) oligomeric Aβ species. (b) Densitometric analysis of intracellular Aβ levels, normalized to β-actin and expressed as fold change relative to control. Data are presented as mean ± SEM (n=3). Statistical analysis was performed using a two-way ANOVA with Holm-Šídák's multiple comparisons test. Significance is denoted as p \u0026lt; 0.05. * indicates a significant increase in monomeric Aβ in the oAβ\u003csub\u003e1-42\u003c/sub\u003e group compared to the control group. # indicates a significant reduction in monomeric Aβ in the oAβ\u003csub\u003e1-42\u003c/sub\u003e + TAL group compared to the oAβ\u003csub\u003e1-42\u003c/sub\u003e alone group. (c) Representative Western blots from lysosomal extracts showing the accumulation of GCase and the maturation of Cathepsin B in response to TAL treatment\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/9eef934c4d0a8e386928d8e8.png"},{"id":88239964,"identity":"206cc05e-465e-4759-8b15-f4aaf8d39220","added_by":"auto","created_at":"2025-08-04 11:07:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":457543,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTAL modulates key proteins in the autophagy pathway dysregulated by oAβ\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e1-42\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e. \u003c/strong\u003eHT-22 cells were treated for 32 hours. Panels show representative Western blots (a, c, e, g) and corresponding densitometric analyses (b, d, f, h). Data are presented as mean ± SEM (n=3-6) and expressed as fold change relative to control. Statistical analysis was performed using one-way ANOVA with Tukey's multiple comparisons test (p \u0026lt; 0.05). (a, b) oAβ\u003csub\u003e1-42\u003c/sub\u003e significantly increased the p-mTOR/mTOR ratio (*), an effect reversed by TAL co-treatment (#). (c, d) No significant changes were observed in the p-AMPK/AMPK ratio among treatment groups. (e, f) p62 levels were significantly increased by oAβ\u003csub\u003e1-42\u003c/sub\u003e (*), and this accumulation was reversed by TAL co-treatment (#). (g, h) The LC3-II/I ratio was significantly decreased by oAβ\u003csub\u003e1-42\u003c/sub\u003e (*), but TAL co-treatment did not result in a statistically significant rescue. In these panels, * denotes a significant difference in the oAβ\u003csub\u003e1-42\u003c/sub\u003e group compared to the control group. # denotes a significant difference in the oAβ\u003csub\u003e1-42\u003c/sub\u003e + TAL group compared to the oAβ\u003csub\u003e1-42\u003c/sub\u003e alone group\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/f72e3022eba7d532424f3292.png"},{"id":88239962,"identity":"6837c766-be1e-48d6-8cac-a17cc4b64d67","added_by":"auto","created_at":"2025-08-04 11:07:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":298198,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of TAL on the gene expression of autophagy-related markers.\u003c/strong\u003e HT-22 cells were treated for 32 hours as indicated, and relative mRNA levels were assessed by RT-qPCR. Data are expressed as fold change relative to the control group, normalized to the housekeeping gene ACTB. Each panel shows the mean and individual data points from two independent experiments (n=2). Due to the low replicate number, no inferential statistical analysis was performed. (a) Treatment with oAβ\u003csub\u003e1-42\u003c/sub\u003e appeared to induce the expression of the stress-response gene \u003cem\u003eSESN2\u003c/em\u003e, an effect that seemed to be normalized by co-treatment with TAL. (b) Expression of the autophagy initiation gene \u003cem\u003eATG5\u003c/em\u003e trended downwards with oAβ\u003csub\u003e1-42\u003c/sub\u003e treatment, while TAL co-treatment appeared to restore its expression to control levels. (c) A similar trend was observed for \u003cem\u003eBECN1\u003c/em\u003e gene expression, which appeared to be reduced by oAβ\u003csub\u003e1-42\u003c/sub\u003e and restored by TAL co-treatment\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/7dbaf284ac51d845f4141538.png"},{"id":88241047,"identity":"e83ed69b-a827-4aaa-a4d0-b98f5ff618ad","added_by":"auto","created_at":"2025-08-04 11:15:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":486165,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTAL treatment does not alter pLRRK2/LRRK2 ratio or total endogenous GCase levels.\u003c/strong\u003eHT-22 cells were treated for 32 hours as indicated. (A) Representative Western blot for phosphorylated LRRK2 (pLRRK2) and total LRRK2. (B) Densitometric analysis of the pLRRK2/LRRK2 ratio, normalized and expressed as fold change relative to the control group. Data are presented as mean ± SEM (n=5-8). A one-way ANOVA showed no significant differences among treatment groups (p=0.1986). (C) Relative amount of endogenous GCase protein as measured by ELISA, expressed as fold change relative to the control group. Data show the mean and individual data points from two inde-pendent experiments (n=2). No statistical analysis was performed on this preliminary data.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/840c395f8e8c2cece48da029.png"},{"id":89093928,"identity":"80165085-3295-45a1-ae99-20e8642b43cf","added_by":"auto","created_at":"2025-08-14 15:09:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3078948,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/4195a93e-cede-4962-b128-bba8230eb83d.pdf"},{"id":88239966,"identity":"7cfdc41b-2e8b-436e-a57c-6ce04273f7af","added_by":"auto","created_at":"2025-08-04 11:07:56","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1306473,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResource.docx","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/e954208c9d4536453ab95f2d.docx"},{"id":88239984,"identity":"8fa59b9a-9620-4b01-949f-cdc18f36b910","added_by":"auto","created_at":"2025-08-04 11:07:57","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22610718,"visible":true,"origin":"","legend":"","description":"","filename":"UncroppedBlotsSupplementary.zip","url":"https://assets-eu.researchsquare.com/files/rs-7094261/v1/d27ed6268f3b9e21ec0d6863.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eTaliglucerase Alfa Modulates Aβ Load and Autophagy-Related Pathways in Mouse Hippocampal Neurons Exposed to oAβ\u003csub\u003e1-42\u003c/sub\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) is the most prevalent neurodegenerative disorder, defined by the presence of extracellular senile plaques formed by amyloid-beta (Aβ) and intracellular neurofibrillary tangles (NFTs) composed of hyperphosphorylated tau protein. While the extracellular aggregation of Aβ is central to the onset and progression of AD [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]; recent studies suggest that the intraneuronal accumulation of Aβ, driven by oligomer internalization, is neurotoxic and may play a critical role in advancing the disease [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGlucocerebrosidase (GCase) is a lysosomal enzyme responsible for catalyzing the hydrolysis of glucosylceramide into glucose and ceramide. Deficiencies in GCase, encoded by the \u003cem\u003eGBA1\u003c/em\u003e gene, have been linked to various neurodegenerative diseases. Homozygous mutations in \u003cem\u003eGBA1\u003c/em\u003e are specifically associated with Gaucher\u0026rsquo;s disease (GD), a lysosomal storage disorder [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. GD patients typically express less than 15% of functional GCase, which causes accumulation of glucosylceramide and glucosylsphingosine in the cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Taliglucerase alfa (TAL), a recombinant human glucocerebrosidase analogue (rhGCase or rhGBA), is produced in genetically modified carrot cells by recombinant DNA technology [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The lysosomal glucosidase GCase is required for hydrolysis of glucosylceramide and is targeted to lysosomes in a mannose-6 phosphate\u0026ndash;independent manner by the lysosomal integral membrane protein type-2 (LIMP-2) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. TAL, marketed in the U.S. as ELELYSO\u0026reg; (Pfizer) for injection is indicated for the treatment of patients 4 years and older with confirmed diagnosis of Type 1 GD. It is a monomeric glycoprotein enzyme containing four N-linked glycosylation sites (MW: 60.8 kDA). It differs from native human GCase by two amino acids at the N terminal and up to 7 amino acids at the C terminal. TAL is a glycosylated protein with oligosaccharide chains at the glycosylation sites having terminal mannose sugars. These mannose-terminated oligosaccharide chains of TAL are specifically recognized by endocytic carbohydrate receptors on the cells that accumulate lipid in GD [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The involvement of GCase in the pathogenesis of AD remains largely underexplored. Recently, it was demonstrated that GCase expression and enzyme activity in the brain of AD patients is lowered and that this deficiency could play a role in the development of AD by inducing lysosomal dysfunction. In addition, it was demonstrated that GCase lentivirus (human complementary DNA of \u003cem\u003eGBA1\u003c/em\u003e) facilitates the clearance of Aβ\u003csub\u003e1\u0026minus;\u0026thinsp;42\u003c/sub\u003e oligomers and protects against Aβ\u003csub\u003e1\u0026minus;\u0026thinsp;42\u003c/sub\u003e oligomer-induced neuronal cell death by enhancing lysosomal function [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eLysosomes collaborate with autophagosomes to degrade and recycle misfolded cytoplasmic proteins, such as Aβ, and organelles within the cytoplasm [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Increased deposition of Aβ is considered a key factor in the pathogenesis of AD [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], and impaired autophagy has been observed in both animal models of AD and AD patients [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Thus, strategies targeting autophagy-related proteins to regulate Aβ production, clearance, and aggregation hold significant potential for the treatment of AD [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Autophagy begins with the formation of preautophagosome membrane originating from the endoplasmic reticulum membrane. The elongation of the preautophagosome is driven by the activation of early-stage autophagy-related proteins (Atgs), including Atg5, Atg12, Atg14, Atg16L, and beclin-1. Soluble form of microtubule-associated protein 1 light chain 3-I (LC3-I) is a cytosolic Atg that undergoes post-translational modification into the membrane-bound form LC3-II during autophagosome formation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], the preautophagosome closes and matures into an autophagosome. The activation of p62 by the Atg16L-beclin-1 complex facilitates autophagic flux, leading to lysosomal transport. The mature autophagosome membrane fuses with the lysosomal membrane, activating late lysosomal proteins and presenting its contents to lysosomal enzymes (cathepsins B, D, and L) for degradation in the acidic lysosomal environment [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The formation of autophagosomes is also regulated by the mammalian target of rapamycin (mTOR). AMP-activated protein kinases (AMPK; heterotrimeric serine/threonine protein kinases) are key regulators of body metabolism. It is well-established that AMPK activation induces autophagy by suppressing mTOR, the primary inhibitor of autophago-some formation. Studies have shown that AMPK activators enhance autophagy by inhibiting mTOR signaling and trigger Aβ degradation via the lysosomal system. Conversely, Aβ has been found to increase mTOR activity, while reductions in Aβ levels decrease mTOR activity, providing evidence of the reciprocal relationship between mTOR and Aβ [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, the levels of p62/sequestosome-1 (p62/\u003cem\u003eSQSTM1\u003c/em\u003e), an autophagic cargo protein and a widely recognized marker of autophagic flux, accumulate during autophagy inhibition and diminish when autophagy is activated [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAdditionally, sestrins are highly conserved proteins encoded by stress-responsive genes, such as those activated by DNA damage, oxidative stress, and hypoxia. Among the three sestrin isoforms expressed in mammalian cells (SESN-1, SESN-2, SESN-3) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], SESN-2 has been the most extensively studied, with its cytoprotective effects attributed to its antioxidant activity and its role in inducing autophagy [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. SESN-2, which is induced by stress conditions [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], promotes autophagy induction by activating AMPK and subsequently suppressing mTOR activity [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo directly investigate the impact of augmenting functional GCase within neuronal lysosomes, we selected TAL for this study over other GCase-enhancing strategies such as small-molecule chaperones (e.g., ambroxol) or substrate-reduction agents (e.g., venglustat). As an enzyme replacement therapy, TAL delivers fully active, well-characterized recombinant GCase, enabling a direct assessment of enzyme supplementation. Furthermore, TAL\u0026rsquo;s mannose-terminated glycans are designed to promote efficient cellular uptake and lysosomal delivery via mannose receptors, ensuring the enzyme reaches its intended site of action. The availability of GMP-grade TAL also provided high purity and batch-to-batch consistency, crucial for the reproducibility of our mechanistic \u003cem\u003ein vitro\u003c/em\u003e investigations.\u003c/p\u003e\u003cp\u003eThe present study hypothesized that TAL might restore GCase and autophagy function in neuronal cells exposed to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, in turn, mitigate Aβ accumulation. To evaluate this hypothesis, we examined the impact of TAL on Aβ accumulation in mouse hippocampal neurons (HT-22 neuronal cells) exposed to oligomeric Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e (oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e), as well as key markers of the autophagy-lysosome pathway implicated in AD.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Exposure of oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e increased cytotoxicity, and TAL protected HT-22 cells from oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e toxicity\u003c/h2\u003e\u003cp\u003eInitially, the effective concentrations of TAL were determined based on concentration ranges reported in the literature. In humans, TAL is administered intravenously every two weeks, primarily targeting peripheral effects in Gaucher disease, with a pediatric dose of 30 U/kg and an adult dose of 60 U/kg. After 38 weeks of treatment, the maximum plasma concentrations were reported as 1656\u0026thinsp;\u0026plusmn;\u0026thinsp;1116 ng/mL in pediatric patients and 5153\u0026thinsp;\u0026plusmn;\u0026thinsp;3099 ng/mL in adult patients [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In our study, cytotoxicity assays were performed using the lowest median, and highest concentrations within the selected range. TAL was not cytotoxic to HT-22 cells when used at these concentrations for 32 h (F\u003csub\u003e(4,18)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.3218, p\u0026thinsp;=\u0026thinsp;0.8596; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea), therefore we used the highest concentration of 8252 ng/mL for further investigations (p\u0026thinsp;=\u0026thinsp;0.9165).\u003c/p\u003e\u003cp\u003eTo evaluate the cytotoxic effect of oligomeric Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e (oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e), two concentrations and three incubation time points were selected. While 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e did not induce cytotoxicity after 24 hours of incubation (p\u0026thinsp;=\u0026thinsp;0.7765), it did result in cytotoxic effects following 32- and 48-hour incubations (p\u0026thinsp;=\u0026thinsp;0.0009 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively). TAL successfully reversed the cytotoxicity induced by 5 \u0026micro;M oAβ at the 32-hour time point (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 compared to the oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-treated group; p\u0026thinsp;=\u0026thinsp;0.8250 compared to the control group; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In contrast, 10 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e exhibited cytotoxicity at all time points (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), and TAL failed to reverse the cytotoxic effects at any of these time intervals (p\u0026thinsp;=\u0026thinsp;0.8494 at 24 h, p\u0026thinsp;=\u0026thinsp;0.9997 at 32 h, and p\u0026thinsp;=\u0026thinsp;0.0589 at 48 h; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eNotably, treatment with 8252 ng/mL TAL alone for 24 hours resulted in a moderate increase in cell viability compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). However, prolonged exposure for 32 and 48 hours at the same concentration did not yield a statistically significant difference in viability relative to untreated controls (p\u0026thinsp;=\u0026thinsp;0.5047 and p\u0026thinsp;=\u0026thinsp;0.0194, respectively; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Based on these observations, subsequent experiments were conducted using 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, 8252 ng/mL TAL, and a 32-hour incubation period as the standardized experimental conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Treatment with TAL Decreased Intraneuronal Aβ Accumulation and Increased Lysosomal GCase and Cathepsin B Levels\u003c/h2\u003e\u003cp\u003eWestern blot analyses were conducted on HT-22 cell lysates following incubation with TAL and/or oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e. After 32 hours of exposure to 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, a significant elevation was observed in monomeric Aβ (4.5 kDa) (p\u0026thinsp;=\u0026thinsp;0.0038), while the increase in low molecular weight (LMW) Aβ forms\u0026mdash;tetramers, trimers, and dimers\u0026mdash;did not reach statistical significance (p\u0026thinsp;=\u0026thinsp;0.0685; Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). Co-treatment with TAL (8252 ng/mL) markedly attenuated the increase in monomeric Aβ levels (p\u0026thinsp;=\u0026thinsp;0.0083), while levels of LMW Aβ forms remained unaffected (p\u0026thinsp;=\u0026thinsp;0.1502; Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b).\u003c/p\u003e\u003cp\u003eAdditionally, in lysosomal extracts, oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment alone did not alter GCase protein expression relative to the control; however, co-treatment with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and TAL, as well as TAL treatment alone, increased GCase protein expression in HT-22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Notably, the lysosomal extracts demonstrated the precursor (pro) form of cathepsin B in control and oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-treated cells, in contrast to the detection of its active form following treatment with TAL, either independently or together with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. TAL Modulates Key Proteins in the Autophagy Signaling Pathway\u003c/h2\u003e\u003cp\u003eTo evaluate potential alterations in the autophagy pathway, we performed Western blot analyses on key regulatory proteins in extracts from HT-22 cells exposed to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and/or TAL (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFirst, we examined the phosphorylation of mTOR, a primary inhibitor of autophagy initiation. In HT-22 cells, oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e exposure led to a significant increase in the p-mTOR/mTOR ratio compared to control cells (p\u0026thinsp;=\u0026thinsp;0.0005). This effect was completely reversed by co-treatment with TAL (p\u0026thinsp;=\u0026thinsp;0.0046 vs. oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e group), which brought the ratio back to control levels (p\u0026thinsp;=\u0026thinsp;0.5265; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b).\u003c/p\u003e\u003cp\u003eNext, we assessed the activation state of AMPK, a known upstream regulator of mTOR. Our analysis of the p-AMPK/AMPK ratio revealed no statistically significant differences among any of the treatment groups (F\u003csub\u003e(3,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.6886, p\u0026thinsp;=\u0026thinsp;0.5721; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, d). This suggests that the observed effects on mTOR occur independently of changes in global AMPK activation in this model.\u003c/p\u003e\u003cp\u003eWe then measured the levels of p62/\u003cem\u003eSQSTM1\u003c/em\u003e, a cargo receptor that accumulates when autophagic flux is impaired. Consistent with mTOR upregulation, oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment caused a significant increase in p62 levels (p\u0026thinsp;=\u0026thinsp;0.0456). Co-treatment with TAL successfully reversed this accumulation, significantly reducing p62 levels compared to the oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e group (p\u0026thinsp;=\u0026thinsp;0.0093; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, f).\u003c/p\u003e\u003cp\u003eFinally, we analyzed the LC3-II/I ratio, a marker of autophagosome formation. While we observed a trend towards a decrease in this ratio with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment, a one-way ANOVA did not find a statistically significant overall difference among the groups (F\u003csub\u003e(3,18)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.906, p\u0026thinsp;=\u0026thinsp;0.0630; Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg, h). Therefore, we could not conclude that TAL provided a statistically significant rescue of this specific marker.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. TAL Treatment Modulated the Gene Expression of Autophagy-Related Markers\u003c/h2\u003e\u003cp\u003eTo further investigate the mechanisms underlying TAL's effects on autophagy, we examined the gene expression of several key autophagy-related markers using RT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). In cells exposed to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, we observed a trend towards increased expression of the stress-response gene \u003cem\u003eSESN2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), and a corresponding trend towards decreased expression of the autophagy initiation genes \u003cem\u003eATG5\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb) and \u003cem\u003eBECN1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). In all cases, co-treatment with TAL appeared to normalize these expression levels back towards those seen in control cells. It is important to note that these experiments were conducted with a low replicate number (n\u0026thinsp;=\u0026thinsp;2) and are therefore presented as preliminary findings without claims of statistical significance.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. TAL Does Not Affect pLRRK2/LRRK2 Ratio or Total Endogenous GCase Levels in HT-22 Cells\u003c/h2\u003e\u003cp\u003eInsights from studies on LRRK2 and GCase interaction led us to examine the potential impact of TAL, a human recombinant GCase analogue, on the pLRRK2/LRRK2 ratio in an \u003cem\u003ein vitro\u003c/em\u003e AD model. In HT-22 cells, oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e exposure did not significantly alter p-LRRK2/LRRK2 levels, nor did co-treatment with TAL (8252 ng/mL) and 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e impact the p-LRRK2/LRRK2 ratio (F\u003csub\u003e(3,23)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.682, p\u0026thinsp;=\u0026thinsp;0.1986; Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b).\u003c/p\u003e\u003cp\u003eAlthough TAL at a concentration of 8252 ng/mL increased GCase protein expression in lysosomal extracts (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec), exposure of cells to increasing concentrations of TAL (540, 1656, 3056, 5153 and 8252 ng/mL) did not lead to an increase in GCase levels in total cell extracts compared to the control (F\u003csub\u003e(5,12)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.4272, p\u0026thinsp;=\u0026thinsp;0.8212; Online Resource 1).The amount of GCase protein in PBS extracts of HT-22 cells, as determined by ELISA, remained unaltered following exposure to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, TAL, or their co-administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eThe current findings indicate that TAL, a recombinant form of GCase, decreased Aβ accumulation and modulated the expression of autophagy-related proteins in HT-22 cells. These results imply that TAL may influence various pathways that contribute to reduced Aβ deposition, potentially through the optimization of autophagy-regulatory mechanisms.\u003c/p\u003e\u003cp\u003eThe amyloid hypothesis of AD, which asserts that Aβ plays a central role as the key peptide, has been widely accepted since 1992 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Aβ forms soluble, low molecular weight (LMW) oligomers in tetrameric, trimeric, and dimeric structures [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], which are considered toxic forms of the peptide before they deposit into amyloid plaques [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. These oligomeric species are internalized and accumulate within neuronal cells [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Monomeric forms, however, have the potential to convert into these oligomeric forms. It was suggested that release of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e monomers or oligomers into the cytoplasm and subsequent aggregation on microtubules may also be critical determinants of neurotoxicity [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In this study, to assess whether TAL reduces oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced toxicity and Aβ burden, HT-22 cells were treated with TAL at 8252 ng/mL in combination with 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e for 32 hours, which led to a reduction in monomeric Aβ load (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b). Additionally, cell viability, reduced by 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e for 32 hours, returned to control levels in cells treated with TAL at 8252 ng/mL (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In the prevalent model of AD, oligomers of Aβ are considered to be the main neurotoxic species; however, in the context of our studies, the monomeric forms of oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, which are prone to conversion into neurotoxic oligomers, might also contribute to the progression of AD by exerting a partially modulatory effect on autophagy pathways.\u003c/p\u003e\u003cp\u003eBased on these results, the observed reduction in monomeric Aβ following TAL treatment likely reflects a multi-pronged impact on Aβ metabolism, extending beyond simple degradation. By enhancing lysosomal GCase activity, TAL improves overall lysosomal function and remodels the local lipid environment [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Improved lysosomal efficiency can enhance the degradation of Aβ precursors like APP and its C-terminal fragments; this enhanced clearance, in turn, offers a potential route to reduced Aβ production [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Furthermore, altered membrane lipid composition, influenced by GCase activity, may directly modulate the activity of secretase enzymes involved in Aβ generation [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Simultaneously, enhanced lysosomal activity facilitates the rapid clearance of internalized soluble Aβ monomers [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. This efficient removal is critical because endo-lysosomal compartments are key sites for intracellular Aβ accumulation and seeding [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. By reducing monomer concentration and preventing their accumulation within these vesicles, TAL directly disrupts the earliest stages of Aβ aggregation. This mechanism is key to inhibiting the formation of toxic oligomeric seeds before significant oligomerization can occur [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Thus, TAL's impact on lysosomal health and lipid homeostasis likely contributes by reducing the available Aβ monomer pool and by preventing the initial steps of aggregation.\u003c/p\u003e\u003cp\u003eAutophagy and lysosomal function are disrupted in individuals with AD and other neurodegenerative disorders linked to protein aggregation. Autophagic markers, such as Atg5, beclin-1, Atg12, and LC3, are also present in amyloid plaques and neurofibrillary tangles in the brains of AD patients [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Furthermore, studies have demonstrated that amyloid precursor protein (APP) and Aβ peptides co-localize with LC3-positive autophagosomes in neuroblastoma cells overexpressing APP and in AD mouse models [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], suggesting that Aβ may be a substrate for autophagic degradation. Additionally, Aβ has been shown to enhance mTOR signaling, and a reduction in mTOR activity correlates with decreased Aβ levels, indicating a relationship between mTOR signaling and Aβ [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Due to its hydrophobic carboxyl terminus [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], Aβ may disrupt intracellular organelle trafficking as well as the trafficking of autophagosomes and their fusion with lysosomes [\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Furthermore, Aβ accumulation within lysosomes [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] has been linked to impaired autophagy and lysosomal degradation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. TAL is a recombinant enzyme analogue used in Gaucher disease (GD), a rare inherited lysosomal storage disorder. In GD, compounds that cannot be degraded, especially lipids, accumulate in the lysosomes, leading to cellular damage and pathological events in the spleen, bone marrow, liver, lungs, and brain. The affected lysosomal enzyme in GD is GCase, which catalyzes the breakdown of glucosylceramide into glucose and ceramide. Homozygous mutations in the \u003cem\u003eGBA1\u003c/em\u003e gene that encodes GCase reduce the lysosomal degradation capacity and cause the accumulation of misfolded proteins. Since lysosomes are also responsible for the degradation of dysfunctional organelles, impaired GCase function leads to the accumulation of damaged organelles within the cell. GCase deficiency and the loss of enzymatic activity have been associated with the pathological progression of AD and increased cell-to-cell spread of Aβ [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Limited information is available regarding the potential impact of GCase deficiency on AD pathology. Given the critical role of Aβ accumulation and lysosomal functionality in AD progression, it is hypothesized that overexpression of GCase could have significant effects in preventing disease progression. Studies have shown a significant reduction in GCase protein levels and enzymatic activity in postmortem hippocampal brain tissue of AD patients and primary neurons exposed to Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e oligomers. Ectopic expression of GCase via lentivirus has corrected the impaired lysosomal activity and accelerated the degradation of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e oligomers, thereby protecting neurons from Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced toxicity. Notably, the neuronal death caused by Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e oligomers was found to correlate with a decrease in GCase protein levels and enzymatic activity, along with accompanying lysosomal biogenesis and acidification damage [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The increased Aβ aggregation and APP observed in GD mice further highlight the relationship between GCase dysfunction and AD. In addition to the synaptic dysfunction observed in nerve cell death, it is suggested that Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e causes lysosomal membrane permeabilization (LMP) due to a loss of lysosomal acidification and disruption of membrane integrity. In primary neurons exposed to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, an increase in intracellular acidification, along with a decrease in lysosome number and size, suggests that LMP plays a role in Aβ toxicity. GCase expression, however has been shown to reverse Aβ oligomer-induced LMP. In AD patients, the expression and enzymatic activity of GCase are reduced, contributing to lysosomal dysfunction and playing a significant role in the development of AD. Gene therapy targeting the \u003cem\u003eGBA1\u003c/em\u003e gene that encodes GCase accelerates Aβ oligomer clearance through increased lysosomal function and protects neurons from Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced cell death [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Pharmacological enzyme replacement therapy aimed at restoring GCase activity or enhancing lysosomal function could be a potential new therapeutic strategy to prevent the progression of AD pathology. However, in our study, total cell extracts showed no increase in GCase protein expression (determined by Western blot) or GCase protein amount (determined by ELISA) in response to rising concentrations of TAL (Online Resource 1; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). In contrast, the pronounced accumulation of GCase observed in lysosomal extracts suggests that TAL exerts its effect through lysosomal accumulation. Moreover, TAL exposure resulted in the accumulation of GCase protein in lysosomal extracts, and the mature form of cathepsin B was also detected in the lysosomal extracts of HT-22 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The lack of a concentration-dependent increase in GCase expression or GCase level in total cell extracts, together with the pronounced accumulation of TAL in lysosomal fractions, supports the interpretation that TAL mediates its effect through lysosomal sequestration. In this study, the autophagy-related proteins p-AMPK/AMPK, p62/\u003cem\u003eSQSTM1\u003c/em\u003e and LC3-II/I were measured in HT-22 cells, along with the assessment of mTOR, the central regulator of autophagy (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), which coordinates autophagic activity through sequential actions of Atgs [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The post-translational modification of LC3-I to LC3-II occurs during autophagosome formation and is incorporated into the growing autophagosome. Mutational analyses indicate that cytosolic LC3-I is formed by the removal of the C-terminal 22 amino acids from newly synthesized LC3, followed by the conversion of a portion of LC3-I to LC3-II. The amount of LC3-II correlates with the extent of autophagosome formation, and LC3 is the first mammalian protein specifically associated with autophagosome membranes [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Lysosomal fusion and protease activity are critical for autophagy, and any abnormalities in this phase can impair cargo degradation, even if other steps in the autophagic pathway function normally. p62/\u003cem\u003eSQSTM1\u003c/em\u003e is an autophagosome cargo protein involved in protein turnover by initiating lysosomal degradation via autophagic flux. The LC3-interacting region of p62/\u003cem\u003eSQSTM1\u003c/em\u003e promotes selective autophagy by interacting with LC3 [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Treatment of HT-22 cells with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e resulted in a significant increase in p-mTOR/mTOR (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b) and p62/\u003cem\u003eSQSTM1\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee, f) levels, accompanied by a decrease in the LC3-II/I protein levels (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg, h). In addition, treatment with TAL, either alone or in combination with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, promoted the conversion of the precursor form of cathepsin B (pro-catB; 43\u0026ndash;45 kDa), observed in the lysosomal extracts of control and oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-treated cells, into the fully active (enzymatically active; mature; 25\u0026ndash;27 kDa) double-chain form consisting of heavy and light subunits (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003eAlthough TAL alone did not induce significant changes in p-mTOR/mTOR, p62, or the LC3-II/I ratio, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the combined treatment of TAL at 8252 ng/mL and 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e for 32 hours significantly impacted the autophagy regulatory pathway. This resulted in a notable decrease in the oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced elevation of p-mTOR/mTOR and p62 levels (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, f). However, this treatment did not lead to a statistically significant reversal of the trend towards a reduced LC3-II/I ratio caused by oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). These findings suggest that TAL, when co-administered with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e, enhances autophagic flux in HT-22 cells, as evidenced by the clearance of p62. The current results also demonstrate that simultaneous exposure to oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and TAL prevents the oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced suppression of ATG5 gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). These findings further suggest that TAL may partially facilitate Aβ clearance through an autophagy-dependent mechanism.\u003c/p\u003e\u003cp\u003eThe induction of sestrin-dependent AMPK activation and the suppression of mTORC1 activity are critical for the maintenance of basal autophagy [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. Sestrin-mediated inhibition of mTOR is also essential for the autophagic degradation of proteins that inhibit antioxidant genes. Through AMPK activation, SESN2 can inhibit enzymes that produce pathogenic levels of reactive oxygen species (ROS) [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Low levels of oxidative stress stimulate sestrins, reducing oxidative stress and preventing cell death [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. In this way, sestrins function as genetic components involved in cell viability and function, eliminating the inevitable consequences of oxidative stress. Sestrin-mediated mTOR inhibition also plays a key role in the autophagy-dependent degradation of proteins that suppress antioxidant gene expression. In the ischemic-damaged mouse brain, increased expression of SESN-2 has been demonstrated [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. The antioxidant and, particularly, the autophagy-inducing effects of sestrins have increased their relevance in neurodegenerative diseases. Exposure of CHP-134 neuroblastoma cells to Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e increased SESN2 expression [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. In primary rat cortical neuronal cultures, Aβ was observed to cause an increase in SESN2, activating antioxidant and autophagy pathways. In the widely used transgenic AD animal model, the 12-month-old APPswe/PSEN1dE9 mice, an increase in SESN-2 expression was observed in the cortex. A concurrent increase in the autophagosome marker LC3-II was also observed in the same cell culture and animal model. The increase in SESN-2 caused by Aβ was reversed by SESN2 siRNA, and a decrease in LC3-II accompanied this reversal. Additionally, knockdown of SESN2 and pharmacological inhibition of autophagy with bafilomycin A enhanced neuronal damage induced by Aβ. These findings suggest that SESN2 induction or inhibition is closely linked to AD, and autophagy pathways play a crucial role in this relationship [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. In our study, however, treatment of HT-22 cells with oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e for 32 hours led to an increase in \u003cem\u003eSESN2\u003c/em\u003e gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), as well as elevated p-mTOR/mTOR (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb) and p62 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef), accompanied by a decrease in the LC3-II/I ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). On the other hand, TAL treatment restored \u003cem\u003eSESN2\u003c/em\u003e gene expression to control levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) and promoted both the initiation and flux of autophagy. These findings suggest that, although oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e induces a compensatory upregulation of \u003cem\u003eSESN2\u003c/em\u003e, this response alone is insufficient to activate autophagy pathways. Moreover, despite the Aβ-induced increase in \u003cem\u003eSESN2\u003c/em\u003e, there was no statistically significant elevation in the p-AMPK/AMPK ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed), indicating that Aβ suppresses autophagic pathways independently of \u003cem\u003eSESN2\u003c/em\u003e-mediated compensation. In contrast, TAL may exert its effects by activating autophagic pathways, thereby partially offsetting the \u003cem\u003eSESN2\u003c/em\u003e upregulation that arises in response to cellular stress.\u003c/p\u003e\u003cp\u003eThe normalization of \u003cem\u003eSESN2\u003c/em\u003e levels by TAL, concurrent with enhanced autophagic flux despite no significant global AMPK activation, can be understood through several interconnected, AMPK-independent mechanisms. Firstly, \u003cem\u003eSESN2\u003c/em\u003e itself can directly suppress mTORC1 by interacting with the GATOR complex on lysosomes and can also associate with the ULK1 initiation complex and p62/\u003cem\u003eSQSTM1\u003c/em\u003e to facilitate autophagic clearance [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Secondly, TAL's primary action of restoring GCase activity leads to improved lysosomal function, such as enhanced substrate degradation [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], which in turn enhances autophagic flux [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e], helps normalize lysosomal pH [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e], and reduces aberrant mTORC1 signaling originating from dysfunctional lysosomes [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. By alleviating the Aβ-induced cellular stress (proteotoxic and oxidative) and restoring efficient lysosomal clearance [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], TAL effectively reduces the upstream stimuli that trigger \u003cem\u003eSESN2\u003c/em\u003e over-expression[\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Consequently, with the upstream stimuli reduced, the cell no longer requires a heightened SESN2 stress response, leading to its normalization [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Furthermore, the restored lysosomal environment allows even basal levels of SESN2 to more efficiently regulate mTORC1 [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e] and support the now more effective autophagic machinery [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn conclusion, this study reveals compelling \u003cem\u003ein vitro\u003c/em\u003e evidence that TAL effectively modulates autophagic pathways, a consequence of its ability to promote GCase accumulation and activity within lysosomes, significantly enhances autophagic pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), boosts lysosomal proteolytic capacity via Cathepsin B maturation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec), and facilitates the degradation of monomeric Aβ species. Consequently, TAL effectively reduces Aβ burden and restores autophagic homeostasis; furthermore, it confers neuroprotection against oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e toxicity in our neuronal model. These findings robustly underscore the therapeutic potential of strategies aimed at augmenting lysosomal GCase function for AD. While these promising results stem from an \u003cem\u003ein vitro\u003c/em\u003e system, they underscore the critical need for further in vivo investigations to confirm these neuroprotective effects and to address crucial translational challenges, notably the blood-brain barrier (BBB) penetration of TAL. Should these limitations, including the development of effective brain-targeted delivery systems, be overcome, targeting lysosomal GCase with ERT-like strategies could represent a powerful and innovative avenue for treating AD and other neurodegenerative conditions characterized by compromised autophagy.\u003c/p\u003e\u003cp\u003e\u003cb\u003eLimitations of the Study\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe present study provides valuable insights into the potential neuroprotective mechanisms of TAL in an \u003cem\u003ein vitro\u003c/em\u003e model of Aβ toxicity. However, certain limitations should be acknowledged. Firstly, all experiments were conducted using the immortalized mouse hippocampal cell line HT-22. While a well-established model, findings may not fully recapitulate the complex intercellular interactions and microenvironment of the human brain in AD, underscoring the need for future validation in primary neuronal cultures, co-culture systems, or in vivo animal models.\u003c/p\u003e\u003cp\u003eFurthermore, a general consideration for \u003cem\u003ein vitro\u003c/em\u003e investigations using exogenous recombinant proteins like TAL is the potential for cellular responses independent of the enzyme's primary catalytic activity. Although such off-target effects cannot be definitively ruled out in our HT-22 cell model, the specific enrichment of GCase protein within the lysosomal fraction following TAL treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec), coupled with observed improvements in lysosomal function (e.g., Cathepsin B maturation) and autophagy pathways, provides substantial evidence that the beneficial outcomes reported are predominantly mediated through its intended GCase replacement mechanism.\u003c/p\u003e\u003cp\u003eFinally, a critical hurdle for the clinical translation of these promising \u003cem\u003ein vitro\u003c/em\u003e findings is the limited ability of large biologic molecules like TAL to cross the BBB. Future research would need to focus on developing effective brain-targeted delivery systems or enzyme modifications to overcome this challenge.\u003c/p\u003e"},{"header":"4. Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e4.1. Cell culture and treatment\u003c/h2\u003e\u003cp\u003eMouse hippocampal neurons (HT-22; passage number 9) were donated by Atlas Biotechnology (Ankara, Turkey). The cells were grown in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #E0500-160) supplemented with 10% fetal bovine serum (FBS) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #A0500-3210), 1% L-glutamine (200 mM) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #K0100-670) and 1% penicillin/streptomycin (10,000 U/mL) (Cegrogen Biotech, Stadtallendorf, Germany, cat. #P0100-790) at 37\u0026deg;C in an incubator with a humidified CO2 environment of 5%.\u003c/p\u003e\u003cp\u003eTAL, a recombinant analog of GCase, is a licensed and patented product of Pfizer [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], and donated by the company for this study.\u003c/p\u003e\u003cp\u003eCell viability experiments were performed using TAL (ELELYSO\u0026reg;, Pfizer, USA) 1656 and 8252 ng/mL. TAL was administered when cell confluency reached 50% in 96-well plates. For the treatment of HT-22 cells, TAL 8252 ng/mL final concentration was used. Control cells were exposed to the same quantity of artificial cerebrospinal fluid (aCSF). TAL was administered when cell confluency reached 70%-80% in 6-well plates. The cells were exposed to 5 \u0026micro;M oAβ\u003csub\u003e1\u0026minus;\u0026thinsp;42\u003c/sub\u003e and concomitant TAL incubation for 32 h. Following incubation, the treatment media was removed and the cells were washed 3 times with phosphate-buffered saline (PBS) with pH 7.4 at 37\u0026deg;C to remove residual oAβ\u003csub\u003e1\u0026minus;\u0026thinsp;42\u003c/sub\u003e. Cells were then lyzed with radioimmunoprecipitation assay (RIPA) buffer (Tris-HCl 50 mM [pH 7.4], NaCl 150 mM, NP-40 1%, sodium deoxycholate 0.5%, SDS 0.1% [Boston Bioproducts, Worchester WA, USA, cat. #BP-115]) supplemented with protease (Complete Protease Inhibitor Cocktail, Roche, Basel, Switzerland, cat. # 11697498001) and phosphatase inhibitors (dithiothreitol DTT, Amresco Inc., Solon, OH, USA, cat. #97061-340), and the protein concentration was determined via Bradford assay. The extracts were stored at -80\u0026deg;C until western blotting.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e4.2. Preparation of oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e\u003c/h2\u003e\u003cp\u003eAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e human peptide (lyophilized, 1 mg) (Novex by Life Technologies, USA, lot #75555483A) was dissolved in sterile water (molecular biology grade) and diluted in Ca\u003csup\u003e2+\u003c/sup\u003e free PBS at a concentration of 2 mM and incubated at 37\u0026deg;C for 24 h. The preparation was centrifuged at 14,000 g for 10 min at 4\u0026deg;C, and the supernatant containing soluble oligomer Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e was transferred to clean tubes and stored at 4\u0026deg;C. oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e was used within 24 h after preparation [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e4.3. Cell viability assay\u003c/h2\u003e\u003cp\u003e96-well plates were seeded with 1.5x10\u003csup\u003e4\u003c/sup\u003e cells per well 1 day before treatment and allowed to adhere overnight to reach 50% confluency. This experiment was carried out using a stock solution of 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT), which was diluted in dimethyl sulfoxide (50 mg/mL) as a 100-fold stock solution [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. At the end of TAL and/or oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment, HT-22 cells were incubated in the culture medium with MTT (0.5 mg/mL) in the dark at 37\u0026deg;C for 4 h to allow the living cells to form insoluble formazan precipitates. Following incubation, 150 \u0026micro;L of isopropyl alcohol was added to each well, and the plates were agitated for 5 min to solubilize the crystals. Absorbance at a wavelength of 570 nm was measured using a plate reader (Biotek Instruments Inc., Winooski, VT, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e4.4. RT(Q)-PCR studies\u003c/h2\u003e\u003cp\u003eA total RNA isolation system (Nzytech, Lisboa, Portugal) was used to extract total RNA from HT-22 cells, and the purity of the recovered RNA was validated spectrophotometrically at 260/280 nm. Utilizing an RT-PCR kit, the RNA was reverse-transcribed and used to create complementary DNA (Strata Gene, La Jolla, CA, USA). According to the manufacturer's recommended thermal cycling methodology, quantitative RT-PCR was performed using SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich, St. Louis, MO, USA, cat. # S9194-20RXN). β-actin (ACTB) was used as an internal control for mRNA expression. Results represent the fold change in the expression of target genes (relative to the control) calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. The following oligonucleotides were used: \u003cem\u003eSESN2\u003c/em\u003e: fw 5': 5-tag cctgcagcctcacct at-3, rev 5': tatctgatgccaaagacgca; \u003cem\u003eATG5\u003c/em\u003e: fw: 5\u0026prime;-gcagatggacagttgcacacac-3\u0026prime;, rev: 5\u0026prime;- gaggtgtttccaacattggctca-3\u0026prime;; \u003cem\u003eBECN1\u003c/em\u003e: fw: 5\u0026prime;-ctggacactcagctcaacgtca-3\u0026prime;, rev: 5\u0026prime;-ctctagtgccagctcctttagc \u0026minus;\u0026thinsp;3\u0026prime;; \u003cem\u003eACTB\u003c/em\u003e: fw: 5\u0026prime;-caccattggcaatgagcggttc-3\u0026prime;, rev: 5\u0026prime;- aggtctttgcggatgtccacgt-3\u0026prime;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e4.5. Lysosomal Extract Preparation and Western Blotting\u003c/h2\u003e\u003cp\u003eFor lysosomal extract preparation, cells cultured in 6-well plates were washed with cold phosphate-buffered saline (PBS). The culture medium was collected and cleared by centrifugation (2,000 g, 10 min, 4\u0026deg;C), and the supernatant was stored. The cells were lysed directly in the wells with 120 \u0026micro;L of ice-cold RIPA buffer (Boston BioProducts, Ashland, MA, USA; cat. #BP-115) supplemented with protease and phosphatase inhibitors. The cell lysate was collected and subjected to two cycles of freeze-thaw and sonication (5 short bursts on ice) to ensure lysosomal membrane disruption. After a final incubation on ice for 30 minutes, the lysate was clarified by centrifugation at 20,630 g for 10 minutes at 4\u0026deg;C. The supernatant, enriched with lysosomal contents, was collected for analysis.\u003c/p\u003e\u003cp\u003eProtein concentrations for both total cell lysates (RIPA) and lysosomal extracts were determined using a BCA protein assay. Equal quantities of protein were separated on 4%-20% Mini-PROTEAN\u0026reg; TGX\u0026trade; Precast Protein Gels (Bio-Rad, Hercules, CA, USA; cat. #4561094) and transferred to Immun-Blot\u0026reg; PVDF membranes (Bio-Rad; cat. #1620177). Membranes were blocked with 5% non-fat dry milk or bovine serum albumin (BSA) in Tris-buffered saline with 0.1% Tween-20 (TBS-T) for 1 hour at room temperature. Membranes were then incubated overnight at 4\u0026deg;C with the following primary antibodies: anti-β-Amyloid (D54D2) XP\u0026reg; Rabbit mAb (1:1000; Cell Signaling Technology, Danvers, MA, USA; cat. #8243S), anti-mTOR (7C10) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #2983S), anti-Phospho-mTOR (Ser2448) (D9C2) XP\u0026reg; Rabbit mAb (1:1000; Cell Signaling Technology; cat. #5536S), anti-AMPKα (D63G4) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #5832), anti-Phospho-AMPKα (Thr172) (D4D6D) Rabbit mAb (1:1000; Cell Signaling Technology; cat. #50081), anti-LRRK2 [MJFF2 (c41-2)] Rabbit mAb (1:1000; Abcam, Cambridge, UK; cat. #ab133474), anti-LRRK2 (phospho S935) [UDD2 10(12)] Rabbit mAb (1:1000; Abcam; cat. #ab133450), anti-GBA [2E2] (1:1000; Abcam; cat. #ab55080), anti-SQSTM1/p62 [2C11] (1:5000; Abcam; cat. #ab56416), anti-LC3B (1:5000; Abcam; cat. #ab48394), and anti-β-Actin (8H10D10) Mouse mAb (1:1000; Cell Signaling Technology; cat. #3700S).\u003c/p\u003e\u003cp\u003eAfter washing in TBS-T, membranes were incubated with the appropriate HRP-conjugated secondary antibodies: Anti-rabbit IgG, HRP-linked Antibody (1:2000; Cell Signaling Technology; cat. #7074S) or Anti-mouse IgG, HRP-linked Antibody (1:2000; Cell Signaling Technology; cat. #7076S). Protein bands were visualized using WesternBright\u0026trade; Sirius\u0026trade; HRP substrate (Advansta, San Jose, CA, USA; cat. #K-12043-D10) and imaged on a Kodak Image Station 4000 MM (Carestream, Rochester, NY, USA). β-actin served as the loading control for normalization. The BLUelf\u0026trade; Prestained Protein Ladder (GeneDireX, Taoyuan City, Taiwan; cat. #PM008-0500) was used to approximate molecular weights.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e4.6. ELISA assays\u003c/h2\u003e\u003cp\u003eThe microplate provided in this kit (BT Lab, Wuhan, China; Mouse glucosidase beta; cat. #E0746Mo) has been pre-coated with an antibody specific to GCase. Standards or samples are then added to the appropriate microplate wells with a biotin-conjugated antibody specific to GCase. Next, Avidin conjugated to Horseradish Peroxidase (HRP) is added to each microplate well and incubated. After TMB substrate solution is added, only those wells that contain GCase, biotin-conjugated antibody and enzyme-conjugated Avidin will exhibit a change in color. The enzyme-substrate reaction is terminated by the addition of sulphuric acid solution and the color change is measured spectrophotometrically at a wavelength of 450 nm\u0026thinsp;\u0026plusmn;\u0026thinsp;10 nm. The concentration of Gcase in the samples is then determined by comparing the O.D. of the samples to the standard curve.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e4.7. Statistical analysis\u003c/h2\u003e\u003cp\u003eAll statistical analyses were performed using GraphPad Prism version 10.3.1 (GraphPad Software, La Jolla, CA, USA). Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM) unless otherwise noted. The specific statistical tests used are detailed in the corresponding figure legends. In general, comparisons between multiple groups were made using one-way or two-way analysis of variance (ANOVA) as appropriate for the experimental design. Post-hoc tests were selected to appropriately test the specific hypotheses, and included Tukey\u0026rsquo;s HSD for all-pairs comparisons, Dunnett\u0026rsquo;s test for comparisons against a single control, and the Holm-Š\u0026iacute;d\u0026aacute;k test for pre-planned comparisons. For all analyses, a p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e This study was supported by the Scientific Research Projects Coordination Unit of Hacettepe University (Project ID: THD-2019-17598), and the Scientific and Technological Research Council of Turkey (TUBITAK-1002; Project ID: 122S157). This study is part of the Ph.D. thesis of \u0026Ccedil;ağrı \u0026Ouml;zkurt. Western blot experiments were conducted at Hacettepe University, School of Pharmacy, Department of Pharmacology. Services were purchased for RT-PCR studies. The authors thank Pfizer for providing Elelyso\u0026reg; (rhGBA; TAL). Additionally, special thanks are given to the Pfizer Turkiye team: Işıl Bayraktar and Ayşe İlay Duru for their valuable assistance in establishing contact with Pfizer Global.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.1. Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Hacettepe University Research Foundation (Grant number THD-2019-17598) and the Scientific and Technological Research Council of Turkey (T\u0026Uuml;BİTAK) (Grant number 122S157).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.2. Competing Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.3. Author Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection, and analysis were performed by \u0026Ccedil;. \u0026Ouml;zkurt and S. K\u0026ouml;se. The first draft of the manuscript was written by P. Kelicen-Uğur. Review and editing were performed by \u0026Ccedil;. \u0026Ouml;zkurt, P. Kelicen-Uğur, \u0026Ccedil;. Karasu, and A. Kortholt. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.4. Data Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analysed during the current study are not publicly available as they form part of an ongoing doctoral thesis but are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.5. Ethics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable. This study did not involve human participants or animals.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.6. Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e6.7. Consent to Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMa L-Y, Lv Y-L, Huo K et al (2017) Autophagy-lysosome dysfunction is involved in Aβ deposition in STZ-induced diabetic rats. Behav Brain Res 320:484\u0026ndash;493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2016.10.031\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2016.10.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai AY, McLaurin J (2011) Mechanisms of Amyloid-Beta Peptide Uptake by Neurons: The Role of Lipid Rafts and Lipid Raft‐Associated Proteins. Int J Alzheimer\u0026rsquo;s Dis 2011:548380. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4061/2011/548380\u003c/span\u003e\u003cspan address=\"10.4061/2011/548380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMohamed A, De Posse E (2011) A β Internalization by Neurons and Glia. Int J Alzheimer\u0026rsquo;s Dis 2011:127984. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4061/2011/127984\u003c/span\u003e\u003cspan address=\"10.4061/2011/127984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNazere K, Takahashi T, Hara N et al (2022) Amyloid Beta Is Internalized via Macropinocytosis, an HSPG- and Lipid Raft-Dependent and Rac1-Mediated Process. Front Mol Neurosci 15:804702. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnmol.2022.804702\u003c/span\u003e\u003cspan address=\"10.3389/fnmol.2022.804702\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDesforges JF, Beutler E (1991) Gaucher\u0026rsquo;s Disease. N Engl J Med 325:1354\u0026ndash;1360. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJM199111073251906\u003c/span\u003e\u003cspan address=\"10.1056/NEJM199111073251906\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e(1993) Treatment of Gaucher\u0026rsquo;s Disease. N Engl J Med 328:1564\u0026ndash;1568. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJM199305273282112\u003c/span\u003e\u003cspan address=\"10.1056/NEJM199305273282112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrabowski GA (2012) Gaucher disease and other storage disorders. Hematology 2012:13\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1182/asheducation.V2012.1.13.3797921\u003c/span\u003e\u003cspan address=\"10.1182/asheducation.V2012.1.13.3797921\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFood US, Administration D (2025) ELELYSO (taliglucerase alfa): U.S. Prescribing Information. U.S. Food and Drug Administration. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.accessdata.fda.gov/drugsatfda_docs/label/2025/022458s033lbl.pdf\u003c/span\u003e\u003cspan address=\"https://www.accessdata.fda.gov/drugsatfda_docs/label/2025/022458s033lbl.pdf\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 25 June 2025\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBlanz J, Zunke F, Markmann S et al (2015) Mannose 6-phosphate‐independent Lysosomal Sorting of LIMP ‐2. Traffic 16:1127\u0026ndash;1136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/tra.12313\u003c/span\u003e\u003cspan address=\"10.1111/tra.12313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoi S, Kim D, Kam T-I et al (2015) Lysosomal Enzyme Glucocerebrosidase Protects against Aβ1\u0026ndash;42 Oligomer-Induced Neurotoxicity. PLoS ONE 10:e0143854. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0143854\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0143854\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMizushima N, Noda T, Yoshimori T et al (1998) A protein conjugation system essential for autophagy. Nature 395:395\u0026ndash;398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/26506\u003c/span\u003e\u003cspan address=\"10.1038/26506\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCorreia SC, Resende R, Moreira PI, Pereira CM (2015) Alzheimer\u0026rsquo;s Disease-Related Misfolded Proteins and Dysfunctional Organelles on Autophagy Menu. DNA Cell Biol 34:261\u0026ndash;273. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/dna.2014.2757\u003c/span\u003e\u003cspan address=\"10.1089/dna.2014.2757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHardy J, Selkoe DJ (2002) The Amyloid Hypothesis of Alzheimer\u0026rsquo;s Disease: Progress and Problems on the Road to Therapeutics. Science 297:353\u0026ndash;356. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1072994\u003c/span\u003e\u003cspan address=\"10.1126/science.1072994\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEshraghi M, Ahmadi M, Afshar S et al (2022) Enhancing autophagy in Alzheimer\u0026rsquo;s disease through drug repositioning. Pharmacol Ther 237:108171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pharmthera.2022.108171\u003c/span\u003e\u003cspan address=\"10.1016/j.pharmthera.2022.108171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Q, Liu Y, Sun M (2017) Autophagy and Alzheimer\u0026rsquo;s Disease. Cell Mol Neurobiol 37:377\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10571-016-0386-8\u003c/span\u003e\u003cspan address=\"10.1007/s10571-016-0386-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eUddin MS, Stachowiak A, Mamun AA et al (2018) Autophagy and Alzheimer\u0026rsquo;s Disease: From Molecular Mechanisms to Therapeutic Implications. Front Aging Neurosci 10:04. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnagi.2018.00004\u003c/span\u003e\u003cspan address=\"10.3389/fnagi.2018.00004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGolde TE (2006) Disease modifying therapy for AD?\u003csup\u003e1\u003c/sup\u003e. J Neurochem 99:689\u0026ndash;707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1471-4159.2006.04211.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1471-4159.2006.04211.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCaccamo A, Majumder S, Richardson A et al (2010) Molecular Interplay between Mammalian Target of Rapamycin (mTOR), Amyloid-β, and Tau. J Biol Chem 285:13107\u0026ndash;13120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M110.100420\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M110.100420\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim Y, Cho H, Kim E-K (2016) Brain metabolism as a modulator of autophagy in neurodegeneration. Brain Res 1649:158\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2016.02.049\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2016.02.049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOrr ME, Oddo S (2013) Autophagic/lysosomal dysfunction in Alzheimer\u0026rsquo;s disease. Alzheimers Res Ther 5:53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/alzrt217\u003c/span\u003e\u003cspan address=\"10.1186/alzrt217\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNixon RA (2013) The role of autophagy in neurodegenerative disease. Nat Med 19:983\u0026ndash;997. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nm.3232\u003c/span\u003e\u003cspan address=\"10.1038/nm.3232\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBj\u0026oslash;rk\u0026oslash;y G, Lamark T, Pankiv S et al (2009) Chap. 12 Monitoring Autophagic Degradation of p62/SQSTM1. Methods in Enzymology. Elsevier, pp 181\u0026ndash;197\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeeters H, Debeer P, Bairoch A et al (2003) PA26 is a candidate gene for heterotaxia in humans: identification of a novel PA26-related gene family in human and mouse. Hum Genet 112:573\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00439-003-0917-5\u003c/span\u003e\u003cspan address=\"10.1007/s00439-003-0917-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee JH, Budanov AV, Karin M (2013) Sestrins Orchestrate Cellular Metabolism to Attenuate Aging. Cell Metab 18:792\u0026ndash;801. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2013.08.018\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2013.08.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBudanov AV, Sablina AA, Feinstein E et al (2004) Regeneration of Peroxiredoxins by p53-Regulated Sestrins, Homologs of Bacterial AhpD. Science 304:596\u0026ndash;600. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1095569\u003c/span\u003e\u003cspan address=\"10.1126/science.1095569\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVelasco-Miguel S, Buckbinder L, Jean P et al (1999) PA26, a novel target of the p53 tumor suppressor and member of the GADD family of DNA damage and growth arrest inducible genes. Oncogene 18:127\u0026ndash;137. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.onc.1202274\u003c/span\u003e\u003cspan address=\"10.1038/sj.onc.1202274\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen C-C, Jeon S-M, Bhaskar PT et al (2010) FoxOs Inhibit mTORC1 and Activate Akt by Inducing the Expression of Sestrin3 and Rictor. Dev Cell 18:592\u0026ndash;604. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.devcel.2010.03.008\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2010.03.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBudanov AV, Karin M (2008) p53 Target Genes Sestrin1 and Sestrin2 Connect Genotoxic Stress and mTOR Signaling. Cell 134:451\u0026ndash;460. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2008.06.028\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2008.06.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbbas R, Park G, Damle B et al (2015) Pharmacokinetics of Novel Plant Cell-Expressed Taliglucerase Alfa in Adult and Pediatric Patients with Gaucher Disease. PLoS ONE 10:e0128986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0128986\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0128986\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo J-P, Arai T, Miklossy J, McGeer PL (2006) Aβ and tau form soluble complexes that may promote self aggregation of both into the insoluble forms observed in Alzheimer\u0026rsquo;s disease. Proc Natl Acad Sci 103:1953\u0026ndash;1958. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0509386103\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0509386103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHardy JA, Higgins GA (1992) Alzheimer\u0026rsquo;s Disease: The Amyloid Cascade Hypothesis. Science 256:184\u0026ndash;185. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1566067\u003c/span\u003e\u003cspan address=\"10.1126/science.1566067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCho E, Youn K, Kwon H et al (2022) Eugenitol ameliorates memory impairments in 5XFAD mice by reducing Aβ plaques and neuroinflammation. Biomed Pharmacother 148:112763. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2022.112763\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2022.112763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBolmont T, Clavaguera F, Meyer-Luehmann M et al (2007) Induction of Tau Pathology by Intracerebral Infusion of Amyloid-β-Containing Brain Extract and by Amyloid-β Deposition in APP \u0026times; Tau Transgenic Mice. Am J Pathol 171:2012\u0026ndash;2020. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2353/ajpath.2007.070403\u003c/span\u003e\u003cspan address=\"10.2353/ajpath.2007.070403\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTakahashi RH, Almeida CG, Kearney PF et al (2004) Oligomerization of Alzheimer\u0026rsquo;s β-Amyloid within Processes and Synapses of Cultured Neurons and Brain. J Neurosci 24:3592\u0026ndash;3599. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.5167-03.2004\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.5167-03.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKravenska Y, Nieznanska H, Nieznanski K et al (2020) The monomers, oligomers, and fibrils of amyloid-β inhibit the activity of mitoBKCa channels by a membrane-mediated mechanism. Biochim Biophys Acta BBA - Biomembr 1862:183337. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbamem.2020.183337\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamem.2020.183337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcNeill A, Magalhaes J, Shen C et al (2014) Ambroxol improves lysosomal biochemistry in glucocerebrosidase mutation-linked Parkinson disease cells. Brain 137:1481\u0026ndash;1495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/brain/awu020\u003c/span\u003e\u003cspan address=\"10.1093/brain/awu020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao Q, Yan P, Ma X et al (2015) Neuronal-Targeted TFEB Accelerates Lysosomal Degradation of APP, Reducing Aβ Generation and Amyloid Plaque Pathogenesis. J Neurosci 35:12137\u0026ndash;12151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.0705-15.2015\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.0705-15.2015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrimm MOW, Mett J, Grimm HS, Hartmann T (2017) APP Function and Lipids: A Bidirectional Link. Front Mol Neurosci 10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnmol.2017.00063\u003c/span\u003e\u003cspan address=\"10.3389/fnmol.2017.00063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYamaguchi T, Yamauchi Y, Furukawa K et al (2016) Expression of B4GALNT1, an essential glycosyltransferase for the synthesis of complex gangliosides, suppresses BACE1 degradation and modulates APP processing. Sci Rep 6:34505. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep34505\u003c/span\u003e\u003cspan address=\"10.1038/srep34505\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMiners JS, Barua N, Kehoe PG et al (2011) Aβ-Degrading Enzymes: Potential for Treatment of Alzheimer Disease. J Neuropathol Exp Neurol 70:944\u0026ndash;959. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/NEN.0b013e3182345e46\u003c/span\u003e\u003cspan address=\"10.1097/NEN.0b013e3182345e46\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu X, Crick SL, Bu G et al (2009) Amyloid seeds formed by cellular uptake, concentration, and aggregation of the amyloid-beta peptide. Proc Natl Acad Sci 106:20324\u0026ndash;20329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0911281106\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0911281106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSch\u0026uuml;tzmann MP, Hasecke F, Bachmann S et al (2021) Endo-lysosomal Aβ concentration and pH trigger formation of Aβ oligomers that potently induce Tau missorting. Nat Commun 12:4634. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-24900-4\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-24900-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eŻukowska J, Moss SJ, Subramanian V, Acharya KR (2024) Molecular basis of selective amyloid-β degrading enzymes in Alzheimer\u0026rsquo;s disease. FEBS J 291:2999\u0026ndash;3029. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/febs.16939\u003c/span\u003e\u003cspan address=\"10.1111/febs.16939\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa J-F, Huang Y, Chen S, ‐D., Halliday G (2010) Immunohistochemical evidence for macroautophagy in neurones and endothelial cells in Alzheimer\u0026rsquo;s disease. Neuropathol Appl Neurobiol 36:312\u0026ndash;319. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2990.2010.01067.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2990.2010.01067.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRohn TT, Wirawan E, Brown RJ et al (2011) Depletion of Beclin-1 due to proteolytic cleavage by caspases in the Alzheimer\u0026rsquo;s disease brain. Neurobiol Dis 43:68\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.nbd.2010.11.003\u003c/span\u003e\u003cspan address=\"10.1016/j.nbd.2010.11.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuglielmotto M, Monteleone D, Piras A et al (2014) Aβ1\u0026ndash;42 monomers or oligomers have different effects on autophagy and apoptosis. Autophagy 10:1827\u0026ndash;1843. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/auto.30001\u003c/span\u003e\u003cspan address=\"10.4161/auto.30001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu WH, Cuervo AM, Kumar A et al (2005) Macroautophagy\u0026mdash;a novel β-amyloid peptide-generating pathway activated in Alzheimer\u0026rsquo;s disease. J Cell Biol 171:87\u0026ndash;98. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1083/jcb.200505082\u003c/span\u003e\u003cspan address=\"10.1083/jcb.200505082\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpilman P, Podlutskaya N, Hart MJ et al (2010) Inhibition of mTOR by Rapamycin Abolishes Cognitive Deficits and Reduces Amyloid-β Levels in a Mouse Model of Alzheimer\u0026rsquo;s Disease. PLoS ONE 5:e9979. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0009979\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0009979\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheung ZH, Ip NY (2011) Autophagy deregulation in neurodegenerative diseases \u0026ndash; recent advances and future perspectives. J Neurochem 118:317\u0026ndash;325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1471-4159.2011.07314.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1471-4159.2011.07314.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMasters CL, Selkoe DJ (2012) Biochemistry of Amyloid -Protein and Amyloid Deposits in Alzheimer Disease. Cold Spring Harb Perspect Med 2:a006262\u0026ndash;a006262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/cshperspect.a006262\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a006262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKakio A, Yano Y, Takai D et al (2004) Interaction between amyloid β-protein aggregates and membranes. J Pept Sci 10:612\u0026ndash;621. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/psc.570\u003c/span\u003e\u003cspan address=\"10.1002/psc.570\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMurphy RM (2007) Kinetics of amyloid formation and membrane interaction with amyloidogenic proteins. Biochim Biophys Acta BBA - Biomembr 1768:1923\u0026ndash;1934. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbamem.2006.12.014\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamem.2006.12.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSasahara K, Morigaki K, Shinya K (2013) Effects of membrane interaction and aggregation of amyloid β-peptide on lipid mobility and membrane domain structure. Phys Chem Chem Phys 15:8929. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/c3cp44517h\u003c/span\u003e\u003cspan address=\"10.1039/c3cp44517h\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi Z-S, Miranda RD, Newhouse YM et al (2002) Apolipoprotein E4 Potentiates Amyloid β Peptide-induced Lysosomal Leakage and Apoptosis in Neuronal Cells. J Biol Chem 277:21821\u0026ndash;21828. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M112109200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M112109200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang AJ, Chandswangbhuvana D, Margol L, Glabe CG (1998) Loss of endosomal/lysosomal membrane impermeability is an early event in amyloid A?1\u0026ndash;42 pathogenesis. J Neurosci Res 52:691\u0026ndash;698. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/(SICI)1097-4547(19980615)52:6\u0026lt;691::AID-JNR8\u0026gt;3.0.CO;2-3\u003c/span\u003e\u003cspan address=\"10.1002/(SICI)1097-4547(19980615)52:6%3C691::AID-JNR8%3E3.0.CO;2-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoon S-Y, Kim D-H (2016) Alzheimer\u0026rsquo;s disease genes and autophagy. Brain Res 1649:201\u0026ndash;209. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2016.03.018\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2016.03.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark H, Kang J-H, Lee S (2020) Autophagy in Neurodegenerative Diseases: A Hunter for Aggregates. Int J Mol Sci 21:3369. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21093369\u003c/span\u003e\u003cspan address=\"10.3390/ijms21093369\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKabeya Y (2000) LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19:5720\u0026ndash;5728. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/emboj/19.21.5720\u003c/span\u003e\u003cspan address=\"10.1093/emboj/19.21.5720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSalminen A, Kaarniranta K, Haapasalo A et al (2012) Emerging role of p62/sequestosome-1 in the pathogenesis of Alzheimer\u0026rsquo;s disease. Prog Neurobiol 96:87\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pneurobio.2011.11.005\u003c/span\u003e\u003cspan address=\"10.1016/j.pneurobio.2011.11.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamesh Babu J, Lamar Seibenhener M, Peng J et al (2008) Genetic inactivation of p62 leads to accumulation of hyperphosphorylated tau and neurodegeneration. J Neurochem 106:107\u0026ndash;120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1471-4159.2008.05340.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1471-4159.2008.05340.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaiuri MC, Tasdemir E, Criollo A et al (2009) Control of autophagy by oncogenes and tumor suppressor genes. Cell Death Differ 16:87\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/cdd.2008.131\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2008.131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBae SH, Sung SH, Oh SY et al (2013) Sestrins Activate Nrf2 by Promoting p62-Dependent Autophagic Degradation of Keap1 and Prevent Oxidative Liver Damage. Cell Metab 17:73\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2012.12.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2012.12.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBudanov AV, Shoshani T, Faerman A et al (2002) Identification of a novel stress-responsive gene Hi95 involved in regulation of cell viability. Oncogene 21:6017\u0026ndash;6031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.onc.1205877\u003c/span\u003e\u003cspan address=\"10.1038/sj.onc.1205877\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBudanov AV, Lee JH, Karin M (2010) Stressin\u0026rsquo; Sestrins take an aging fight. EMBO Mol Med 2:388\u0026ndash;400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/emmm.201000097\u003c/span\u003e\u003cspan address=\"10.1002/emmm.201000097\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHara T, Nakamura K, Matsui M et al (2006) Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 441:885\u0026ndash;889. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature04724\u003c/span\u003e\u003cspan address=\"10.1038/nature04724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim J-R, Lee S-R, Chung HJ et al (2003) Identification of amyloid β-peptide responsive genes by cDNA microarray technology: Involvement of RTP801 in amyloid β-peptide toxicity. Exp Mol Med 35:403\u0026ndash;411. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/emm.2003.53\u003c/span\u003e\u003cspan address=\"10.1038/emm.2003.53\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen Y-S, Chen S-D, Wu C-L et al (2014) Induction of sestrin2 as an endogenous protective mechanism against amyloid beta-peptide neurotoxicity in primary cortical culture. Exp Neurol 253:63\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2013.12.009\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2013.12.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu C, Jiang Y, Xu W, Bao X (2023) Sestrin2: multifaceted functions, molecular basis, and its implications in liver diseases. Cell Death Dis 14:160. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41419-023-05669-4\u003c/span\u003e\u003cspan address=\"10.1038/s41419-023-05669-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePeng Y, Liou B, Lin Y et al (2021) Substrate Reduction Therapy Reverses Mitochondrial, mTOR, and Autophagy Alterations in a Cell Model of Gaucher Disease. Cells 10:2286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10092286\u003c/span\u003e\u003cspan address=\"10.3390/cells10092286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMagalhaes J, Gegg ME, Migdalska-Richards A et al (2016) Autophagic lysosome reformation dysfunction in glucocerebrosidase deficient cells: relevance to Parkinson disease. Hum Mol Genet 25:3432\u0026ndash;3445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hmg/ddw185\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddw185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSillence DJ (2013) Glucosylceramide modulates endolysosomal pH in Gaucher disease. Mol Genet Metab 109:194\u0026ndash;200. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymgme.2013.03.015\u003c/span\u003e\u003cspan address=\"10.1016/j.ymgme.2013.03.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen S-D, Yang J-L, Hsieh Y-H et al (2021) Potential Roles of Sestrin2 in Alzheimer\u0026rsquo;s Disease: Antioxidation, Autophagy Promotion, and Beyond. Biomedicines 9:1308. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biomedicines9101308\u003c/span\u003e\u003cspan address=\"10.3390/biomedicines9101308\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShaaltiel Y, Baum G, Bartfeld D et al (2011) Human lysosomal proteins from plant cell culture\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasza \u0026Aacute;, Penke B, Frank Z et al (2017) Studies for Improving a Rat Model of Alzheimer\u0026rsquo;s Disease: Icv Administration of Well-Characterized β-Amyloid 1\u0026ndash;42 Oligomers Induce Dysfunction in Spatial Memory. Molecules 22:2007. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules22112007\u003c/span\u003e\u003cspan address=\"10.3390/molecules22112007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang Y, Ju T, Yang D (2005) Induction of hypoxia inducible factor-1 attenuates metabolic insults induced by 3‐nitropropionic acid in rat C6 glioma cells. J Neurochem 93:513\u0026ndash;525. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1471-4159.2005.03032.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1471-4159.2005.03032.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2\u0026thinsp;\u0026ndash; ∆∆CT Method. Methods 25:402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Taliglucerase alfa, β-glucocerebrosidase, Alzheimer’s disease, autophagy","lastPublishedDoi":"10.21203/rs.3.rs-7094261/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7094261/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntraneuronal amyloid-beta (Aβ) accumulation and autophagic dysfunction are key pathological features of Alzheimer's disease (AD). Mutations in \u003cem\u003eGBA1\u003c/em\u003e, which encodes the lysosomal enzyme β-glucocerebrosidase (GCase), are linked to several neurodegenerative disorders, but the role of GCase in AD is underexplored. We hypothesized that taliglucerase alfa (TAL), a recombinant human GCase, could reduce intracellular Aβ accumulation by modulating autophagy pathways in a neuronal AD model. Endogenous Aβ accumulation was induced in mouse hippocampal neuronal cells (HT-22) by exposure to an oligomeric Aβ fragment (oAβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e), followed by treatment with TAL. Using Western blotting, ELISA, and RT-PCR, we evaluated soluble Aβ levels and key proteins in the autophagy-lysosome pathway, including GCase, cathepsin B, p62/sequestosome-1 (p62/\u003cem\u003eSQSTM1\u003c/em\u003e), and the mammalian target of rapamycin (mTOR). In this \u003cem\u003ein vitro\u003c/em\u003e model, TAL significantly reduced the intracellular load of monomeric Aβ. This reduction was associated with a restoration of autophagic function, marked by the normalization of mTOR signaling and p62 levels, alongside enhanced lysosomal proteolytic capacity. These findings suggest that enhancing lysosomal GCase levels through enzyme replacement therapy represents a promising therapeutic strategy for the treatment of AD.\u003c/p\u003e","manuscriptTitle":"Taliglucerase Alfa Modulates Aβ Load and Autophagy-Related Pathways in Mouse Hippocampal Neurons Exposed to oAβ1-42","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-04 11:07:52","doi":"10.21203/rs.3.rs-7094261/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"10089b94-4101-4c40-9bbf-0431838b28d9","owner":[],"postedDate":"August 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-08-14T15:08:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-04 11:07:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7094261","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7094261","identity":"rs-7094261","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}