The novel target, mechanism and agonist of α-Ketoglutaric acid in delaying mesenchymal stem cell senescence

The novel target, mechanism and agonist of α-Ketoglutaric acid in delaying mesenchymal stem cell senescence | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The novel target, mechanism and agonist of α-Ketoglutaric acid in delaying mesenchymal stem cell senescence Peng Chen, Zhao Cui, Caifeng Li, Shiwen Deng, Wei Liu, Jiameng Li, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5000966/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract α-Ketoglutaric acid (aKG) participates in the tricarboxylic acid cycle in the process of cell aerobic metabolism and is of significant physiological importance. Although aKG is genetically associated with human longevity and decreased fertility, its anti-aging mechanism remain largely unknown. Here, we used interdisciplinary techniques such as metabolomics, chemical biology, and organoid microfluidic devices to explore the regulatory effect of aKG on senescence in a mesenchymal stem cell (MSC) model. We found that the expression of isocitrate dehydrogenase 1 (IDH1) in MSCs decreased after senescence, leading to reduced production of the active product aKG. Increasing intracellular aKG by supplementation with exogenous aKG or overexpression of IDH1 can promote MSC proliferation and delay MSC senescence, while inhibiting aKG production by knocking down IDH1 can induce premature MSC senescence. Specifically, aKG facilitates the interaction of ribosomal protein S23 (RPS23) with 2-oxoglutarate and Fe(II)-dependent oxygenase domain containing protein 1 (OGFOD1), and subsequently enhancing the hydroxylation of RPS23. This modulation of the RPS23–OGFOD1 complex contributes to the augmentation of protein translational fidelity. Finally, we attempted to activate IDH1 as a new anti-aging strategy. IDH1 is activated by the natural active molecule scutellarin (Scu), which not only increases the production of aKG but also delays the senescence of MSCs and ameliorates the aging phenotype of aged mouse. In summary, our study elucidates the effect of aKG on protein translation accuracy during MSC senescence and provides a potential therapeutic target for the treatment of aging-related diseases. Biological sciences/Chemical biology/Target identification Biological sciences/Biochemistry/Proteomics Health sciences/Diseases/Metabolic disorders α-ketoglutaric acid mesenchymal stem cells senescence RPS23 protein homeostasis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 INTRODUCTION α-Ketoglutarate acid (aKG), which is involved in a variety of metabolic and cellular pathways, acts as an antioxidant, interferes with nitrogen and ammonia balance, and affects epigenetics and immune regulation 1 . aKG has been reported to slow the aging process and is considered a safe supplement with the potential to prolong health and even reduce morbidity 2 – 5 . Isocitrate dehydrogenase 1 (IDH1), a key enzyme involved in aKG production, plays important roles in biological processes such as cellular metabolism, redox status, epigenetic regulation and DNA repair 6 . IDH1 is associated with human age-related diseases, and IDH1 expression decreases with age in a variety of tissues, including human ovarian cells and Caenorhabditis elegans 7 , 8 . Although indirect evidence from various studies suggests that the IDH1-aKG signaling axis may play an important role in aging, its potential molecular mechanism and anti-aging targets are unclear. Aging is characterized by a decline in the physiological function of organs and is the primary risk factor for various chronic diseases 9 . With self-renewal ability and differentiation potential, stem cells are essential for maintaining tissue and organ structure and function, as well as facilitating injury repair 10 – 12 . Stem cell senescence is considered to be an important feature and driving force of body aging. Exploring strategies to increase the number of stem cells in the body to delay aging is also a major focus of research. An imbalance in protein homeostasis is a common problem in the process of senescence 13 . Defective mechanisms or mutations lead to a decrease in translation accuracy, potentially resulting in the synthesis of malformed proteins. This can lead to dysfunctional protein formation and the accumulation of toxic protein aggregates 14 . Recent studies have suggested that extending lifespan by inhibiting TOR (a target of rapamycin) is linked to the enhancement of translation fidelity 15 , 16 . In addition, studies have been performed to improve translation fidelity and improve the health and lifespan of yeast, worms and flies by mutating a single amino acid of ribosomal protein S23 (RPS23) 16 . This finding also proves the direct relationship between the reduction in translation errors and the prolongation of life expectancy. As an important cofactor of proline hydroxylase, aKG plays an important role in the hydroxylation of the RPS23 protein, which has attracted our attention 17 , 18 . We investigated the potential role of IDH1 and aKG in regulating protein homeostasis during cellular senescence. In this study, we found that aKG is a metabolic marker of senescence in MSCs. Three methods, namely, exogenous aKG supplementation, the overexpression of IDH1, and the activation of IDH1 to increase intracellular aKG levels, were shown to delay MSC senescence. Furthermore, we demonstrated that aKG promotes the hydroxylation of RPS23 and the interaction of OGFOD1 with RPS23 to improve the accuracy of protein translation. Finally, we successfully delayed the senescence of pathological or physiological MSCs and ameliorated the aging phenotypes of aging mice using a small molecule agonist of IDH1. Overall, our study identified the mechanisms by which aKG delays the senescence of MSCs by targeting RPS23 to maintain protein homeostasis. These findings pave the way for identifying novel interventions to enhance translation accuracy, thereby potentially improving cellular and individual aging processes. MATERIALS AND METHODS Cell lines and mice Human SHED cells (P2) were obtained from Saliai Stem Cell Science and Technology Co., Ltd. (Guangzhou, China). Human ADSC cells (P2) and human USC cells (P2) were obtained from Cyagen Biosciences (Guangzhou, China). IPSCs were obtained from MEGAROBO Technology Co., Ltd. (Beijing, China). CaCO2 cells were preserved by cryopreservation in our laboratory. MSCs were cultured in OptiVitro® MSC Expansion Medium XF (ExCell Bio, Suzhou, China), IPSCs were cultured in PSCeasy hESC/hiPS Medium (CELLAPY, Beijing, China), and CaCO2 cells were cultured in DMEM (XP Biomed, Shanghai, China). All cells were routinely maintained at 37°C in humidified air containing 5% CO 2 . The culture medium was replaced every 3 days; when the confluence of the cells reached 80%-90%, the cells were washed with PBS (Coolaber, Beijing, China) and passaged through 0.25% trypsin-EDTA (Biosharp, Hefei, China) digestion. Male BALB/c mice (12 months old) were obtained from SiPeiFu Biotech (Beijing, China). The mice were kept in the absence of specific pathogens, had a 12-hour light/dark cycle and were raised to 20 months of age. Mice were randomly divided into two groups, and the weights of the mice were evenly distributed among the groups. Then, the mice received an intraperitoneal injection of 30 mg/kg/day Scu or 0.9% saline solution daily for 80 days. All care and treatment of the experimental animals were in strict accordance with the guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care approved by the Institutional Animal Care and Use Committee of the Chinese Materia Medica China Academy of Chinese Medical Sciences (license no. ERCCACMS21-2203-02). Compound preparation, cell viability assay, and cell colony formation AKG (Sigma, Louis, USA) and DM-aKG (Sigma, Louis, USA) were dissolved in pure water as stock solutions at 100 mM and stored at -20°C. Scu (Nature Standard, Shanghai, China) was dissolved in dimethyl sulfoxide (DMSO) (Sigma, Louis, USA) as a 100 mM stock solution and stored at -20°C. aKG, DM-aKG, and Scu stock solutions were freshly diluted with medium to their final concentrations before each in vitro experiment. The final DMSO concentration did not exceed 0.1%. Cells were plated in 96-well plates and treated with the indicated compounds. After 48 hours of incubation, the cells were incubated with CCK-8 reagent (MedChemExpress, Shanghai, China) for another 2 hours. Then, the absorbance at 450 nm was determined spectrophotometrically on a Synergy2 multimode microplate reader (BioTek, Winooski, USA). Cell viability is expressed as a percentage relative to that of the control group after subtraction of the background signal. For the cell colony formation assay, MSCs were seeded in 6-well plates, treated with the indicated compounds, and stained with crystal violet solution. SA-β-gal staining SA-β-gal staining was used to detect cell senescence. According to the instructions of the β-gal staining kit (Solarbio, Beijing, China), the cells were washed with PBS twice, fixed for 15 min, and incubated overnight at 37°C. Images were taken randomly, and the SA-β-gal-positive cells were counted. Detection of aKG For the cell samples, the cells were resuspended in PBS, ultrasonically disrupted on ice, and then centrifuged at 8000 × g for 10 min at 4°C. For tissue samples, fresh tissue was homogenized in PBS on ice and then centrifuged at 8000 × g for 10 min at 4°C. All the supernatant was removed and placed on ice for testing. Serum samples can be used directly for testing. The aKG concentration was assessed using a human α-ketoglutaric acid (aKG) ELISA kit (Bohu, Shanghai, China) according to the manufacturer's instructions. Western blotting Whole-cell lysates were prepared using RIPA lysis buffer (Epizyme, Shanghai, China) supplemented with complete protease inhibitor cocktail (Beyotime, Shanghai, China), homogenized and centrifuged at 12000 × g for 10 min at 4°C. The protein concentration of the cell lysates was determined by BCA protein assay reagent (Solarbio, Beijing, China). The cell lysates were incubated in SDS‒PAGE sample loading buffer at 95°C for 10 min, separated by 8%-12% SDS‒PAGE, and transferred to PVDF membranes (Millipore, Billerica, USA). The membranes were blocked with 5% skim milk at 25°C for 30 min and then incubated with primary antibodies against IDH1 (1:3000, #12332-1-AP, Proteintech), IDH2 (1:1000, #A7190, ABclonal), IDH3A (1:1000, #A14650, ABclonal), IDH3B (1:1000, #A13742, ABclonal), GLS (1:1000, #A11043, ABclonal), Glud1 (1:1000, #A7631, ABclonal), Glud2 (1:1000, #A6604, ABclonal), p16 (1:1000, #A11651, ABclonal), p21 (1:1000, #A1483, ABclonal), HIF1a (1:1000, #A6265, ABclonal), Hydroxy-HIF-1α (1:1000, #D43B5, Cell Signaling Technology), RPS23 (1:1000, #BF8511, AFfirm), OGFOD1 (1:1000, #A16543, ABclonal), hydroxyproline (1:1000, #bs-10389R, Bioss), GAPDH (1:20000, #A19056, ABclonal), or β-tubulin (1:1000, #AC105, ABclonal) overnight at 4°C. Subsequently, the membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse IgG secondary antibodies (Beyotime, Shanghai, China) for 1 hour at room temperature. SuperKine™ hypersensitive ECL luminescent solution (Abbkine, Wuhan, China) was used for the detection of the proteins of interest. The membranes were analyzed by an SH-520 Gel Imaging Analysis System (Shenhua Bio, Shanghai, China) and quantified by ImageJ software. Immunofluorescence (IF) Assay The cells were seeded onto glass coverslips (Biosharp, Hefei, China), treated with the indicated compounds for 48 hours, and fixed in 4% paraformaldehyde for 5 min. After being washed with PBS three times, the cells were permeabilized with 0.2% Triton X-100 for 3 min, blocked with 5% BSA for 60 min at room temperature, and probed with primary antibodies against Ki67 (1:300, #A21861, ABclonal), γH2AX (1:300, #AP0099, ABclonal), RPS23 (1:200, #BF8511, AFfirm), and OGFOD1 (1:200, #A16543, ABclonal) for 60 min at room temperature. Then, the cells were exposed to Alexa Fluor 594-labeled (red) anti-rabbit or FITC-labeled (green) anti-rabbit secondary antibodies (Bioss, Beijing, China) and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Beyotime, Shanghai, China). Image acquisition was achieved using an EVOS M7000 intelligent imaging system (Thermo Fisher Scientific, Lafayette, USA) and a STEDYCON (Abberior, Gottingen, Germany) attached to a Olympus BX53 (Olympus, Tokyo, Japan). TCA-targeted metabolic flux analysis After the cells completely adhered to the wall, the old medium was discarded, and the adherent cells were gently washed twice with PBS. Then, the PBS was discarded, and the prepared D-glucose- 13 C 6 (Macklin, Shanghai, China)-labeled medium was added to the Petri dish to continue culture. The cells were collected after 24 hours of culture. Metabolites were extracted from cells using acetonitrile: water (1:1) and derived with 3-nitrophenylhydrazine. The metabolites were analyzed by a Jasper HPLC-Sciex 4500 MD. The chromatographic conditions were as follows: Phenomenex Kinetex C18 chromatographic column (100 × 2.1 mm, 2.6 µm). Mobile phase A was 0.1% formic acid in water, and mobile phase B was 0.1% formic acid in acetonitrile. TPP After centrifugation at 12000 × g for 10 min at 4°C, low-generation and high-generation ADSC cells were mixed at a 1:1 ratio and then lysed in PBS supplemented with 1% EDTA-free cocktail to obtain soluble proteins. The supernatant was divided into three equal parts, two of which were treated with 5 µM aKG and 40 µM aKG (dissolved in pure water), and the other was treated separately with the same amount of pure water as the vehicle. The protein extract was incubated for 30 min with aKG or pure water at room temperature, heated for 4 min at 52 ℃, and then cooled for 3 min at room temperature. The heated pyrolysis products were centrifuged at 20000 × g for 20 min at 4°C to separate soluble proteins from precipitated proteins. The collected supernatant was divided into two parts: one was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS‒PAGE) to quantify the protein band strength, and the other was analyzed by TMT-based quantitative proteomics. CETSA For the validation of RPS23 based on western blotting analysis by TPP, two portions of ADSC cell lysates incubated with DMSO or 100 µM aKG were divided into eight aliquots. All aliquots were heated individually at different temperatures for 4 min. After cooling on ice for 3 min, the soluble fraction was obtained by centrifugation as described above and used for western blotting. SIP A solvent-induced protein precipitation assay was conducted as described previously 19 . The two portions of ADSC cell lysate incubated with DMSO or 100 µM aKG were divided into seven aliquots. Denaturation is initiated by the addition of an acetone/ethanol/acetic acid (A.E.A.) mixture of organic solvents. When the ratio of organic solvent was 50:50:0.1, the final organic solvent ratio ranged from 9–16%. After equilibrating at 37°C for 20 min, the soluble fraction was obtained by centrifugation as described above and used for western blotting. Quantitative RT‒PCR Total RNA was isolated using a total RNA extraction kit (Bioss, Beijing, China). RNA was reverse-transcribed to complementary DNA (cDNA) with ABScript III Reverse Transcriptase (ABclonal, Wuhan, China). Quantitative real-time reverse transcription polymerase chain reaction (RT‒PCR) was performed using Universal Blue qPCR SYBR Green Master Mix (Yeasen, Shanghai, China). The 20 µL reaction mixture contained 400 nM primers, 10 µL of qPCR SYBR Green Master Mix, 2 µL of template cDNA, and nuclease-free water. cDNA amplification was conducted via QuantStudio™ 7 Flex quantitative real-time PCR (Applied Biosystems, Foster City, USA) following the manufacturer’s instructions. GAPDH was used as an internal control. IDH1 activity assay To detect the direct effect of Scu on the IDH1 protein in MSCs, IDH1 antibody plates were generated by coating IDH1 antibody (Proteintech, Wuhan, China) onto 96-well plates (100 ng/well) overnight at 4°C. ADSC lysates were added to IDH1 antibody plates, incubated at room temperature for 2 hours, and then washed with PBS to remove unbound protein to obtain IDH1 protein plates. After incubation for 1 h with varying concentrations of Scu in IDH1 protein plates, three washes with PBS were performed, and the relative IDH1 activity was detected with a Cytoplasmic Isocitrate Dehydrogenase (ICDHc) Activity Detection Kit (Solarbio, Beijing, China) according to the manufacturer's instructions. Differential scanning fluorimetry (DSF) A total of 10 µL of RPS23 recombinant protein (0.2 µg) was mixed with 2 µL of aKG (100 µM) or 2 µL of PBS in a reaction mixture containing 5 µL of protein thermal shift buffer and 2.5 µL of protein thermal shift dye (Thermo, Foster City, USA). The prepared reaction mixture was transferred to a 0.1 mL multistrip PCR tube. DSF was performed using QuantStudio™ 7 Flex quantitative real-time PCR (Applied Biosystems, Foster City, USA), and each melting curve was programmed as follows: 25°C for 2 min, followed by a 1°C increase per min from 25°C to 95°C and finally 95°C for 2 min. Generation and characterization of MSCs with Gene Knockdown and Overexpression The three highest-scoring shRNA sequences targeting human IDH1 were designed and synthesized by using the pLV-U6-SHRNA-CMV-EGFP(T2A)-PURO vector (Scilia, Beijing, China). The human IDH1 gene expression lentiviral vector was designed and synthesized by using the pLV[Exp]-mCherry:T2A:Bsd-EF1A > FLAG/hIDH1 vector (VectorBuilder, Guangzhou, China). The shRNA sequences targeting human OGFOD1 were designed and synthesized by using the pRP[shRNA]-Bsd-U6 > hOGFOD1 vector (VectorBuilder, Guangzhou, China). The IPTG-inducible shRNA sequences targeting human OGFOD1 were designed and synthesized by using the pLV[shRNA]-LacI:T2A:Bsd-U6/2xLacO > hOGFOD1 vector (VectorBuilder, Guangzhou, China). Empty vectors were used as negative controls. A Lentiviral Packaging Kit (Biorigin, Beijing, China) was used for lentiviral packaging according to the manufacturer’s protocols. The cells were then infected with lentivirus concentrate for 24 hours and cultured in MSCs expansion medium. After 72 hours, puromycin or blasticidin was used to select gene knockdown and overexpression cell lines, respectively. Flow cytometry CD73 (1:50, #bs-4834R-APC, Bioss), CD90 (1:100, #16897-MM10-P, SinoBiological) and CD105 (1:100, #10149-MM13-PE, SinoBiological) as positive markers and CD34 (1:100, #68035-XM01-F, SinoBiological), CD45 (1:50, #10086-MM05-F, SinoBiological) and CD116 (1:100, #A23355, ABclonal) as negative markers, which were used to characterize MSCs by a Beckman Coulter CytoFLEX (Beckman Coulter, California, USA). Osteogenic and adipogenic Following the manufacturer's instructions, a human-related stem cell osteogenic differentiation kit (Cyagen, Suzhou, China) and a human-related stem cell adipogenic differentiation kit (Cyagen, Suzhou, China) were used to induce the osteogenic and adipogenic differentiation of MSCs, respectively. After 25 days of osteogenesis and lipogenesis, calcium nodules and lipid droplets were observed and photographed under a microscope after staining with Alizarin Red S (Cyagen, Suzhou, China) and Oil Red O (Cyagen, Suzhou, China). BLI analysis The binding affinities of the compounds for recombinant RPS23 were determined by a biolayer interferometry assay using Gator Plus (Gator Bio, California, USA). The recombinant RPS23 protein was labeled with a 2-fold molar amount of biotin reagent, and unbound biotin was removed by ultrafiltration. The SMAP biosensor probe (Gator Bio, California, USA) was prewetted with kinetic buffer (PBS, 0.05% BSA, 0.01% Tween 20), and then biotin-labeled recombinant protein was loaded onto the equilibrated SMAP biosensor probe. A group of probes incubated in protein-free buffer was used as a control. All the data were analyzed by GatorBio data analysis software, and the equilibrium dissociation constant (K d ) was calculated according to the ratio of K off to K on . Immunoprecipitation Whole-cell lysates were prepared using RIPA lysis buffer (Epizyme, Shanghai, China) supplemented with complete protease inhibitor cocktail (Selleck, Houston, USA) and incubated with 40 µL of Protein G Magnetic Beads (Yeasen, Shanghai, China) bound to the corresponding antibodies at 4°C overnight. After washing with PBS three times, the immunoprecipitate was analyzed by Western blotting. Translation fidelity dual luciferase assays for use in MSCs To measure translation fidelity in MSCs, we used a previously published double luciferase p2luci plasmid 20 . Insert GCAGGAACACAATAGCAATTACAGA as an STOP reference at the polylinker for the insertion window position between Renilla Luc and firefly Luc and insert GCAGGAACACAACAGCAATTACAGA as a no-STOP reference at the polylinker for the insertion window position between Renilla Luc and firefly Luc. These translation fidelity reports were cloned and inserted into the modified pLV-EF1A vector (VectorBuilder, Guangzhou, China). The percentage of stop codon readthrough was calculated by dividing the Firefly/Renilla ratio of the stop codon readthrough or miscombination report by the average Firefly/Renilla of the control report, as in previously published literature 16 . Protein expression and purification RPS23 (residues 1 to 143) was cloned and inserted into the NdeI/Xho I sites of the pET-28a + vector. The recombinant plasmids were transformed into E. coli BL21 (DE3) cells (Vazyme, Nanjing, China), cultured in 300 mL of Luria–Bertani (LB) medium at 37°C until the absorbance at OD 600 reached 0.4–0.6, after which the cells were induced with 0.4 mmol/L isopropyl-D-thiogalactopyranoside (IPTG) for 6 h at 16°C. To obtain the nondenatured protein, cell debris was removed by centrifugation, and the supernatant was loaded onto preequilibrated Ni-NTA resin (Beyotime, Shanghai, China). Proteins were eluted using 200 mM imidazole. Then, the imidazole solution was replaced with a PBS solution by ultrafiltration. Finally, the protein concentration was measured using a BCA kit (Solarbio, Beijing, China), and the final protein was concentrated to 10 mg/ml and stored at 4°C. Microfluidic device fabrication Microfluidic devices were designed and calibrated using polydimethylsiloxane (PDMS) materials (Wenhao, Suzhou, China) to construct liver organoids and intestinal barriers according to previous studies. The intestinal barrier was formed via in situ culture, and liver organoids were added after the induction of maturation. CaCO 2 cells were seeded in transwell plates (Corning, NY, USA) and cultured continuously for 14 days to form the intestinal barrier. IPSC-derived liver organoid induction methods were described in previous articles 21 . Quality control of the intestinal barrier and liver organoids was performed. Crystal violet (0.1%) and 100 µM 2-NBDG probe staining were used to test the integrity of the barrier. The expression of the markers CYP3A4 (1:100, 67110-1-Ig, Proteintech), ALB (1:100, 16475-1-AP, Proteintech), AFP (1:100, 14550-1-AP, Proteintech) and FOXA2 (1:100, 22474-1-AP, Proteintech) in liver organoids was tested using immunofluorescence. Liquid chromatography was used to detect the concentration differences of Scu under different metabolic modes in the culture media. After 24 hours of cyclic cultivation in the entire device, the levels of aging biomarkers of mesenchymal stem cells were detected by immunofluorescence. JC-1 assay All cells were stained using a JC-1 staining kit (Beyotime) following the manufacturer’s instructions. After staining, the cells were immediately examined using an EVOS M7000 intelligent imaging system (Thermo Fisher Scientific). Micro-CT analysis Mouse femurs were removed and placed in PBS at room temperature for testing. The distal femurs were scanned with a Micro-CT image system (SkyScan 1276, Bruker, Germany). A voltage of 60 kV, current of 200 µA, scanning resolution of 6.5 µm and visual field size of 2016*1344 were used to scan the femurs of the mice. Using the lowest end of the growth plate of the knee joint of the femur as the baseline, the bone marrow cavity region with a thickness of 1 mm was selected as the region of interest for three-dimensional reconstruction (ROI). The three-dimensional image was reconstructed with NRecon software and analyzed by DataViewer, CTan and CTvox software. Behavioral studies All behavioral testing procedures included the Y maze and Morris water maze, according to the methods previously described by Li et al. 22 . Luminex Mouse serum multiplex cytokines were detected according to the instructions of the Bio-Plex Pro Human Cytokine Screening Panel, 48 Plex Kit (Bio-Rad, California, USA). Briefly, magnetic beads were added to a 96-well plate and washed with wash buffer. Mouse serum was then added to the 96-well plate with magnetic beads and incubated for 30 min at room temperature. After washing, antibodies were added, and the plates were incubated for 30 min. After washing, streptavidin PE was added, the plates were incubated for 10 min after shaking, the plates were washed, the detection solution was added, and the proteins were measured on a Bio Plex 200 system (Bio-Rad, California, USA). The lower limit of each sample for each cytokine was 50 beads. A standard curve was prepared according to the dilution standard concentration in the instructions, and the detection data were converted to pg/mL concentrations. Quantification and statistical analysis The Grubbs test or ROUT test was used to exclude outliers from the experimental data 23 . SPSS and GraphPad Prism software were used for statistical analysis. All the data were tested for normality using the Kolmogorov‒Smirnov test or Shapiro‒Wilk test. Normally distributed data are expressed as the mean ± s.e.m., and nonnormally distributed data are expressed as the mean. The values and interquartile ranges are expressed, and the statistical analysis methods were as follows: (1) Two groups: if the data were normally distributed and consistent with homogeneity of variance, the independent sample t test was used; otherwise, the Wilcoxon signed rank test was used. (2) Paired samples: If the data were normally distributed, the paired samples t test was used; otherwise, the Wilcoxon signed rank test was used; (3) Three or more groups: if the data were normally distributed and conformed to the homogeneity of variances, then one-way analysis of variance was performed, followed by Tukey's test for multiple comparisons; otherwise, the Kruskal‒Wallis H test followed by Bonferroni correction was used for multiple comparisons. (4) Correlation analysis: If the data were normally distributed, Pearson correlation analysis was used; otherwise, Spearman correlation analysis was used. The correlation coefficient is recorded as "r", and "n=" represents the number of biological repetitions used in this study. p < 0.05 was considered to indicate statistical significance. RESULTS aKG can enhance the proliferation of MSCs and delay cell senescence As a catalytic product of IDH1, aKG is considered a central metabolic substance that regulates aging 8 . TCA is a hub for integrating metabolism and signaling in the senescence network, and aKG is a tricarboxylic acid cycle (TCA) intermediate. Therefore, we used glucose- 13 C to detect the production of TCA-related metabolic small molecules in MSCs (Fig. 1 a). Compared to those in lower-generation MSCs, the production of citrate, aconitate, aKG, fumarate, malate, and acetyl-CoA decreased significantly in higher-generation MSCs (Fig. 1 b, c). Then, we used cell proliferation assay to evaluate the effect of these small molecule metabolites on MSCs and found that only aKG significantly promoted the proliferation of MSCs (Fig. 1 d-f). Dimethyl α-ketoglutarate (DM-aKG) is a cell-permeable derivative of aKG that also significantly improves MSC proliferation (Fig. 1 d-f). Then, we examined aKG levels in MSCs subjected to physiological senescence and D-galactose (D-Gal)-induced pathological replication (Fig. 2 a, b and Fig S1 a, b). Compared with young MSCs, aKG levels were significantly lower in all three types of MSCs subjected to pathological and physiological senescence (Fig. 2 c and Fig S1 c). Next, we investigated whether supplementation with aKG may have geroprotective effects on human MSCs. Our investigations revealed that the administration of both aKG and its dimethyl ester DM-aKG resulted in elevated intracellular concentrations of aKG, with DM-aKG demonstrating efficacy at substantially lower dosages relative to aKG (Fig. 2 c). Subsequently, to elucidate the influence of aKG on the senescence of MSCs, we proceeded to evaluate the effects of DM-aKG supplementation. Our study shown that cell proliferation was greater in the group supplemented with DM-aKG than in the control group, as indicated by growth curve analysis, a clonal expansion assay, and the percentage of Ki67 + cells (Fig. 2 d-f). Similarly, we observed that DM-aKG delayed cellular senescence in human MSCs, as evidenced by decreased numbers of senescence-associated β-galactosidase (SA-β-Gal)-positive cells, decreased expression of DNA damage-related γH2AX proteins, decreased expression of the senescence markers p16, p21, IL6 and IL8, and increased expression of LMNB1 (Fig. 2 g-k). Overall, our study revealed that aKG is a potential metabolic marker of MSC senescence and that a reduction in aKG production may be one of the factors driving MSC senescence. aKG directly binds to RPS23 and regulates RPS23 hydroxylation To investigate the molecular mechanism by which aKG delays MSCs senescence, we employed an unbiased biochemical method known as the thermal proteome profiling-cellular context thermal shift (TPP) assay 24 . Given our hypothesis that the key targets of aKG may be conserved and universally expressed, we used human adipose mesenchymal stem cells (ADSCs) as the protein source for TPP (Fig. 3 a). The detectable proteins in the soluble fraction of the cell lysate were quantified by mass spectrometry (Fig S2 a and Fig. 3 b). Enrichment analysis revealed a strong correlation between aKG targets and ribosomal function (Fig S2 b). Further screening experiments identified RPS23 as the main target protein of aKG, as confirmed by differential scanning fluorimetry (DSF), cellular thermal shift assay (CETSA) and solvent-induced protein precipitation (SIP) experiments (Fig. 3 c-g). Next, biolayer interferometry (BLI) analysis showed that aKG specifically bound to RPS23 with a dissociation constant (K d ) of 6.16 µM (Fig. 3 h). Previous studies have shown that OGFOD1 catalyzes the prolyl hydroxylation of RPS23 in eukaryotes and that aKG is an important cofactor in this process (Fig. 3 i) 18 . Therefore, we first examined changes in OGFOD1 and RPS23 protein levels and RPS23 protein hydroxylation in senescent MSCs. Our study found that there were no significant changes in OGFOD1 and RPS23 protein expression levels in senescent MSCs compared to young MSCs, whereas RPS23 protein hydroxylation was significantly reduced (Fig. 3 j). Interestingly, DM-aKG supplementation increased RPS23 hydroxylation in senescent MSCs (Fig. 3 k). Next, we indirectly assessed the effect of aKG on RPS23 hydroxylation by detecting the formation of the OGFOD1‒RPS23 complex. Similarly, our study found that RPS23 and OGFOD1 co-localization signal levels were reduced in senescent MSCs compared to young MSCs, and DM-aKG supplementation increased RPS23 and OGFOD1 co-localization signal levels (Fig. 3 l). Finally, we probed anti-OGFOD1 immunoprecipitates with an antibody against RPS23 and anti-RPS23 immunoprecipitates with an antibody against OGFOD1. These experiments revealed similar results, with RPS23 migrating at 16 kDa, OGFOD1 at 63 kDa, and the presence of an 80-kDa OGFOD1‒RPS23 complex (Fig. 3 m, n). In conclusion, our study revealed a direct interaction between aKG and RPS23, and supplementation with aKG can enhance the hydroxylation of RPS23, and increase the formation of OGFOD1‒RPS23 complexes. Increased aKG production induced by the overexpression of IDH1 delays MSC senescence As aKG supplementation can significantly improve the proliferative activity of MSCs, we screened proteins in the TCA cycle that can produce aKG (Fig S3). With increasing generations of MSCs, the senescence markers p16 and p21 were significantly increased, but only IDH1 expression was significantly decreased in the proteins related to aKG production (Fig. 4 a). Thus, the decrease in the aKG level may be related to the decreased expression of IDH1. To explore the potential of delaying MSC senescence by manipulating IDH1 expression levels through knockdown and overexpression. We overexpressed IDH1 in low-passage MSCs and detected the senescence phenotype during continuous culture (Fig. 4 b). Both IDH1-overexpressing (OE_IDH1) MSCs and OE_CON MSCs were positive for mesenchymal progenitor markers, including CD73, CD90, and CD105 (Fig. 4 c), and negative for non-MSC markers, such as CD34, CD45, and CD116 (Fig S4a, b). As expected, the level of aKG increased significantly in OE_IDH1 MSCs (Fig. 4 d). Interestingly, the senescence characteristics of OE_CON MSCs were more distinct than those of OE_IDH1 MSCs. Specifically, compared with OE_CON MSCs, fewer OE_IDH1 MSCs were SA-β-Gal-positive (Fig. 4 e). OE_IDH1 MSCs also exhibited an increase in cell proliferation, a greater percentage of Ki67-positive cells (Fig. 4 f, g), decreased expression of cell senescence markers, including p16, p21, IL6 and IL8, and increased LMNB1 (Fig. 4 h, i). In addition, overexpression of IDH1 did not affect OGFOD1 protein and RPS23 levels, but significantly increased RPS23 protein hydroxylation (Fig. 4 i), suggesting that overexpression of IDH1 promotes RPS23 protein hydroxylation by increasing aKG levels. We finally compared the multipotent differentiation potential of OE_IDH1 and OE_CON MSCs. Both OE_IDH1 and OE_CON MSCs differentiated into white adipocytes and osteoblasts with comparable efficiency (Fig S4c-f). Next, we studied whether IDH1 is necessary for maintaining long-term intracellular homeostasis of MSCs. In contrast to IDH1 overexpression, aKG decreased significantly after IDH1 knockdown in MSCs (Fig. 5 a). Similarly, knockdown of IDH1 (Sh_IDH1) in MSCs resulted in premature senescence, including progressive impairment of cell proliferation (Fig. 5 b), increased numbers of SA-β-Gal + cells (Fig. 5 c), decreased numbers of Ki67 + cells (Fig. 5 d), and increased expression of the DNA damage marker γH2AX (Fig. 5 e). In addition, compared to those in Sh_CON MSCs, the expression of the senescence markers p16, p21, IL6 and IL8 was upregulated, while the expression of LMNB1 was downregulated in Sh_IDH1 MSCs (Fig. 5 f-h). Importantly, we increased the aKG level in Sh_IDH1 MSCs by supplementing exogenous aKG and found that supplementing DM-aKG partially reversed the premature senescence induced by IDH1 knockdown in MSCs (Fig. 5 b-h). In addition, our study found that knockdown of IDH1 did not affect the expression levels of OGFOD1 and RPS23 proteins, but significantly inhibited the hydroxylation of PRS23 protein, while exogenous aKG supplementation could restore the hydroxylation level of RPS23 protein to some extent (Fig. 5 g-h). In summary, these results confirm that IDH1 functions as a geroprotector for MSCs and that the reduction in aKG resulting from decreased IDH1 expression leads to MSC senescence. aKG ensures translation accuracy in MSCs via the hydroxylation of RPS23 Mutations in RPS23 have been associated with the modulation of translation accuracy 25 , 26 . Additionally, hydroxylation of RPS23 (HO-RPS23) affects ribosome translation accuracy in eukaryotes 18 . To investigate this further, we adapted our in vivo reporters to detect common translation errors and stop codon readthroughs in ADSCs (Fig. 6 a). First, we validated our reporting system with the drug paromomycin, which causes translation errors. We observed a dose-dependent increase in translational error (Fig. 6 b and Fig S5). We also found a significant increase in stop codon readthrough in physiologically senescent ADSCs compared to young ADSCs (Fig. 6 c, d). Importantly, aKG and its analog DM-aKG improved translational fidelity and decreased stop codon readthrough in senescent ADSCs (Fig. 6 c, d). Furthermore, the decrease in stop codon readthrough induced by aKG and DM-aKG was inhibited by the Fe(II) chelator 2,2-dipyridyl (DIP) and the panhydroxylase inhibitor dimethyloxalylglycine (DMOG) (Fig. 6 c, d and Fig S5). Next, we investigated the effect of IDH1 knockdown and overexpression on stop codon readthrough in ADSC cells. Overexpressing IDH1 in physiologically senescent ADSCs significantly reduced stop codon readthrough, and this effect was inhibited by DIP and DMOG (Fig. 6 e). Similarly, knocking down IDH1 in low-passage ADSCs increased stop codon readthrough, which was inhibited by aKG or DM-aKG (Fig. 6 f). To further demonstrate whether aKG regulates protein translation accuracy through RPS23 hydroxylation, we constructed IPTG induced OGFOD1 knockdown ADSCs (Sh_OGF#1) and conventional OGFOD1 knockdown ADSCs (Sh_OGF#2). Our study found that, with increasing IPTG induction time, decreased OGFOD1 protein expression resulted in decreased RPS23 protein hydroxylation, and RPS23 protein hydroxylation was significantly decreased in Sh_OGF#2 ADSCs (Fig. 6 g). This indicates that OGFOD1 plays an important role in the hydroxylation of RPS23 protein. Further, we found that the hydroxylation level of RPS23 protein decreased gradually with the extension of IPTG induction time, resulting in the increase stop codon readthrough of ADSCs (Fig. 6 h). At the same time, stop codon readthrough was significantly increased in Sh_OGF#2 ADSCs and could not be reduced by supplementation of aKG and DM-aKG (Fig. 6 i). Similarly, we found that DIP and DMOG also inhibited the promotion of ADSC proliferation by aKG or DM-aKG (Fig. 6 j, k). Importantly, after knocking down OGFOD1, the proliferation activity of ADSCs was significantly reduced, and the effects of aKG and DM-aKG on cell proliferation disappeared (Fig. 6 l). In conclusion, the above studies demonstrated that the IDH1-αKG-OH-RPS23 signaling axis regulates the accuracy of protein translation in MSCs. IDH1 small molecule agonists could maintain MSC proliferation and delay senescence Since activation of IDH1 can promote the production of aKG 27 , we subsequently explored anti-aging strategies by activating IDH1. In our previous study, we discovered that Scu, a naturally active molecule, can enhance IDH1 enzyme activity in HepG2 cells and stimulate aKG production 28 . As shown in Fig. 7 a, we measured aKG and NADPH levels in MSCs to evaluate the effect of Scu on IDH1 enzyme activity. Similarly, our study revealed that Scu restored aKG levels in physiologically aged MSCs, with an EC 50 of 14.47 µM (Fig. 7 b, c). Strikingly, our results indicated that Scu significantly increased the proliferation of MSCs (Fig. 7 d), and contributed to sustaining their proliferative capacity during long-term culture (Fig. 7 e). This was evidenced by an increase in colony formation rate and the number of Ki67 + cells, and the decrease in the expression of γH2AX (Fig S6). In addition, long-term supplementation with Scu significantly reduced the number of senescence-associated SA-β-Gal + cells (Fig. 7 f), decreased the expression of p16 and p21, and increased the hydroxylation of PRS23 (Fig. 7 g and Fig S6c). In addition, we utilized D-GAL to induce pathological senescence in MSCs to examine the effect of Scu on this process. Consistently, Scu increased aKG production in pathologically senescent MSCs (Fig S7a) and significantly ameliorated D-GAL-induced senescence (Fig S7b). Following D-GAL induction, MSCs exhibited a reduction in Ki67 + cell and colony proliferation; an increase in γH2AX expression; upregulation of p16, p21, IL6, and IL8; and downregulation of LMNB1 (Fig S7c-f). These results indicate that Scu significantly ameliorated both physiological senescence and pathological senescence induced by D-GAL in MSC cells. Similar to the effect of aKG, Scu significantly increased the interaction between RPS23 and OGFOD1 protein in ADSCs (Fig. 7 h, i). In physiological senescent ADSCs, Scu significantly inhibited stop codon readthrough (Fig. 7 j). Importantly, the effect of Scu on codon readthrough and proliferation activity of ADSCs could be eliminated by DMOG, DIP, and knockdown of OGFOD1 (Fig. 7 j-m). The above results show that by activating IDH1 to promote aKG production, Scu can promote RPS23 hydroxylation and delay the senescence of MSCs. Overall, our study highlights the potential of Scu to improve MSCs proliferation and delay senescence by activating the IDH1-aKG-OH-RPS23 signaling axis. Simulating an IDH1 small molecule agonist improves the senescence phenotype in vivo using microfluidic devices Since there is currently a lack of animal models for evaluating MSCs, we constructed an intestinal barrier-liver organoid model that simulates the drug metabolism environment in vivo to evaluate the effects of drugs on MSCs after intestinal absorption and liver metabolism. A composite microfluidic device was constructed by incorporating transwell cells immersed in a flowing culture medium. These transwell cells consisted of an intestinal barrier, liver organoids, and mesenchymal stem cells, all positioned on the upper surface of the transwell chamber. Each transwell cell was fully submerged in maintenance medium, establishing stable internal circulation (Fig. 8 a). The intestinal barrier was formed via in situ culture, and liver organoids were added after the induction of maturation. After intestinal barrier formation, quality control was performed. Crystal violet staining and 2-NBDG probe staining revealed a compact cell layer without gaps (Fig. 8 b). Immunofluorescence of liver organoids induced by human induced pluripotent stem cells (iPSCs) clearly revealed the expression of liver biomarkers in the organoids (Fig. 8 c). We utilized this device to study the impact of 90 µg/mL Scu in circulating culture under different metabolic modes. The intestinal barrier and liver metabolism substantially increased the metabolism of Scu, resulting in a decrease in its concentration within the circulating culture medium (Fig. 8 d, e). Using this device, we further evaluated the ability of 90 µg/mL Scu to delay D-Gal-induced MSC senescence. Moreover, Scu improved the activity and senescence phenotype of D-Gal-induced senescent MSCs (Fig. 8 f), increased Ki67 expression in D-Gal-induced senescent cells, and reduced γH2AX expression in D-Gal-induced senescent MSCs (Fig. 8 g, h). Furthermore, staining with the mitochondrial membrane potential probe JC-1 indicated that Scu enhances membrane potential aggregation in MSCs (Fig. 8 i). In conclusion, we successfully constructed an intestinal barrier-liver organoid microfluidic device to simulate the in vivo environment and found that Scu also delayed MSC senescence in this system. IDH1 small molecule agonists improve the aging phenotype in aged mice Finally, we used 20-month-old mice to evaluate the effect of Scu on the aKG level, behavioral outcomes, bone status and senescence-associated secretory phenotype (SASP) in vivo (Fig. 9 a). After 80 days of Scu administration, we measured aKG levels in various tissues and observed a significant increase in aKG levels in the kidney, brain, skeletal muscle, serum, etc. (Fig. 9 b). In addition, we noted an increase in aKG levels in bone marrow hematopoietic stem cells from mice treated with Scu (Fig. 9 c). The Morris water maze test is widely utilized to assess cognitive decline, which is an important aging phenotype. Compared with the control group, the group treated with Scu showed improved learning and decreased escape latency during the 5-day training phase (Fig. 9 d-e). Moreover, during the probe trial test, in which the hidden platform was removed on day 6, the Scu-treated group spent significantly more time in the target quadrant (Fig. 9 f-g). The group treated with Scu also completed more entries into the platform location and needed less time to travel from the entry point to the target zone (Fig. 9 h-i). Furthermore, the Scu group also showed increased spontaneous alternations compared to the control group in the Y-maze test (Fig. 9 j-k). In addition, Scu improved the skin and bone status of aged mice, as evidenced by increased skin thickness, elevated bone volume fraction (BV/TV), enhanced trabecular bone number (Tb.N), increased bone mineral density (BMD), and decreased structural model index (SMI) (Fig. 9 l-q). Additionally, analysis of multiple serum factors revealed that Scu significantly reduced the SASP in aged mice. In conclusion, IDH1 small molecule agonists ameliorate the aging phenotype in aged mice to some extent, suggesting potential applications in aging-related conditions. DISCUSSION In this study, we found that reduced aKG production caused by decreased IDH1 levels drives premature senescence of human MSCs by increasing the misynthesis of proteins. We found that aKG decreased in both physiologically and pathologically senescent human MSCs, which was attributed to the reduced expression of IDH1. In addition, IDH1 knockdown accelerated the senescence of human MSCs, while exogenous supplementation with aKG and IDH1 overexpression delayed these processes. Mechanistic analysis revealed that IDH1 tightly regulates the production of aKG, and in turn, aKG maintains the translation of proteins by promoting the hydroxylation of RPS23. Therefore, low levels of IDH1 lead to insufficient aKG production, decreased RPS23 hydroxylation, reduced protein translation accuracy, and accelerated cell senescence. We found that in the context of IDH1 overexpression, supplementation with aKG and IDH1 small molecule agonists could maintain the proliferation of MSCs and delay their senescence. In summary, our work unveiled the previously unrecognized role of IDH1 in regulating protein translation and cell senescence. This discovery deepens our understanding of how the accurate translation of proteins can govern the homeostasis of human MSCs. IDH1 has been extensively investigated in various biological settings. For example, IDH1 acts as a cytoplasmic enzyme that catalyzes the reversible transformation of isocitrate and aKG. Some studies have shown that IDH1, an antioxidant gene, can protect granulosa cells from aging-related oxidative stress in humans and monkeys 7 . In addition to its enzyme activity, studies have shown that IDH1 functions as an RNA-binding protein that is directly involved in fine-tuning the initiation of transcript translation. Additionally, IDH1 is implicated in various cellular processes, including chromatin structure and transcriptional regulation, cell cycle regulation, and RNA processing 29 , 30 . However, little is known about the role of IDH1 in regulating human stem cell homeostasis. IDH1 is essential for maintaining homeostasis in human MSCs, consistent with the observed tolerance of pluripotent stem cells to cellular defects 31 . Previous studies have reported various effects of aKG, the primary catalytic product of IDH1. For example, aKG is implicated in gene transcriptional regulation and cell cycle control 32 . A decrease in the aKG level caused by IDH1 depletion leads to cell arrest in the G1 phase, while aKG supplementation promotes cell cycle progression 32 . In addition, intracellular aKG has been reported to maintain the pluripotency of embryonic stem cells 33 . The self-renewal of embryonic stem cells is directly supported by the increase in cell permeability aKG in vitro 33 . However, little is known about the role of aKG in regulating the senescence of human MSCs. Consistent with previous studies, our study revealed that decreased expression of IDH1 is a primary cause of decreased aKG levels in senescent MSCs and that supplementation with aKG in IDH1-knockdown MSCs can partially reverse the senescence phenotype. Additionally, long-term supplementation with aKG during MSC proliferation maintained the proliferation activity and reduced the senescence of MSCs. Notably, increasing aKG levels in MSCs through the IDH1 agonist Scu successfully delayed MSC senescence and significantly improved the aging phenotype of aged mice in vivo . A study on age-related osteoporosis showed that the aKG level in bone marrow MSCs isolated from aged mice was significantly lower than that in bone marrow MSCs isolated from young adult mice, and in vitro supplementation with aKG significantly increased bone mass in aged mice, reduced age-related bone loss, and accelerated bone regeneration in aged rodents 34 . The main mechanism underlying these effects is that aKG improves the senescence-related phenotype of bone marrow MSCs from aged mice by regulating histone methylation. aKG also promotes the proliferation, colony formation, migration, and osteogenic potential of bone marrow MSCs 34 . Similarly, our study revealed that the IDH1 small molecule agonist Scu successfully increased the level of aKG in bone marrow MSCs and in various tissues of aged mice. Scu significantly improved several aging phenotypes in mice, including improved learning and memory ability, ameliorated osteoporosis, increased dermal thickness, and inhibited aging-related secretory phenotypes. This shows that IDH1 small molecular agonists have great potential for promoting MSC regeneration and delaying senescence. Disorder of protein balance is a key factor in aging and age-related diseases, and translation is one of its key determinants 35 – 37 . Many studies have shown that increased fidelity of protein synthesis has a life-prolonging effect on unicellular and multicellular eukaryotes 16 , 38 – 40 . Drugs commonly used for anti-aging, such as rapamycin, torin1, and trametinib, can reduce translation errors, suggesting that maintenance of the fidelity of protein synthesis may serve as a common mechanism underlying the anti-aging effects of these drugs 16 . In this study, we revealed the significance of the endogenous metabolite aKG for the protein translation accuracy of MSCs. With increasing culture passages, aKG levels in MSCs decreased gradually, and protein translation errors increased. Supplementation with aKG significantly reduced protein mistranslation. Consistent with previous reports that IDH1 deficiency inhibited proliferation in human granulosa cells 7 , we found that knockdown of IDH1 led to a decrease in aKG levels and RPS23 protein hydroxylation in MSCs, resulting in a significant increase in stop codon readthrough; overexpression of IDH1 increased aKG levels and RPS23 protein hydroxylation in MSCs, thereby significantly reducing stop codon readthrough, maintaining cell proliferation and delaying senescence. Our findings suggest that the overexpression of IDH1 endows human MSCs with stronger proliferation ability and greater anti-senescence ability, further supporting the anti-senescence effect of IDH1 in human MSCs. Mechanistically, we found that low levels of IDH1 reduced the production of aKG, affected the normal hydroxylation of RPS23, increased the mistranslation of proteins, and ultimately accelerated the senescence of MSCs. Some studies have shown that OGFOD1 catalyzes RPS23 hydroxylation, which in turn affects translation accuracy 17 , 18 . In this process, aKG is an important cofactor of RPS23 hydroxylation catalyzed by OGFOD1 18,41 . Interestingly, our study found direct binding of aKG to RPS23, which may be related to aKG promoting the interaction between RPS23 and OGFOD1. Our research show that after OGFOD1 was knocked down, the level of RPS23 protein hydroxylation in MSCs decreased, and the regulation of protein translation accuracy and cell proliferation activity by aKG disappeared. This suggests that OGFOD1‒HO-RPS23 plays an important role in the process of aKG promoting RPS23 protein hydroxylation and thus regulating protein translation accuracy. Similarly, we successfully increased the accuracy of protein synthesis by overexpressing IDH1 and using IDH1 small molecule agonists to increase aKG levels and promote hydroxylation of RPS23 protein. Several studies suggest that aKG or IDH1 activity promotes stem cell proliferation by reducing repressive histone modifications 33 , 42 . Our study suggests that improving translational fidelity is another indispensable mechanism for aKG in maintaining stem cell health. Overall, our study provides a potential way to mitigate MSC senescence by regulating appropriate protein synthesis, although the exact mechanism by which aKG promotes accurate protein synthesis through RPS23 needs further investigation. CONCLUSIONS Our study highlights the crucial role of aKG, which is essential for maintaining protein homeostasis and delaying senescence in MSCs. These findings provide potential insights for the development of IDH1 agonists and the amelioration of aging through small molecule intervention in translation accuracy. Declarations AUTHOR CONTRIBUTIONS Zhao Cui, Hongjun Yang, and Peng Chen conceived this study. Hongjun Yang and Peng Chen provided financial and administrative support. Zhao Cui, Caifeng Li, Shiwen Deng, Jiameng Li, Wei Liu, and Shuhua Ma conducted most of the experiments. Xiaoxu Wang revised the grammar of the article. Shiwen Deng and Junxian Cao provided advice for this study. Zhao Cui and Peng Chen wrote the manuscript. ACKNOWLEDGMENTS This work was supported by the China Academy of Chinese Medical Sciences Innovation Fund (CI2021A00610), the National Key Research and Development Project of China (2019YFC1708900), the National Natural Science Foundation of China (82274224), the Fundamental Research Funds for the Central Public Welfare Research Institutes of China (JBGS2023002, ZZ-13 YQ-082Y), and the National Key Research and Development Project of China (2019YFC1708900). CONFLICT OF INTEREST The authors declare no competing interests. ETHICS APPROVAL AND CONSENT TO PARTICIPATE The animal study was approved by the Institutional Animal Care and Use Committee of the Experimental Research Center, China Academy of Chinese Medical Sciences (license no. ERCCACMS21-2203-02). References Gyanwali B, Lim ZX, Soh J, Lim C, Guan SP, Goh J et al (2022) Alpha-Ketoglutarate dietary supplementation to improve health in humans. Trends Endocrinol Metab 33:136–146 Barardo D, Thornton D, Thoppil H, Walsh M, Sharifi S, Ferreira S et al (2017) The DrugAge database of aging-related drugs. Aging Cell 16:594–597 Bayliak MM, Lushchak VI (2021) Pleiotropic effects of alpha-ketoglutarate as a potential anti-ageing agent. Ageing Res Rev 66:101237 Wu N, Yang M, Gaur U, Xu H, Yao Y, Li D (2016) Alpha-Ketoglutarate: Physiological Functions and Applications. Biomol Ther (Seoul) 24:1–8 Asadi Shahmirzadi A, Edgar D, Liao CY, Hsu YM, Lucanic M, Asadi Shahmirzadi A et al (2020) Alpha-Ketoglutarate, an Endogenous Metabolite, Extends Lifespan and Compresses Morbidity in Aging Mice. Cell Metab ;32:447 – 56.e6. Dang L, Yen K, Attar EC (2016) IDH mutations in cancer and progress toward development of targeted therapeutics. Ann Oncol 27:599–608 Wang S, Zheng Y, Li J, Yu Y, Zhang W, Song M et al (2020) Single-Cell Transcriptomic Atlas Primate Ovarian Aging Cell 180:585–600e19 Copes N, Edwards C, Chaput D, Saifee M, Barjuca I, Nelson D et al (2015) Metabolome and proteome changes with aging in Caenorhabditis elegans. Exp Gerontol 72:67–84 Belsky DW, Caspi A, Houts R, Cohen HJ, Corcoran DL, Danese A et al (2015) Quantification of biological aging in young adults. Proc Natl Acad Sci U S A 112:E4104–E4110 Tang XY, Wu S, Wang D, Chu C, Hong Y, Tao M et al (2022) Human organoids in basic research and clinical applications. Signal Transduct Target Ther 7:168 Kumar A, Yun H, Funderburgh ML, Du Y (2022) Regenerative therapy for the Cornea. Prog Retin Eye Res 87:101011 Fu NY, Nolan E, Lindeman GJ, Visvader JE (2020) Stem Cells and the Differentiation Hierarchy in Mammary Gland Development. Physiol Rev 100:489–523 Stein KC, Morales-Polanco F, van der Lienden J, Rainbolt TK, Frydman J (2022) Ageing exacerbates ribosome pausing to disrupt cotranslational proteostasis. Nature 601:637–642 Vermulst M, Denney AS, Lang MJ, Hung CW, Moore S, Moseley MA et al (2015) Transcription errors induce proteotoxic stress and shorten cellular lifespan. Nat Commun 6:8065 Conn CS, Qian SB (2013) Nutrient signaling in protein homeostasis: an increase in quantity at the expense of quality. Sci Signal 6:ra24 Martinez-Miguel VE, Lujan C, Espie-Caullet T, Martinez-Martinez D, Moore S, Backes C et al (2021) Increased fidelity of protein synthesis extends lifespan. Cell Metab 33:2288–2300 .e12 Singleton RS, Liu-Yi P, Formenti F, Ge W, Sekirnik R, Fischer R et al (2014) OGFOD1 catalyzes prolyl hydroxylation of RPS23 and is involved in translation control and stress granule formation. Proc Natl Acad Sci U S A 111:4031–4036 Loenarz C, Sekirnik R, Thalhammer A, Ge W, Spivakovsky E, Mackeen MM et al (2014) Hydroxylation of the eukaryotic ribosomal decoding center affects translational accuracy. Proc Natl Acad Sci U S A 111:4019–4024 Zhang X, Wang Q, Li Y, Ruan C, Wang S, Hu L et al (2020) Solvent-Induced Protein Precipitation for Drug Target Discovery on the Proteomic Scale. Anal Chem 92:1363–1371 Grentzmann G, Ingram JA, Kelly PJ, Gesteland RF, Atkins JF (1998) A dual-luciferase reporter system for studying recoding signals. RNA 4:479–486 Wang Y, Wang H, Deng P, Chen W, Guo Y, Tao T et al (2018) In situ differentiation and generation of functional liver organoids from human iPSCs in a 3D perfusable chip system. Lab Chip 18:3606–3616 Leng L, Yuan Z, Su X, Chen Z, Yang S, Chen M et al (2023) Hypothalamic Menin regulates systemic aging and cognitive decline. PLoS Biol 21:e3002033 Motulsky HJ, Brown RE (2006) Detecting outliers when fitting data with nonlinear regression - a new method based on robust nonlinear regression and the false discovery rate. BMC Bioinformatics 7:123 Cui Z, Li C, Chen P, Yang H (2022) An update of label-free protein target identification methods for natural active products. Theranostics 12:1829–1854 Triman KL (2007) Mutational analysis of the ribosome. Adv Genet 58:89–119 Alksne LE, Anthony RA, Liebman SW, Warner JR (1993) An accuracy center in the ribosome conserved over 2 billion years. Proc Natl Acad Sci U S A 90:9538–9541 Xiang S, Gu H, Jin L, Thorne RF, Zhang XD, Wu M (2018) LncRNA IDH1-AS1 links the functions of c-Myc and HIF1α via IDH1 to regulate the Warburg effect. Proc Natl Acad Sci U S A 115:E1465–e74 Cui Z, Li C, Liu W, Sun M, Deng S, Cao J et al (2024) Scutellarin activates IDH1 to exert antitumor effects in hepatocellular carcinoma progression. Cell Death Dis 15:267 Liu L, Li T, Song G, He Q, Yin Y, Lu JY et al (2019) Insight into novel RNA-binding activities via large-scale analysis of lncRNA-bound proteome and IDH1-bound transcriptome. Nucleic Acids Res 47:2244–2262 Liu L, Lu JY, Li F, Xing X, Li T, Yang X et al (2019) IDH1 fine-tunes cap-dependent translation initiation. J Mol Cell Biol 11:816–828 Zhang W, Qu J, Suzuki K, Liu GH, Izpisua Belmonte JC (2013) Concealing cellular defects in pluripotent stem cells. Trends Cell Biol 23:587–592 Yang Y, Zhang Z, Li W, Si Y, Li L, Du W (2023) αKG-driven RNA polymerase II transcription of cyclin D1 licenses malic enzyme 2 to promote cell-cycle progression. Cell Rep 42:112770 Carey BW, Finley LW, Cross JR, Allis CD, Thompson CB (2015) Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells. Nature 518:413–416 Wang Y, Deng P, Liu Y, Wu Y, Chen Y, Guo Y et al (2020) Alpha-ketoglutarate ameliorates age-related osteoporosis via regulating histone methylations. Nat Commun 11:5596 Hipp MS, Kasturi P, Hartl FU (2019) The proteostasis network and its decline in ageing. Nat Rev Mol Cell Biol 20:421–435 Labbadia J, Morimoto RI (2015) The biology of proteostasis in aging and disease. Annu Rev Biochem 84:435–464 Steffen KK, Dillin A (2016) A Ribosomal Perspective on Proteostasis and Aging. Cell Metab 23:1004–1012 Anisimova AS, Alexandrov AI, Makarova NE, Gladyshev VN, Dmitriev SE (2018) Protein synthesis and quality control in aging. Aging (Albany N Y) 10:4269–4288 von der Haar T, Leadsham JE, Sauvadet A, Tarrant D, Adam IS, Saromi K et al (2017) The control of translational accuracy is a determinant of healthy ageing in yeast. Open Biol ;7 Suhm T, Kaimal JM, Dawitz H, Peselj C, Masser AE, Hanzén S et al (2018) Mitochondrial Translation Efficiency Controls Cytoplasmic Protein Homeostasis. Cell Metab ;27:1309-22.e6 Horita S, Scotti JS, Thinnes C, Mottaghi-Taromsari YS, Thalhammer A, Ge W et al (2015) Structure of the ribosomal oxygenase OGFOD1 provides insights into the regio- and stereoselectivity of prolyl hydroxylases. Structure 23:639–652 Xu Y, Zhang Y, García-Cañaveras JC, Guo L, Kan M, Yu S et al (2020) Chaperone-mediated autophagy regulates the pluripotency of embryonic stem cells. Science 369:397–403 Additional Declarations There is NO Competing Interest. Supplementary Files GA.png GRAPHICAL ABSTRACT OriginalWB.pdf SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5000966","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":358218322,"identity":"45b28cff-7082-4741-aa81-503aa2bcb16a","order_by":0,"name":"Peng Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYFCCBAYGxgYo+wPJWhhnkKyFmYcYDfLt6c8e/Nxhk2fO3nv4tU2ZNQN/e3cCXi0GZx6kG/aeSSu27DmXZp1zLp1B4szZDfi1SCQck2ZsO5y44UaOmXFu22GgSC5+LfIzEtuAWv4nbrj/xszYkhgtDDeS2YBaDgBt4TF+zEiMFoMzz9gNe9uSE3f25Jgx9pxL5yHoF0iItdklbmc/Y/zhR5m1HH97LwGHMTCwQawDMiQY2IiLGrgW5g9ALcToGAWjYBSMghEGABttSntEoTZHAAAAAElFTkSuQmCC","orcid":"","institution":"China Academy of Chinese Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Peng","middleName":"","lastName":"Chen","suffix":""},{"id":358218323,"identity":"73b2a10f-3f22-45e5-b4a5-ce0d510da31a","order_by":1,"name":"Zhao Cui","email":"","orcid":"https://orcid.org/0000-0001-8927-8815","institution":"Experimental Research Center, China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zhao","middleName":"","lastName":"Cui","suffix":""},{"id":358218324,"identity":"1ec0f71d-86a8-4c7e-a8cd-27a12c24046f","order_by":2,"name":"Caifeng Li","email":"","orcid":"","institution":"Experimental Research Center, China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Caifeng","middleName":"","lastName":"Li","suffix":""},{"id":358218325,"identity":"a67d6abb-8f78-4dcc-8aa9-8c096da07122","order_by":3,"name":"Shiwen Deng","email":"","orcid":"","institution":"Experimental Research Center, China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shiwen","middleName":"","lastName":"Deng","suffix":""},{"id":358218326,"identity":"a13a6959-fe98-44d9-8431-e4fdf33c7d59","order_by":4,"name":"Wei Liu","email":"","orcid":"","institution":"Experimental Research Center, China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""},{"id":358218327,"identity":"aa447a46-48a0-4671-b898-9da40ea94c9b","order_by":5,"name":"Jiameng Li","email":"","orcid":"","institution":"The First Affiliated Hospital of Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiameng","middleName":"","lastName":"Li","suffix":""},{"id":358218328,"identity":"7e3f23c6-a265-4bc6-a574-ad76662d0c5e","order_by":6,"name":"Tong Lei","email":"","orcid":"","institution":"China Academy of Chinese Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Lei","suffix":""},{"id":358218329,"identity":"2cd428bd-d87e-4780-97d7-29b63d7c3473","order_by":7,"name":"Junxian Cao","email":"","orcid":"","institution":"China Academy of Chinese Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Junxian","middleName":"","lastName":"Cao","suffix":""},{"id":358218330,"identity":"14243383-d5c2-4075-864e-3823ac2bbf02","order_by":8,"name":"Ziyi Wang","email":"","orcid":"","institution":"China Academy of Chinese Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Ziyi","middleName":"","lastName":"Wang","suffix":""},{"id":358218331,"identity":"1adcbe80-d0f8-4bd2-a52b-db5b95bf319b","order_by":9,"name":"xiaowu wang","email":"","orcid":"","institution":"AstraZeneca Pharmaceuticals LP","correspondingAuthor":false,"prefix":"","firstName":"xiaowu","middleName":"","lastName":"wang","suffix":""},{"id":358218332,"identity":"0490fba1-21e0-44d8-913c-f69112039af0","order_by":10,"name":"Shuhua Ma","email":"","orcid":"","institution":"China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shuhua","middleName":"","lastName":"Ma","suffix":""},{"id":358218333,"identity":"016c805c-29bf-4022-acb4-bc541f3e9422","order_by":11,"name":"Hongjun Yang","email":"","orcid":"","institution":"China Academy of Chinese Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hongjun","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-08-30 03:55:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5000966/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5000966/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":65240144,"identity":"97e6c329-7cb9-4194-a89d-a88cfacaed24","added_by":"auto","created_at":"2024-09-25 06:27:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":415538,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe metabolomics reveals that aKG is a functional molecule in MSCs aging.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea \u003c/strong\u003eSchematic diagram of the TCA-targeted metabolic flux analysis of physiologically senescent MSCs. \u003cstrong\u003eb\u003c/strong\u003e \u003csup\u003e13\u003c/sup\u003eC-labeled TCA metabolites were identified by GC‒MS analysis. \u003cem\u003en \u003c/em\u003e= 4. \u003cstrong\u003ec\u003c/strong\u003e Heatmap of metabolomics showing the absolute intracellular levels of 13C-labeled TCA metabolites identified by GC‒MS analysis. \u003cem\u003en \u003c/em\u003e= 4. \u003cstrong\u003ed-f\u003c/strong\u003e Effects of treatment with aconitate, citric acid, fumarate, malate, aKG, and DM-aKG for 48 h on the proliferation of MSCs at P8. \u003cem\u003en \u003c/em\u003e= 4. The data are presented as the means ± s.e.m. \u003cstrong\u003eb, c \u003c/strong\u003eAll compared with the P5 group. \u003cstrong\u003ed-f \u003c/strong\u003eAll compared with the 0 μM treatment group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. ADSCs: human adipose-derived stem cells; SHEDs: human stem cells from human exfoliated deciduous teeth; USCs: human umbilical cord mesenchymal stem cells; P: passage.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/af09f53bee82a4aa9ae85097.png"},{"id":65240312,"identity":"cebed578-cdb7-4d6a-8d02-cb32f382220a","added_by":"auto","created_at":"2024-09-25 06:35:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":692101,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eaKG maintains MSCproliferation and delays cell senescence.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eSchematic diagram of MSCphysiological senescence. \u003cstrong\u003eb\u003c/strong\u003e MSCs were stained with SA-β-Gal after physiological senescence. Scale bars, 50 μm. \u003cstrong\u003ec\u003c/strong\u003e Detection of aKG content in MSCs after physiological aging and supplementation with 1 mM aKG and 100 μM DM-aKG for 48 h.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003en \u003c/em\u003e= 4. \u003cstrong\u003ed\u003c/strong\u003e Growth curve showing the cumulative population doublings of MSCs treatment with 100 μM DM-aKG over passages. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ee\u003c/strong\u003e Colony formation, \u003cstrong\u003ef \u003c/strong\u003eKi67 staining, \u003cstrong\u003eg\u003c/strong\u003eSA-β-Gal staining, and \u003cstrong\u003eh\u003c/strong\u003e γH2AX staining of young MSCs (P6) and senescent MSCs (P13) treatment with 100 μM DM-aKG. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 50 μm. \u003cstrong\u003ei \u003c/strong\u003eqRT‒PCR analysis of the expression of senescence marker genes in young MSCs (P6) and senescent MSCs (P13) treatment with 100 μM DM-aKG. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ej, k\u003c/strong\u003e Western blot analysis of IDH1, p16, and p21 in young MSCs (P6) and senescent MSCs (P13) treatment with 100 μM DM-aKG. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. The data are presented as the means ± s.e.m. \u003cstrong\u003ec \u003c/strong\u003eAll compared with the P13 group. \u003cstrong\u003ee-k\u003c/strong\u003e All compared to MSCs at P13 in the 0 μM DM-aKG group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. OE: overexpression group. Sh: short hairpin RNA group. CON: Control group; Scu: Scutellarin. ADSCs: human adipose-derived stem cells; SHEDs: human stem cells from human exfoliated deciduous teeth; USCs: human umbilical cord mesenchymal stem cells; P: passage.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/307d4bf8a73045dae4a7a910.png"},{"id":65238548,"identity":"acae8760-e04f-4bc2-b5d7-b77f4897af3a","added_by":"auto","created_at":"2024-09-25 06:19:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":679937,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eaKG promotes RPS23 hydroxylation and the OGFOD1\u003c/strong\u003e‒\u003cstrong\u003eRPS23 complex formation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Schematic diagram of TPP. \u003cstrong\u003eb\u003c/strong\u003e Volcano plots of the fold changes in soluble protein levels were generated to identify potential targets of aKG with the most significant changes in protein content. RPS23 is indicated on the plots. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ec\u003c/strong\u003e DSF was used to detect changes in the T\u003csub\u003em\u003c/sub\u003e of RPS23 after the addition of aKG. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ed, e\u003c/strong\u003e Treatment with 100 μM aKG increased the thermal stability of RPS23 in ADSC lysates, as measured by a temperature-dependent CETSA. GAPDH was used as the loading control.\u003cem\u003e n \u003c/em\u003e= 3. \u003cstrong\u003ef, g\u003c/strong\u003e Treatment with 100 μM aKG increased the stability of RPS23 in ADSC lysates, as measured by a solvent-induced protein precipitation assay. GAPDH was used as the loading control.\u003cem\u003e n \u003c/em\u003e= 3. \u003cstrong\u003eh\u003c/strong\u003e The binding constant between RPS23 and aKG was detected by BLI.\u003cstrong\u003e i\u003c/strong\u003e Schematic diagram of the hydroxylation of RPS23 catalyzed by OGFOD1. \u003cstrong\u003ej, k \u003c/strong\u003eWestern blot analysis of OGFOD1, and co-immunoprecipitation analysis of RPS23 and OH-RPS23 by anti-hydroxyproline antibody coprecipitates RPS23 in young ADSC (P6) and senescent ADSC (P15) treatment with DM-aKG for 48 h. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003el\u003c/strong\u003e ADSCs were treated with 100 μM DM-aKG for 48 h and incubated with antibodies against OGFOD1 and RPS23 and stained with DAPI. Cells were imaged with a ultra-high resolution microscope. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 25 μm. \u003cstrong\u003em\u003c/strong\u003e Determination of the interaction between endogenous OGFOD1 and RPS23 with DM-aKG. Anti-OGFOD1 antibody coprecipitates RPS23 at its native molecular weight (16 kDa) and as a complexed form with OGFOD1 (79 kDa denoted by “*”), and \u003cstrong\u003en\u003c/strong\u003e Anti-RPS23 antibody coprecipitates OGFOD1 at its native molecular weight (63 kDa) and as a complexed form with RPS23 (79 kDa denoted by “*”) as determined by anti-OGFOD1 and anti-RPS23 immunoblot analysis. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. The data are presented as the means ± s.e.m. \u003cstrong\u003ee, g\u003c/strong\u003e All compared with the CT group. \u003cstrong\u003ej\u003c/strong\u003e All compared with P6 group. \u003cstrong\u003ek\u003c/strong\u003e All compared to ADSC at P15 in the 0 μM DM-aKG group. \u003cstrong\u003em, n\u003c/strong\u003e All compared with 0 μM DM-aKG group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. P: passage; CT: control group; IB: immunoblot. IP: immunoprecipitation; CETSA: Cellular Thermal Shift Assay. SIP: solvent-induced protein precipitation.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/6cad9129f031805d0183691a.png"},{"id":65240139,"identity":"5a76b07b-1b70-4d17-bd08-18d7003e7b5b","added_by":"auto","created_at":"2024-09-25 06:27:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":567323,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eaKG levels are correlated with IDH1 expression and overexpress IDH1 delays the physiological senescence in MSCs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eP6 and P13/P14 MSCs were assayed for protein levels of aKG-related enzymes. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003eb\u003c/strong\u003e Schematic diagram of IDH1 overexpression in MSCs. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ec\u003c/strong\u003e Flow cytometry analysis ofthe expression of the cell surface markers CD73, CD90, and CD105 in OE_CON and OE_IDH1 MSCs at P7.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ed\u003c/strong\u003e Detection of aKG levels in OE_CON and OE_IDH1 MSCs at P7. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ee\u003c/strong\u003e SA-β-Gal staining of OE_CON and OE_IDH1 MSCs at P13. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 200 μm. \u003cstrong\u003ef\u003c/strong\u003e Cloning ability and \u003cstrong\u003eg \u003c/strong\u003eKi67 staining of OE_CON and OE_IDH1 MSCs at P13. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 50 μm. \u003cstrong\u003eh \u003c/strong\u003eqRT‒PCR analysis of the expression of senescence marker genes in OE_CON and OE_IDH1 MSCs at P13. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ei\u003c/strong\u003e Western blotanalysis of IDH1, OGFOD1, p16, and p21, and co-immunoprecipitation analysis of RPS23 and OH-RPS23 by anti-hydroxyproline antibody coprecipitates RPS23 in OE_CON and OE_IDH1 MSCs at P13. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. The data are presented as the means ± s.e.m. \u003cstrong\u003ea \u003c/strong\u003eAll compared with the P13 or P14 group. \u003cstrong\u003ed-h \u003c/strong\u003eAll compared with the OE_CON group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. OE: overexpressiongroup; CON: control; ADSC: human adipose-derived stem cell; SHED: human stem cell from human exfoliated deciduous teeth.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/e1b1278f661ed72872eb7127.png"},{"id":65240142,"identity":"71ab0f34-b475-4729-955f-62063e9714a2","added_by":"auto","created_at":"2024-09-25 06:27:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":533601,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eaKG reverses IDH1knockdown-induced MSC senescence.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eDetection of aKG levels in Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG for 48 h at P9. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003eb\u003c/strong\u003e SA-β-Gal staining of Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG for 48 h at P9. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 100 μm. \u003cstrong\u003ec\u003c/strong\u003e Growth curve showing the cumulative population doublings of Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG over passages. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ed\u003c/strong\u003e Ki67 staining and \u003cstrong\u003ee \u003c/strong\u003eγH2AX staining of Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG for 48 h at P9. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 50 μm. \u003cstrong\u003ef \u003c/strong\u003eqRT‒PCR analysis of the expression of senescence marker genes in Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG for 48 h at P9.\u003cem\u003e n \u003c/em\u003e= 3. \u003cstrong\u003eg, h\u003c/strong\u003e Western blot analysis of IDH1, OGFOD1, p16, and p21, and co-immunoprecipitation analysis of RPS23 and OH-RPS23 by anti-hydroxyproline antibody coprecipitates RPS23 in Sh_CON, Sh_IDH1, and Sh_IDH1 MSCs treatment with 200 μM DM-aKG for 48 h at P9. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. The dataare presented as the means ± s.e.m. \u003cstrong\u003ea\u003c/strong\u003e All compared with the Sh_CON group. \u003cstrong\u003eb-h \u003c/strong\u003eAll compared with the Sh_IDH1 group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. Sh: short hairpin RNA group; OE: overexpressed group; Sh: short hairpin RNA group; CON: Control group; ADSC: human adipose-derived stem cells; SHED: human stem cells from human exfoliated deciduous teeth; USC: human umbilical cord mesenchymal stem cells.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/90be5bfa7ecbea6c94a29c8c.png"},{"id":65238547,"identity":"0277a745-c308-49c0-a57c-14801035743c","added_by":"auto","created_at":"2024-09-25 06:19:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":327276,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eaKG improves the accuracy of protein translation by OGFOD1\u003c/strong\u003e‒\u003cstrong\u003eHO-RPS23 in MSCs.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eSchematic representation of dual-luciferase reporters used to assay translation errors in ADSCs. \u003cstrong\u003eb\u003c/strong\u003e The reporter was validated by treating ADSCsat P7 treated with the error-inducing drug paromomycin for 24 h. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003ec, d\u003c/strong\u003e Effect of treatment with aKG and DM-aKG for 48 h on the stop codon readthrough of senescent ADSCs (P15) with DIP or DMOG. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003ee\u003c/strong\u003eEffect of IDH1 overexpression onthe stop codon readthrough ofADSCsat P13 treated with DIP or DMOG for 48 h. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003ef\u003c/strong\u003e Effect of IDH1 knockdown on the stop codon readthrough of ADSCs at P7 treated with 500 μM aKG or 50 μM DM-aKG for 48 h. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003eg\u003c/strong\u003e Western blot analysis of OGFOD1, and co-immunoprecipitation analysis of RPS23 and OH-RPS23 by anti-hydroxyproline antibody coprecipitates RPS23 in Sh_CON, 2 mM IPTG-inducible Sh_OGF#1, and Sh_OGF#2 ADSCs at P9. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003eh \u003c/strong\u003eThe stop codon readthrough of Sh_OGF#1 ADSCs at P9 treated with 2 mM IPTG for the indicated time. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003ei\u003c/strong\u003e Effect of OGFOD1 knockdown on the stop codon readthrough ofADSCsat P9 treated with 500 μM aKG or 50 μM DM-aKG for 48 h. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003ej, k\u003c/strong\u003e Effects of treatment with aKG and DM-aKG for 48 h on the proliferation of ADSCs at P7 with 50 μM DIP or 200 μM DMOG. \u003cem\u003en \u003c/em\u003e= 5. \u003cstrong\u003el\u003c/strong\u003e Effects of treatment with 500 μM aKG and 50 μM DM-aKG for 48 h on the proliferation of Sh_OGFOD1 ADSCs at P9. \u003cem\u003en \u003c/em\u003e= 5. The data are presented as the means ± s.e.m. \u003cstrong\u003eb\u003c/strong\u003e All compared to 0 μM paromomycin group. \u003cstrong\u003ec, d\u003c/strong\u003e All compared to MSCs at P15 in the 0 μM aKG or 0 μM DM-aKG group. \u003cstrong\u003ee \u003c/strong\u003eAll compared to the OE_CON group. \u003cstrong\u003ef\u003c/strong\u003e All compared to the Sh_IDH1 group. \u003cstrong\u003ei\u003c/strong\u003eAll compared to the Sh_OGF#2 group. \u003cstrong\u003ej, k\u003c/strong\u003e All compared to the 0 μM aKG or DM-aKG group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. IPTG: isopropyl β-D-thiogalactoside; OGF: OGFOD1; P: passage; DMOG: dimethyloxalylglycine; DIP: Fe(II) chelator 2,2-dipyridyl.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/c8cc42bcb49f0fe09cafd7ef.png"},{"id":65240145,"identity":"adb587ca-42d7-4937-a921-1c8284f80d17","added_by":"auto","created_at":"2024-09-25 06:27:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":647800,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe IDH1 agonist Scu can increase the proliferation and delay the physiological senescence of MSCs by promoting RPS23 hydroxylation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eSchematic diagram of the catalytic reaction of the IDH1 protein. \u003cstrong\u003eb\u003c/strong\u003e Effect of Scu on aKG production in physiologically senescent MSCs. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ec\u003c/strong\u003e Dose curve of the effect of Scu on IDH1 activity. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ed\u003c/strong\u003e Effect of Scu treatment for 48 h on the proliferation of MSCs at P8. \u003cem\u003en \u003c/em\u003e= 4. \u003cstrong\u003ee\u003c/strong\u003e Growth curve showing the cumulative population doublings of MSCs treated with 10 μM Scu over passages.\u003cem\u003e n \u003c/em\u003e= 3. \u003cstrong\u003ef \u003c/strong\u003eSA-β-Gal staining of young MSCs (P8) and senescent MSCs (P14) treatment with 10 μM Scu. \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 200 μm. \u003cstrong\u003eg\u003c/strong\u003e Western blot analysis of OGFOD1, p16, and p21, and co-immunoprecipitation analysis of RPS23 and OH-RPS23 by anti-hydroxyproline antibody coprecipitates RPS23 in young MSCs (P8) and senescent MSCs (P14) treatment with 10 μM Scu. GAPDH was used as the loading control.\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003eh \u003c/strong\u003eADSCs were treated with 10 μM Scu and incubated with antibodies against OGFOD1 and RPS23 and stained with DAPI. Cells were imaged with a ultra-high resolution microscope. \u003cem\u003en\u003c/em\u003e = 6. Scale bars, 25 μm. \u003cstrong\u003ei\u003c/strong\u003e Determination of the interaction between endogenous OGFOD1 and RPS23 in ADSCs at P8 treated with Scu for 48 h. Anti-RPS23 antibody coprecipitates OGFOD1 at its native molecular weight (63 kDa) and as a complexed form with RPS23 (79 kDa denoted by “*”) as determined by anti-OGFOD1 and anti-RPS23 immunoblot analysis. GAPDH was used as the loading control. \u003cem\u003en \u003c/em\u003e= 3. \u003cstrong\u003ej\u003c/strong\u003eEffect of treatment with 10 μM Scu for 48 h on the stop codon readthrough of ADSCs with 50 μM DIP or 200 μM DMOG.\u003cem\u003e n \u003c/em\u003e= 6. \u003cstrong\u003ek\u003c/strong\u003e Effects of treatment with 10 μM Scu for 48 h on the stop codon readthrough of Sh_IDH1 and Sh_OGFOD1 ADSCs at P9. \u003cem\u003en \u003c/em\u003e= 6. \u003cstrong\u003el \u003c/strong\u003eEffects of treatment with Scu for 48 h on the proliferation of ADSCs at P8 with 50 μM DIP or 200 μM DMOG. \u003cem\u003en \u003c/em\u003e= 4. \u003cstrong\u003em \u003c/strong\u003eEffect of treatment with 10 μM Scu for 48 h on the proliferation of Sh_IDH1 and Sh_OGFOD1 ADSCs at P9. \u003cem\u003en \u003c/em\u003e= 4. The data are presented as the means ± s.e.m. \u003cstrong\u003eb, f, j\u003c/strong\u003eAll compared to MSCs at P14 in the0 μM Scu group. \u003cstrong\u003ed, i, l\u003c/strong\u003e All compared to the 0 μM Scu group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. Scu: scutellarin. ADSCs: human adipose-derived stem cells; SHEDs: human stem cells from human exfoliated deciduous teeth; USCs: human umbilical cord mesenchymal stem cells; OGF: OGFOD1; P: passage.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/c00eccc4760227de0b26cc02.png"},{"id":65240143,"identity":"5e0ecc66-e9c8-442d-a464-59b6770c95ef","added_by":"auto","created_at":"2024-09-25 06:27:31","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":952424,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimulating the effects of IDH1 agonists on MSCs \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e using microfluidic devices.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e The microfluidic devices include anintestinal barrier, liver organoids, and MSCs (P8),all of which are located on the upper surface of the transwellchamber. Each module can be submerged in the maintenance medium, creating stable internal circulation. \u003cstrong\u003eb \u003c/strong\u003eQuality detection after the intestinal barrier was formed by CaCO2 cells. Scale bars, 50 μm. \u003cstrong\u003ec\u003c/strong\u003eMorphology of liver organoids induced by human IPSCs. Scale bars, 50 μm. \u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003cstrong\u003ed\u003c/strong\u003eChanges in the concentration of Scu before and after 24 h of circulation in the microfluidic system without organoids. \u003cstrong\u003ee \u003c/strong\u003eDifference in Scu concentrations in circulating solutions under different metabolic modes after 12 h and 24 h at an initial Scu concentration of 90 μg/mL. \u003cem\u003en \u003c/em\u003e= 3. Effect of treatment with 90 μg/mL Scu for 48 h on \u003cstrong\u003ef\u003c/strong\u003e SA-β-Gal staining, \u003cstrong\u003eg\u003c/strong\u003e Ki67 staining, and \u003cstrong\u003eh\u003c/strong\u003eγH2AX staining in D-Gal-induced senescent MSCs (P8). \u003cem\u003en \u003c/em\u003e= 6. Scale bars, 50 μm. \u003cstrong\u003ei \u003c/strong\u003eEffect of treatment with 90 μg/mL Scu for 48 h on the membrane potential aggregation (red) in D-Gal-induced senescent MSCs (P8) detected by mitochondrial membrane potential JC-1 probe. When the mitochondrial membrane potential is low, the JC-1 probe will appear in a monomericstate (green). \u003cem\u003en\u003c/em\u003e = 6. Scale bars, 50 μm. \u003cstrong\u003ef-h\u003c/strong\u003e All compared to D-Gal-treated MSCs without Scu group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. Scu: scutellarin; D-Gal: D-galactose; AFP: α-fetoprotein; ALB: albumin; CYP3A4: cytochrome P450 3A4; FOXA2: forkhead box A2; ADSCs: human adipose-derived stem cells; SHEDs: human stem cells from human exfoliated deciduous teeth; USCs: human umbilical cord mesenchymal stem cells; P: passage.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/862dd713401fba7c81cf1b28.png"},{"id":65238542,"identity":"db8f8e13-dcd1-4754-8db8-3bc2c180c6bd","added_by":"auto","created_at":"2024-09-25 06:19:31","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":591255,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe IDH1 agonist as new anti-aging strategies improves the aging phenotype in aged mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003eSchematic plan for the administration of Scu (30 mg/kg/day). \u003cstrong\u003eb\u003c/strong\u003e The level of aKG in different tissuesand \u003cstrong\u003ec\u003c/strong\u003e bone MSCs fromaged mice after the administration of Scu. \u003cem\u003en \u003c/em\u003e= 8. \u003cstrong\u003ed-e \u003c/strong\u003eThe behavior of aged mice with Scu administration in the Morris water maze test during the 5-day training phase. \u003cem\u003en \u003c/em\u003e= 10. \u003cstrong\u003ef-i \u003c/strong\u003eThe behavior of aged mice with Scu administration in the Morris water maze test in which the hidden platform was removed on day 6. \u003cem\u003en \u003c/em\u003e= 10. \u003cstrong\u003ej-k\u003c/strong\u003e The behavior of aged mice with Scu administration in the Y maze. \u003cem\u003en \u003c/em\u003e= 10. \u003cstrong\u003el-m\u003c/strong\u003e The dermal thickness and \u003cstrong\u003en-q\u003c/strong\u003e bone state of aged mice were tested after the administration of Scu. \u003cem\u003en \u003c/em\u003e= 5. Scale bars, 100 μm. \u003cstrong\u003er\u003c/strong\u003e Multifactor detection in aged mouse serum after the administration of Scu. \u003cem\u003en \u003c/em\u003e= 10. The dataare presented as the means ± s.e.m. \u003cstrong\u003eb-r \u003c/strong\u003eAll compared to the CT group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.001. Scu: scutellarin. CT: control group; Scu: scutellarin; BV/TV: bone volume fraction; Tb.N: enhanced trabecular bone number; BMD: bone mineral density; SMI: structural model index.\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/4c5f8cd6444dbffc7ee0c3c0.png"},{"id":67983019,"identity":"b47a6725-5717-44d3-b15b-489c336078d9","added_by":"auto","created_at":"2024-11-01 03:18:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6549260,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/6e85c2db-abb5-4512-a0a6-adcd85587838.pdf"},{"id":65238538,"identity":"cd9dacb8-3865-42c4-8782-02d2dee33131","added_by":"auto","created_at":"2024-09-25 06:19:31","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":137613,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGRAPHICAL ABSTRACT\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/479dc7ea2744b901ae154e92.png"},{"id":65240310,"identity":"fc5c5b5a-cc5e-4088-81bc-40204fbd6c79","added_by":"auto","created_at":"2024-09-25 06:35:31","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":939862,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalWB.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/a455815946c27ac069473cb4.pdf"},{"id":65238546,"identity":"3023b8a6-56f7-466d-a663-56419237bbc7","added_by":"auto","created_at":"2024-09-25 06:19:31","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1730429,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-5000966/v1/ec0764c20aec44dff588f569.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"The novel target, mechanism and agonist of α-Ketoglutaric acid in delaying mesenchymal stem cell senescence","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eα-Ketoglutarate acid (aKG), which is involved in a variety of metabolic and cellular pathways, acts as an antioxidant, interferes with nitrogen and ammonia balance, and affects epigenetics and immune regulation \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. aKG has been reported to slow the aging process and is considered a safe supplement with the potential to prolong health and even reduce morbidity \u003csup\u003e\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Isocitrate dehydrogenase 1 (IDH1), a key enzyme involved in aKG production, plays important roles in biological processes such as cellular metabolism, redox status, epigenetic regulation and DNA repair \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. IDH1 is associated with human age-related diseases, and IDH1 expression decreases with age in a variety of tissues, including human ovarian cells and \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Although indirect evidence from various studies suggests that the IDH1-aKG signaling axis may play an important role in aging, its potential molecular mechanism and anti-aging targets are unclear.\u003c/p\u003e \u003cp\u003eAging is characterized by a decline in the physiological function of organs and is the primary risk factor for various chronic diseases \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. With self-renewal ability and differentiation potential, stem cells are essential for maintaining tissue and organ structure and function, as well as facilitating injury repair \u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Stem cell senescence is considered to be an important feature and driving force of body aging. Exploring strategies to increase the number of stem cells in the body to delay aging is also a major focus of research. An imbalance in protein homeostasis is a common problem in the process of senescence \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Defective mechanisms or mutations lead to a decrease in translation accuracy, potentially resulting in the synthesis of malformed proteins. This can lead to dysfunctional protein formation and the accumulation of toxic protein aggregates \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Recent studies have suggested that extending lifespan by inhibiting TOR (a target of rapamycin) is linked to the enhancement of translation fidelity \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In addition, studies have been performed to improve translation fidelity and improve the health and lifespan of yeast, worms and flies by mutating a single amino acid of ribosomal protein S23 (RPS23) \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. This finding also proves the direct relationship between the reduction in translation errors and the prolongation of life expectancy. As an important cofactor of proline hydroxylase, aKG plays an important role in the hydroxylation of the RPS23 protein, which has attracted our attention \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. We investigated the potential role of IDH1 and aKG in regulating protein homeostasis during cellular senescence.\u003c/p\u003e \u003cp\u003eIn this study, we found that aKG is a metabolic marker of senescence in MSCs. Three methods, namely, exogenous aKG supplementation, the overexpression of IDH1, and the activation of IDH1 to increase intracellular aKG levels, were shown to delay MSC senescence. Furthermore, we demonstrated that aKG promotes the hydroxylation of RPS23 and the interaction of OGFOD1 with RPS23 to improve the accuracy of protein translation. Finally, we successfully delayed the senescence of pathological or physiological MSCs and ameliorated the aging phenotypes of aging mice using a small molecule agonist of IDH1. Overall, our study identified the mechanisms by which aKG delays the senescence of MSCs by targeting RPS23 to maintain protein homeostasis. These findings pave the way for identifying novel interventions to enhance translation accuracy, thereby potentially improving cellular and individual aging processes.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and mice\u003c/h2\u003e \u003cp\u003eHuman SHED cells (P2) were obtained from Saliai Stem Cell Science and Technology Co., Ltd. (Guangzhou, China). Human ADSC cells (P2) and human USC cells (P2) were obtained from Cyagen Biosciences (Guangzhou, China). IPSCs were obtained from MEGAROBO Technology Co., Ltd. (Beijing, China). CaCO2 cells were preserved by cryopreservation in our laboratory. MSCs were cultured in OptiVitro\u0026reg; MSC Expansion Medium XF (ExCell Bio, Suzhou, China), IPSCs were cultured in PSCeasy hESC/hiPS Medium (CELLAPY, Beijing, China), and CaCO2 cells were cultured in DMEM (XP Biomed, Shanghai, China). All cells were routinely maintained at 37\u0026deg;C in humidified air containing 5% CO\u003csub\u003e2\u003c/sub\u003e. The culture medium was replaced every 3 days; when the confluence of the cells reached 80%-90%, the cells were washed with PBS (Coolaber, Beijing, China) and passaged through 0.25% trypsin-EDTA (Biosharp, Hefei, China) digestion.\u003c/p\u003e \u003cp\u003eMale BALB/c mice (12 months old) were obtained from SiPeiFu Biotech (Beijing, China). The mice were kept in the absence of specific pathogens, had a 12-hour light/dark cycle and were raised to 20 months of age. Mice were randomly divided into two groups, and the weights of the mice were evenly distributed among the groups. Then, the mice received an intraperitoneal injection of 30 mg/kg/day Scu or 0.9% saline solution daily for 80 days. All care and treatment of the experimental animals were in strict accordance with the guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care approved by the Institutional Animal Care and Use Committee of the Chinese Materia Medica China Academy of Chinese Medical Sciences (license no. ERCCACMS21-2203-02).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCompound preparation, cell viability assay, and cell colony formation\u003c/h2\u003e \u003cp\u003eAKG (Sigma, Louis, USA) and DM-aKG (Sigma, Louis, USA) were dissolved in pure water as stock solutions at 100 mM and stored at -20\u0026deg;C. Scu (Nature Standard, Shanghai, China) was dissolved in dimethyl sulfoxide (DMSO) (Sigma, Louis, USA) as a 100 mM stock solution and stored at -20\u0026deg;C. aKG, DM-aKG, and Scu stock solutions were freshly diluted with medium to their final concentrations before each \u003cem\u003ein vitro\u003c/em\u003e experiment. The final DMSO concentration did not exceed 0.1%.\u003c/p\u003e \u003cp\u003eCells were plated in 96-well plates and treated with the indicated compounds. After 48 hours of incubation, the cells were incubated with CCK-8 reagent (MedChemExpress, Shanghai, China) for another 2 hours. Then, the absorbance at 450 nm was determined spectrophotometrically on a Synergy2 multimode microplate reader (BioTek, Winooski, USA). Cell viability is expressed as a percentage relative to that of the control group after subtraction of the background signal. For the cell colony formation assay, MSCs were seeded in 6-well plates, treated with the indicated compounds, and stained with crystal violet solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eSA-β-gal staining\u003c/h2\u003e \u003cp\u003eSA-β-gal staining was used to detect cell senescence. According to the instructions of the β-gal staining kit (Solarbio, Beijing, China), the cells were washed with PBS twice, fixed for 15 min, and incubated overnight at 37\u0026deg;C. Images were taken randomly, and the SA-β-gal-positive cells were counted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDetection of aKG\u003c/h2\u003e \u003cp\u003eFor the cell samples, the cells were resuspended in PBS, ultrasonically disrupted on ice, and then centrifuged at 8000 \u0026times; g for 10 min at 4\u0026deg;C. For tissue samples, fresh tissue was homogenized in PBS on ice and then centrifuged at 8000 \u0026times; g for 10 min at 4\u0026deg;C. All the supernatant was removed and placed on ice for testing. Serum samples can be used directly for testing. The aKG concentration was assessed using a human α-ketoglutaric acid (aKG) ELISA kit (Bohu, Shanghai, China) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eWhole-cell lysates were prepared using RIPA lysis buffer (Epizyme, Shanghai, China) supplemented with complete protease inhibitor cocktail (Beyotime, Shanghai, China), homogenized and centrifuged at 12000 \u0026times; g for 10 min at 4\u0026deg;C. The protein concentration of the cell lysates was determined by BCA protein assay reagent (Solarbio, Beijing, China). The cell lysates were incubated in SDS‒PAGE sample loading buffer at 95\u0026deg;C for 10 min, separated by 8%-12% SDS‒PAGE, and transferred to PVDF membranes (Millipore, Billerica, USA). The membranes were blocked with 5% skim milk at 25\u0026deg;C for 30 min and then incubated with primary antibodies against IDH1 (1:3000, #12332-1-AP, Proteintech), IDH2 (1:1000, #A7190, ABclonal), IDH3A (1:1000, #A14650, ABclonal), IDH3B (1:1000, #A13742, ABclonal), GLS (1:1000, #A11043, ABclonal), Glud1 (1:1000, #A7631, ABclonal), Glud2 (1:1000, #A6604, ABclonal), p16 (1:1000, #A11651, ABclonal), p21 (1:1000, #A1483, ABclonal), HIF1a (1:1000, #A6265, ABclonal), Hydroxy-HIF-1α (1:1000, #D43B5, Cell Signaling Technology), RPS23 (1:1000, #BF8511, AFfirm), OGFOD1 (1:1000, #A16543, ABclonal), hydroxyproline (1:1000, #bs-10389R, Bioss), GAPDH (1:20000, #A19056, ABclonal), or β-tubulin (1:1000, #AC105, ABclonal) overnight at 4\u0026deg;C. Subsequently, the membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse IgG secondary antibodies (Beyotime, Shanghai, China) for 1 hour at room temperature. SuperKine\u0026trade; hypersensitive ECL luminescent solution (Abbkine, Wuhan, China) was used for the detection of the proteins of interest. The membranes were analyzed by an SH-520 Gel Imaging Analysis System (Shenhua Bio, Shanghai, China) and quantified by ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF) Assay\u003c/h2\u003e \u003cp\u003eThe cells were seeded onto glass coverslips (Biosharp, Hefei, China), treated with the indicated compounds for 48 hours, and fixed in 4% paraformaldehyde for 5 min. After being washed with PBS three times, the cells were permeabilized with 0.2% Triton X-100 for 3 min, blocked with 5% BSA for 60 min at room temperature, and probed with primary antibodies against Ki67 (1:300, #A21861, ABclonal), γH2AX (1:300, #AP0099, ABclonal), RPS23 (1:200, #BF8511, AFfirm), and OGFOD1 (1:200, #A16543, ABclonal) for 60 min at room temperature. Then, the cells were exposed to Alexa Fluor 594-labeled (red) anti-rabbit or FITC-labeled (green) anti-rabbit secondary antibodies (Bioss, Beijing, China) and stained with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI) (Beyotime, Shanghai, China). Image acquisition was achieved using an EVOS M7000 intelligent imaging system (Thermo Fisher Scientific, Lafayette, USA) and a STEDYCON (Abberior, Gottingen, Germany) attached to a Olympus BX53 (Olympus, Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTCA-targeted metabolic flux analysis\u003c/h2\u003e \u003cp\u003eAfter the cells completely adhered to the wall, the old medium was discarded, and the adherent cells were gently washed twice with PBS. Then, the PBS was discarded, and the prepared D-glucose-\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003eC\u003csub\u003e6\u003c/sub\u003e (Macklin, Shanghai, China)-labeled medium was added to the Petri dish to continue culture. The cells were collected after 24 hours of culture. Metabolites were extracted from cells using acetonitrile: water (1:1) and derived with 3-nitrophenylhydrazine. The metabolites were analyzed by a Jasper HPLC-Sciex 4500 MD. The chromatographic conditions were as follows: Phenomenex Kinetex C18 chromatographic column (100 \u0026times; 2.1 mm, 2.6 \u0026micro;m). Mobile phase A was 0.1% formic acid in water, and mobile phase B was 0.1% formic acid in acetonitrile.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eTPP\u003c/h2\u003e \u003cp\u003eAfter centrifugation at 12000 \u0026times; g for 10 min at 4\u0026deg;C, low-generation and high-generation ADSC cells were mixed at a 1:1 ratio and then lysed in PBS supplemented with 1% EDTA-free cocktail to obtain soluble proteins. The supernatant was divided into three equal parts, two of which were treated with 5 \u0026micro;M aKG and 40 \u0026micro;M aKG (dissolved in pure water), and the other was treated separately with the same amount of pure water as the vehicle. The protein extract was incubated for 30 min with aKG or pure water at room temperature, heated for 4 min at 52 ℃, and then cooled for 3 min at room temperature. The heated pyrolysis products were centrifuged at 20000 \u0026times; g for 20 min at 4\u0026deg;C to separate soluble proteins from precipitated proteins. The collected supernatant was divided into two parts: one was separated by sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis (SDS‒PAGE) to quantify the protein band strength, and the other was analyzed by TMT-based quantitative proteomics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCETSA\u003c/h2\u003e \u003cp\u003eFor the validation of RPS23 based on western blotting analysis by TPP, two portions of ADSC cell lysates incubated with DMSO or 100 \u0026micro;M aKG were divided into eight aliquots. All aliquots were heated individually at different temperatures for 4 min. After cooling on ice for 3 min, the soluble fraction was obtained by centrifugation as described above and used for western blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eSIP\u003c/h2\u003e \u003cp\u003eA solvent-induced protein precipitation assay was conducted as described previously \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. The two portions of ADSC cell lysate incubated with DMSO or 100 \u0026micro;M aKG were divided into seven aliquots. Denaturation is initiated by the addition of an acetone/ethanol/acetic acid (A.E.A.) mixture of organic solvents. When the ratio of organic solvent was 50:50:0.1, the final organic solvent ratio ranged from 9\u0026ndash;16%. After equilibrating at 37\u0026deg;C for 20 min, the soluble fraction was obtained by centrifugation as described above and used for western blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT‒PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using a total RNA extraction kit (Bioss, Beijing, China). RNA was reverse-transcribed to complementary DNA (cDNA) with ABScript III Reverse Transcriptase (ABclonal, Wuhan, China). Quantitative real-time reverse transcription polymerase chain reaction (RT‒PCR) was performed using Universal Blue qPCR SYBR Green Master Mix (Yeasen, Shanghai, China). The 20 \u0026micro;L reaction mixture contained 400 nM primers, 10 \u0026micro;L of qPCR SYBR Green Master Mix, 2 \u0026micro;L of template cDNA, and nuclease-free water. cDNA amplification was conducted via QuantStudio\u0026trade; 7 Flex quantitative real-time PCR (Applied Biosystems, Foster City, USA) following the manufacturer\u0026rsquo;s instructions. GAPDH was used as an internal control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eIDH1 activity assay\u003c/h2\u003e \u003cp\u003eTo detect the direct effect of Scu on the IDH1 protein in MSCs, IDH1 antibody plates were generated by coating IDH1 antibody (Proteintech, Wuhan, China) onto 96-well plates (100 ng/well) overnight at 4\u0026deg;C. ADSC lysates were added to IDH1 antibody plates, incubated at room temperature for 2 hours, and then washed with PBS to remove unbound protein to obtain IDH1 protein plates. After incubation for 1 h with varying concentrations of Scu in IDH1 protein plates, three washes with PBS were performed, and the relative IDH1 activity was detected with a Cytoplasmic Isocitrate Dehydrogenase (ICDHc) Activity Detection Kit (Solarbio, Beijing, China) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDifferential scanning fluorimetry (DSF)\u003c/h2\u003e \u003cp\u003eA total of 10 \u0026micro;L of RPS23 recombinant protein (0.2 \u0026micro;g) was mixed with 2 \u0026micro;L of aKG (100 \u0026micro;M) or 2 \u0026micro;L of PBS in a reaction mixture containing 5 \u0026micro;L of protein thermal shift buffer and 2.5 \u0026micro;L of protein thermal shift dye (Thermo, Foster City, USA). The prepared reaction mixture was transferred to a 0.1 mL multistrip PCR tube. DSF was performed using QuantStudio\u0026trade; 7 Flex quantitative real-time PCR (Applied Biosystems, Foster City, USA), and each melting curve was programmed as follows: 25\u0026deg;C for 2 min, followed by a 1\u0026deg;C increase per min from 25\u0026deg;C to 95\u0026deg;C and finally 95\u0026deg;C for 2 min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eGeneration and characterization of MSCs with Gene Knockdown and Overexpression\u003c/h2\u003e \u003cp\u003eThe three highest-scoring shRNA sequences targeting human IDH1 were designed and synthesized by using the pLV-U6-SHRNA-CMV-EGFP(T2A)-PURO vector (Scilia, Beijing, China). The human IDH1 gene expression lentiviral vector was designed and synthesized by using the pLV[Exp]-mCherry:T2A:Bsd-EF1A\u0026thinsp;\u0026gt;\u0026thinsp;FLAG/hIDH1 vector (VectorBuilder, Guangzhou, China). The shRNA sequences targeting human OGFOD1 were designed and synthesized by using the pRP[shRNA]-Bsd-U6\u0026thinsp;\u0026gt;\u0026thinsp;hOGFOD1 vector (VectorBuilder, Guangzhou, China). The IPTG-inducible shRNA sequences targeting human OGFOD1 were designed and synthesized by using the pLV[shRNA]-LacI:T2A:Bsd-U6/2xLacO\u0026thinsp;\u0026gt;\u0026thinsp;hOGFOD1 vector (VectorBuilder, Guangzhou, China). Empty vectors were used as negative controls. A Lentiviral Packaging Kit (Biorigin, Beijing, China) was used for lentiviral packaging according to the manufacturer\u0026rsquo;s protocols. The cells were then infected with lentivirus concentrate for 24 hours and cultured in MSCs expansion medium. After 72 hours, puromycin or blasticidin was used to select gene knockdown and overexpression cell lines, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eCD73 (1:50, #bs-4834R-APC, Bioss), CD90 (1:100, #16897-MM10-P, SinoBiological) and CD105 (1:100, #10149-MM13-PE, SinoBiological) as positive markers and CD34 (1:100, #68035-XM01-F, SinoBiological), CD45 (1:50, #10086-MM05-F, SinoBiological) and CD116 (1:100, #A23355, ABclonal) as negative markers, which were used to characterize MSCs by a Beckman Coulter CytoFLEX (Beckman Coulter, California, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eOsteogenic and adipogenic\u003c/h2\u003e \u003cp\u003eFollowing the manufacturer's instructions, a human-related stem cell osteogenic differentiation kit (Cyagen, Suzhou, China) and a human-related stem cell adipogenic differentiation kit (Cyagen, Suzhou, China) were used to induce the osteogenic and adipogenic differentiation of MSCs, respectively. After 25 days of osteogenesis and lipogenesis, calcium nodules and lipid droplets were observed and photographed under a microscope after staining with Alizarin Red S (Cyagen, Suzhou, China) and Oil Red O (Cyagen, Suzhou, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eBLI analysis\u003c/h2\u003e \u003cp\u003eThe binding affinities of the compounds for recombinant RPS23 were determined by a biolayer interferometry assay using Gator Plus (Gator Bio, California, USA). The recombinant RPS23 protein was labeled with a 2-fold molar amount of biotin reagent, and unbound biotin was removed by ultrafiltration. The SMAP biosensor probe (Gator Bio, California, USA) was prewetted with kinetic buffer (PBS, 0.05% BSA, 0.01% Tween 20), and then biotin-labeled recombinant protein was loaded onto the equilibrated SMAP biosensor probe. A group of probes incubated in protein-free buffer was used as a control. All the data were analyzed by GatorBio data analysis software, and the equilibrium dissociation constant (K\u003csub\u003ed\u003c/sub\u003e) was calculated according to the ratio of K\u003csub\u003eoff\u003c/sub\u003e to K\u003csub\u003eon\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation\u003c/h2\u003e \u003cp\u003eWhole-cell lysates were prepared using RIPA lysis buffer (Epizyme, Shanghai, China) supplemented with complete protease inhibitor cocktail (Selleck, Houston, USA) and incubated with 40 \u0026micro;L of Protein G Magnetic Beads (Yeasen, Shanghai, China) bound to the corresponding antibodies at 4\u0026deg;C overnight. After washing with PBS three times, the immunoprecipitate was analyzed by Western blotting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eTranslation fidelity dual luciferase assays for use in MSCs\u003c/h2\u003e \u003cp\u003eTo measure translation fidelity in MSCs, we used a previously published double luciferase p2luci plasmid \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Insert GCAGGAACACAATAGCAATTACAGA as an STOP reference at the polylinker for the insertion window position between Renilla Luc and firefly Luc and insert GCAGGAACACAACAGCAATTACAGA as a no-STOP reference at the polylinker for the insertion window position between Renilla Luc and firefly Luc. These translation fidelity reports were cloned and inserted into the modified pLV-EF1A vector (VectorBuilder, Guangzhou, China). The percentage of stop codon readthrough was calculated by dividing the Firefly/Renilla ratio of the stop codon readthrough or miscombination report by the average Firefly/Renilla of the control report, as in previously published literature \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eProtein expression and purification\u003c/h2\u003e \u003cp\u003eRPS23 (residues 1 to 143) was cloned and inserted into the NdeI/Xho I sites of the pET-28a\u0026thinsp;+\u0026thinsp;vector. The recombinant plasmids were transformed into \u003cem\u003eE. coli\u003c/em\u003e BL21 (DE3) cells (Vazyme, Nanjing, China), cultured in 300 mL of Luria\u0026ndash;Bertani (LB) medium at 37\u0026deg;C until the absorbance at OD\u003csub\u003e600\u003c/sub\u003e reached 0.4\u0026ndash;0.6, after which the cells were induced with 0.4 mmol/L isopropyl-D-thiogalactopyranoside (IPTG) for 6 h at 16\u0026deg;C. To obtain the nondenatured protein, cell debris was removed by centrifugation, and the supernatant was loaded onto preequilibrated Ni-NTA resin (Beyotime, Shanghai, China). Proteins were eluted using 200 mM imidazole. Then, the imidazole solution was replaced with a PBS solution by ultrafiltration. Finally, the protein concentration was measured using a BCA kit (Solarbio, Beijing, China), and the final protein was concentrated to 10 mg/ml and stored at 4\u0026deg;C.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eMicrofluidic device fabrication\u003c/h2\u003e \u003cp\u003e Microfluidic devices were designed and calibrated using polydimethylsiloxane (PDMS) materials (Wenhao, Suzhou, China) to construct liver organoids and intestinal barriers according to previous studies. The intestinal barrier was formed via \u003cem\u003ein situ\u003c/em\u003e culture, and liver organoids were added after the induction of maturation. CaCO\u003csub\u003e2\u003c/sub\u003e cells were seeded in transwell plates (Corning, NY, USA) and cultured continuously for 14 days to form the intestinal barrier. IPSC-derived liver organoid induction methods were described in previous articles \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Quality control of the intestinal barrier and liver organoids was performed. Crystal violet (0.1%) and 100 \u0026micro;M 2-NBDG probe staining were used to test the integrity of the barrier. The expression of the markers CYP3A4 (1:100, 67110-1-Ig, Proteintech), ALB (1:100, 16475-1-AP, Proteintech), AFP (1:100, 14550-1-AP, Proteintech) and FOXA2 (1:100, 22474-1-AP, Proteintech) in liver organoids was tested using immunofluorescence. Liquid chromatography was used to detect the concentration differences of Scu under different metabolic modes in the culture media. After 24 hours of cyclic cultivation in the entire device, the levels of aging biomarkers of mesenchymal stem cells were detected by immunofluorescence.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eJC-1 assay\u003c/h2\u003e \u003cp\u003eAll cells were stained using a JC-1 staining kit (Beyotime) following the manufacturer\u0026rsquo;s instructions. After staining, the cells were immediately examined using an EVOS M7000 intelligent imaging system (Thermo Fisher Scientific).\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eMicro-CT analysis\u003c/h2\u003e \u003cp\u003eMouse femurs were removed and placed in PBS at room temperature for testing. The distal femurs were scanned with a Micro-CT image system (SkyScan 1276, Bruker, Germany). A voltage of 60 kV, current of 200 \u0026micro;A, scanning resolution of 6.5 \u0026micro;m and visual field size of 2016*1344 were used to scan the femurs of the mice. Using the lowest end of the growth plate of the knee joint of the femur as the baseline, the bone marrow cavity region with a thickness of 1 mm was selected as the region of interest for three-dimensional reconstruction (ROI). The three-dimensional image was reconstructed with NRecon software and analyzed by DataViewer, CTan and CTvox software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eBehavioral studies\u003c/h2\u003e \u003cp\u003eAll behavioral testing procedures included the Y maze and Morris water maze, according to the methods previously described by Li et al. \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eLuminex\u003c/h2\u003e \u003cp\u003eMouse serum multiplex cytokines were detected according to the instructions of the Bio-Plex Pro Human Cytokine Screening Panel, 48 Plex Kit (Bio-Rad, California, USA). Briefly, magnetic beads were added to a 96-well plate and washed with wash buffer. Mouse serum was then added to the 96-well plate with magnetic beads and incubated for 30 min at room temperature. After washing, antibodies were added, and the plates were incubated for 30 min. After washing, streptavidin PE was added, the plates were incubated for 10 min after shaking, the plates were washed, the detection solution was added, and the proteins were measured on a Bio Plex 200 system (Bio-Rad, California, USA). The lower limit of each sample for each cytokine was 50 beads. A standard curve was prepared according to the dilution standard concentration in the instructions, and the detection data were converted to pg/mL concentrations.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eQuantification and statistical analysis\u003c/h2\u003e \u003cp\u003e \u003cem\u003eThe\u003c/em\u003e Grubbs test or ROUT test was used to exclude outliers from the experimental data \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. SPSS and GraphPad Prism software were used for statistical analysis. All the data were tested for normality using the Kolmogorov‒Smirnov test or Shapiro‒Wilk test. Normally distributed data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;s.e.m., and nonnormally distributed data are expressed as the mean. The values and interquartile ranges are expressed, and the statistical analysis methods were as follows: (1) Two groups: if the data were normally distributed and consistent with homogeneity of variance, the independent sample t test was used; otherwise, the Wilcoxon signed rank test was used. (2) Paired samples: If the data were normally distributed, the paired samples t test was used; otherwise, the Wilcoxon signed rank test was used; (3) Three or more groups: if the data were normally distributed and conformed to the homogeneity of variances, then one-way analysis of variance was performed, followed by Tukey's test for multiple comparisons; otherwise, the Kruskal‒Wallis H test followed by Bonferroni correction was used for multiple comparisons. (4) Correlation analysis: If the data were normally distributed, Pearson correlation analysis was used; otherwise, Spearman correlation analysis was used. The correlation coefficient is recorded as \"r\", and \"n=\" represents the number of biological repetitions used in this study. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003eaKG can enhance the proliferation of MSCs and delay cell senescence\u003c/h2\u003e \u003cp\u003eAs a catalytic product of IDH1, aKG is considered a central metabolic substance that regulates aging \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. TCA is a hub for integrating metabolism and signaling in the senescence network, and aKG is a tricarboxylic acid cycle (TCA) intermediate. Therefore, we used glucose-\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003eC to detect the production of TCA-related metabolic small molecules in MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Compared to those in lower-generation MSCs, the production of citrate, aconitate, aKG, fumarate, malate, and acetyl-CoA decreased significantly in higher-generation MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, c). Then, we used cell proliferation assay to evaluate the effect of these small molecule metabolites on MSCs and found that only aKG significantly promoted the proliferation of MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f). Dimethyl α-ketoglutarate (DM-aKG) is a cell-permeable derivative of aKG that also significantly improves MSC proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f). Then, we examined aKG levels in MSCs subjected to physiological senescence and D-galactose (D-Gal)-induced pathological replication (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, b and Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ea, b). Compared with young MSCs, aKG levels were significantly lower in all three types of MSCs subjected to pathological and physiological senescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and Fig \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we investigated whether supplementation with aKG may have geroprotective effects on human MSCs. Our investigations revealed that the administration of both aKG and its dimethyl ester DM-aKG resulted in elevated intracellular concentrations of aKG, with DM-aKG demonstrating efficacy at substantially lower dosages relative to aKG (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Subsequently, to elucidate the influence of aKG on the senescence of MSCs, we proceeded to evaluate the effects of DM-aKG supplementation. Our study shown that cell proliferation was greater in the group supplemented with DM-aKG than in the control group, as indicated by growth curve analysis, a clonal expansion assay, and the percentage of Ki67\u003csup\u003e+\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-f). Similarly, we observed that DM-aKG delayed cellular senescence in human MSCs, as evidenced by decreased numbers of senescence-associated β-galactosidase (SA-β-Gal)-positive cells, decreased expression of DNA damage-related γH2AX proteins, decreased expression of the senescence markers p16, p21, IL6 and IL8, and increased expression of LMNB1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg-k). Overall, our study revealed that aKG is a potential metabolic marker of MSC senescence and that a reduction in aKG production may be one of the factors driving MSC senescence.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eaKG directly binds to RPS23 and regulates RPS23 hydroxylation\u003c/h2\u003e \u003cp\u003eTo investigate the molecular mechanism by which aKG delays MSCs senescence, we employed an unbiased biochemical method known as the thermal proteome profiling-cellular context thermal shift (TPP) assay \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Given our hypothesis that the key targets of aKG may be conserved and universally expressed, we used human adipose mesenchymal stem cells (ADSCs) as the protein source for TPP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The detectable proteins in the soluble fraction of the cell lysate were quantified by mass spectrometry (Fig \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003ea and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Enrichment analysis revealed a strong correlation between aKG targets and ribosomal function (Fig \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eb). Further screening experiments identified RPS23 as the main target protein of aKG, as confirmed by differential scanning fluorimetry (DSF), cellular thermal shift assay (CETSA) and solvent-induced protein precipitation (SIP) experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec-g). Next, biolayer interferometry (BLI) analysis showed that aKG specifically bound to RPS23 with a dissociation constant (K\u003csub\u003ed\u003c/sub\u003e) of 6.16 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). Previous studies have shown that OGFOD1 catalyzes the prolyl hydroxylation of RPS23 in eukaryotes and that aKG is an important cofactor in this process (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei) \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Therefore, we first examined changes in OGFOD1 and RPS23 protein levels and RPS23 protein hydroxylation in senescent MSCs. Our study found that there were no significant changes in OGFOD1 and RPS23 protein expression levels in senescent MSCs compared to young MSCs, whereas RPS23 protein hydroxylation was significantly reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ej). Interestingly, DM-aKG supplementation increased RPS23 hydroxylation in senescent MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ek). Next, we indirectly assessed the effect of aKG on RPS23 hydroxylation by detecting the formation of the OGFOD1‒RPS23 complex. Similarly, our study found that RPS23 and OGFOD1 co-localization signal levels were reduced in senescent MSCs compared to young MSCs, and DM-aKG supplementation increased RPS23 and OGFOD1 co-localization signal levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003el). Finally, we probed anti-OGFOD1 immunoprecipitates with an antibody against RPS23 and anti-RPS23 immunoprecipitates with an antibody against OGFOD1. These experiments revealed similar results, with RPS23 migrating at 16 kDa, OGFOD1 at 63 kDa, and the presence of an 80-kDa OGFOD1‒RPS23 complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003em, n). In conclusion, our study revealed a direct interaction between aKG and RPS23, and supplementation with aKG can enhance the hydroxylation of RPS23, and increase the formation of OGFOD1‒RPS23 complexes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eIncreased aKG production induced by the overexpression of IDH1 delays MSC senescence\u003c/h2\u003e \u003cp\u003eAs aKG supplementation can significantly improve the proliferative activity of MSCs, we screened proteins in the TCA cycle that can produce aKG (Fig S3). With increasing generations of MSCs, the senescence markers p16 and p21 were significantly increased, but only IDH1 expression was significantly decreased in the proteins related to aKG production (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Thus, the decrease in the aKG level may be related to the decreased expression of IDH1. To explore the potential of delaying MSC senescence by manipulating IDH1 expression levels through knockdown and overexpression. We overexpressed IDH1 in low-passage MSCs and detected the senescence phenotype during continuous culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Both IDH1-overexpressing (OE_IDH1) MSCs and OE_CON MSCs were positive for mesenchymal progenitor markers, including CD73, CD90, and CD105 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), and negative for non-MSC markers, such as CD34, CD45, and CD116 (Fig S4a, b). As expected, the level of aKG increased significantly in OE_IDH1 MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Interestingly, the senescence characteristics of OE_CON MSCs were more distinct than those of OE_IDH1 MSCs. Specifically, compared with OE_CON MSCs, fewer OE_IDH1 MSCs were SA-β-Gal-positive (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). OE_IDH1 MSCs also exhibited an increase in cell proliferation, a greater percentage of Ki67-positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef, g), decreased expression of cell senescence markers, including p16, p21, IL6 and IL8, and increased LMNB1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eh, i). In addition, overexpression of IDH1 did not affect OGFOD1 protein and RPS23 levels, but significantly increased RPS23 protein hydroxylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ei), suggesting that overexpression of IDH1 promotes RPS23 protein hydroxylation by increasing aKG levels. We finally compared the multipotent differentiation potential of OE_IDH1 and OE_CON MSCs. Both OE_IDH1 and OE_CON MSCs differentiated into white adipocytes and osteoblasts with comparable efficiency (Fig S4c-f).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we studied whether IDH1 is necessary for maintaining long-term intracellular homeostasis of MSCs. In contrast to IDH1 overexpression, aKG decreased significantly after IDH1 knockdown in MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Similarly, knockdown of IDH1 (Sh_IDH1) in MSCs resulted in premature senescence, including progressive impairment of cell proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb), increased numbers of SA-β-Gal\u003csup\u003e+\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), decreased numbers of Ki67\u003csup\u003e+\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed), and increased expression of the DNA damage marker γH2AX (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). In addition, compared to those in Sh_CON MSCs, the expression of the senescence markers p16, p21, IL6 and IL8 was upregulated, while the expression of LMNB1 was downregulated in Sh_IDH1 MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef-h). Importantly, we increased the aKG level in Sh_IDH1 MSCs by supplementing exogenous aKG and found that supplementing DM-aKG partially reversed the premature senescence induced by IDH1 knockdown in MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb-h). In addition, our study found that knockdown of IDH1 did not affect the expression levels of OGFOD1 and RPS23 proteins, but significantly inhibited the hydroxylation of PRS23 protein, while exogenous aKG supplementation could restore the hydroxylation level of RPS23 protein to some extent (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg-h). In summary, these results confirm that IDH1 functions as a geroprotector for MSCs and that the reduction in aKG resulting from decreased IDH1 expression leads to MSC senescence.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003eaKG ensures translation accuracy in MSCs via the hydroxylation of RPS23\u003c/h2\u003e \u003cp\u003eMutations in RPS23 have been associated with the modulation of translation accuracy \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Additionally, hydroxylation of RPS23 (HO-RPS23) affects ribosome translation accuracy in eukaryotes \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. To investigate this further, we adapted our \u003cem\u003ein vivo\u003c/em\u003e reporters to detect common translation errors and stop codon readthroughs in ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). First, we validated our reporting system with the drug paromomycin, which causes translation errors. We observed a dose-dependent increase in translational error (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb and Fig S5). We also found a significant increase in stop codon readthrough in physiologically senescent ADSCs compared to young ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, d). Importantly, aKG and its analog DM-aKG improved translational fidelity and decreased stop codon readthrough in senescent ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, d). Furthermore, the decrease in stop codon readthrough induced by aKG and DM-aKG was inhibited by the Fe(II) chelator 2,2-dipyridyl (DIP) and the panhydroxylase inhibitor dimethyloxalylglycine (DMOG) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, d and Fig S5). Next, we investigated the effect of IDH1 knockdown and overexpression on stop codon readthrough in ADSC cells. Overexpressing IDH1 in physiologically senescent ADSCs significantly reduced stop codon readthrough, and this effect was inhibited by DIP and DMOG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee). Similarly, knocking down IDH1 in low-passage ADSCs increased stop codon readthrough, which was inhibited by aKG or DM-aKG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further demonstrate whether aKG regulates protein translation accuracy through RPS23 hydroxylation, we constructed IPTG induced OGFOD1 knockdown ADSCs (Sh_OGF#1) and conventional OGFOD1 knockdown ADSCs (Sh_OGF#2). Our study found that, with increasing IPTG induction time, decreased OGFOD1 protein expression resulted in decreased RPS23 protein hydroxylation, and RPS23 protein hydroxylation was significantly decreased in Sh_OGF#2 ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg). This indicates that OGFOD1 plays an important role in the hydroxylation of RPS23 protein. Further, we found that the hydroxylation level of RPS23 protein decreased gradually with the extension of IPTG induction time, resulting in the increase stop codon readthrough of ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh). At the same time, stop codon readthrough was significantly increased in Sh_OGF#2 ADSCs and could not be reduced by supplementation of aKG and DM-aKG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ei). Similarly, we found that DIP and DMOG also inhibited the promotion of ADSC proliferation by aKG or DM-aKG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ej, k). Importantly, after knocking down OGFOD1, the proliferation activity of ADSCs was significantly reduced, and the effects of aKG and DM-aKG on cell proliferation disappeared (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003el). In conclusion, the above studies demonstrated that the IDH1-αKG-OH-RPS23 signaling axis regulates the accuracy of protein translation in MSCs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003eIDH1 small molecule agonists could maintain MSC proliferation and delay senescence\u003c/h2\u003e \u003cp\u003eSince activation of IDH1 can promote the production of aKG \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, we subsequently explored anti-aging strategies by activating IDH1. In our previous study, we discovered that Scu, a naturally active molecule, can enhance IDH1 enzyme activity in HepG2 cells and stimulate aKG production \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea, we measured aKG and NADPH levels in MSCs to evaluate the effect of Scu on IDH1 enzyme activity. Similarly, our study revealed that Scu restored aKG levels in physiologically aged MSCs, with an EC\u003csub\u003e50\u003c/sub\u003e of 14.47 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb, c). Strikingly, our results indicated that Scu significantly increased the proliferation of MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed), and contributed to sustaining their proliferative capacity during long-term culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee). This was evidenced by an increase in colony formation rate and the number of Ki67\u003csup\u003e+\u003c/sup\u003e cells, and the decrease in the expression of γH2AX (Fig S6). In addition, long-term supplementation with Scu significantly reduced the number of senescence-associated SA-β-Gal\u003csup\u003e+\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ef), decreased the expression of p16 and p21, and increased the hydroxylation of PRS23 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eg and Fig S6c). In addition, we utilized D-GAL to induce pathological senescence in MSCs to examine the effect of Scu on this process. Consistently, Scu increased aKG production in pathologically senescent MSCs (Fig S7a) and significantly ameliorated D-GAL-induced senescence (Fig S7b). Following D-GAL induction, MSCs exhibited a reduction in Ki67\u003csup\u003e+\u003c/sup\u003e cell and colony proliferation; an increase in γH2AX expression; upregulation of p16, p21, IL6, and IL8; and downregulation of LMNB1 (Fig S7c-f). These results indicate that Scu significantly ameliorated both physiological senescence and pathological senescence induced by D-GAL in MSC cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilar to the effect of aKG, Scu significantly increased the interaction between RPS23 and OGFOD1 protein in ADSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eh, i). In physiological senescent ADSCs, Scu significantly inhibited stop codon readthrough (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ej). Importantly, the effect of Scu on codon readthrough and proliferation activity of ADSCs could be eliminated by DMOG, DIP, and knockdown of OGFOD1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ej-m). The above results show that by activating IDH1 to promote aKG production, Scu can promote RPS23 hydroxylation and delay the senescence of MSCs. Overall, our study highlights the potential of Scu to improve MSCs proliferation and delay senescence by activating the IDH1-aKG-OH-RPS23 signaling axis.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e\n\u003ch3\u003eSimulating an IDH1 small molecule agonist improves the senescence phenotype in vivo using microfluidic devices\u003c/h3\u003e\n\u003cp\u003eSince there is currently a lack of animal models for evaluating MSCs, we constructed an intestinal barrier-liver organoid model that simulates the drug metabolism environment \u003cem\u003ein vivo\u003c/em\u003e to evaluate the effects of drugs on MSCs after intestinal absorption and liver metabolism. A composite microfluidic device was constructed by incorporating transwell cells immersed in a flowing culture medium. These transwell cells consisted of an intestinal barrier, liver organoids, and mesenchymal stem cells, all positioned on the upper surface of the transwell chamber. Each transwell cell was fully submerged in maintenance medium, establishing stable internal circulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea). The intestinal barrier was formed via \u003cem\u003ein situ\u003c/em\u003e culture, and liver organoids were added after the induction of maturation. After intestinal barrier formation, quality control was performed. Crystal violet staining and 2-NBDG probe staining revealed a compact cell layer without gaps (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb). Immunofluorescence of liver organoids induced by human induced pluripotent stem cells (iPSCs) clearly revealed the expression of liver biomarkers in the organoids (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ec). We utilized this device to study the impact of 90 \u0026micro;g/mL Scu in circulating culture under different metabolic modes. The intestinal barrier and liver metabolism substantially increased the metabolism of Scu, resulting in a decrease in its concentration within the circulating culture medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ed, e). Using this device, we further evaluated the ability of 90 \u0026micro;g/mL Scu to delay D-Gal-induced MSC senescence. Moreover, Scu improved the activity and senescence phenotype of D-Gal-induced senescent MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ef), increased Ki67 expression in D-Gal-induced senescent cells, and reduced γH2AX expression in D-Gal-induced senescent MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eg, h). Furthermore, staining with the mitochondrial membrane potential probe JC-1 indicated that Scu enhances membrane potential aggregation in MSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ei). In conclusion, we successfully constructed an intestinal barrier-liver organoid microfluidic device to simulate the \u003cem\u003ein vivo\u003c/em\u003e environment and found that Scu also delayed MSC senescence in this system.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eIDH1 small molecule agonists improve the aging phenotype in aged mice\u003c/h3\u003e\n\u003cp\u003eFinally, we used 20-month-old mice to evaluate the effect of Scu on the aKG level, behavioral outcomes, bone status and senescence-associated secretory phenotype (SASP) \u003cem\u003ein vivo\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea). After 80 days of Scu administration, we measured aKG levels in various tissues and observed a significant increase in aKG levels in the kidney, brain, skeletal muscle, serum, etc. (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eb). In addition, we noted an increase in aKG levels in bone marrow hematopoietic stem cells from mice treated with Scu (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ec). The Morris water maze test is widely utilized to assess cognitive decline, which is an important aging phenotype. Compared with the control group, the group treated with Scu showed improved learning and decreased escape latency during the 5-day training phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ed-e). Moreover, during the probe trial test, in which the hidden platform was removed on day 6, the Scu-treated group spent significantly more time in the target quadrant (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ef-g). The group treated with Scu also completed more entries into the platform location and needed less time to travel from the entry point to the target zone (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eh-i). Furthermore, the Scu group also showed increased spontaneous alternations compared to the control group in the Y-maze test (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ej-k). In addition, Scu improved the skin and bone status of aged mice, as evidenced by increased skin thickness, elevated bone volume fraction (BV/TV), enhanced trabecular bone number (Tb.N), increased bone mineral density (BMD), and decreased structural model index (SMI) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003el-q). Additionally, analysis of multiple serum factors revealed that Scu significantly reduced the SASP in aged mice. In conclusion, IDH1 small molecule agonists ameliorate the aging phenotype in aged mice to some extent, suggesting potential applications in aging-related conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, we found that reduced aKG production caused by decreased IDH1 levels drives premature senescence of human MSCs by increasing the misynthesis of proteins. We found that aKG decreased in both physiologically and pathologically senescent human MSCs, which was attributed to the reduced expression of IDH1. In addition, IDH1 knockdown accelerated the senescence of human MSCs, while exogenous supplementation with aKG and IDH1 overexpression delayed these processes. Mechanistic analysis revealed that IDH1 tightly regulates the production of aKG, and in turn, aKG maintains the translation of proteins by promoting the hydroxylation of RPS23. Therefore, low levels of IDH1 lead to insufficient aKG production, decreased RPS23 hydroxylation, reduced protein translation accuracy, and accelerated cell senescence. We found that in the context of IDH1 overexpression, supplementation with aKG and IDH1 small molecule agonists could maintain the proliferation of MSCs and delay their senescence. In summary, our work unveiled the previously unrecognized role of IDH1 in regulating protein translation and cell senescence. This discovery deepens our understanding of how the accurate translation of proteins can govern the homeostasis of human MSCs.\u003c/p\u003e \u003cp\u003eIDH1 has been extensively investigated in various biological settings. For example, IDH1 acts as a cytoplasmic enzyme that catalyzes the reversible transformation of isocitrate and aKG. Some studies have shown that IDH1, an antioxidant gene, can protect granulosa cells from aging-related oxidative stress in humans and monkeys \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In addition to its enzyme activity, studies have shown that IDH1 functions as an RNA-binding protein that is directly involved in fine-tuning the initiation of transcript translation. Additionally, IDH1 is implicated in various cellular processes, including chromatin structure and transcriptional regulation, cell cycle regulation, and RNA processing \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. However, little is known about the role of IDH1 in regulating human stem cell homeostasis. IDH1 is essential for maintaining homeostasis in human MSCs, consistent with the observed tolerance of pluripotent stem cells to cellular defects \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Previous studies have reported various effects of aKG, the primary catalytic product of IDH1. For example, aKG is implicated in gene transcriptional regulation and cell cycle control \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. A decrease in the aKG level caused by IDH1 depletion leads to cell arrest in the G1 phase, while aKG supplementation promotes cell cycle progression \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In addition, intracellular aKG has been reported to maintain the pluripotency of embryonic stem cells \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. The self-renewal of embryonic stem cells is directly supported by the increase in cell permeability aKG \u003cem\u003ein vitro\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. However, little is known about the role of aKG in regulating the senescence of human MSCs. Consistent with previous studies, our study revealed that decreased expression of IDH1 is a primary cause of decreased aKG levels in senescent MSCs and that supplementation with aKG in IDH1-knockdown MSCs can partially reverse the senescence phenotype. Additionally, long-term supplementation with aKG during MSC proliferation maintained the proliferation activity and reduced the senescence of MSCs. Notably, increasing aKG levels in MSCs through the IDH1 agonist Scu successfully delayed MSC senescence and significantly improved the aging phenotype of aged mice \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eA study on age-related osteoporosis showed that the aKG level in bone marrow MSCs isolated from aged mice was significantly lower than that in bone marrow MSCs isolated from young adult mice, and \u003cem\u003ein vitro\u003c/em\u003e supplementation with aKG significantly increased bone mass in aged mice, reduced age-related bone loss, and accelerated bone regeneration in aged rodents \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. The main mechanism underlying these effects is that aKG improves the senescence-related phenotype of bone marrow MSCs from aged mice by regulating histone methylation. aKG also promotes the proliferation, colony formation, migration, and osteogenic potential of bone marrow MSCs \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Similarly, our study revealed that the IDH1 small molecule agonist Scu successfully increased the level of aKG in bone marrow MSCs and in various tissues of aged mice. Scu significantly improved several aging phenotypes in mice, including improved learning and memory ability, ameliorated osteoporosis, increased dermal thickness, and inhibited aging-related secretory phenotypes. This shows that IDH1 small molecular agonists have great potential for promoting MSC regeneration and delaying senescence.\u003c/p\u003e \u003cp\u003eDisorder of protein balance is a key factor in aging and age-related diseases, and translation is one of its key determinants \u003csup\u003e\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Many studies have shown that increased fidelity of protein synthesis has a life-prolonging effect on unicellular and multicellular eukaryotes \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Drugs commonly used for anti-aging, such as rapamycin, torin1, and trametinib, can reduce translation errors, suggesting that maintenance of the fidelity of protein synthesis may serve as a common mechanism underlying the anti-aging effects of these drugs \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. In this study, we revealed the significance of the endogenous metabolite aKG for the protein translation accuracy of MSCs. With increasing culture passages, aKG levels in MSCs decreased gradually, and protein translation errors increased. Supplementation with aKG significantly reduced protein mistranslation. Consistent with previous reports that IDH1 deficiency inhibited proliferation in human granulosa cells \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, we found that knockdown of IDH1 led to a decrease in aKG levels and RPS23 protein hydroxylation in MSCs, resulting in a significant increase in stop codon readthrough; overexpression of IDH1 increased aKG levels and RPS23 protein hydroxylation in MSCs, thereby significantly reducing stop codon readthrough, maintaining cell proliferation and delaying senescence. Our findings suggest that the overexpression of IDH1 endows human MSCs with stronger proliferation ability and greater anti-senescence ability, further supporting the anti-senescence effect of IDH1 in human MSCs.\u003c/p\u003e \u003cp\u003eMechanistically, we found that low levels of IDH1 reduced the production of aKG, affected the normal hydroxylation of RPS23, increased the mistranslation of proteins, and ultimately accelerated the senescence of MSCs. Some studies have shown that OGFOD1 catalyzes RPS23 hydroxylation, which in turn affects translation accuracy \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In this process, aKG is an important cofactor of RPS23 hydroxylation catalyzed by OGFOD1 \u003csup\u003e18,41\u003c/sup\u003e. Interestingly, our study found direct binding of aKG to RPS23, which may be related to aKG promoting the interaction between RPS23 and OGFOD1. Our research show that after OGFOD1 was knocked down, the level of RPS23 protein hydroxylation in MSCs decreased, and the regulation of protein translation accuracy and cell proliferation activity by aKG disappeared. This suggests that OGFOD1‒HO-RPS23 plays an important role in the process of aKG promoting RPS23 protein hydroxylation and thus regulating protein translation accuracy. Similarly, we successfully increased the accuracy of protein synthesis by overexpressing IDH1 and using IDH1 small molecule agonists to increase aKG levels and promote hydroxylation of RPS23 protein. Several studies suggest that aKG or IDH1 activity promotes stem cell proliferation by reducing repressive histone modifications\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Our study suggests that improving translational fidelity is another indispensable mechanism for aKG in maintaining stem cell health. Overall, our study provides a potential way to mitigate MSC senescence by regulating appropriate protein synthesis, although the exact mechanism by which aKG promotes accurate protein synthesis through RPS23 needs further investigation.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eOur study highlights the crucial role of aKG, which is essential for maintaining protein homeostasis and delaying senescence in MSCs. These findings provide potential insights for the development of IDH1 agonists and the amelioration of aging through small molecule intervention in translation accuracy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhao Cui, Hongjun Yang, and Peng Chen conceived this study. Hongjun Yang and Peng Chen provided financial and administrative support. Zhao Cui, Caifeng Li, Shiwen Deng, Jiameng Li, Wei Liu, and Shuhua Ma conducted most of the experiments. Xiaoxu Wang revised the grammar of the article. Shiwen Deng and Junxian Cao provided advice for this study. Zhao Cui and Peng Chen wrote the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the China Academy of Chinese Medical Sciences Innovation Fund (CI2021A00610), the National Key Research and Development Project of China (2019YFC1708900), the National Natural Science Foundation of China (82274224), the Fundamental Research Funds for the Central Public Welfare Research Institutes of China (JBGS2023002, ZZ-13 YQ-082Y), and the National Key Research and Development Project of China (2019YFC1708900).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS APPROVAL AND CONSENT TO PARTICIPATE\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was approved by the Institutional Animal Care and Use Committee of the Experimental Research Center, China Academy of Chinese Medical Sciences (license no. ERCCACMS21-2203-02).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGyanwali B, Lim ZX, Soh J, Lim C, Guan SP, Goh J et al (2022) Alpha-Ketoglutarate dietary supplementation to improve health in humans. Trends Endocrinol Metab 33:136\u0026ndash;146\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarardo D, Thornton D, Thoppil H, Walsh M, Sharifi S, Ferreira S et al (2017) The DrugAge database of aging-related drugs. Aging Cell 16:594\u0026ndash;597\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayliak MM, Lushchak VI (2021) Pleiotropic effects of alpha-ketoglutarate as a potential anti-ageing agent. Ageing Res Rev 66:101237\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu N, Yang M, Gaur U, Xu H, Yao Y, Li D (2016) Alpha-Ketoglutarate: Physiological Functions and Applications. Biomol Ther (Seoul) 24:1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsadi Shahmirzadi A, Edgar D, Liao CY, Hsu YM, Lucanic M, Asadi Shahmirzadi A et al (2020) Alpha-Ketoglutarate, an Endogenous Metabolite, Extends Lifespan and Compresses Morbidity in Aging Mice. Cell Metab ;32:447\u0026thinsp;\u0026ndash;\u0026thinsp;56.e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDang L, Yen K, Attar EC (2016) IDH mutations in cancer and progress toward development of targeted therapeutics. Ann Oncol 27:599\u0026ndash;608\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Zheng Y, Li J, Yu Y, Zhang W, Song M et al (2020) Single-Cell Transcriptomic Atlas Primate Ovarian Aging Cell 180:585\u0026ndash;600e19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCopes N, Edwards C, Chaput D, Saifee M, Barjuca I, Nelson D et al (2015) Metabolome and proteome changes with aging in Caenorhabditis elegans. Exp Gerontol 72:67\u0026ndash;84\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelsky DW, Caspi A, Houts R, Cohen HJ, Corcoran DL, Danese A et al (2015) Quantification of biological aging in young adults. Proc Natl Acad Sci U S A 112:E4104\u0026ndash;E4110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang XY, Wu S, Wang D, Chu C, Hong Y, Tao M et al (2022) Human organoids in basic research and clinical applications. Signal Transduct Target Ther 7:168\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar A, Yun H, Funderburgh ML, Du Y (2022) Regenerative therapy for the Cornea. Prog Retin Eye Res 87:101011\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu NY, Nolan E, Lindeman GJ, Visvader JE (2020) Stem Cells and the Differentiation Hierarchy in Mammary Gland Development. Physiol Rev 100:489\u0026ndash;523\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStein KC, Morales-Polanco F, van der Lienden J, Rainbolt TK, Frydman J (2022) Ageing exacerbates ribosome pausing to disrupt cotranslational proteostasis. Nature 601:637\u0026ndash;642\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVermulst M, Denney AS, Lang MJ, Hung CW, Moore S, Moseley MA et al (2015) Transcription errors induce proteotoxic stress and shorten cellular lifespan. Nat Commun 6:8065\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConn CS, Qian SB (2013) Nutrient signaling in protein homeostasis: an increase in quantity at the expense of quality. Sci Signal 6:ra24\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez-Miguel VE, Lujan C, Espie-Caullet T, Martinez-Martinez D, Moore S, Backes C et al (2021) Increased fidelity of protein synthesis extends lifespan. Cell Metab 33:2288\u0026ndash;2300 .e12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingleton RS, Liu-Yi P, Formenti F, Ge W, Sekirnik R, Fischer R et al (2014) OGFOD1 catalyzes prolyl hydroxylation of RPS23 and is involved in translation control and stress granule formation. Proc Natl Acad Sci U S A 111:4031\u0026ndash;4036\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoenarz C, Sekirnik R, Thalhammer A, Ge W, Spivakovsky E, Mackeen MM et al (2014) Hydroxylation of the eukaryotic ribosomal decoding center affects translational accuracy. Proc Natl Acad Sci U S A 111:4019\u0026ndash;4024\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Wang Q, Li Y, Ruan C, Wang S, Hu L et al (2020) Solvent-Induced Protein Precipitation for Drug Target Discovery on the Proteomic Scale. Anal Chem 92:1363\u0026ndash;1371\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrentzmann G, Ingram JA, Kelly PJ, Gesteland RF, Atkins JF (1998) A dual-luciferase reporter system for studying recoding signals. RNA 4:479\u0026ndash;486\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Wang H, Deng P, Chen W, Guo Y, Tao T et al (2018) In situ differentiation and generation of functional liver organoids from human iPSCs in a 3D perfusable chip system. Lab Chip 18:3606\u0026ndash;3616\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeng L, Yuan Z, Su X, Chen Z, Yang S, Chen M et al (2023) Hypothalamic Menin regulates systemic aging and cognitive decline. PLoS Biol 21:e3002033\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMotulsky HJ, Brown RE (2006) Detecting outliers when fitting data with nonlinear regression - a new method based on robust nonlinear regression and the false discovery rate. BMC Bioinformatics 7:123\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Z, Li C, Chen P, Yang H (2022) An update of label-free protein target identification methods for natural active products. Theranostics 12:1829\u0026ndash;1854\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTriman KL (2007) Mutational analysis of the ribosome. Adv Genet 58:89\u0026ndash;119\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlksne LE, Anthony RA, Liebman SW, Warner JR (1993) An accuracy center in the ribosome conserved over 2 billion years. Proc Natl Acad Sci U S A 90:9538\u0026ndash;9541\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang S, Gu H, Jin L, Thorne RF, Zhang XD, Wu M (2018) LncRNA IDH1-AS1 links the functions of c-Myc and HIF1α via IDH1 to regulate the Warburg effect. Proc Natl Acad Sci U S A 115:E1465\u0026ndash;e74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Z, Li C, Liu W, Sun M, Deng S, Cao J et al (2024) Scutellarin activates IDH1 to exert antitumor effects in hepatocellular carcinoma progression. Cell Death Dis 15:267\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Li T, Song G, He Q, Yin Y, Lu JY et al (2019) Insight into novel RNA-binding activities via large-scale analysis of lncRNA-bound proteome and IDH1-bound transcriptome. Nucleic Acids Res 47:2244\u0026ndash;2262\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Lu JY, Li F, Xing X, Li T, Yang X et al (2019) IDH1 fine-tunes cap-dependent translation initiation. J Mol Cell Biol 11:816\u0026ndash;828\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Qu J, Suzuki K, Liu GH, Izpisua Belmonte JC (2013) Concealing cellular defects in pluripotent stem cells. Trends Cell Biol 23:587\u0026ndash;592\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, Zhang Z, Li W, Si Y, Li L, Du W (2023) αKG-driven RNA polymerase II transcription of cyclin D1 licenses malic enzyme 2 to promote cell-cycle progression. Cell Rep 42:112770\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarey BW, Finley LW, Cross JR, Allis CD, Thompson CB (2015) Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells. Nature 518:413\u0026ndash;416\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Deng P, Liu Y, Wu Y, Chen Y, Guo Y et al (2020) Alpha-ketoglutarate ameliorates age-related osteoporosis via regulating histone methylations. Nat Commun 11:5596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHipp MS, Kasturi P, Hartl FU (2019) The proteostasis network and its decline in ageing. Nat Rev Mol Cell Biol 20:421\u0026ndash;435\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabbadia J, Morimoto RI (2015) The biology of proteostasis in aging and disease. Annu Rev Biochem 84:435\u0026ndash;464\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteffen KK, Dillin A (2016) A Ribosomal Perspective on Proteostasis and Aging. Cell Metab 23:1004\u0026ndash;1012\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnisimova AS, Alexandrov AI, Makarova NE, Gladyshev VN, Dmitriev SE (2018) Protein synthesis and quality control in aging. Aging (Albany N Y) 10:4269\u0026ndash;4288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evon der Haar T, Leadsham JE, Sauvadet A, Tarrant D, Adam IS, Saromi K et al (2017) The control of translational accuracy is a determinant of healthy ageing in yeast. Open Biol ;7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuhm T, Kaimal JM, Dawitz H, Peselj C, Masser AE, Hanz\u0026eacute;n S et al (2018) Mitochondrial Translation Efficiency Controls Cytoplasmic Protein Homeostasis. \u003cem\u003eCell Metab\u003c/em\u003e ;27:1309-22.e6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorita S, Scotti JS, Thinnes C, Mottaghi-Taromsari YS, Thalhammer A, Ge W et al (2015) Structure of the ribosomal oxygenase OGFOD1 provides insights into the regio- and stereoselectivity of prolyl hydroxylases. Structure 23:639\u0026ndash;652\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Y, Zhang Y, Garc\u0026iacute;a-Ca\u0026ntilde;averas JC, Guo L, Kan M, Yu S et al (2020) Chaperone-mediated autophagy regulates the pluripotency of embryonic stem cells. Science 369:397\u0026ndash;403\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"α-ketoglutaric acid, mesenchymal stem cells, senescence, RPS23, protein homeostasis","lastPublishedDoi":"10.21203/rs.3.rs-5000966/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5000966/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eα-Ketoglutaric acid (aKG) participates in the tricarboxylic acid cycle in the process of cell aerobic metabolism and is of significant physiological importance. Although aKG is genetically associated with human longevity and decreased fertility, its anti-aging mechanism remain largely unknown. Here, we used interdisciplinary techniques such as metabolomics, chemical biology, and organoid microfluidic devices to explore the regulatory effect of aKG on senescence in a mesenchymal stem cell (MSC) model. We found that the expression of isocitrate dehydrogenase 1 (IDH1) in MSCs decreased after senescence, leading to reduced production of the active product aKG. Increasing intracellular aKG by supplementation with exogenous aKG or overexpression of IDH1 can promote MSC proliferation and delay MSC senescence, while inhibiting aKG production by knocking down IDH1 can induce premature MSC senescence. Specifically, aKG facilitates the interaction of ribosomal protein S23 (RPS23) with 2-oxoglutarate and Fe(II)-dependent oxygenase domain containing protein 1 (OGFOD1), and subsequently enhancing the hydroxylation of RPS23. This modulation of the RPS23\u0026ndash;OGFOD1 complex contributes to the augmentation of protein translational fidelity. Finally, we attempted to activate IDH1 as a new anti-aging strategy. IDH1 is activated by the natural active molecule scutellarin (Scu), which not only increases the production of aKG but also delays the senescence of MSCs and ameliorates the aging phenotype of aged mouse. In summary, our study elucidates the effect of aKG on protein translation accuracy during MSC senescence and provides a potential therapeutic target for the treatment of aging-related diseases.\u003c/p\u003e","manuscriptTitle":"The novel target, mechanism and agonist of α-Ketoglutaric acid in delaying mesenchymal stem cell senescence","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-25 06:19:26","doi":"10.21203/rs.3.rs-5000966/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b5d57cf9-8481-4189-8200-07936e0f24c2","owner":[],"postedDate":"September 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":38109714,"name":"Biological sciences/Chemical biology/Target identification"},{"id":38109715,"name":"Biological sciences/Biochemistry/Proteomics"},{"id":38109716,"name":"Health sciences/Diseases/Metabolic disorders"}],"tags":[],"updatedAt":"2024-11-01T03:10:24+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-25 06:19:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5000966","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5000966","identity":"rs-5000966","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}