PknB and STP as Potential Targets of Luteolin in Combating Trueperella pyogenes Infections | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article PknB and STP as Potential Targets of Luteolin in Combating Trueperella pyogenes Infections Yueting Guo, Hongyu Su, Lihui Yu, Yingyu Wang, Chunlian Tian, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5222514/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 6 You are reading this latest preprint version Abstract Trueperella pyogenes ( T. pyogenes ) is a significant opportunistic pathogen that causes suppurative infection in many animals, as well as humans. Considering the strong drug resistance of T. pyogenes , the development of novel antibacterial drugs and drug targets to combat infections is necessary. Serine/threonine protein kinases (STKs) and serine/threonine phosphatases (STPs) play pivotal roles in the physiological processes, pathogenesis, and resistance of several important bacterial pathogens, indicating their potential as antimicrobial drug targets. In this study, we aimed to investigate the effects of luteolin, a natural flavonoid, on serine/threonine protein kinase B (PknB) and serine/threonine phosphatase (STP). The results revealed that after T. pyogenes was treated with 1/2 MIC (39 µg/mL) luteolin for 36 h, the transcription and translation levels of the pknB and stp genes decreased significantly. Molecular docking revealed that hydrophobic forces were predominant in the interaction between luteolin and PknB, whereas hydrogen bonding was predominant in the interaction between luteolin and STP. The results of the molecular interaction assay revealed that the K D value of luteolin with PknB and STP were 3.125×10 − 4 M and 1.128×10 − 5 M, respectively. Additionally, luteolin could inhibit the activities of PknB and STP. Our study demonstrated that luteolin can inhibit PknB and STP at multiple levels, and it is expected to be used as a PknB/STP inhibitor to develop new drugs against drug-resistant bacterial infections. Biological sciences/Drug discovery/Pharmacology Biological sciences/Microbiology/Antimicrobials Trueperella pyogenes Luteolin PknB STP Drug target Inhibitor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Trueperella pyogenes ( T. pyogenes ) is an opportunistic, gram-positive bacterium that causes various infections such as mastitis, pneumonia, liver abscess, metritis, endocarditis, and osteoarthritis. These infections not only cause significant economic losses in the animal husbandry industry but also pose a serious threat to human health and safety 1 , 2 . Aminoglycosides, β-lactams, tetracyclines, macrolides, and fluoroquinolones are commonly used to treat T. pyogenes infections; however, their use may contribute to the emergence of antimicrobial resistance. The development of antimicrobial resistance in T. pyogenes has become a formidable obstacle inhibiting its clinical management 3 – 6 . Consequently, the exploration of novel drug targets and drugs that can effectively combat T. pyogenes infections is crucial. Bacteria can survive under a variety of environmental stimuli. Adaptability is largely attributed to the presence of diverse protein kinases, which enable bacteria to sense and respond to external signals 7 . Signal transduction via reversible phosphorylation is important for environmental adaptation and virulence in pathogenic bacteria 8 . A two-component system, which is composed of histidine kinases (HKs) and response regulators (RRs), is involved in multiple bacterial behaviors by regulating quorum sensing, bacterial pathogenicity, and antimicrobial resistance 9 – 12 . However, recent studies have revealed that eukaryotic-like serine/threonine kinases (eSTKs) and eukaryotic-like serine/threonine phosphatases (eSTPs) are widely distributed in bacteria and are important regulators of several important bacterial pathogens, including Mycobacterium tuberculosis , Streptococcus pneumoniae , Listeria monocytogenes , and Streptococcus suis 13 – 17 . In Streptococcus pyogenes , both STK and STP participate in cell division, adhesion to, and invasion of, epithelial cells, and virulence. Mycobacterium tuberculosis involves eleven Ser/Thr kinases, two of which, PknA and PknB, regulate essential physiologies and antimicrobial susceptibility of Mycobacterium tuberculosis 18 . Based on their critical physiological roles, STK and STP have the potential to be developed as drug targets. In our previous study, we reported that serine/threonine protein kinase B (PknB) and serine/threonine phosphatase (STP), which have potential as drug targets to combat T. pyogenes infections, are present in T. pyogenes . Natural plant products are valuable resources for screening new antibacterial drugs. Luteolin is a natural secondary flavonoid and is widely distributed in vegetables and medicinal plants such as broccoli, honeysuckle, and chrysanthemum. Luteolin exhibits antioxidant, anti-inflammatory, anti-tumor, and antimicrobial effects 19 , 20 . Our previous findings indicated that luteolin could inhibit the growth of T. pyogenes by affecting different cellular components, such as the cell wall, cell membrane, nucleic acid, and proteins 21 . Additionally, luteolin could increase the susceptibility of T. pyogenes to aminoglycosides and macrolides by inhibiting MATE and the MsrA efflux pump 22 , 23 . Our recent studies demonstrated that luteolin can also inhibit the biofilm formation of T. pyogenes . Luteolin decreased the expression of biofilm-related genes such as luxS , rbsB , and lsrB 24 . These findings suggest that luteolin has great potential as an effective anti-biofilm agent against T. pyogenes. In recent years, many natural compounds, particularly protein kinase inhibitors, have been identified as potential drug candidates. These compounds serve as promising starting points for the development of new substances with therapeutic properties 25 . For example, a study demonstrated that matrine acts as a novel inhibitor of protein kinase C phosphorylated kinase, thereby inhibiting hepatitis B virus replication through the regulation of mitogen-activated protein kinase signalling 26 . Another study revealed that luteolin inhibited the autophosphorylation activity of the typical histidine kinase (HK853) in Thermotoga maritime by occupying the binding pocket of adenosine diphosphate (ADP) through hydrogen bonding and π-π superposition 27 . Researches have indicated that luteolin and several other flavones possess the ability to inhibit kinase enzymes 28 – 31 . For instance, casein kinase 2 (CK2) is a serine/threonine protein kinase related to gene expression, protein synthesis degradation in eukaryotic cells, and luteolin can interact with CK2 and inhibit its activity 32 . However, there are no pertinent reports documenting the effects of flavonoids on the serine/threonine kinase and phosphatase activities of T. pyogenes . The primary objective of this study was to determine the potential of luteolin as an inhibitor of PknB and STP in T. pyogenes -induced infections. Materials and methods Animals Female New Zealand white rabbits (3 mouths of age) were purchased from Kang da Biological Technology Co., Ltd. (Qingdao, China, Permit No.: SCXK (Lu) 2016-0002) and reared under pathogen-free conditions for immunization. All the experiments were performed according to the Guidelines of Animal Experiments of Shenyang Agricultural University, and efforts were made to minimize suffering. The protocol was approved by the Ethics Committee of Shenyang Agricultural University (SYXK(Liao)2021-0010, Shenyang, China). The study was carried out in accordance with the ARRIVE guidelines. Strains, media and growth conditions The T. pyogenes strain ATCC19411 was purchased from the American Type Culture Collection (Manassas, VA, USA). Seventeen T. pyogenes isolates (T001-T017) were obtained from dairy cows and preserved in our laboratory. The T. pyogenes isolates were cultured on Mueller–Hinton agar (MH(A), AOBOX, Beijing, China) supplemented with 5% sterile defibrinated sheep blood (Solarbio, Beijing, China) for 48 h at 37°C in 5% CO 2 . Three to five colonies were subsequently inoculated in brain heart infusion (BHI) medium (Solarbio, Beijing, China) supplemented with 8% (v/v) foetal bovine serum (FBS; Gibco, Grand Island, United States) for 24 h at 37°C with shaking at 180 rpm. Luteolin (purity ≥ 98%) was purchased from Shanghai Pureone Biotechnology Co., Ltd. (Shanghai, China) and dissolved in 1% dimethyl sulfoxide (DMSO, Sigma-Aldrich, Shanghai, China) as a stock solution. It was stored at -20℃ before use. Screening of the pknB and stp genes The pknB - and stp -positive strains were identified via PCR. The primers for pknB and stp are listed in Table 1 . Each PCR reaction included 5 µL of PrimeSTAR Max (Premix) (2x; TaKaRa, Dalian, China), 0.2 µL of each primer, 0.5 µL of template DNA and nuclease-free water in a total volume of 10 µL. The PCR conditions were as follows: 35 cycles of denaturation at 98℃ for 10 s, annealing at 61℃ for 5 s, and extension at 72℃ for 10 s. After PCR amplification, the products were extracted using 1% agarose (Sigma, Shanghai, China) gel electrophoresis. Gel imaging analysis was performed via the Azure Biosystems C300 system (United States), and photographs were taken. The PCR products were sent to Sangon Biotech Company (Shanghai, China) for sequencing. The obtained gene sequences were then compared with the pknB and stp gene sequences recorded in NCBI for BLAST analysis. Table 1 Primer sequences for PCR used in this study Gene Sequence (5‘-3’) Product Size (bp) Temperature (℃) pknB forward: ATGGCGTCGGTGAGCGAC 998 56.9 reverse: TCAGTGTCCAATCTGTGCGAGA stp forward: CGGGATCCATGGCTGACGTACCCCGAA 732 61 reverse: CCCAAGCTTTCGATTGTGTTTGTTCTCTTCAACCG Analysis of the expression of pknB and stp using quantitative real-time PCR Quantitative real-time PCR (qRT - PCR) was conducted to detect the expression levels of the pknB and stp genes after luteolin treatment of T. pyogenes for 36 h. In this study, gapdh was used for normalization as endogenous reference gene and the relative expression levels of pknB and stp genes were calculated via the 2 −ΔΔCt method. The treatment protocol for the T. pyogenes samples was the same as previously described 23 . Briefly, T. pyogenes cultured to the logarithmic phase was diluted to 1×10 6 CFU/mL and mixed with 1/2 MIC luteolin (final concentration, 39 µg/mL); the bacterial suspensions were cultured at 37℃ for 36 h. The bacterial suspensions treated with the same final concentration of DMSO (v/v, 0.01%) were employed as a solvent control. Total RNA from T. pyogenes was extracted via TRIzol Reagent (Ambion, Carlsbad, USA) following the manufacturer’s instructions. cDNA synthesis was subsequently carried out via a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). The transcription levels of the pknB and stp genes were detected via the TB Green Premix Ex TaqTM II Kit (TaKaRa, Dalian, China) on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher, USA). The conditions for qRT - PCR were as follows: predenaturation at 95°C for 30 s; then, 40 cycles of 95°C for 5 s, 60°C for 30 s and 72°C for 30 s. The primer sequences are listed in Table 2 . The threshold cycle (Ct) values were obtained from the qRT-PCR reaction. Compared to the gapdh gene (internal control), the relative expression of the target gene was calculated using the 2 −ΔΔCt method (ΔCt = Ct target gene − Ct internal control, and ΔΔCt = ΔCt test sample − ΔCt control sample in each sample), as previously described 33 . The data are presented as the means ± standard deviations (SDs) derived from three independent experiments. Table 2 Primer sequences for qPCR used in this study Gene Sequence (5‘-3’) Product Size (bp) Temperature (℃) pknB forward: TCGACTTCTCACCACTGAACAC 188 56.9 reverse: CTTTCATCAGTGCAAGCGTGA stp forward: TCGTCGTCGGCATCCTGTCC 112 61 reverse: TTGTCTGCGTCATTGTGGCTGAG gapdh forward: CGGCGAAGAACGAGGACATCAC 153 63.5 reverse: GTCGGCAGTGTAGGCGTGAAC Protein expression and purification The primers used for amplification of the complete gene sequences of pknB and stp carrying restriction sites are listed in Table 3 . The PCR products of pknB and stp carrying Hin d Ⅲ and Bam H Ⅰ restriction sites were inserted into the digested pET-28a vector to generate the recombinant plasmids pET-28a- pknB and pET-28a- stp . These plasmids were transformed into BL21(DE3) E. coli competent cells (TransGen Biotech) for protein expression. When the cell density reached an OD 600 of approximately 0.6, the cells were induced to express His-PknB and His-STP fusion proteins by adding 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) (Sigma, USA) and incubating at 22℃ for 16 h. The fusion proteins His-PknB and His-STP were purified via Ni-NTA columns (TaKaRa, Dalian, China) following the manufacturer’s recommendations. The purified proteins were then identified by Western blot analysis using a corresponding alkaline phosphatase-conjugated anti-polyhistidine monoclonal antibody (BBI Life Science, Shanghai, China). Table 3 Primer sequences used in the expression of the His-PKNB and His-STP fusion proteins Gene Sequence (5‘-3’) Product Size (bp) Temperature (℃) Restriction site pknB forward: CGGGATCCATGG CTGACGTACCCCGAA 998 56.9 BamH Ⅰ reverse: TAAAGCGGCCG CTTACGGCCGAACAGATGGCGTA Hind Ⅲ stp forward: CGGGATCCATGG CTGACGTACCCCGAA 732 61 BamH Ⅰ reverse: CCCAAGCTTTCGATTG TGTTTGTTCTCTTCAACCG Hind Ⅲ Preparation of polyclonal antibodies against His-PknB and His-STP proteins The purified His-PknB and His-STP fusion proteins were used as antigens to prepare polyclonal antibodies. Adult female New Zealand white rabbits were used to generate antibodies. Approximately 0.4 mg of purified His-PknB was emulsified with an equal volume of Freund’s Complete Adjuvant (Sigma, Shanghai, China) and injected subcutaneously at multiple sites along the backs of New Zealand white rabbits. Following an initial immunization period of 15 days, the protein was mixed with Freund’s Incomplete Adjuvant (Sigma, Shanghai, China) for booster immunizations on the 7th, 14th, and 21st days. One week after the final immunization, rabbits were anesthetized with isoflurane and their sera were separated. A similar methodology was applied to generate polyclonal antibodies against recombinant His-STP. Antibody titers were determined by indirect ELISA, utilizing the respective antigen as the coating antigen and the pre-immunization serum of each rabbit as the negative control. The pGEX4T-1 vectors were used to express the fusion proteins GST-PknB and GST-STP, which carry a glutathione S-transferase (GST) tag. The fusion proteins GST-PknB and GST-STP were purified via glutathione sepharose affinity. GST-PknB and GST-STP were used as antigens to determine the titers of anti-PknB and anti-STP polyclonal antibodies via ELISA. Once the titer reached 1:16,000, the serum of the rabbits was collected and stored at -80℃. Analysis of the expression levels of PknB and STP via Western blotting Western blotting was used to detect the expression levels of PknB and STP of T. pyogenes after luteolin treatment for 36 h. The method of treating T. pyogenes with luteolin is same as decreased in “ Analysis of the expression of pknB and stp using quantitative real-time PCR ”. Total protein extraction from T. pyogenes and luteolin treatment were conducted according to the protocol reported by Guo et al 23 . SDS - PAGE of protein samples was performed, and then the protein samples were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Shanghai, China). Anti-His-PknB or anti-His-STP polyclonal antibodies were used as the primary antibodies, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) was used as the secondary antibody. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference protein. The membranes were visualized via the Azure C300 imaging system (Azure, Dublin, USA). The Western blot analyses were performed in at least three replicates for each protein, and the intensity of the protein bands was quantified via ImageJ software ( http://developer.imagej.net/development ). Molecular docking of luteolin with the PknB and STP proteins The three-dimensional (3D) structures of the PknB and STP proteins were predicted via the homology modelling technique. The protein sequences were uploaded to https://swissmodel.expasy.org/ , an online prediction tool, and then the homologous proteins with a high degree of sequence homology were identified as templates. The 3D structures of PknB and STP were built according to the templates, and the PDB files were stored for subsequent molecular docking. The 3D structure of luteolin was sketched via ChemDraw Ultra 7.0, energy-minimized via Chem3D Ultra 7.0, and saved as a PDB file for ligands. CB-Dock2 ( https://cadd.labshare.cn/cb-dock2/php/index.php ) is a molecular docking tool that utilizes AutoDock Vina analysis 34 , 35 to automatically identify and analyze the binding sites of ligands and receptors. The molecular docking between luteolin and PknB/STP was predicted via CB-Dock2, and the details of the ligand-receptor interactions were analyzed. The three-dimensional (3D) interaction mode was generated by the Protein-Ligand Interaction Profiler (PLIP) and PyMol v2.6 software 36 , 37 , while BIOVIA Discovery Studio (DS) Visualizer 2021 software was employed to create the interaction two-dimensional (2D) diagrams. Detection of the interaction between luteolin and PknB/STP Surface Plasmon Resonance (SPR) technology has been proven to be a significant approach for target-based drug discovery and development in the modern era 38 . The interaction between luteolin and PknB/STP was determined via surface plasmon resonance (SPR) technology on a Biacore T200 system (GE Healthcare, Sweden) equipped with an NTA sensor chip (GE Healthcare). The proteins were diluted with 1×PBS-P buffer to achieve a final concentration of 30 µg/mL, resulting in a coupling level of approximately 3,000 RU. Luteolin was diluted to a series of concentrations (0.3125, 0.625, 1.25, 2.5, 5, and 10 µmol/L) in 1×PBS-P buffer and flowed through the chip surface with PknB/STP protein coupling. Finally, the data obtained were analysed via Biacore T200 evaluation software, and the association constant (K a ), dissociation constant (K d ) and the equilibrium dissociation constant (K D ) were determined. Determination of luteolin’s effects on PknB and STP activities PknB phosphorylates itself by hydrolyzing ATP. Therefore, the kinase activity can be determined by measuring the consumption of ATP. The kinase activity detection assay was performed in 50 µL of kinase reaction buffer (Tris-HCl 50 mM, DTT 1 mM, pH 7.8) containing 10 mM MgCl 2 , 20 µM ATP, 2 µg PknB, and different concentrations of luteolin or DMSO. The reaction mixtures were incubated at 25°C for 30 min. Subsequently, 50 µL of Kinase-Lumi™ Reagent (Beyotime, Shanghai, China) was added to each well. After a 10-minute incubation, relative luminescence units (RLU) were measured using a multimode plate reader (VICTOR Nivo). Inhibition percentage was calculated as (RLU X − RLU P ) / (RLU N − RLU P ) × 100%, where RLU X is the RLU value for a test treated with compound X, and RLU P and RLU N are the RLU values for the reaction mixture without the treatment of compound and the reaction mixture lacking PknB, respectively. Phosphatase activity was detected as previously described 43 . Briefly, reactions were performed in 100 µL mixture (containing 50 µg/mL STP in p-nitrophenyl phosphate (pNPP) buffer 25 mM Tris-HCl, pH 7.5, 4 mM MnCl 2 , 0.1 mM EDTA, 0.02% β-mercaptoethanol) and the various concentrations of luteolin (5, 10, 20, 40, and 80 µg/mL). The reaction mixtures were incubated at 37 ℃ for 30 min to allow inhibitor-enzyme interaction and initiated by adding pNPP to a final concentration of 1 mM and incubated at 37 ℃ for 30 min. Finally, 50 µL 1M NaOH was added to quench the reaction, and the absorbance was measured at 405 nm. The absorbance was calculated as a percentage of the phosphatase activity and plotted as a function of inhibitor concentration to determine the half-maximal inhibitory concentration (IC 50 ) of luteolin for STP. The data that were displayed on a log scale were log-transformed and non-linear regression was conducted using GraphPad Prism 8.0 with the variable slope normalized model for enzyme inhibition to ascertain IC 50 . The experiments were carried out three times independently under the same conditions. Statistical analysis The Western blot and qRT - PCR results are presented as the means ± standard deviations (SDs) of three separate experiments. Statistical analysis and independent Student’s tests were performed via GraphPad Prism 8.0 and SPSS Statistics V17.0. Statistical significance was defined as * P < 0.05 and ** P < 0.01. Results Effects of luteolin on the transcription levels of pknB and stp The pknB and stp genes were detected across all the T. pyogenes isolates. To investigate the effect of luteolin on the transcription levels of pknB and stp genes, Qrt - PCR analysis was conducted after luteolin treatment on T. pyogenes . As shown in Fig. 1 , there were significant reductions in the expression of pknB and stp genes after luteolin treatment. Specifically, compared with that in the control group, the expression of pknB gene decreased to 8.0–72.7%, while the expression of stp gene decreased to 4.3–71.6%. These results indicated that luteolin could reduce the transcription levels of pknB and stp genes in T. pyogenes . Effects of luteolin on the translation levels of PknB and STP Polyclonal antibodies against His-PknB and His-STP were generated by immunizing New Zealand white rabbits. The purification and identification results of His-PknB and His-STP are presented in Fig. 2 A and D , which indicate that His-PknB and His-STP were successfully obtained. Similarly, GST-PknB and GST-STP were successfully obtained, as shown in Fig. 2 B and E . The ELISA results indicated that the titers of the anti-His-PknB and anti-His-STP polyclonal antibodies reached 1:2,048,000, providing evidence for the ability of rabbit antiserum to recognize the PknB and STP proteins (Fig. 2 C and F ). Subsequently, anti-His-PknB and anti-His-STP polyclonal antibodies were used in Western blot assays to analyse the protein expression of PknB and STP in T. pyogenes . Three separate Western blot assays were performed, among which one representative Western blot is shown in Fig. 3 A and B . As depicted in Fig. 3 C, compared with that in the control group, the relative expression level of PknB in 18 T. pyogenes strains decreased to 26.7% − 73.1% after luteolin treatment. Similarly, luteolin also significantly reduced the protein expression level of STP (decreased to 25.9% − 72.6%) (Fig. 3 D). Molecular docking of luteolin and PknB/STP To explore the interaction between luteolin and the PknB/STP proteins, molecular docking analysis was performed via CB-Dock 2. The theoretical three-dimensional binding mode of luteolin and PknB is illustrated in Fig. 4 A and B . The simulation results revealed that luteolin was able to interact with the primary amino acid residues on the active site of PknB. The binding energy of luteolin and PknB was − 8.9 kcal/mol, which indicated good binding ability. The 3D and 2D interaction plot of the luteolin-PknB complex is presented in Fig. 4 C and D . We found that luteolin was positioned at the hydrophobic pocket, surrounded by the residues ALA41, LEU20, MET148, MET95, MET158 and VAL28, forming a stable hydrophobic binding. Among these amino acid residues, most of them belong to protein kinase domain. As illustrated in Fig. 4 E and F , the theoretical three-dimensional binding mode of luteolin and STP is presented. The binding energy between luteolin and STP was − 7.4 kcal/mol. The binding interactions primarily involved hydrogen bonding and van der Waals forces, with the key interacting residues being ASP192, GLN137, ALA150, VAL136, ARG156, ARG177 and HIS151 (Fig. 4 G and H ). Among these amino residues, all belong to the PPM-type phosphatase domain. Therefore, it is predicted that luteolin may inhibit the activity of protein kinases and phosphatases by binding to the key amino acid residues of the PknB and STP proteins. These results indicate that luteolin exhibits a strong binding affinity for the PknB/STP proteins. Affinity of luteolin with PknB/STP The affinity between luteolin and PknB or STP was determined via the Biacore T200 system to verify the possibility of interaction of luteolin with PknB and STP. The sensor diagram and fitting curve are shown in Fig. 5 . The binding and dissociation curves revealed the rapid binding and slow dissociation patterns of luteolin and PknB/STP. Through analysis of the fitting parameters, it was determined that the K D value of the luteolin and PknB/STP proteins were 3.125×10 − 4 M and 1.128×10 − 5 M, respectively. These findings indicate that luteolin can stably bind to PknB and STP. Effects of luteolin on PknB and STP activities To further assess the effect of luteolin on the activity of PknB and STP, the kinase and phosphatase activity detection assays were conducted to determine the IC 50 of luteolin. It was shown in Fig. 6 A that the IC 50 of luteolin against PknB was 63.28 µg/mL. The data further verified the inhibitory effect of luteolin on PknB. Additionally, luteolin inhibited the activity of STP in a dose-dependent manner. The IC 50 of luteolin on STP was 47.72 µg/mL (Fig. 6 B). Discussion Infections caused by T. pyogenes pose a serious threat to animal husbandry, endangered species protection, and human health. Additionally, the antimicrobial resistance of T. pyogenes is critical, and novel anti-infection strategies to combat T. pyogenes are urgently needed. STKs and STPs play important roles in cell division, metabolism, virulence, resistance, and pathogenesis in many important bacterial pathogens 8 . The significant functions of reversible protein phosphorylation orchestrated by bacterial kinases and phosphatases have been duly acknowledged in recent decades, with various bacterial protein kinases being proposed as viable candidates for novel antibiotic targets 39 . Several inhibitors that target STK, including staurosporine, K252a, AT9283, and APY29, have recently been discovered. These inhibitors have a significant inhibitory effect on the growth of Streptococcus. suis in minimal medium 40 . Chen D. and colleagues reported that sclerotiorin inhibited protein kinase G in Mycobacterium tuberculosis and impaired the growth of mycobacterial macrophages 41 . Flavanones were identified as potential natural inhibitors of the ATP binding site of PknG in Mycobacterium tuberculosis and play crucial roles in regulating bacterial metabolism for survival in host macrophages 42 . Zheng et al. reported that aurintricarboxylic acid (ATA) bound Stp1 directly and inhibited its activity and that ATA was a potent Stp1 inhibitor against staphylococcal infection 43 . However, inhibitors targeting T. pyogenes PknB and STP have not been reported. Luteolin, a representative natural flavonoid, is widely distributed in nature. Recent studies have verified that luteolin not only has good antibacterial activity but also inhibits the formation of bacterial biofilms and the expression of virulence genes 24 , 44 , 45 . Studies have shown that luteolin has anti-quorum-sensing (QS) and anti-biofilm abilities against Pseudomonas aeruginosa 46 . This is achieved by downregulating the QS signal molecules OdDHL and BHL, inhibiting the relative expression of QS genes, and competing with OdDHL for binding to the LasR receptor protein 47 . In this study, we found that luteolin significantly inhibited the transcription and translation levels of the pknB and stp genes. In addition, luteolin can interact with important amino acid residues of the PknB and STP proteins. Furthermore, luteolin significantly inhibited the activity of PknB and STP. It is hypothesized that it may be due to the tight binding between the inhibitor and the active region of the protein that it is able to compete with the substrate, thus reducing the catalytic ability of the active site and leading to a decrease in protein activity. These results indicate the potential of luteolin as a potential inhibitor of PknB and STP to combat the antimicrobial resistance, virulence, and other biological activities of bacteria. However, the specific effect and mechanism of luteolin on T. pyogenes through PknB/STP need to be further explored. Our results suggest the feasibility of luteolin as an inhibitor of PknB and STP and provide a theoretical basis for the development of new antibacterial drugs based on natural compounds in the future. To date, a number of researches have reported the application of SPR in detecting the interaction between drug molecules and target proteins. This technology can accelerate the screening process of new drugs and improve efficiency, significantly saving research and development costs. Early study has reported that luteolin could bind to the N-terminal of ATP/ADP-binding domain of Hsp90. The stability of this interaction was further confirmed by SPR analysis, suggesting that luteolin may act as a potent Hsp90 inhibitor for antitumor strategies 48 . Previous work demonstrated that luteolin bound to the L85 and S155 residues of the CviR protein of Chromobacterium violaceum , suggesting that luteolin interacts with the CviR quorum-sensing regulator, influencing the formation of bacterial biofilms and regulating bacterial virulence 49 . In prior studies, we ascertained that luteolin inhibited the activities of MsrA and TatD DNases in T. pyogenes by binding with them 23 , 44 . In this study, the molecular docking results revealed that the PknB and STP proteins had strong affinities with luteolin, and the 3D and 2D structures of combinations of these proteins were presented. The PknB and STP proteins bind to luteolin mainly through hydrophobic forces and hydrogen bonds, respectively. Furthermore, the low free energy between luteolin and PknB/STP demonstrated that the active sites of the PknB and STP proteins were well occupied by luteolin and that their binding was highly stable. The affinity fitting results in this study illustrated that luteolin and PknB/STP could form a relatively stable combination. It has been postulated that the PknB and STP proteins are potential targets of luteolin. These findings provide a theoretical foundation for the use of luteolin as a natural antibacterial agent that targets the PknB/STP proteins. Therefore, further studies are needed to elucidate the effects of luteolin on pathogenicity and antimicrobial resistance though the targeting of PknB or STP in T. pyogenes . There are still some limitations in this study. Due to constraints related to time and resources, only a preliminary exploration was conducted, and a comprehensive investigation into the action mechanism of luteolin on PknB and STP was not performed. Furthermore, the biological functions of PknB and STP in T. pyogenes were not examined in this study, leading to ambiguity regarding their roles in the organism. Our future studies will aim to address these gaps through the application of gene knockout and other technologies. Conclusions This study aimed to explore the regulatory effects of luteolin on the expression of PknB and STP, as well as the interaction between luteolin and PknB/STP, including their binding sites. These results presented compelling evidence supporting the potential of luteolin as an inhibitor of the PknB and STP proteins of T. pyogenes . Our findings demonstrated a significant inhibitory effect of luteolin on the transcription and translation of the pknB and stp genes. Additionally, luteolin could inhibit the activities of PknB and STP. Furthermore, our results indicated that luteolin could interact with the key amino acid residues of PknB and STP. Luteolin is a promising candidate for the development of novel antibacterial agent to combat T. pyogenes infections. Declarations Data availability Data is provided within the manuscript or supplementary information files. Acknowledgements We sincerely thank Tian Lan and Sheng Yang of Northeastern University for their assistance in the affinity assay. Authors ’ contributions M.C.L. and Y.R.G. conceived and designed this project and experiments. Y.T.G. and H.Y.S. performed the experiments. L.H.Y. participated for the preparation of animal experiments. Y.T.G., H.Y.S., Y.Y.W., C.L.T. and D.X.Z. participated in experiment design and data analysis. Y.T.G. wrote the original draft preparation. Y.R.G. and M.C.L. participated in revising the manuscript. All the authors have read and approved the final manuscript. Funding This study was supported by the National Nature Science Foundation of China, Grant Number 31972736. Competing interests The authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to Y.R.G or M.C.L. Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations. References Rzewuska, M. et al. Pathogenicity and Virulence of Trueperella pyogenes : A Review. Int. J. Mol. Sci. 20 , 2737 (2019). Marchionatti, E., Kittl, S., Sendi, P. & Perreten, V. Whole genome-based antimicrobial resistance, virulence, and phylogenetic characteristics of Trueperella pyogenes clinical isolates from humans and animals. Vet. Microbiol. 294 , 110102 (2024). Mileva, R. et al. Oxytetracycline Pharmacokinetics After Intramuscular Administration in Cows with Clinical Metritis Associated with Trueperella Pyogenes Infection. Antibiotics-Basel 9 , 392 (2020). Marchionatti, E. & Perreten, V. Novel macrolide-lincosamide-streptogramin B resistance gene erm (56) in Trueperella pyogenes . mSphere 8 , e002392 (2023). Zhang, D. et al. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution. Microb. Pathog . 105 , 51–56 (2017). Galán-Relaño, Á. et al. Antimicrobial susceptibility and genetic characterization of Trueperella pyogenes isolates from pigs reared under intensive and extensive farming practices. Vet. Microbiol. 232 , 89–95 (2019). Liang, C. et al. Staphylococcus aureus Transcriptome Data and Metabolic Modelling Investigate the Interplay of Ser/Thr Kinase PknB, Its Phosphatase Stp, the glmR/yvcK Regulon and the cdaA Operon for Metabolic Adaptation. Microorganisms 9 , 2148 (2021). Liu, H. et al. Stk and Stp1 participate in Streptococcus suis serotype 2 pathogenesis by regulating capsule thickness and translocation of certain virulence factors. Microb. Pathog . 152 , 104607 (2021). Zhu, Y., Dou, Q., Du, L. & Wang, Y. QseB/QseC: a two-component system globally regulating bacterial behaviors. Trends Microbiol. 31 , 749–762 (2023). Li, L. et al. Roles of two-component regulatory systems in Klebsiella pneumoniae : Regulation of virulence, antibiotic resistance, and stress responses. Microbiol. Res. 272 , 127374 (2023). Isaka, M. et al. Streptococcus pyogenes TrxSR Two-Component System Regulates Biofilm Production in Acidic Environments. Infect. Immun. 89 , e0036021 (2021). Schaefers, M. M. Regulation of Virulence by Two-Component Systems in Pathogenic Burkholderia . Infect. Immun. 88 , e00927–e00919 (2020). Burastero, O. et al. Specificity and Reactivity of Mycobacterium tuberculosis Serine/Threonine Kinases PknG and PknB. J. Chem. Inf. Model. 62 , 1723–1733 (2022). Tang, J. et al. A link between STK signalling and capsular polysaccharide synthesis in Streptococcus suis . Nat. Commun. 14 , 2480 (2023). Zhang, C. et al. The Eukaryote-Like Serine/Threonine Kinase STK Regulates the Growth and Metabolism of Zoonotic Streptococcus suis . Front. Cell. Infect. Microbiol. 7 , 66 (2017). Janczarek, M., Vinardell, J. M., Lipa, P. & Karaś, M. Hanks-Type Serine/Threonine Protein Kinases and Phosphatases in Bacteria: Roles in Signaling and Adaptation to Various Environments. Int. J. Mol. Sci. 19 , 2872 (2018). Nagarajan, S. N., Lenoir, C. & Grangeasse, C. Recent advances in bacterial signaling by serine/threonine protein kinases. Trends Microbiol. 30 , 553–566 (2022). Zeng, J. et al. Protein kinases PknA and PknB independently and coordinately regulate essential Mycobacterium tuberculosis physiologies and antimicrobial susceptibility. PLoS Pathog . 16 , e1008452 (2020). Shi, M. et al. Luteolin, a flavone ingredient: Anticancer mechanisms, combined medication strategy, pharmacokinetics, clinical trials, and pharmaceutical researches. Phytother Res. 38 , 880–911 (2024). Taheri, Y. et al. Paving Luteolin Therapeutic Potentialities and Agro-Food-Pharma Applications: Emphasis on In Vivo Pharmacological Effects and Bioavailability Traits. Oxid Med Cell Longev. 1987588 (2021). (2021). Guo, Y. et al. The Antibacterial Activity and Mechanism of Action of Luteolin Against Trueperella pyogenes . Infect. Drug Resist. 13 , 1697–1711 (2020). Zhang, D. et al. Luteolin Showed a Resistance Elimination Effect on Gentamicin by Decreasing MATE mRNA Expression in Trueperella pyogenes . Microb. Drug Resist. 25 , 619–626 (2019). Guo, Y. et al. Luteolin increases susceptibility to macrolides by inhibiting MsrA efflux pump in Trueperella pyogenes . Vet. Res. 53 , 3 (2022). Zhang, L. et al. Effects of Luteolin on Biofilm of Trueperella pyogenes and Its Therapeutic Effect on Rat Endometritis. Int. J. Mol. Sci. 23 , 14451 (2022). Baier, A. & Szyszka, R. Compounds from Natural Sources as Protein Kinase Inhibitors. Biomolecules 10 , 1546 (2020). Zhou, S. et al. Novel protein kinase C phosphorylated kinase inhibitor-matrine suppresses replication of hepatitis B virus via modulating the mitogen-activated protein kinase signal. Bioengineered 13 , 2851–2865 (2022). Zhou, Y. et al. Structural Basis for the Inhibition of the Autophosphorylation Activity of HK853 by Luteolin. Molecules 24 , 933 (2019). Wu, K. J. et al. Small Molecule Pin1 Inhibitor Blocking NF-κB Signaling in Prostate Cancer Cells. Chem. Asian J. 13 , 275–279 (2018). Lu, J. J. et al. Quinones derived from plant secondary metabolites as anti-cancer agents. Anticancer Agents Med. Chem. 13 , 456–463 (2013). Leung, K. H. et al. Discovery of a small-molecule inhibitor of STAT3 by ligand-based pharmacophore screening. Methods 71 , 38–43 (2015). Lyon, G. J. et al. Rational design of a global inhibitor of the virulence response in Staphylococcus aureus, based in part on localization of the site of inhibition to the receptor-histidine kinase, AgrC. Proc. Natl. Acad. Sci. U S A . 21 , 13330–13335 (2000). Lolli, G. et al. Inhibition of protein kinase CK2 by flavonoids and tyrphostins. A structural insight. Biochemistry 51 , 6097–6107 (2012). Rao, X., Huang, X., Zhou, Z. & Lin, X. An improvement of the 2ˆ (-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath . 3 , 71–85 (2013). Liu, Y. et al. CB-Dock2: improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. Nucleic Acids Res. 50 , W159–W164 (2020). Trott, O. & Olson, A. J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 31 , 455–461 (2013). Adasme, M. F. et al. PLIP 2021: expanding the scope of the protein-ligand interaction profiler to DNA and RNA. Nucleic Acids Res. 49 , W530–W534 (2021). Gaudreault, F., Morency, L. P. & Najmanovich, R. J. NRGsuite: a PyMOL plugin to perform docking simulations in real time using FlexAID. Bioinformatics 31 , 3856–3858 (2015). Das, S. et al. Surface plasmon resonance as a fascinating approach in target-based drug discovery and development. Trends Anal. Chem. 171 , 117501–117501 (2024). King, A. & Blackledge, M. S. Evaluation of small molecule kinase inhibitors as novel antimicrobial and antibiofilm agents. Chem. Biol. Drug Des. 98 , 1038–1064 (2021). Li, H. et al. Inhibitors targeting the autophosphorylation of serine/threonine kinase of Streptococcus suis show potent antimicrobial activity. Front. Microbiol. 13 , 990091 (2022). Chen, D. et al. Sclerotiorin inhibits protein kinase G from Mycobacterium tuberculosis and impairs mycobacterial growth in macrophages. Tuberculosis (Edinb) . 103 , 37–43 (2017). Swain, S. P. et al. Flavanones: A potential natural inhibitor of the ATP binding site of PknG of Mycobacterium tuberculosis . J. Biomol. Struct. Dyn. 40 , 11885–11899 (2022). Zheng, W. et al. Structure-Based Identification of a Potent Inhibitor Targeting Stp1-Mediated Virulence Regulation in Staphylococcus aureus . Cell. Chem. Biol. 23 , 1002–1013 (2016). Zhang, Z. et al. Molecular Basis for Luteolin as a Natural TatD DNase Inhibitor in Trueperella pyogenes . Int. J. Mol. Sci. 23 , 8374 (2022). Diyah, N. W., Indriani, D. A., Dessidianti, R. & Siswandono, S. silico analysis of luteolin derivatives as antibacterial agents targeting DNA gyrase and CTX-M-15 extended-spectrum β-lactamase of Escherichia coli . J. Adv. Pharm. Technol. Res. 15 , 29–36 (2024). Fakhar, M., Ahmed, M. & Nasim Sabri, A. Computational and experimental strategies for combating MBL P. aeruginosa (MBLPA) biofilms using phytochemicals: Targeting the quorum sensing network. Saudi J. Biol. Sci. 31 , 104001 (2024). Geng, Y. F. et al. An innovative role for luteolin as a natural quorum sensing inhibitor in Pseudomonas aeruginosa . Life Sci. 274 , 119325 (2021). Fu, J. et al. Luteolin induces carcinoma cell apoptosis through binding Hsp90 to suppress constitutive activation of STAT3. PLoS One . 7 , e49194 (2012). Rivera, M. L. C. et al. Effect of Capsicum Frutescens Extract, Capsaicin, and Luteolin on Quorum Sensing Regulated Phenotypes. J. Food Sci. 84 , 1477–1486 (2019). Tables Tables 1 to 3 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table1.docx Table2.docx Table3.docx WBrawfile.pptx Luteolin.sdf Stp.pdb PknB.pdb StpLuteolinout2.7.4.complex.pdb PknBLuteolinout1.8.9.complex.pdb Cite Share Download PDF Status: Published Journal Publication published 03 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 05 Jun, 2025 Reviews received at journal 18 May, 2025 Reviewers agreed at journal 27 Apr, 2025 Reviewers invited by journal 26 Apr, 2025 Submission checks completed at journal 11 Apr, 2025 First submitted to journal 07 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5222514","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":448851997,"identity":"f2a1b94e-0483-48b6-982e-82edbef930ad","order_by":0,"name":"Yueting Guo","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yueting","middleName":"","lastName":"Guo","suffix":""},{"id":448851999,"identity":"e507bd6a-e7ed-42ff-8d87-001d3283c4d7","order_by":1,"name":"Hongyu Su","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongyu","middleName":"","lastName":"Su","suffix":""},{"id":448852000,"identity":"5de9f903-cfbf-4e30-a13e-68d41ea32fce","order_by":2,"name":"Lihui Yu","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Lihui","middleName":"","lastName":"Yu","suffix":""},{"id":448852002,"identity":"e57c65a1-4e88-4044-a5f8-735010a02370","order_by":3,"name":"Yingyu Wang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yingyu","middleName":"","lastName":"Wang","suffix":""},{"id":448852003,"identity":"e0b6b287-31d4-4965-8128-aa860561f59b","order_by":4,"name":"Chunlian Tian","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chunlian","middleName":"","lastName":"Tian","suffix":""},{"id":448852004,"identity":"297bbceb-caa9-4713-a535-374309b533ff","order_by":5,"name":"Dexian Zhang","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dexian","middleName":"","lastName":"Zhang","suffix":""},{"id":448852005,"identity":"245af80e-98d3-4eb4-95a7-96af0e8cf3f2","order_by":6,"name":"Yuru Guo","email":"","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuru","middleName":"","lastName":"Guo","suffix":""},{"id":448852007,"identity":"6fb1f8fc-6a40-412b-8277-9761c377beba","order_by":7,"name":"Mingchun Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYBACPmYgkQDEBgwMjA+gggZ4tbAhaWGGKSWgBcYAKmOTIE4LO4/phoc7auXNJXKPVf5ss0tsYG/eJsFQcwePw3jMbiSeOW64c0Ze2m3etuTEBp5jZRIMx54R0NJ2LMHgRo7ZbcY25sQGiRwzCcaGw8RpKfzZVp/YIP+GKC01YC0MvG2HgbbwENLCVgbUcsBww5k3xtI8544bt/GkFVskHMOthZ//8LabP9vq5A2O5xh+/FFWLdvPfnjjjQ81uLVAAVQBIxs0phIIaWBgqIPSfwgrHQWjYBSMgpEHACr9UXH/jXysAAAAAElFTkSuQmCC","orcid":"","institution":"Shenyang Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Mingchun","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-10-08 06:38:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5222514/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5222514/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-08698-5","type":"published","date":"2025-07-03T15:58:31+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81649759,"identity":"1fe09cf0-2cf9-4005-bf70-56be2818336e","added_by":"auto","created_at":"2025-04-29 15:50:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3107239,"visible":true,"origin":"","legend":"\u003cp\u003eThe mRNA expression level of \u003cem\u003epknB\u003c/em\u003eand \u003cem\u003estp\u003c/em\u003e genes in 17 \u003cem\u003eT. pyogenes\u003c/em\u003eafter luteolin treatment.\u003cstrong\u003e (A)\u003c/strong\u003e the mRNA expression of \u003cem\u003epknB\u003c/em\u003e, \u003cstrong\u003e(B)\u003c/strong\u003ethe mRNA expression of \u003cem\u003estp. T. pyogenes \u003c/em\u003etreated with luteolin at 1/2 MIC. Data were presented as means ±SD. (*compared with the solvent control, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/7e4ee4f96fdd49c84f21ff1b.png"},{"id":81650379,"identity":"2df051d0-6191-4b91-81e6-65d457bae10f","added_by":"auto","created_at":"2025-04-29 15:58:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5745981,"visible":true,"origin":"","legend":"\u003cp\u003ePreparation of the anti-PknB and anti-STP polyclonal antibodies. \u003cstrong\u003e(A, D) \u003c/strong\u003eWestern blot analysis of purified His- PknB and His-STP fusion proteins using an anti-His monoclonal antibody. \u003cstrong\u003e(B, E) \u003c/strong\u003eWestern blot analysis of purified GST- PknB and GST-STP fusion proteins using an anti-GST monoclonal antibody. \u003cstrong\u003e(C, F)\u003c/strong\u003e Detection of serum titer of anti-His- PknB and His-STP proteins by ELISA.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/95c3bcdd09a323a53bb3d8e9.png"},{"id":81651239,"identity":"25816f14-4881-42bf-8d00-62a9dc1f4ce7","added_by":"auto","created_at":"2025-04-29 16:14:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3971319,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of luteolin on the expression of PknB and STP in 17 \u003cem\u003eT. pyogenes\u003c/em\u003e. \u003cstrong\u003e(A, B)\u003c/strong\u003e Western blot results PknB and STP in \u003cem\u003eT. pyogenes\u003c/em\u003e with different treatment, \u003cstrong\u003e(C) \u003c/strong\u003ethe protein expression of PknB, \u003cstrong\u003e(D)\u003c/strong\u003e the protein expression of STP. \u003cem\u003eT. pyogenes\u003c/em\u003e treated with luteolin at 1/2 MIC. Data were presented as means ±SD. (*compared with the solvent control, *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/848bd0a4138e206d54c7d404.png"},{"id":81649781,"identity":"22f685be-bf71-4560-8c3b-6921de32905d","added_by":"auto","created_at":"2025-04-29 15:50:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":32066838,"visible":true,"origin":"","legend":"\u003cp\u003eThe molecular docking results of luteolin and the PknB or STP protein.\u003cstrong\u003e (A, E) \u003c/strong\u003edocking surface map of luteolin with PknB and STP, \u003cstrong\u003e(B, C, F, G)\u003c/strong\u003e show luteolin interacting with the amino acid residues located within the active sites of the PknB and STP pockets in three-dimensional (3D) docking models, \u003cstrong\u003e(D)\u003c/strong\u003e show the interactions between luteolin and PknB in two-dimensional (2D) docking model, \u003cstrong\u003e(H)\u003c/strong\u003e show the interactions between luteolin and STP in two-dimensional (2D) docking model.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/49e587a0171e6b5bdbb6aab1.png"},{"id":81650568,"identity":"e705a70e-9d1a-4f40-be10-95b386cdb52e","added_by":"auto","created_at":"2025-04-29 16:06:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2172527,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of the interaction between luteolin and the PknB and STP proteins by SPR.\u003cstrong\u003e (A) \u003c/strong\u003eAffinity sensing diagram for a series of concentrations of luteolin with PknB protein. (\u003cstrong\u003eB) \u003c/strong\u003eAffinity fitting curve of luteolin with the PknB protein. (\u003cstrong\u003eC) \u003c/strong\u003eAffinity sensing diagram for a series of concentrations of luteolin with STP protein. (\u003cstrong\u003eD) \u003c/strong\u003eAffinity fitting curve of luteolin with the STP protein.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/7254d9e14be50a0e5ec91e02.png"},{"id":81649770,"identity":"3fee0a70-a209-415f-aa92-fcf875434184","added_by":"auto","created_at":"2025-04-29 15:50:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2439666,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of luteolin on the activitiy of PknB and STP. \u003cstrong\u003e(A)\u003c/strong\u003e Inhibitory effect of luteolin at different concentrations on PknB activity. \u003cstrong\u003e(B)\u003c/strong\u003e Inhibitory effect of luteolin at different concentrations on STP activity.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/c54da12677437b7ab8e31b3c.png"},{"id":86179415,"identity":"c76dbde9-9bc6-4a2a-9aa2-c7bf4a6ee857","added_by":"auto","created_at":"2025-07-07 16:17:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":44623420,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/1b3520ef-43a8-486e-bbaf-2bc0e16fe3f5.pdf"},{"id":81649763,"identity":"133f507d-cfb5-4882-8503-6f29d44c6255","added_by":"auto","created_at":"2025-04-29 15:50:31","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":12994,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/8704f7338d79eeb501fb00fd.docx"},{"id":81650382,"identity":"1a29c491-3347-459b-b3d9-2123d7d80f3d","added_by":"auto","created_at":"2025-04-29 15:58:31","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":13004,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/9e5da2e9e0ec12906cdb8edc.docx"},{"id":81650562,"identity":"c6c0cc04-592a-4973-b5e8-bedb19a6c863","added_by":"auto","created_at":"2025-04-29 16:06:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":13244,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/c3f010dd4047e547da029dc3.docx"},{"id":81649771,"identity":"e33c8557-949c-4280-99fd-567530517637","added_by":"auto","created_at":"2025-04-29 15:50:32","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":3040280,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawfile.pptx","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/f260cd368c1452afa0eddd23.pptx"},{"id":81650396,"identity":"87a83500-b622-4f14-a5d2-d547e13ac244","added_by":"auto","created_at":"2025-04-29 15:58:32","extension":"sdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":4964,"visible":true,"origin":"","legend":"","description":"","filename":"Luteolin.sdf","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/d764d1f4b8162787b9774f3b.sdf"},{"id":81649775,"identity":"2f1b6820-6378-4153-b852-54dec7e03d14","added_by":"auto","created_at":"2025-04-29 15:50:32","extension":"pdb","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":141291,"visible":true,"origin":"","legend":"","description":"","filename":"Stp.pdb","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/ce1c8bf13dae0c11cd90dbb1.pdb"},{"id":81650393,"identity":"abbd3d0b-56f2-43c5-83e2-f5bd808e3be3","added_by":"auto","created_at":"2025-04-29 15:58:32","extension":"pdb","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":168811,"visible":true,"origin":"","legend":"","description":"","filename":"PknB.pdb","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/c8ae4ad94145451679e09bcb.pdb"},{"id":81650387,"identity":"c8b3f1a7-a125-4b56-bb8c-34ac03cec76f","added_by":"auto","created_at":"2025-04-29 15:58:32","extension":"pdb","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":141095,"visible":true,"origin":"","legend":"","description":"","filename":"StpLuteolinout2.7.4.complex.pdb","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/1ac12cf0393415129747b163.pdb"},{"id":81649785,"identity":"ec995599-40a4-4578-8877-47826be45fce","added_by":"auto","created_at":"2025-04-29 15:50:32","extension":"pdb","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":172685,"visible":true,"origin":"","legend":"","description":"","filename":"PknBLuteolinout1.8.9.complex.pdb","url":"https://assets-eu.researchsquare.com/files/rs-5222514/v1/ea9e12384464ddee36a97b50.pdb"}],"financialInterests":"No competing interests reported.","formattedTitle":"PknB and STP as Potential Targets of Luteolin in Combating Trueperella pyogenes Infections","fulltext":[{"header":"Introduction","content":"\u003cp\u003e \u003cem\u003eTrueperella pyogenes\u003c/em\u003e (\u003cem\u003eT. pyogenes\u003c/em\u003e) is an opportunistic, gram-positive bacterium that causes various infections such as mastitis, pneumonia, liver abscess, metritis, endocarditis, and osteoarthritis. These infections not only cause significant economic losses in the animal husbandry industry but also pose a serious threat to human health and safety\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Aminoglycosides, β-lactams, tetracyclines, macrolides, and fluoroquinolones are commonly used to treat \u003cem\u003eT. pyogenes\u003c/em\u003e infections; however, their use may contribute to the emergence of antimicrobial resistance. The development of antimicrobial resistance in \u003cem\u003eT. pyogenes\u003c/em\u003e has become a formidable obstacle inhibiting its clinical management \u003csup\u003e\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Consequently, the exploration of novel drug targets and drugs that can effectively combat \u003cem\u003eT. pyogenes\u003c/em\u003e infections is crucial.\u003c/p\u003e \u003cp\u003eBacteria can survive under a variety of environmental stimuli. Adaptability is largely attributed to the presence of diverse protein kinases, which enable bacteria to sense and respond to external signals\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Signal transduction via reversible phosphorylation is important for environmental adaptation and virulence in pathogenic bacteria\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. A two-component system, which is composed of histidine kinases (HKs) and response regulators (RRs), is involved in multiple bacterial behaviors by regulating quorum sensing, bacterial pathogenicity, and antimicrobial resistance\u003csup\u003e\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. However, recent studies have revealed that eukaryotic-like serine/threonine kinases (eSTKs) and eukaryotic-like serine/threonine phosphatases (eSTPs) are widely distributed in bacteria and are important regulators of several important bacterial pathogens, including \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e, \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e, \u003cem\u003eListeria monocytogenes\u003c/em\u003e, and \u003cem\u003eStreptococcus suis\u003c/em\u003e\u003csup\u003e\u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In \u003cem\u003eStreptococcus pyogenes\u003c/em\u003e, both STK and STP participate in cell division, adhesion to, and invasion of, epithelial cells, and virulence. \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e involves eleven Ser/Thr kinases, two of which, PknA and PknB, regulate essential physiologies and antimicrobial susceptibility of \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Based on their critical physiological roles, STK and STP have the potential to be developed as drug targets. In our previous study, we reported that serine/threonine protein kinase B (PknB) and serine/threonine phosphatase (STP), which have potential as drug targets to combat \u003cem\u003eT. pyogenes\u003c/em\u003e infections, are present in \u003cem\u003eT. pyogenes\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eNatural plant products are valuable resources for screening new antibacterial drugs. Luteolin is a natural secondary flavonoid and is widely distributed in vegetables and medicinal plants such as broccoli, honeysuckle, and chrysanthemum. Luteolin exhibits antioxidant, anti-inflammatory, anti-tumor, and antimicrobial effects\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Our previous findings indicated that luteolin could inhibit the growth of \u003cem\u003eT. pyogenes\u003c/em\u003e by affecting different cellular components, such as the cell wall, cell membrane, nucleic acid, and proteins\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Additionally, luteolin could increase the susceptibility of \u003cem\u003eT. pyogenes\u003c/em\u003e to aminoglycosides and macrolides by inhibiting MATE and the MsrA efflux pump\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Our recent studies demonstrated that luteolin can also inhibit the biofilm formation of \u003cem\u003eT. pyogenes\u003c/em\u003e. Luteolin decreased the expression of biofilm-related genes such as \u003cem\u003eluxS\u003c/em\u003e, \u003cem\u003erbsB\u003c/em\u003e, and \u003cem\u003elsrB\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. These findings suggest that luteolin has great potential as an effective anti-biofilm agent against \u003cem\u003eT. pyogenes.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eIn recent years, many natural compounds, particularly protein kinase inhibitors, have been identified as potential drug candidates. These compounds serve as promising starting points for the development of new substances with therapeutic properties\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. For example, a study demonstrated that matrine acts as a novel inhibitor of protein kinase C phosphorylated kinase, thereby inhibiting hepatitis B virus replication through the regulation of mitogen-activated protein kinase signalling\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Another study revealed that luteolin inhibited the autophosphorylation activity of the typical histidine kinase (HK853) in \u003cem\u003eThermotoga maritime\u003c/em\u003e by occupying the binding pocket of adenosine diphosphate (ADP) through hydrogen bonding and π-π superposition\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Researches have indicated that luteolin and several other flavones possess the ability to inhibit kinase enzymes\u003csup\u003e\u003cspan additionalcitationids=\"CR29 CR30\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. For instance, casein kinase 2 (CK2) is a serine/threonine protein kinase related to gene expression, protein synthesis degradation in eukaryotic cells, and luteolin can interact with CK2 and inhibit its activity\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHowever, there are no pertinent reports documenting the effects of flavonoids on the serine/threonine kinase and phosphatase activities of \u003cem\u003eT. pyogenes\u003c/em\u003e. The primary objective of this study was to determine the potential of luteolin as an inhibitor of PknB and STP in \u003cem\u003eT. pyogenes\u003c/em\u003e-induced infections.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eFemale New Zealand white rabbits (3 mouths of age) were purchased from Kang da Biological Technology Co., Ltd. (Qingdao, China, Permit No.: SCXK (Lu) 2016-0002) and reared under pathogen-free conditions for immunization. All the experiments were performed according to the Guidelines of Animal Experiments of Shenyang Agricultural University, and efforts were made to minimize suffering. The protocol was approved by the Ethics Committee of Shenyang Agricultural University (SYXK(Liao)2021-0010, Shenyang, China). The study was carried out in accordance with the ARRIVE guidelines.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eStrains, media and growth conditions\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eT. pyogenes\u003c/em\u003e strain ATCC19411 was purchased from the American Type Culture Collection (Manassas, VA, USA). Seventeen \u003cem\u003eT. pyogenes\u003c/em\u003e isolates (T001-T017) were obtained from dairy cows and preserved in our laboratory. The \u003cem\u003eT. pyogenes\u003c/em\u003e isolates were cultured on Mueller\u0026ndash;Hinton agar (MH(A), AOBOX, Beijing, China) supplemented with 5% sterile defibrinated sheep blood (Solarbio, Beijing, China) for 48 h at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. Three to five colonies were subsequently inoculated in brain heart infusion (BHI) medium (Solarbio, Beijing, China) supplemented with 8% (v/v) foetal bovine serum (FBS; Gibco, Grand Island, United States) for 24 h at 37\u0026deg;C with shaking at 180 rpm. Luteolin (purity\u0026thinsp;\u0026ge;\u0026thinsp;98%) was purchased from Shanghai Pureone Biotechnology Co., Ltd. (Shanghai, China) and dissolved in 1% dimethyl sulfoxide (DMSO, Sigma-Aldrich, Shanghai, China) as a stock solution. It was stored at -20℃ before use.\u003c/p\u003e \u003cp\u003e \u003cb\u003eScreening of the\u003c/b\u003e \u003cb\u003epknB\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003estp\u003c/b\u003e \u003cb\u003egenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003epknB\u003c/em\u003e- and \u003cem\u003estp\u003c/em\u003e-positive strains were identified via PCR. The primers for \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Each PCR reaction included 5 \u0026micro;L of PrimeSTAR Max (Premix) (2x; TaKaRa, Dalian, China), 0.2 \u0026micro;L of each primer, 0.5 \u0026micro;L of template DNA and nuclease-free water in a total volume of 10 \u0026micro;L. The PCR conditions were as follows: 35 cycles of denaturation at 98℃ for 10 s, annealing at 61℃ for 5 s, and extension at 72℃ for 10 s. After PCR amplification, the products were extracted using 1% agarose (Sigma, Shanghai, China) gel electrophoresis. Gel imaging analysis was performed via the Azure Biosystems C300 system (United States), and photographs were taken. The PCR products were sent to Sangon Biotech Company (Shanghai, China) for sequencing. The obtained gene sequences were then compared with the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e gene sequences recorded in NCBI for BLAST analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for PCR used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026lsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct Size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTemperature (℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003epknB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: ATGGCGTCGGTGAGCGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e998\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: TCAGTGTCCAATCTGTGCGAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003estp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: CGGGATCCATGGCTGACGTACCCCGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: CCCAAGCTTTCGATTGTGTTTGTTCTCTTCAACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of the expression of\u003c/b\u003e \u003cb\u003epknB\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003estp\u003c/b\u003e \u003cb\u003eusing quantitative real-time PCR\u003c/b\u003e\u003c/p\u003e \u003cp\u003eQuantitative real-time PCR (qRT\u003cb\u003e-\u003c/b\u003ePCR) was conducted to detect the expression levels of the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes after luteolin treatment of \u003cem\u003eT. pyogenes\u003c/em\u003e for 36 h. In this study, \u003cem\u003egapdh\u003c/em\u003e was used for normalization as endogenous reference gene and the relative expression levels of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes were calculated via the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. The treatment protocol for the \u003cem\u003eT. pyogenes\u003c/em\u003e samples was the same as previously described\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Briefly, \u003cem\u003eT. pyogenes\u003c/em\u003e cultured to the logarithmic phase was diluted to 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL and mixed with 1/2 MIC luteolin (final concentration, 39 \u0026micro;g/mL); the bacterial suspensions were cultured at 37℃ for 36 h. The bacterial suspensions treated with the same final concentration of DMSO (v/v, 0.01%) were employed as a solvent control. Total RNA from \u003cem\u003eT. pyogenes\u003c/em\u003e was extracted via TRIzol Reagent (Ambion, Carlsbad, USA) following the manufacturer\u0026rsquo;s instructions. cDNA synthesis was subsequently carried out via a PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). The transcription levels of the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes were detected via the TB Green Premix Ex TaqTM II Kit (TaKaRa, Dalian, China) on the Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher, USA). The conditions for qRT\u003cb\u003e-\u003c/b\u003ePCR were as follows: predenaturation at 95\u0026deg;C for 30 s; then, 40 cycles of 95\u0026deg;C for 5 s, 60\u0026deg;C for 30 s and 72\u0026deg;C for 30 s. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The threshold cycle (Ct) values were obtained from the qRT-PCR reaction. Compared to the \u003cem\u003egapdh\u003c/em\u003e gene (internal control), the relative expression of the target gene was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method (ΔCt\u0026thinsp;=\u0026thinsp;Ct target gene\u0026thinsp;\u0026minus;\u0026thinsp;Ct internal control, and ΔΔCt\u0026thinsp;=\u0026thinsp;ΔCt test sample\u0026thinsp;\u0026minus;\u0026thinsp;ΔCt control sample in each sample), as previously described\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. The data are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations (SDs) derived from three independent experiments.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for qPCR used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026lsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct Size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTemperature (℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003epknB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: TCGACTTCTCACCACTGAACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e188\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: CTTTCATCAGTGCAAGCGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003estp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: TCGTCGTCGGCATCCTGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: TTGTCTGCGTCATTGTGGCTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egapdh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: CGGCGAAGAACGAGGACATCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e63.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: GTCGGCAGTGTAGGCGTGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eProtein expression and purification\u003c/h3\u003e\n\u003cp\u003eThe primers used for amplification of the complete gene sequences of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e carrying restriction sites are listed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The PCR products of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e carrying \u003cem\u003eHin\u003c/em\u003ed Ⅲ and \u003cem\u003eBam\u003c/em\u003eH Ⅰ restriction sites were inserted into the digested pET-28a vector to generate the recombinant plasmids pET-28a-\u003cem\u003epknB\u003c/em\u003e and pET-28a-\u003cem\u003estp\u003c/em\u003e. These plasmids were transformed into BL21(DE3) \u003cem\u003eE. coli\u003c/em\u003e competent cells (TransGen Biotech) for protein expression. When the cell density reached an OD\u003csub\u003e600\u003c/sub\u003e of approximately 0.6, the cells were induced to express His-PknB and His-STP fusion proteins by adding 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) (Sigma, USA) and incubating at 22℃ for 16 h. The fusion proteins His-PknB and His-STP were purified via Ni-NTA columns (TaKaRa, Dalian, China) following the manufacturer\u0026rsquo;s recommendations. The purified proteins were then identified by Western blot analysis using a corresponding alkaline phosphatase-conjugated anti-polyhistidine monoclonal antibody (BBI Life Science, Shanghai, China).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in the expression of the His-PKNB and His-STP fusion proteins\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026lsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct Size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTemperature (℃)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRestriction site\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003epknB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: CGGGATCCATGG\u003c/p\u003e \u003cp\u003eCTGACGTACCCCGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e998\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e56.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBamH Ⅰ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: TAAAGCGGCCG\u003c/p\u003e \u003cp\u003eCTTACGGCCGAACAGATGGCGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHind Ⅲ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003estp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward: CGGGATCCATGG\u003c/p\u003e \u003cp\u003eCTGACGTACCCCGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e732\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBamH Ⅰ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ereverse: CCCAAGCTTTCGATTG\u003c/p\u003e \u003cp\u003eTGTTTGTTCTCTTCAACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHind Ⅲ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003ePreparation of polyclonal antibodies against His-PknB and His-STP proteins\u003c/h3\u003e\n\u003cp\u003eThe purified His-PknB and His-STP fusion proteins were used as antigens to prepare polyclonal antibodies. Adult female New Zealand white rabbits were used to generate antibodies. Approximately 0.4 mg of purified His-PknB was emulsified with an equal volume of Freund\u0026rsquo;s Complete Adjuvant (Sigma, Shanghai, China) and injected subcutaneously at multiple sites along the backs of New Zealand white rabbits. Following an initial immunization period of 15 days, the protein was mixed with Freund\u0026rsquo;s Incomplete Adjuvant (Sigma, Shanghai, China) for booster immunizations on the 7th, 14th, and 21st days. One week after the final immunization, rabbits were anesthetized with isoflurane and their sera were separated. A similar methodology was applied to generate polyclonal antibodies against recombinant His-STP. Antibody titers were determined by indirect ELISA, utilizing the respective antigen as the coating antigen and the pre-immunization serum of each rabbit as the negative control.\u003c/p\u003e \u003cp\u003eThe pGEX4T-1 vectors were used to express the fusion proteins GST-PknB and GST-STP, which carry a glutathione S-transferase (GST) tag. The fusion proteins GST-PknB and GST-STP were purified via glutathione sepharose affinity. GST-PknB and GST-STP were used as antigens to determine the titers of anti-PknB and anti-STP polyclonal antibodies via ELISA. Once the titer reached 1:16,000, the serum of the rabbits was collected and stored at -80℃.\u003c/p\u003e\n\u003ch3\u003eAnalysis of the expression levels of PknB and STP via Western blotting\u003c/h3\u003e\n\u003cp\u003eWestern blotting was used to detect the expression levels of PknB and STP of \u003cem\u003eT. pyogenes\u003c/em\u003e after luteolin treatment for 36 h. The method of treating \u003cem\u003eT. pyogenes\u003c/em\u003e with luteolin is same as decreased in \u0026ldquo;\u003cb\u003eAnalysis of the expression of\u003c/b\u003e \u003cb\u003epknB\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003estp\u003c/b\u003e \u003cb\u003eusing quantitative real-time PCR\u003c/b\u003e\u0026rdquo;. Total protein extraction from \u003cem\u003eT. pyogenes\u003c/em\u003e and luteolin treatment were conducted according to the protocol reported by Guo et al\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. SDS\u003cb\u003e-\u003c/b\u003ePAGE of protein samples was performed, and then the protein samples were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Shanghai, China). Anti-His-PknB or anti-His-STP polyclonal antibodies were used as the primary antibodies, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) was used as the secondary antibody. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference protein. The membranes were visualized via the Azure C300 imaging system (Azure, Dublin, USA). The Western blot analyses were performed in at least three replicates for each protein, and the intensity of the protein bands was quantified via ImageJ software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://developer.imagej.net/development\u003c/span\u003e\u003cspan address=\"http://developer.imagej.net/development\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking of luteolin with the PknB and STP proteins\u003c/h2\u003e \u003cp\u003eThe three-dimensional (3D) structures of the PknB and STP proteins were predicted via the homology modelling technique. The protein sequences were uploaded to \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://swissmodel.expasy.org/\u003c/span\u003e\u003cspan address=\"https://swissmodel.expasy.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, an online prediction tool, and then the homologous proteins with a high degree of sequence homology were identified as templates. The 3D structures of PknB and STP were built according to the templates, and the PDB files were stored for subsequent molecular docking. The 3D structure of luteolin was sketched via ChemDraw Ultra 7.0, energy-minimized via Chem3D Ultra 7.0, and saved as a PDB file for ligands. CB-Dock2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cadd.labshare.cn/cb-dock2/php/index.php\u003c/span\u003e\u003cspan address=\"https://cadd.labshare.cn/cb-dock2/php/index.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) is a molecular docking tool that utilizes AutoDock Vina analysis\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e to automatically identify and analyze the binding sites of ligands and receptors. The molecular docking between luteolin and PknB/STP was predicted via CB-Dock2, and the details of the ligand-receptor interactions were analyzed. The three-dimensional (3D) interaction mode was generated by the Protein-Ligand Interaction Profiler (PLIP) and PyMol v2.6 software\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, while BIOVIA Discovery Studio (DS) Visualizer 2021 software was employed to create the interaction two-dimensional (2D) diagrams.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDetection of the interaction between luteolin and PknB/STP\u003c/h3\u003e\n\u003cp\u003eSurface Plasmon Resonance (SPR) technology has been proven to be a significant approach for target-based drug discovery and development in the modern era\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The interaction between luteolin and PknB/STP was determined via surface plasmon resonance (SPR) technology on a Biacore T200 system (GE Healthcare, Sweden) equipped with an NTA sensor chip (GE Healthcare). The proteins were diluted with 1\u0026times;PBS-P buffer to achieve a final concentration of 30 \u0026micro;g/mL, resulting in a coupling level of approximately 3,000 RU. Luteolin was diluted to a series of concentrations (0.3125, 0.625, 1.25, 2.5, 5, and 10 \u0026micro;mol/L) in 1\u0026times;PBS-P buffer and flowed through the chip surface with PknB/STP protein coupling. Finally, the data obtained were analysed via Biacore T200 evaluation software, and the association constant (K\u003csub\u003ea\u003c/sub\u003e), dissociation constant (K\u003csub\u003ed\u003c/sub\u003e) and the equilibrium dissociation constant (K\u003csub\u003eD\u003c/sub\u003e) were determined.\u003c/p\u003e\n\u003ch3\u003eDetermination of luteolin’s effects on PknB and STP activities\u003c/h3\u003e\n\u003cp\u003ePknB phosphorylates itself by hydrolyzing ATP. Therefore, the kinase activity can be determined by measuring the consumption of ATP. The kinase activity detection assay was performed in 50 \u0026micro;L of kinase reaction buffer (Tris-HCl 50 mM, DTT 1 mM, pH 7.8) containing 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 20 \u0026micro;M ATP, 2 \u0026micro;g PknB, and different concentrations of luteolin or DMSO. The reaction mixtures were incubated at 25\u0026deg;C for 30 min. Subsequently, 50 \u0026micro;L of Kinase-Lumi\u0026trade; Reagent (Beyotime, Shanghai, China) was added to each well. After a 10-minute incubation, relative luminescence units (RLU) were measured using a multimode plate reader (VICTOR Nivo). Inhibition percentage was calculated as (RLU\u003csub\u003eX\u003c/sub\u003e\u0026minus; RLU\u003csub\u003eP\u003c/sub\u003e) / (RLU\u003csub\u003eN\u003c/sub\u003e \u0026minus; RLU\u003csub\u003eP\u003c/sub\u003e) \u0026times; 100%, where RLU\u003csub\u003eX\u003c/sub\u003e is the RLU value for a test treated with compound X, and RLU\u003csub\u003eP\u003c/sub\u003e and RLU\u003csub\u003eN\u003c/sub\u003e are the RLU values for the reaction mixture without the treatment of compound and the reaction mixture lacking PknB, respectively.\u003c/p\u003e \u003cp\u003ePhosphatase activity was detected as previously described\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Briefly, reactions were performed in 100 \u0026micro;L mixture (containing 50 \u0026micro;g/mL STP in p-nitrophenyl phosphate (pNPP) buffer 25 mM Tris-HCl, pH 7.5, 4 mM MnCl\u003csub\u003e2\u003c/sub\u003e, 0.1 mM EDTA, 0.02% β-mercaptoethanol) and the various concentrations of luteolin (5, 10, 20, 40, and 80 \u0026micro;g/mL). The reaction mixtures were incubated at 37 ℃ for 30 min to allow inhibitor-enzyme interaction and initiated by adding pNPP to a final concentration of 1 mM and incubated at 37 ℃ for 30 min. Finally, 50 \u0026micro;L 1M NaOH was added to quench the reaction, and the absorbance was measured at 405 nm. The absorbance was calculated as a percentage of the phosphatase activity and plotted as a function of inhibitor concentration to determine the half-maximal inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) of luteolin for STP. The data that were displayed on a log scale were log-transformed and non-linear regression was conducted using GraphPad Prism 8.0 with the variable slope normalized model for enzyme inhibition to ascertain IC\u003csub\u003e50\u003c/sub\u003e. The experiments were carried out three times independently under the same conditions.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe Western blot and qRT\u003cb\u003e-\u003c/b\u003ePCR results are presented as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations (SDs) of three separate experiments. Statistical analysis and independent Student\u0026rsquo;s tests were performed via GraphPad Prism 8.0 and SPSS Statistics V17.0. Statistical significance was defined as *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEffects of luteolin on the transcription levels of\u003c/b\u003e \u003cb\u003epknB\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003estp\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes were detected across all the \u003cem\u003eT. pyogenes\u003c/em\u003e isolates. To investigate the effect of luteolin on the transcription levels of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes, Qrt\u003cb\u003e-\u003c/b\u003ePCR analysis was conducted after luteolin treatment on \u003cem\u003eT. pyogenes\u003c/em\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, there were significant reductions in the expression of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes after luteolin treatment. Specifically, compared with that in the control group, the expression of \u003cem\u003epknB\u003c/em\u003e gene decreased to 8.0\u0026ndash;72.7%, while the expression of \u003cem\u003estp\u003c/em\u003e gene decreased to 4.3\u0026ndash;71.6%. These results indicated that luteolin could reduce the transcription levels of \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes in \u003cem\u003eT. pyogenes\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEffects of luteolin on the translation levels of PknB and STP\u003c/h2\u003e \u003cp\u003ePolyclonal antibodies against His-PknB and His-STP were generated by immunizing New Zealand white rabbits. The purification and identification results of His-PknB and His-STP are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA \u003cb\u003eand D\u003c/b\u003e, which indicate that His-PknB and His-STP were successfully obtained. Similarly, GST-PknB and GST-STP were successfully obtained, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB \u003cb\u003eand E\u003c/b\u003e. The ELISA results indicated that the titers of the anti-His-PknB and anti-His-STP polyclonal antibodies reached 1:2,048,000, providing evidence for the ability of rabbit antiserum to recognize the PknB and STP proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC \u003cb\u003eand F\u003c/b\u003e). Subsequently, anti-His-PknB and anti-His-STP polyclonal antibodies were used in Western blot assays to analyse the protein expression of PknB and STP in \u003cem\u003eT. pyogenes\u003c/em\u003e. Three separate Western blot assays were performed, among which one representative Western blot is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA \u003cb\u003eand B\u003c/b\u003e. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, compared with that in the control group, the relative expression level of PknB in 18 \u003cem\u003eT. pyogenes\u003c/em\u003e strains decreased to 26.7% \u0026minus;\u0026thinsp;73.1% after luteolin treatment. Similarly, luteolin also significantly reduced the protein expression level of STP (decreased to 25.9% \u0026minus;\u0026thinsp;72.6%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eMolecular docking of luteolin and PknB/STP\u003c/h2\u003e \u003cp\u003eTo explore the interaction between luteolin and the PknB/STP proteins, molecular docking analysis was performed via CB-Dock 2. The theoretical three-dimensional binding mode of luteolin and PknB is illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA \u003cb\u003eand B\u003c/b\u003e. The simulation results revealed that luteolin was able to interact with the primary amino acid residues on the active site of PknB. The binding energy of luteolin and PknB was \u0026minus;\u0026thinsp;8.9 kcal/mol, which indicated good binding ability. The 3D and 2D interaction plot of the luteolin-PknB complex is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC \u003cb\u003eand D\u003c/b\u003e. We found that luteolin was positioned at the hydrophobic pocket, surrounded by the residues ALA41, LEU20, MET148, MET95, MET158 and VAL28, forming a stable hydrophobic binding. Among these amino acid residues, most of them belong to protein kinase domain. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE \u003cb\u003eand F\u003c/b\u003e, the theoretical three-dimensional binding mode of luteolin and STP is presented. The binding energy between luteolin and STP was \u0026minus;\u0026thinsp;7.4 kcal/mol. The binding interactions primarily involved hydrogen bonding and van der Waals forces, with the key interacting residues being ASP192, GLN137, ALA150, VAL136, ARG156, ARG177 and HIS151 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG \u003cb\u003eand H\u003c/b\u003e). Among these amino residues, all belong to the PPM-type phosphatase domain. Therefore, it is predicted that luteolin may inhibit the activity of protein kinases and phosphatases by binding to the key amino acid residues of the PknB and STP proteins. These results indicate that luteolin exhibits a strong binding affinity for the PknB/STP proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAffinity of luteolin with PknB/STP\u003c/h2\u003e \u003cp\u003eThe affinity between luteolin and PknB or STP was determined via the Biacore T200 system to verify the possibility of interaction of luteolin with PknB and STP. The sensor diagram and fitting curve are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. The binding and dissociation curves revealed the rapid binding and slow dissociation patterns of luteolin and PknB/STP. Through analysis of the fitting parameters, it was determined that the K\u003csub\u003eD\u003c/sub\u003e value of the luteolin and PknB/STP proteins were 3.125\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M and 1.128\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e M, respectively. These findings indicate that luteolin can stably bind to PknB and STP.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffects of luteolin on PknB and STP activities\u003c/h2\u003e \u003cp\u003eTo further assess the effect of luteolin on the activity of PknB and STP, the kinase and phosphatase activity detection assays were conducted to determine the IC\u003csub\u003e50\u003c/sub\u003e of luteolin. It was shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA that the IC\u003csub\u003e50\u003c/sub\u003e of luteolin against PknB was 63.28 \u0026micro;g/mL. The data further verified the inhibitory effect of luteolin on PknB. Additionally, luteolin inhibited the activity of STP in a dose-dependent manner. The IC\u003csub\u003e50\u003c/sub\u003e of luteolin on STP was 47.72 \u0026micro;g/mL (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eInfections caused by \u003cem\u003eT. pyogenes\u003c/em\u003e pose a serious threat to animal husbandry, endangered species protection, and human health. Additionally, the antimicrobial resistance of \u003cem\u003eT. pyogenes\u003c/em\u003e is critical, and novel anti-infection strategies to combat \u003cem\u003eT. pyogenes\u003c/em\u003e are urgently needed. STKs and STPs play important roles in cell division, metabolism, virulence, resistance, and pathogenesis in many important bacterial pathogens\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe significant functions of reversible protein phosphorylation orchestrated by bacterial kinases and phosphatases have been duly acknowledged in recent decades, with various bacterial protein kinases being proposed as viable candidates for novel antibiotic targets\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Several inhibitors that target STK, including staurosporine, K252a, AT9283, and APY29, have recently been discovered. These inhibitors have a significant inhibitory effect on the growth of \u003cem\u003eStreptococcus. suis\u003c/em\u003e in minimal medium\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Chen D. and colleagues reported that sclerotiorin inhibited protein kinase G in \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e and impaired the growth of mycobacterial macrophages\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Flavanones were identified as potential natural inhibitors of the ATP binding site of PknG in \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e and play crucial roles in regulating bacterial metabolism for survival in host macrophages\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Zheng et al. reported that aurintricarboxylic acid (ATA) bound Stp1 directly and inhibited its activity and that ATA was a potent Stp1 inhibitor against staphylococcal infection\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. However, inhibitors targeting \u003cem\u003eT. pyogenes\u003c/em\u003e PknB and STP have not been reported.\u003c/p\u003e \u003cp\u003eLuteolin, a representative natural flavonoid, is widely distributed in nature. Recent studies have verified that luteolin not only has good antibacterial activity but also inhibits the formation of bacterial biofilms and the expression of virulence genes\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Studies have shown that luteolin has anti-quorum-sensing (QS) and anti-biofilm abilities against \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. This is achieved by downregulating the QS signal molecules OdDHL and BHL, inhibiting the relative expression of QS genes, and competing with OdDHL for binding to the LasR receptor protein\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we found that luteolin significantly inhibited the transcription and translation levels of the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes. In addition, luteolin can interact with important amino acid residues of the PknB and STP proteins. Furthermore, luteolin significantly inhibited the activity of PknB and STP. It is hypothesized that it may be due to the tight binding between the inhibitor and the active region of the protein that it is able to compete with the substrate, thus reducing the catalytic ability of the active site and leading to a decrease in protein activity. These results indicate the potential of luteolin as a potential inhibitor of PknB and STP to combat the antimicrobial resistance, virulence, and other biological activities of bacteria. However, the specific effect and mechanism of luteolin on \u003cem\u003eT. pyogenes\u003c/em\u003e through PknB/STP need to be further explored. Our results suggest the feasibility of luteolin as an inhibitor of PknB and STP and provide a theoretical basis for the development of new antibacterial drugs based on natural compounds in the future.\u003c/p\u003e \u003cp\u003eTo date, a number of researches have reported the application of SPR in detecting the interaction between drug molecules and target proteins. This technology can accelerate the screening process of new drugs and improve efficiency, significantly saving research and development costs. Early study has reported that luteolin could bind to the N-terminal of ATP/ADP-binding domain of Hsp90. The stability of this interaction was further confirmed by SPR analysis, suggesting that luteolin may act as a potent Hsp90 inhibitor for antitumor strategies\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Previous work demonstrated that luteolin bound to the L85 and S155 residues of the CviR protein of \u003cem\u003eChromobacterium violaceum\u003c/em\u003e, suggesting that luteolin interacts with the CviR quorum-sensing regulator, influencing the formation of bacterial biofilms and regulating bacterial virulence\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. In prior studies, we ascertained that luteolin inhibited the activities of MsrA and TatD DNases in \u003cem\u003eT. pyogenes\u003c/em\u003e by binding with them\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, the molecular docking results revealed that the PknB and STP proteins had strong affinities with luteolin, and the 3D and 2D structures of combinations of these proteins were presented. The PknB and STP proteins bind to luteolin mainly through hydrophobic forces and hydrogen bonds, respectively. Furthermore, the low free energy between luteolin and PknB/STP demonstrated that the active sites of the PknB and STP proteins were well occupied by luteolin and that their binding was highly stable. The affinity fitting results in this study illustrated that luteolin and PknB/STP could form a relatively stable combination. It has been postulated that the PknB and STP proteins are potential targets of luteolin.\u003c/p\u003e \u003cp\u003eThese findings provide a theoretical foundation for the use of luteolin as a natural antibacterial agent that targets the PknB/STP proteins. Therefore, further studies are needed to elucidate the effects of luteolin on pathogenicity and antimicrobial resistance though the targeting of PknB or STP in \u003cem\u003eT. pyogenes\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThere are still some limitations in this study. Due to constraints related to time and resources, only a preliminary exploration was conducted, and a comprehensive investigation into the action mechanism of luteolin on PknB and STP was not performed. Furthermore, the biological functions of PknB and STP in \u003cem\u003eT. pyogenes\u003c/em\u003e were not examined in this study, leading to ambiguity regarding their roles in the organism. Our future studies will aim to address these gaps through the application of gene knockout and other technologies.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study aimed to explore the regulatory effects of luteolin on the expression of PknB and STP, as well as the interaction between luteolin and PknB/STP, including their binding sites. These results presented compelling evidence supporting the potential of luteolin as an inhibitor of the PknB and STP proteins of \u003cem\u003eT. pyogenes\u003c/em\u003e. Our findings demonstrated a significant inhibitory effect of luteolin on the transcription and translation of the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes. Additionally, luteolin could inhibit the activities of PknB and STP. Furthermore, our results indicated that luteolin could interact with the key amino acid residues of PknB and STP. Luteolin is a promising candidate for the development of novel antibacterial agent to combat \u003cem\u003eT. pyogenes\u003c/em\u003e infections.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e Data is provided within the manuscript or supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe sincerely thank Tian Lan and Sheng Yang of Northeastern University for their assistance in the affinity assay.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e’\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003econtributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.C.L. and Y.R.G. conceived and designed this project and experiments. Y.T.G. and H.Y.S. performed the experiments. L.H.Y. participated for the preparation of animal experiments. Y.T.G., H.Y.S., Y.Y.W., C.L.T. and D.X.Z. participated in experiment design and data analysis. Y.T.G. wrote the original draft preparation. Y.R.G. and M.C.L. participated in revising the manuscript. All the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Nature Science Foundation of China, Grant Number 31972736.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrespondence\u003c/strong\u003e and requests for materials should be addressed to Y.R.G or M.C.L.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReprints and permissions information\u003c/strong\u003e is available at www.nature.com/reprints.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher’s note\u003c/strong\u003e Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations.\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRzewuska, M. et al. Pathogenicity and Virulence of \u003cem\u003eTrueperella pyogenes\u003c/em\u003e: A Review. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 2737 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarchionatti, E., Kittl, S., Sendi, P. \u0026amp; Perreten, V. Whole genome-based antimicrobial resistance, virulence, and phylogenetic characteristics of \u003cem\u003eTrueperella pyogenes\u003c/em\u003e clinical isolates from humans and animals. \u003cem\u003eVet. Microbiol.\u003c/em\u003e \u003cb\u003e294\u003c/b\u003e, 110102 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMileva, R. et al. Oxytetracycline Pharmacokinetics After Intramuscular Administration in Cows with Clinical Metritis Associated with \u003cem\u003eTrueperella Pyogenes\u003c/em\u003e Infection. \u003cem\u003eAntibiotics-Basel\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 392 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarchionatti, E. \u0026amp; Perreten, V. Novel macrolide-lincosamide-streptogramin B resistance gene \u003cem\u003eerm\u003c/em\u003e (56) in \u003cem\u003eTrueperella pyogenes\u003c/em\u003e. \u003cem\u003emSphere\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, e002392 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, D. et al. \u003cem\u003eTrueperella pyogenes\u003c/em\u003e isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution. \u003cem\u003eMicrob. Pathog\u003c/em\u003e. \u003cb\u003e105\u003c/b\u003e, 51\u0026ndash;56 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGal\u0026aacute;n-Rela\u0026ntilde;o, \u0026Aacute;. et al. Antimicrobial susceptibility and genetic characterization of \u003cem\u003eTrueperella pyogenes\u003c/em\u003e isolates from pigs reared under intensive and extensive farming practices. \u003cem\u003eVet. Microbiol.\u003c/em\u003e \u003cb\u003e232\u003c/b\u003e, 89\u0026ndash;95 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang, C. et al. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e Transcriptome Data and Metabolic Modelling Investigate the Interplay of Ser/Thr Kinase PknB, Its Phosphatase Stp, the \u003cem\u003eglmR/yvcK\u003c/em\u003e Regulon and the \u003cem\u003ecdaA\u003c/em\u003e Operon for Metabolic Adaptation. \u003cem\u003eMicroorganisms\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 2148 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, H. et al. Stk and Stp1 participate in \u003cem\u003eStreptococcus suis\u003c/em\u003e serotype 2 pathogenesis by regulating capsule thickness and translocation of certain virulence factors. \u003cem\u003eMicrob. Pathog\u003c/em\u003e. \u003cb\u003e152\u003c/b\u003e, 104607 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, Y., Dou, Q., Du, L. \u0026amp; Wang, Y. QseB/QseC: a two-component system globally regulating bacterial behaviors. \u003cem\u003eTrends Microbiol.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 749\u0026ndash;762 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, L. et al. Roles of two-component regulatory systems in \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e: Regulation of virulence, antibiotic resistance, and stress responses. \u003cem\u003eMicrobiol. Res.\u003c/em\u003e \u003cb\u003e272\u003c/b\u003e, 127374 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsaka, M. et al. \u003cem\u003eStreptococcus pyogenes\u003c/em\u003e TrxSR Two-Component System Regulates Biofilm Production in Acidic Environments. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cb\u003e89\u003c/b\u003e, e0036021 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaefers, M. M. Regulation of Virulence by Two-Component Systems in \u003cem\u003ePathogenic Burkholderia\u003c/em\u003e. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cb\u003e88\u003c/b\u003e, e00927\u0026ndash;e00919 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurastero, O. et al. Specificity and Reactivity of \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e Serine/Threonine Kinases PknG and PknB. \u003cem\u003eJ. Chem. Inf. Model.\u003c/em\u003e \u003cb\u003e62\u003c/b\u003e, 1723\u0026ndash;1733 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, J. et al. A link between STK signalling and capsular polysaccharide synthesis in \u003cem\u003eStreptococcus suis\u003c/em\u003e. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 2480 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, C. et al. The Eukaryote-Like Serine/Threonine Kinase STK Regulates the Growth and Metabolism of Zoonotic \u003cem\u003eStreptococcus suis\u003c/em\u003e. \u003cem\u003eFront. Cell. Infect. Microbiol.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 66 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanczarek, M., Vinardell, J. M., Lipa, P. \u0026amp; Karaś, M. Hanks-Type Serine/Threonine Protein Kinases and Phosphatases in Bacteria: Roles in Signaling and Adaptation to Various Environments. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 2872 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagarajan, S. N., Lenoir, C. \u0026amp; Grangeasse, C. Recent advances in bacterial signaling by serine/threonine protein kinases. \u003cem\u003eTrends Microbiol.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 553\u0026ndash;566 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, J. et al. Protein kinases PknA and PknB independently and coordinately regulate essential \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e physiologies and antimicrobial susceptibility. \u003cem\u003ePLoS Pathog\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e, e1008452 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi, M. et al. Luteolin, a flavone ingredient: Anticancer mechanisms, combined medication strategy, pharmacokinetics, clinical trials, and pharmaceutical researches. \u003cem\u003ePhytother Res.\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 880\u0026ndash;911 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaheri, Y. et al. Paving Luteolin Therapeutic Potentialities and Agro-Food-Pharma Applications: Emphasis on \u003cem\u003eIn Vivo\u003c/em\u003e Pharmacological Effects and Bioavailability Traits. \u003cem\u003eOxid Med Cell Longev.\u003c/em\u003e 1987588 (2021). (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, Y. et al. The Antibacterial Activity and Mechanism of Action of Luteolin Against \u003cem\u003eTrueperella pyogenes\u003c/em\u003e. \u003cem\u003eInfect. Drug Resist.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 1697\u0026ndash;1711 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, D. et al. Luteolin Showed a Resistance Elimination Effect on Gentamicin by Decreasing MATE mRNA Expression in \u003cem\u003eTrueperella pyogenes\u003c/em\u003e. \u003cem\u003eMicrob. Drug Resist.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 619\u0026ndash;626 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, Y. et al. Luteolin increases susceptibility to macrolides by inhibiting MsrA efflux pump in \u003cem\u003eTrueperella pyogenes\u003c/em\u003e. \u003cem\u003eVet. Res.\u003c/em\u003e \u003cb\u003e53\u003c/b\u003e, 3 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L. et al. Effects of Luteolin on Biofilm of \u003cem\u003eTrueperella pyogenes\u003c/em\u003e and Its Therapeutic Effect on Rat Endometritis. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 14451 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaier, A. \u0026amp; Szyszka, R. Compounds from Natural Sources as Protein Kinase Inhibitors. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1546 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, S. et al. Novel protein kinase C phosphorylated kinase inhibitor-matrine suppresses replication of hepatitis B virus via modulating the mitogen-activated protein kinase signal. \u003cem\u003eBioengineered\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 2851\u0026ndash;2865 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, Y. et al. Structural Basis for the Inhibition of the Autophosphorylation Activity of HK853 by Luteolin. \u003cem\u003eMolecules\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 933 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu, K. J. et al. Small Molecule Pin1 Inhibitor Blocking NF-κB Signaling in Prostate Cancer Cells. \u003cem\u003eChem. Asian J.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 275\u0026ndash;279 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu, J. J. et al. Quinones derived from plant secondary metabolites as anti-cancer agents. \u003cem\u003eAnticancer Agents Med. Chem.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 456\u0026ndash;463 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeung, K. H. et al. Discovery of a small-molecule inhibitor of STAT3 by ligand-based pharmacophore screening. \u003cem\u003eMethods\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e, 38\u0026ndash;43 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyon, G. J. et al. Rational design of a global inhibitor of the virulence response in Staphylococcus aureus, based in part on localization of the site of inhibition to the receptor-histidine kinase, AgrC. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e21\u003c/b\u003e, 13330\u0026ndash;13335 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLolli, G. et al. Inhibition of protein kinase CK2 by flavonoids and tyrphostins. A structural insight. \u003cem\u003eBiochemistry\u003c/em\u003e \u003cb\u003e51\u003c/b\u003e, 6097\u0026ndash;6107 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao, X., Huang, X., Zhou, Z. \u0026amp; Lin, X. An improvement of the 2ˆ (-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. \u003cem\u003eBiostat Bioinforma Biomath\u003c/em\u003e. \u003cb\u003e3\u003c/b\u003e, 71\u0026ndash;85 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y. et al. CB-Dock2: improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, W159\u0026ndash;W164 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrott, O. \u0026amp; Olson, A. J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. \u003cem\u003eJ. Comput. Chem.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 455\u0026ndash;461 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdasme, M. F. et al. PLIP 2021: expanding the scope of the protein-ligand interaction profiler to DNA and RNA. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, W530\u0026ndash;W534 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaudreault, F., Morency, L. P. \u0026amp; Najmanovich, R. J. NRGsuite: a PyMOL plugin to perform docking simulations in real time using FlexAID. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 3856\u0026ndash;3858 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas, S. et al. Surface plasmon resonance as a fascinating approach in target-based drug discovery and development. \u003cem\u003eTrends Anal. Chem.\u003c/em\u003e \u003cb\u003e171\u003c/b\u003e, 117501\u0026ndash;117501 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKing, A. \u0026amp; Blackledge, M. S. Evaluation of small molecule kinase inhibitors as novel antimicrobial and antibiofilm agents. \u003cem\u003eChem. Biol. Drug Des.\u003c/em\u003e \u003cb\u003e98\u003c/b\u003e, 1038\u0026ndash;1064 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, H. et al. Inhibitors targeting the autophosphorylation of serine/threonine kinase of \u003cem\u003eStreptococcus suis\u003c/em\u003e show potent antimicrobial activity. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 990091 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, D. et al. Sclerotiorin inhibits protein kinase G from \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e and impairs mycobacterial growth in macrophages. \u003cem\u003eTuberculosis (Edinb)\u003c/em\u003e. \u003cb\u003e103\u003c/b\u003e, 37\u0026ndash;43 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwain, S. P. et al. Flavanones: A potential natural inhibitor of the ATP binding site of PknG of \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e. \u003cem\u003eJ. Biomol. Struct. Dyn.\u003c/em\u003e \u003cb\u003e40\u003c/b\u003e, 11885\u0026ndash;11899 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng, W. et al. Structure-Based Identification of a Potent Inhibitor Targeting Stp1-Mediated Virulence Regulation in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. \u003cem\u003eCell. Chem. Biol.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 1002\u0026ndash;1013 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Z. et al. Molecular Basis for Luteolin as a Natural TatD DNase Inhibitor in \u003cem\u003eTrueperella pyogenes\u003c/em\u003e. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 8374 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiyah, N. W., Indriani, D. A., Dessidianti, R. \u0026amp; Siswandono, S. \u003cem\u003esilico\u003c/em\u003e analysis of luteolin derivatives as antibacterial agents targeting DNA gyrase and CTX-M-15 extended-spectrum β-lactamase of \u003cem\u003eEscherichia coli\u003c/em\u003e. \u003cem\u003eJ. Adv. Pharm. Technol. Res.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 29\u0026ndash;36 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFakhar, M., Ahmed, M. \u0026amp; Nasim Sabri, A. Computational and experimental strategies for combating MBL \u003cem\u003eP. aeruginosa\u003c/em\u003e (MBLPA) biofilms using phytochemicals: Targeting the quorum sensing network. \u003cem\u003eSaudi J. Biol. Sci.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 104001 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeng, Y. F. et al. An innovative role for luteolin as a natural quorum sensing inhibitor in \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cb\u003e274\u003c/b\u003e, 119325 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu, J. et al. Luteolin induces carcinoma cell apoptosis through binding Hsp90 to suppress constitutive activation of STAT3. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e7\u003c/b\u003e, e49194 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRivera, M. L. C. et al. Effect of Capsicum Frutescens Extract, Capsaicin, and Luteolin on Quorum Sensing Regulated Phenotypes. \u003cem\u003eJ. Food Sci.\u003c/em\u003e \u003cb\u003e84\u003c/b\u003e, 1477\u0026ndash;1486 (2019).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Trueperella pyogenes, Luteolin, PknB, STP, Drug target, Inhibitor","lastPublishedDoi":"10.21203/rs.3.rs-5222514/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5222514/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eTrueperella pyogenes\u003c/em\u003e (\u003cem\u003eT. pyogenes\u003c/em\u003e) is a significant opportunistic pathogen that causes suppurative infection in many animals, as well as humans. Considering the strong drug resistance of \u003cem\u003eT. pyogenes\u003c/em\u003e, the development of novel antibacterial drugs and drug targets to combat infections is necessary. Serine/threonine protein kinases (STKs) and serine/threonine phosphatases (STPs) play pivotal roles in the physiological processes, pathogenesis, and resistance of several important bacterial pathogens, indicating their potential as antimicrobial drug targets. In this study, we aimed to investigate the effects of luteolin, a natural flavonoid, on serine/threonine protein kinase B (PknB) and serine/threonine phosphatase (STP). The results revealed that after \u003cem\u003eT. pyogenes\u003c/em\u003e was treated with 1/2 MIC (39 \u0026micro;g/mL) luteolin for 36 h, the transcription and translation levels of the \u003cem\u003epknB\u003c/em\u003e and \u003cem\u003estp\u003c/em\u003e genes decreased significantly. Molecular docking revealed that hydrophobic forces were predominant in the interaction between luteolin and PknB, whereas hydrogen bonding was predominant in the interaction between luteolin and STP. The results of the molecular interaction assay revealed that the K\u003csub\u003eD\u003c/sub\u003e value of luteolin with PknB and STP were 3.125\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e M and 1.128\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e M, respectively. Additionally, luteolin could inhibit the activities of PknB and STP. Our study demonstrated that luteolin can inhibit PknB and STP at multiple levels, and it is expected to be used as a PknB/STP inhibitor to develop new drugs against drug-resistant bacterial infections.\u003c/p\u003e","manuscriptTitle":"PknB and STP as Potential Targets of Luteolin in Combating Trueperella pyogenes Infections","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-29 15:50:26","doi":"10.21203/rs.3.rs-5222514/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-05T04:41:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-18T05:34:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"284734864801997407755568446634630054526","date":"2025-04-27T07:04:28+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-26T09:51:08+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-11T05:20:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-04-08T01:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ab0f191f-4da5-4fae-83b6-f94209ffd803","owner":[],"postedDate":"April 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47760900,"name":"Biological sciences/Drug discovery/Pharmacology"},{"id":47760901,"name":"Biological sciences/Microbiology/Antimicrobials"}],"tags":[],"updatedAt":"2025-07-07T16:07:24+00:00","versionOfRecord":{"articleIdentity":"rs-5222514","link":"https://doi.org/10.1038/s41598-025-08698-5","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-03 15:58:31","publishedOnDateReadable":"July 3rd, 2025"},"versionCreatedAt":"2025-04-29 15:50:26","video":"","vorDoi":"10.1038/s41598-025-08698-5","vorDoiUrl":"https://doi.org/10.1038/s41598-025-08698-5","workflowStages":[]},"version":"v1","identity":"rs-5222514","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5222514","identity":"rs-5222514","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.