De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea

De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Data Note De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea Johan Zicola, Prasad Dasari, Katharina Klara Hahn, Katharina Ziese-Kubon, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4144249/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Jun, 2024 Read the published version in BMC Genomic Data → Version 1 posted 9 You are reading this latest preprint version Abstract Objectives The oak processionary moth (OPM) ( Thaumetopoea processionea ) is a species of moth (order: Lepidoptera ) native to parts of central Europe. However, in recent years, it has become an invasive species in various countries, particularly in the United Kingdom and the Netherlands. The larvae of the OPM are covered with urticating barbed hairs (setae) causing irritating and allergic reactions at the three last larval stages (L3-L5). The aim of our study was to generate a de novo transcriptomic assembly for OPM larvae by including one non-allergenic stage (L2) and two allergenic stages (L4 and L5). A transcriptomic assembly will help identify potential allergenic peptides produced by OPM larvae, providing valuable information for developing novel therapeutic strategies and allergic immunodiagnostic assays. Data Transcriptomes of three larval stages of the OPM were de novo assembled and annotated using Trinity and Trinotate, respectively. A total of 145,251 transcripts from 99,868 genes were identified. Bench-marking universal single-copy orthologues analysis indicated high completeness of the assembly. About 19,600 genes are differentially expressed between the non-allergenic and allergenic larval stages. The data provided here contribute to the characterization of OPM, which is both an invasive species and a health hazard. Transcriptome RNA-seq oak processionary moth allergen Objective The impact of the OPM on human health is a significant concern [ 1 ]. Direct contact with the caterpillars or their setae containing potential allergenic peptides that can cause skin irritation, redness, itching, and the formation of painful rashes and blisters. In addition to dermatitis, the inhalation of the caterpillar hairs can lead to respiratory problems [ 2 , 3 ]. The microscopic hairs can irritate the airways, causing symptoms such as coughing, wheezing, sore throat, and difficulty breathing [ 4 ]. In some cases, severe allergic reactions may occur, leading to asthma attacks or anaphylaxis, a life-threatening condition. To identify OPM allergens, we generated transcriptomic data for OPM larvae at the non-allergenic stage (L2) and at two allergenic stages (L4 and L5). The de novo transcriptomic assembly across all three stages defined the expressed genes and the predicted encoded peptides. Differential gene expression between the stages can highlight genes potentially involved in the allergenic properties of stages L4 and L5. These data will help identifying potential allergenic peptides produced by OPM larvae that can prospectively fill the diagnostic gap in the development of allergic immunization assays and allergy immunotherapy options. Data description RNA isolation and library preparation Larvae of Thaumetopoea processionea were all collected from a single nest in an English oak tree ( Quercus robur ) in Briesener Zootzen (Germany, 52°45'18.6"N 12°40'29.3"E), in May 14, 2022 (L2 and L4 stages) and June 15, 2022 (L5 stage). The larvae were then brought to the laboratory, snap frozen in liquid nitrogen, and stored at -80°C. Larvae were homogenized with mortar and pestle in liquid nitrogen and 20 mg of tissue was used for total RNA extraction with the Quick-RNA™ Tissue/Insect Microprep kit (Zymo, R2030). Eleven RNA-seq libraries (4 x L2 larvae, 4 x L4 larvae, 3 x L5 larvae) were prepared with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB, E7760L). Paired-end sequencing (100 + 100 bp) was performed on the 11 pooled libraries on the MGISEQ-2000 (BGI) to obtain about 30–55 million reads per library. Data filtering, transcriptome assembly and quality We used the de novo transcriptome assembly pipeline recommended by the Harvard Faculty of Arts and Sciences Informatics Group ( https://github.com/harvardinformatics/TranscriptomeAssemblyTools ) which considers common issues [ 5 ]. The raw reads were first cleaned from rare kmers and sequencing errors using Rcorrector [ 6 ]. The read adaptors were then trimmed and bad quality reads were removed using cutadapt [ 7 ] (cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --quality-base 33 --max-n 0 -o output.R1.fq -p output.R2.fq input.R1.fq input.R2.fq). Ribosomal RNA sequences were removed using bowtie2 [ 8 ] against the Lepidoptera SSU and LSU rRNA sequences downloaded from the SILVA database ( https://www.arb-silva.de ) (bowtie2 --nofw --quiet --very-sensitive-local --phred33 -x index_bowtie − 1 input.R1.fq -2 input.R2.fq --un-conc-gz output.rRNA_removed.fq.gz > /dev/null). Over-represented sequences were removed using the python script RemoveFastqcOverrepSequenceReads.py ( https://github.com/harvardinformatics/TranscriptomeAssemblyTools ). Empty reads produced by cutadapt (header present but read sequence removed) were removed using a perl command (perl -i -p -e 's/^ $ /N/g;' input.fq). The de novo assembly of the OPM transcriptome was performed using Trinity (v2.15.1) [ 9 ] using the pooled fastq files to build all possible transcripts across all three stages and biological replicates (Trinity --seqType fq --CPU 8 --max_memory 100G --left pooled.R1.fa --right pooled.R2.fa --SS_lib_type RF --output trinity_output). The assembly fasta file was uploaded on NCBI as transcriptomic shotgun assembly for verification, and transcripts identified as duplicates or matching other kingdoms were removed and resubmitted. Raw fastq files and transcriptome assembly are available in NCBI ( Data file 1). The description statistics of the assembly generated with the Trinity perl script TrinityStats.pl is available in Data file 2. Long open reading frames and derived peptide sequences were obtained using the Perl scripts TransDecoder.LongOrfs and TransDecoder.Predict, respectively (Haas, BJ. https://github.com/TransDecoder (v5.7.0)). The completeness of the transcriptome assembly was determined with Benchmarking Universal Single-Copy Orthologs (BUSCO) software (v5.4.3) [ 10 ]. Longest isoforms of each gene (99,868 genes total) were retrieved using the get_longest_isoform_seq_per_trinity_gene.pl utility script from Trinity. These isoforms were compared to the 5,286 marker genes from the Lepidoptera lineage and the completeness found was 89.3%, including 84.9% and 4.4% of single-copy and duplicated genes, respectively (BUSCO analysis summary in Data file 3 ). Annotation Functional annotation of the transcriptome assembly generated by Trinity was performed with Trinotate (v3.2.2) [ 11 ] and provided in Data file 4 . Differential expression analysis To identify differentially expressed between stages, a salmon (v0.10.2) [ 12 ] index was first build on the Trinity output fasta file (salmon index -Trinity.fasta -i Trinity.fasta.salmon.idx), the utility Trinity perl script was then used to perform alignment and abundance estimation on single samples (align_and_estimate_abundance.pl --transcripts Trinity.fasta --gene_trans_map Trinity.fasta.gene_trans_map --samples_file samples.txt --est_methold salmon --SS_lib_type RF). The output salmon quant.sf files from salmon were then imported in R using the tximport and DESeq2 (v1.28.1) packages [ 13 , 14 ]. Differential expressed genes between stages and between the allergenic and non-allergenic stages were identified. Log fold change shrinkage was performed using the apelgm R package [ 15 ]. The lists of differentially expressed genes with an adjusted p-value below 5% for each comparison were summarized in an Excel spreadsheet ( Data File 5 ). Table 1 Overview of data files Label Name of data file/data set File types (file extension) Data repository and identifier (DOI or accession number) Data file 1 Sequencing data and transcriptome assembly of Thaumetopoea processionea larval stages SRA and TSA files (.fastq, .fasta) NCBI BioProject PRJNA1072613 https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1072613 [ 16 ] Data file 2 Summary statistics of the transcriptome assembly Text file (.txt) Figshare, https://doi.org/10.6084/m9.figshare.25333600.v1 [ 17 ] Data file 3 Benchmarking Universal Single-Copy Orthologues (BUSCO) analysis of the transcriptome assembly Text file (.txt) Figshare, https://doi.org/10.6084/m9.figshare.25333603.v1 [ 18 ] Data file 4 Trinotate annotation report Compressed text file (.tsv.gz) Figshare, https://doi.org/10.6084/m9.figshare.25333753.v1 [ 19 ] Data file 5 Genes differentially expressed between stages and between allergenic and non-allergenic stages Excel file (.xls) Figshare, https://doi.org/10.6084/m9.figshare.25333777.v1 [ 20 ] Data file 6 Bioinformatics script for the de novo transcriptome assembly analysis PDF document (.pdf) Figshare, https://doi.org/10.6084/m9.figshare.25334269.v1 [ 21 ] Limitations The de novo transcriptomic analysis of the OPM provided here considered only larval stages of the insect. Thus, the transcripts defined here represent only a fraction of the transcriptome. For instance, genes expressed specifically in the imago cannot be detected with our approach. A more comprehensive picture of the OPM transcriptome would require integrating samples from more developmental stages, e.g. egg, pupa, and imago life stages in a de novo transcriptome assembly. Abbreviations BUSCO Bench-marking universal single-copy orthologs OPM Oak processionary moth TSA Transcriptome shotgun assembly SRA Short read archive Declarations Not applicable. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Data availability The raw RNA-seq and the transcriptome assembly are available on the NCBI accession number PRJNA1072613 [16]. See table 1 and references [17–20] for Figshare results. Detailed bioinformatics scripts are available as PDF document in Data File 6 [21] and on GitHub (https://github.com/johanzi/OPM_transcriptome_assembly). Author's contribution SS and TB designed the experiment, AM collected the larvae, PD and KKH identified the larvae and conditioned the samples, KZK extracted RNA from the samples prepared the RNA-seq libraries, JZ performed the analyses and wrote the manuscript. All authors reviewed the manuscript. Funding This work was supported by a grant from the Federal Ministry of Food and Agriculture (Germany) to TB (FNR #22220NR145X). Open Access funding enabled and organized by Projekt DEAL. We acknowledge support by the Open Access Publication Funds of Göttingen University. References Rahlenbeck S, Utikal J. The oak processionary moth: a new health hazard? Br J Gen Pract. 2015;65:435–6. Gottschling S, Meyer S. An epidemic airborne disease caused by the oak processionary caterpillar. Pediatr Dermatol. 2006;23:64–6. Forkel S, Mörlein J, Sulk M, Beutner C, Rohe W, Schön M p., et al. Work-related hazards due to oak processionary moths: a pilot survey on medical symptoms. J Eur Acad Dermatol Venereol. 2021;35:e779–82. Battisti A, Holm G, Fagrell B, Larsson S. Urticating Hairs in Arthropods: Their Nature and Medical Significance. Annu Rev Entomol. 2011;56 Volume 56, 2011:203–20. Freedman AH, Clamp M, Sackton TB. Error, noise and bias in de novo transcriptome assemblies. Mol Ecol Resour. 2021;21:18–29. Song L, Florea L. Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads. GigaScience. 2015;4:48. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011;17:10–2. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357–9. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29:644–52. Manni M, Berkeley MR, Seppey M, Simão FA, Zdobnov EM. BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes. Mol Biol Evol. 2021;38:4647–54. Bryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep. 2017;18:762–76. Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417–9. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. Soneson C, Love MI, Robinson MD. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. 2016. Zhu A, Ibrahim JG, Love MI. Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences. Bioinformatics. 2019;35:2084–92. NCBI BioProject. https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1072613. Accessed 1 Mar 2024. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Summary statistics of the de novo transcriptome assembly of oak processionary moth (larval stages L2, L4, L5). figshare https://doi.org/10.6084/m9.figshare.25333600.v1. 2024. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Benchmarking Universal Single-Copy Orthologues (BUSCO) analysis on the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, L5). figshare https://10.6084/m9.figshare.25333603.v1. 2024. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Trinotate annotation of the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, and L5). figshare https://10.6084/m9.figshare.25333753.v1. 2024. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Differential gene expression analyses between larval stages of the oak processionary moth (Thaumetopoea processionea). figshare https://10.6084/m9.figshare.25333777.v1. 2024. Zicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Bioinformatic script for the de novo transcriptome assembly analysis of the oak processionary moth (Thaumetopoea processionea). figshare https://doi.org/10.6084/m9.figshare.25334269.v1. 2024. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 08 Jun, 2024 Read the published version in BMC Genomic Data → Version 1 posted Editorial decision: Revision requested 13 May, 2024 Reviews received at journal 13 May, 2024 Reviewers agreed at journal 13 May, 2024 Reviews received at journal 09 Apr, 2024 Reviewers agreed at journal 08 Apr, 2024 Reviewers invited by journal 08 Apr, 2024 Submission checks completed at journal 26 Mar, 2024 Editor assigned by journal 26 Mar, 2024 First submitted to journal 21 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4144249","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Data Note","associatedPublications":[],"authors":[{"id":284320146,"identity":"52208f0c-6d44-4c75-af3b-768ce2b89be3","order_by":0,"name":"Johan Zicola","email":"","orcid":"","institution":"Georg-August-University Göttingen","correspondingAuthor":false,"prefix":"","firstName":"Johan","middleName":"","lastName":"Zicola","suffix":""},{"id":284320147,"identity":"b3cf7684-ab38-48e6-baea-129ad8e61efb","order_by":1,"name":"Prasad Dasari","email":"","orcid":"","institution":"University Medical Center Göttingen","correspondingAuthor":false,"prefix":"","firstName":"Prasad","middleName":"","lastName":"Dasari","suffix":""},{"id":284320148,"identity":"bf262f6e-8532-4603-b459-d75752bae146","order_by":2,"name":"Katharina Klara Hahn","email":"","orcid":"","institution":"University Medical Center Göttingen","correspondingAuthor":false,"prefix":"","firstName":"Katharina","middleName":"Klara","lastName":"Hahn","suffix":""},{"id":284320149,"identity":"6f87eb34-33ac-4948-9245-06a6fd4459c2","order_by":3,"name":"Katharina Ziese-Kubon","email":"","orcid":"","institution":"Georg-August-University Göttingen","correspondingAuthor":false,"prefix":"","firstName":"Katharina","middleName":"","lastName":"Ziese-Kubon","suffix":""},{"id":284320150,"identity":"57e90000-708f-404a-add4-ce734f85daf1","order_by":4,"name":"Armin Meurer","email":"","orcid":"","institution":"University of Applied Sciences and Arts (HAWK)","correspondingAuthor":false,"prefix":"","firstName":"Armin","middleName":"","lastName":"Meurer","suffix":""},{"id":284320151,"identity":"d56d85e8-d551-4824-97e7-0b5f4684b1d8","order_by":5,"name":"Timo Buhl","email":"","orcid":"","institution":"University Medical Center Göttingen","correspondingAuthor":false,"prefix":"","firstName":"Timo","middleName":"","lastName":"Buhl","suffix":""},{"id":284320152,"identity":"7d65d0f2-0b5a-4b67-91f3-40936c864389","order_by":6,"name":"Stefan Scholten","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABVklEQVRIie2RP0vDQBTA3xFIl7RZr2DtV0gJVIRivkqOQrrYPYNISuBcLF1THPwKGbt54SDTfYCAHSqCuAgpOLSIfy5NI6YqdBTJb7jj7r3fvXc8gIqKP0q6WTEgJrdDAOTl90q+FcdPVEDBVgEmHbPIwdq+CikSsAY/K+1rP/LWM7D0K5/x1J0PwlvfQ89u79yq1fnjcgatSVkxYpWMxgJIMI9txsTDMJxHnnIgHNlYwzmeCjCn5TKGqh0t6hRsA58aLKJ8GCbk4qVJuVS0rilDJGTlxqi+HL1SsHLljQ+MhHhKk77nigyRm7ICsYZ8+RQKN4rH7UxBS8oyxbxHWZXdvzgdv0UxCRLHZiLmnWlWBUS/ecm1LhpTbAY7jfn8bvREe5Ye9KOFe8bbjWSwQCv3RK9NhJmuaa812R1MMZSvKNuZqPhb6DfQaqum++VXVFRU/G8+AH1Yf4/3WEWoAAAAAElFTkSuQmCC","orcid":"","institution":"Georg-August-University Göttingen","correspondingAuthor":true,"prefix":"","firstName":"Stefan","middleName":"","lastName":"Scholten","suffix":""}],"badges":[],"createdAt":"2024-03-21 14:31:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4144249/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4144249/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12863-024-01237-7","type":"published","date":"2024-06-08T14:48:58+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58822101,"identity":"56cc76e4-48a6-4d22-baa1-71321788ae74","added_by":"auto","created_at":"2024-06-21 16:31:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":327612,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4144249/v1/31da112d-80a4-40ba-9f0a-0d17cc653a14.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea","fulltext":[{"header":"Objective","content":"\u003cp\u003eThe impact of the OPM on human health is a significant concern [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Direct contact with the caterpillars or their setae containing potential allergenic peptides that can cause skin irritation, redness, itching, and the formation of painful rashes and blisters. In addition to dermatitis, the inhalation of the caterpillar hairs can lead to respiratory problems [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The microscopic hairs can irritate the airways, causing symptoms such as coughing, wheezing, sore throat, and difficulty breathing [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In some cases, severe allergic reactions may occur, leading to asthma attacks or anaphylaxis, a life-threatening condition. To identify OPM allergens, we generated transcriptomic data for OPM larvae at the non-allergenic stage (L2) and at two allergenic stages (L4 and L5). The \u003cem\u003ede novo\u003c/em\u003e transcriptomic assembly across all three stages defined the expressed genes and the predicted encoded peptides. Differential gene expression between the stages can highlight genes potentially involved in the allergenic properties of stages L4 and L5. These data will help identifying potential allergenic peptides produced by OPM larvae that can prospectively fill the diagnostic gap in the development of allergic immunization assays and allergy immunotherapy options.\u003c/p\u003e"},{"header":"Data description","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and library preparation\u003c/h2\u003e \u003cp\u003eLarvae of \u003cem\u003eThaumetopoea processionea\u003c/em\u003e were all collected from a single nest in an English oak tree (\u003cem\u003eQuercus robur\u003c/em\u003e) in Briesener Zootzen (Germany, 52\u0026deg;45'18.6\"N 12\u0026deg;40'29.3\"E), in May 14, 2022 (L2 and L4 stages) and June 15, 2022 (L5 stage). The larvae were then brought to the laboratory, snap frozen in liquid nitrogen, and stored at -80\u0026deg;C. Larvae were homogenized with mortar and pestle in liquid nitrogen and 20 mg of tissue was used for total RNA extraction with the Quick-RNA\u0026trade; Tissue/Insect Microprep kit (Zymo, R2030). Eleven RNA-seq libraries (4 x L2 larvae, 4 x L4 larvae, 3 x L5 larvae) were prepared with NEBNext\u0026reg; Ultra\u0026trade; II Directional RNA Library Prep Kit for Illumina\u0026reg; (NEB, E7760L). Paired-end sequencing (100\u0026thinsp;+\u0026thinsp;100 bp) was performed on the 11 pooled libraries on the MGISEQ-2000 (BGI) to obtain about 30\u0026ndash;55\u0026nbsp;million reads per library.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eData filtering, transcriptome assembly and quality\u003c/h2\u003e \u003cp\u003eWe used the \u003cem\u003ede novo\u003c/em\u003e transcriptome assembly pipeline recommended by the Harvard Faculty of Arts and Sciences Informatics Group (\u003cspan class=\"ExternalRef\"\u003e \u003cspan class=\"RefSource\"\u003ehttps://github.com/harvardinformatics/TranscriptomeAssemblyTools\u003c/span\u003e \u003cspan address=\"https://github.com/harvardinformatics/TranscriptomeAssemblyTools\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e \u003c/span\u003e) which considers common issues [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The raw reads were first cleaned from rare kmers and sequencing errors using Rcorrector [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The read adaptors were then trimmed and bad quality reads were removed using cutadapt [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] (cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --quality-base 33 --max-n 0 -o output.R1.fq -p output.R2.fq input.R1.fq input.R2.fq). Ribosomal RNA sequences were removed using bowtie2 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] against the \u003cem\u003eLepidoptera\u003c/em\u003e SSU and LSU rRNA sequences downloaded from the SILVA database (\u003cspan class=\"ExternalRef\"\u003e \u003cspan class=\"RefSource\"\u003ehttps://www.arb-silva.de\u003c/span\u003e \u003cspan address=\"https://www.arb-silva.de\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e \u003c/span\u003e) (bowtie2 --nofw --quiet --very-sensitive-local --phred33 -x index_bowtie \u0026minus;\u0026thinsp;1 input.R1.fq -2 input.R2.fq --un-conc-gz output.rRNA_removed.fq.gz \u0026gt; /dev/null). Over-represented sequences were removed using the python script RemoveFastqcOverrepSequenceReads.py (\u003cspan class=\"ExternalRef\"\u003e \u003cspan class=\"RefSource\"\u003ehttps://github.com/harvardinformatics/TranscriptomeAssemblyTools\u003c/span\u003e \u003cspan address=\"https://github.com/harvardinformatics/TranscriptomeAssemblyTools\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e \u003c/span\u003e). Empty reads produced by cutadapt (header present but read sequence removed) were removed using a perl command (perl -i -p -e 's/^\u003cspan\u003e$\u003c/span\u003e/N/g;' input.fq). The \u003cem\u003ede novo\u003c/em\u003e assembly of the OPM transcriptome was performed using Trinity (v2.15.1) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] using the pooled fastq files to build all possible transcripts across all three stages and biological replicates (Trinity --seqType fq --CPU 8 --max_memory 100G --left pooled.R1.fa --right pooled.R2.fa --SS_lib_type RF --output trinity_output). The assembly fasta file was uploaded on NCBI as transcriptomic shotgun assembly for verification, and transcripts identified as duplicates or matching other kingdoms were removed and resubmitted. Raw fastq files and transcriptome assembly are available in NCBI (\u003cb\u003eData file 1).\u003c/b\u003e The description statistics of the assembly generated with the Trinity perl script TrinityStats.pl is available in \u003cb\u003eData file 2.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eLong open reading frames and derived peptide sequences were obtained using the Perl scripts TransDecoder.LongOrfs and TransDecoder.Predict, respectively (Haas, BJ. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/TransDecoder\u003c/span\u003e\u003cspan address=\"https://github.com/TransDecoder\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (v5.7.0)).\u003c/p\u003e \u003cp\u003eThe completeness of the transcriptome assembly was determined with Benchmarking Universal Single-Copy Orthologs (BUSCO) software (v5.4.3) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Longest isoforms of each gene (99,868 genes total) were retrieved using the get_longest_isoform_seq_per_trinity_gene.pl utility script from Trinity. These isoforms were compared to the 5,286 marker genes from the \u003cem\u003eLepidoptera\u003c/em\u003e lineage and the completeness found was 89.3%, including 84.9% and 4.4% of single-copy and duplicated genes, respectively (BUSCO analysis summary in \u003cb\u003eData file 3\u003c/b\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAnnotation\u003c/h2\u003e \u003cp\u003eFunctional annotation of the transcriptome assembly generated by Trinity was performed with Trinotate (v3.2.2) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] and provided in \u003cb\u003eData file 4\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eDifferential expression analysis\u003c/h2\u003e \u003cp\u003eTo identify differentially expressed between stages, a salmon (v0.10.2) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] index was first build on the Trinity output fasta file (salmon index -Trinity.fasta -i Trinity.fasta.salmon.idx), the utility Trinity perl script was then used to perform alignment and abundance estimation on single samples (align_and_estimate_abundance.pl --transcripts Trinity.fasta --gene_trans_map Trinity.fasta.gene_trans_map --samples_file samples.txt --est_methold salmon --SS_lib_type RF). The output salmon quant.sf files from salmon were then imported in R using the tximport and DESeq2 (v1.28.1) packages [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Differential expressed genes between stages and between the allergenic and non-allergenic stages were identified. Log fold change shrinkage was performed using the apelgm R package [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The lists of differentially expressed genes with an adjusted p-value below 5% for each comparison were summarized in an Excel spreadsheet (\u003cb\u003eData File 5\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOverview of data files\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLabel\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eName of data file/data set\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFile types\u003c/p\u003e \u003cp\u003e(file extension)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eData repository and identifier (DOI or accession number)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSequencing data and transcriptome assembly of Thaumetopoea processionea larval stages\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSRA and TSA files (.fastq, .fasta)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNCBI BioProject PRJNA1072613 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/bioproject/PRJNA1072613\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1072613\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eSummary statistics of the transcriptome assembly\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eText file (.txt)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFigshare, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6084/m9.figshare.25333600.v1\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.25333600.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBenchmarking Universal Single-Copy Orthologues (BUSCO) analysis of the transcriptome assembly\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eText file (.txt)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFigshare, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6084/m9.figshare.25333603.v1\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.25333603.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 4\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eTrinotate annotation report\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCompressed text file (.tsv.gz)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFigshare, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6084/m9.figshare.25333753.v1\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.25333753.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 5\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eGenes differentially expressed between stages and between allergenic and non-allergenic stages\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eExcel file (.xls)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFigshare, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6084/m9.figshare.25333777.v1\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.25333777.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eData file 6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eBioinformatics script for the de novo transcriptome assembly analysis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePDF document (.pdf)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFigshare, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.6084/m9.figshare.25334269.v1\u003c/span\u003e\u003cspan address=\"10.6084/m9.figshare.25334269.v1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Limitations","content":"\u003cp\u003eThe \u003cem\u003ede novo\u003c/em\u003e transcriptomic analysis of the OPM provided here considered only larval stages of the insect. Thus, the transcripts defined here represent only a fraction of the transcriptome. For instance, genes expressed specifically in the imago cannot be detected with our approach. A more comprehensive picture of the OPM transcriptome would require integrating samples from more developmental stages, e.g. egg, pupa, and imago life stages in a \u003cem\u003ede novo\u003c/em\u003e transcriptome assembly.\u003c/p\u003e "},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBUSCO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBench-marking universal single-copy orthologs\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOPM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOak processionary moth\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTranscriptome shotgun assembly\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSRA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eShort read archive\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe raw RNA-seq and the transcriptome assembly are available on the NCBI accession number PRJNA1072613 [16]. See table 1 and references [17\u0026ndash;20] for Figshare results. Detailed bioinformatics scripts are available as PDF document in Data File 6 [21] and on GitHub (https://github.com/johanzi/OPM_transcriptome_assembly).\u003c/p\u003e\n\u003cp\u003eAuthor\u0026apos;s contribution\u003c/p\u003e\n\u003cp\u003eSS and TB designed the experiment, AM collected the larvae, PD and KKH identified the larvae and conditioned the samples, KZK extracted RNA from the samples prepared the RNA-seq libraries, JZ performed the analyses and wrote the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by a grant from the Federal Ministry of Food and Agriculture (Germany) to TB (FNR #22220NR145X). Open Access funding enabled and organized by Projekt DEAL. We acknowledge support by the Open Access Publication Funds of G\u0026ouml;ttingen University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRahlenbeck S, Utikal J. The oak processionary moth: a new health hazard? Br J Gen Pract. 2015;65:435\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eGottschling S, Meyer S. An epidemic airborne disease caused by the oak processionary caterpillar. Pediatr Dermatol. 2006;23:64\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003eForkel S, M\u0026ouml;rlein J, Sulk M, Beutner C, Rohe W, Sch\u0026ouml;n M p., et al. Work-related hazards due to oak processionary moths: a pilot survey on medical symptoms. J Eur Acad Dermatol Venereol. 2021;35:e779\u0026ndash;82.\u003c/li\u003e\n\u003cli\u003eBattisti A, Holm G, Fagrell B, Larsson S. Urticating Hairs in Arthropods: Their Nature and Medical Significance. Annu Rev Entomol. 2011;56 Volume 56, 2011:203\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eFreedman AH, Clamp M, Sackton TB. Error, noise and bias in de novo transcriptome assemblies. Mol Ecol Resour. 2021;21:18\u0026ndash;29.\u003c/li\u003e\n\u003cli\u003eSong L, Florea L. Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads. GigaScience. 2015;4:48.\u003c/li\u003e\n\u003cli\u003eMartin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011;17:10\u0026ndash;2.\u003c/li\u003e\n\u003cli\u003eLangmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eGrabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29:644\u0026ndash;52.\u003c/li\u003e\n\u003cli\u003eManni M, Berkeley MR, Seppey M, Sim\u0026atilde;o FA, Zdobnov EM. BUSCO Update: Novel and Streamlined Workflows along with Broader and Deeper Phylogenetic Coverage for Scoring of Eukaryotic, Prokaryotic, and Viral Genomes. Mol Biol Evol. 2021;38:4647\u0026ndash;54.\u003c/li\u003e\n\u003cli\u003eBryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep. 2017;18:762\u0026ndash;76.\u003c/li\u003e\n\u003cli\u003ePatro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.\u003c/li\u003e\n\u003cli\u003eSoneson C, Love MI, Robinson MD. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. 2016.\u003c/li\u003e\n\u003cli\u003eZhu A, Ibrahim JG, Love MI. Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences. Bioinformatics. 2019;35:2084\u0026ndash;92.\u003c/li\u003e\n\u003cli\u003eNCBI BioProject. https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1072613. Accessed 1 Mar 2024.\u003c/li\u003e\n\u003cli\u003eZicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Summary statistics of the de novo transcriptome assembly of oak processionary moth (larval stages L2, L4, L5). figshare https://doi.org/10.6084/m9.figshare.25333600.v1. 2024.\u003c/li\u003e\n\u003cli\u003eZicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Benchmarking Universal Single-Copy Orthologues (BUSCO) analysis on the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, L5). figshare https://10.6084/m9.figshare.25333603.v1. 2024.\u003c/li\u003e\n\u003cli\u003eZicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Trinotate annotation of the de novo transcriptome assembly of the oak processionary moth (larval stages L2, L4, and L5). figshare https://10.6084/m9.figshare.25333753.v1. 2024.\u003c/li\u003e\n\u003cli\u003eZicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Differential gene expression analyses between larval stages of the oak processionary moth (Thaumetopoea processionea). figshare https://10.6084/m9.figshare.25333777.v1. 2024.\u003c/li\u003e\n\u003cli\u003eZicola J, Dasari P, Ziese-Kubon K, Meurer A, Buhl T, Scholten S. Bioinformatic script for the de novo transcriptome assembly analysis of the oak processionary moth (Thaumetopoea processionea). figshare https://doi.org/10.6084/m9.figshare.25334269.v1. 2024.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-genomic-data","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gtic","sideBox":"Learn more about [BMC Genomic Data](http://bmcgenet.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gtic/default.aspx","title":"BMC Genomic Data","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Transcriptome, RNA-seq, oak processionary moth, allergen","lastPublishedDoi":"10.21203/rs.3.rs-4144249/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4144249/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjectives\u003c/h2\u003e \u003cp\u003eThe oak processionary moth (OPM) (\u003cem\u003eThaumetopoea processionea\u003c/em\u003e) is a species of moth (order: \u003cem\u003eLepidoptera\u003c/em\u003e) native to parts of central Europe. However, in recent years, it has become an invasive species in various countries, particularly in the United Kingdom and the Netherlands. The larvae of the OPM are covered with urticating barbed hairs (setae) causing irritating and allergic reactions at the three last larval stages (L3-L5). The aim of our study was to generate a \u003cem\u003ede novo\u003c/em\u003e transcriptomic assembly for OPM larvae by including one non-allergenic stage (L2) and two allergenic stages (L4 and L5). A transcriptomic assembly will help identify potential allergenic peptides produced by OPM larvae, providing valuable information for developing novel therapeutic strategies and allergic immunodiagnostic assays.\u003c/p\u003e\u003ch2\u003eData\u003c/h2\u003e \u003cp\u003eTranscriptomes of three larval stages of the OPM were \u003cem\u003ede novo\u003c/em\u003e assembled and annotated using Trinity and Trinotate, respectively. A total of 145,251 transcripts from 99,868 genes were identified. Bench-marking universal single-copy orthologues analysis indicated high completeness of the assembly. About 19,600 genes are differentially expressed between the non-allergenic and allergenic larval stages. The data provided here contribute to the characterization of OPM, which is both an invasive species and a health hazard.\u003c/p\u003e","manuscriptTitle":"De novo transcriptome assembly of the oak processionary moth Thaumetopoea processionea","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-29 11:51:48","doi":"10.21203/rs.3.rs-4144249/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-13T15:50:47+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-13T14:45:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"590382fa-966b-4656-a410-377681b21836","date":"2024-05-13T13:24:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-10T02:13:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"f9a62156-4ab4-4c4e-973d-07e231b968f5","date":"2024-04-09T03:24:46+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-08T10:03:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-27T02:52:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-27T02:52:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Genomic Data","date":"2024-03-21T14:29:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-genomic-data","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"gtic","sideBox":"Learn more about [BMC Genomic Data](http://bmcgenet.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/gtic/default.aspx","title":"BMC Genomic Data","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ed79b402-5476-4126-be93-97da24a0e9e2","owner":[],"postedDate":"March 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-06-21T14:48:59+00:00","versionOfRecord":{"articleIdentity":"rs-4144249","link":"https://doi.org/10.1186/s12863-024-01237-7","journal":{"identity":"bmc-genomic-data","isVorOnly":false,"title":"BMC Genomic Data"},"publishedOn":"2024-06-08 14:48:58","publishedOnDateReadable":"June 8th, 2024"},"versionCreatedAt":"2024-03-29 11:51:48","video":"","vorDoi":"10.1186/s12863-024-01237-7","vorDoiUrl":"https://doi.org/10.1186/s12863-024-01237-7","workflowStages":[]},"version":"v1","identity":"rs-4144249","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4144249","identity":"rs-4144249","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}