Crocin effects on the anticancer properties of Lactobacillus lactis probiotics against colorectal adenocarcinoma cells

Crocin effects on the anticancer properties of Lactobacillus lactis probiotics against colorectal adenocarcinoma cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Crocin effects on the anticancer properties of Lactobacillus lactis probiotics against colorectal adenocarcinoma cells Faranak Gholipour, Mehdi Entezar, Mohammad Amini, Somayeh Vandghanooni, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4665517/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Nov, 2024 Read the published version in Naunyn-Schmiedeberg's Archives of Pharmacology → Version 1 posted 12 You are reading this latest preprint version Abstract There are numerous potential mechanisms that can account for the propensity of probiotics to prevent the onset of colorectal cancer. These effects include but are not limited to deactivation of cancer-causing agents, competition with harmful bacteria, boosting the immune system, and reducing cell proliferation by controlling apoptosis and cell differentiation. Other benefits include fermenting undigested food and limiting the activity of certain signaling pathways. Research has shown that the gut microbiota is impacted by nutrition, which subsequently affects the metabolomics, thereby establishing a connection between diet, microbiota, and overall health. The objective of this study was to assess the resistance of Lactobacillus lactis to Crocin. The study involved extracting cell-free supernatants from untreated bacteria and bacteria treated with crocin, and then examining their ability to prevent the growth of HCT-116 colon cancer cells. It was proven that L. lactic , when treated with crocin, can effectively fight against various types of harmful bacteria and can survive in acidic conditions. After 48 hours, both CFS and cro-CFS showed a dose-dependent inhibition of HCT-116 cell growth. The half-maximal inhibitory concentration was 97.41 µL/mL for CFS and 72.07 µL/mL for cro-CFS. The results of flow cytometry tests confirmed the MTT assay findings, showing that cro-CFS-treated cells had a higher rate of apoptosis at 46.8% compared to CFS-treated cells at 25.42%. The results were confirmed by qPCR, which showed that the Caspase 9 and BAX genes were upregulated and the BCL-2 expression level was reduced in cells treated with cro-CFS and CFS. Crocin could alter the metabolomics of probiotics present in the gut, potentially impacting their ability to fight cancer. Crocin Probiotics Lactobacillus lactis Anticancer colorectal cancer Treatment Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Colorectal cancer (CRC), which refers to cancer in the colon and/or rectum, is a major health issue. It is the third most frequently diagnosed and second most deadly form of cancer [ 1 ]. In 2022, colorectal cancer was responsible for 9.4% of cancer deaths. Research has shown that factors, such as diet, family history, and chronic inflammation increase the risk of developing this type of cancer [ 2 ]. The digestive system has both beneficial and harmful bacteria, and recent studies suggest that the bacteria present in our gut (gut bacteria) have a significant impact on maintaining overall health. Scientists named the term "immunobiotics" to refer to a certain kind of probiotic that belongs to the lactic acid genus [ 3 ]. This probiotic is known for its ability to regulate inflammation and improve the body's immune system. Probiotic bacteria can help prevent colon cancer by stimulating the immune system, changing the microorganisms in the intestine, increasing antioxidant activity, regulating cell growth, and breaking down harmful substances like mutagenic compounds and secondary bile acids produced by gut bacteria [ 4 ]. Colon cells use short-chain fatty acids (SCFA) as a source of energy, which regulate the pH level of the intestine, prevent excessive production of secondary bile acids, and encourage the elimination of cancer cells [ 5 ]. Probiotics intake increases the production of SCFAs on a daily basis, which can impact inflammation via interaction with certain receptors that are expressed in the intestine and the regulation of the immune system. Both linoleic acid (LA) and conjugated linoleic acid (CLA) are capable of activating genes that cause apoptosis, such as Bcl-2, caspase 3, and caspase 9, which in turn can reduce the growth of colon cancer cells [ 6 ]. A number of studies have found that certain bacteria such as Lactobacillus , Bifid bacterium , Streptococcus salivary , and Propionibacterium freudenreichii subspecies have the ability to produce CLA in the terminal ileum. The CLA can be absorbed by the cells in the colon or interact with them to generate beneficial results [ 6 ]. Research suggests that certain dietary substances can cause at least 50% of cancers. Clinical trials have shown that prebiotics can increase the number and activity of beneficial bacteria in the gut and change the metabolomics released by these bacteria. Further studies have found that bacteria possess an advanced system that enables them to identify nutritional signals and regulate their metabolic activities accordingly [ 7 ]. Food additives have the potential to alter the microbiome, including LAB, as well as secondary metabolites and metabolic pathways. For centuries, crocin has been utilized as a food additive to treat several diseases. Crocin is gained from the dried stigmas of Crocus sativa L., which is also known as saffron. Although crocin is recognized as a powerful anticancer element in saffron stigma, the molecular mechanisms behind its effectiveness are not yet understood [ 8 ]. Research has revealed that it possesses anti-cancer attributes in cultured human malignant cell lines and animal models,, as well as anti-oxidative, anti-atherosclerotic, anti-hyperlipidemia, cardio-protective, hepato-protective, and neuroprotective effects [ 9 ]. The ability of crocin to alter gene expression and trigger programmed cell death (apoptosis) in animals during preclinical studies suggests that it could potentially be a highly efficacious treatment option to prevent cancer and for chemotherapy treatment in humans [ 10 ]. Antioxidants can enhance the performance of LAB in the digestive system, thereby increasing their ability to fight cancer [ 11 ]. The study aimed to delve deeper into the potential of crocin in augmenting the anticancer properties of probiotics. The bacterial species used in this study as a probiotic was Lactobacillus lactic . The study compared the ability of bacterial metabolites produced by L. lactic that were treated with crocin to hinder growth of colon cancer cells to that of metabolites produced by untreated L. lactic used as a control. The MTT assay was used to evaluate the toxicity of the secreted metabolites of probiotics on the HCT human colorectal adenocarcinoma cell line. The analysis of apoptosis/necrosis using flow cytometry was performed through staining of annexin V/PI. As the final step, qPCR was utilized to investigate the expression level of genes contributing to the apoptosis and survival of malignant cells to unveil the molecular mechanisms underlying anti-tumor activity of bioactive metabolites of bacteria. 2. Material and methods 2.1. Materials and Instruments The Pasteur Institute was where HCT-116 colorectal cancer cell line was bought. All of the Shigella dysenteriae, Staphylococ aureus, Pseudomonas aeruginosa and Lactobacillus lactis PTCC 1057, were provided by the Iranian Research Organization for Science and Technology (Tehran, Iran). From SPL Life Sciences, we bought tissue culture flasks, 96-well culture plates, 6-well culture plates, and pipettes (Gyeonggi-do, South Korea). Invitrogen supplied RPMI 1640 medium, trypsin, penicillin, streptomycin, and FBS (Waltham, MA, USA). Sigma Aldrich was where we got MTT powder, Triton-X100, diethylpyrocarbonate (DEPC), Proteinase K, trypan blue, and sterile discs (St. Louis, MI, USA). Merck gave us the DMSO, the crocin, and the de Man, Rogosa, and Sharpe (MRS) media (Darmstadt, Germany). RNA isolation kit (RiboEx) was purchased from GeneAll company (Korea). InterLabService was where the Reverta-L reagent kit was bought (Moscow, Russia). Complementary DNA (cDNA) synthesis kit (BioFact™ RT-Kit) and 2X Real-Time PCR Master Mix were bought from BioFact company (Korea). Bio-Rad T100 Thermal Cycler (USA) and Applied Biosystems™ StepOne™ Real-Time PCR System (USA) were used to carry out cDNA synthesis and qPCR reactions. An ELx 800 spectrophotometer (Biotek, USA) was used to evaluate optical density (OD). Annexin V-fluorescein isothiocyanate (FITC) Propidium iodide (PI) dual staining kit was provided from EBioscience (Waltham, MA, USA). Unless stated otherwise, all extra materials were bought from Fermentas Life Science (Waltham, MA, USA) or Merck (Darmstadt, Germany). 2.2. Cell-free supernatant (CFS) preparation L. lactis was cultivated at a temperature of 37°C in a modified MRS broth medium until it reached 0.7–0.8 OD at 600 nm wavelength. MRS agar, which is a defined medium, was created to grow lactobacilli from various sources as a substitute for tomato juice agar. The OD (0.8) yield on MRS agar was determined to be 10 9 colony-forming units (CFU) per milliliter, which corresponds to the bacterial density found in the large intestine (i.e., around 10 9 – 10 11 CFU/ml). During multiple cultures, bacteria grown in the presence of crocin showed resistance to increasing concentrations of crocin, including 25 µg/ml, 50 µg/ml, 75 µg/ml, 100 µg/ml, 125 µg/ml, 150 µg/ml, and 200 µg/ml. For 48 hours, the bacteria were cultured in the mentioned concentrations of crocin, or until 10 9 CFU/ml of bacterial colonies were cultivated in MRS broth. After that, the supernatants and sediments of the resistance bacteria to the highest concentration of crocin (200 µg/ml) and untreated bacteria were collected, and then adjusted to 7.4 pH. Next, to produce cell-free supernatant (CFS) and crocin-resistant bacteria supernatant (cro-CFS), the supernatants were passed through 0.2-micron sterile filters. Besides, bacterial sediments were PBS-washed two times and the resistance of recovered bacteria to low pH was evaluated. To conduct cellular investigations, both untreated and crocin-treated bacteria were harvested and transferred to RPMI medium 24 hours prior to treatment. Following, the supernatants were centrifuged to collect CFS and cro-CFS, their pH was adjusted to 7.4 and they were filtered via a 0.2-micron filter. 2.3. Evaluating the resistance of corcin-treated bacteria to the acidic environments The resilience of bacteria treated with crocin to the acidic environment of the stomach was investigated. Briefly, the bacteria that showed the greatest resistance to crocin at pH 7.2 were isolated and washed with PBS. They were then exposed to pH 3.0 PBS for 0, 1, 2, and 3 hours. The rate of bacterial resistance was determined using the MRS agar-based pour plate method in regard to the survival of bacteria. The following equation explains how the survival rates of the bacteria were determined [ 12 ]. Equation I: Survival rate% = log CFUN1/log CFUN0×100. In this equation, N1 signifies the counts viable bacteria isolated on MRS agar at low pH, and N0 represents the counts of viable bacteria prior to culturing in an acidic environment. 2.3. Antimicrobial Susceptibility Test The effectiveness of CFS in fighting pathogen bacteria commonly found in medical settings was tested using an antimicrobial susceptibility test, also known as disc diffusion and zone of inhibition assay. Gram-negative bacteria Shigella dysenteriyae , gram-positive bacteria Staphylococcus aureus , and Pseudomonas aeruginosa [ 12 ] were used in the experiment. All bacterial strains were grown in nutritious broths and a germ-free disc covered by cro-CSF (10 µl/mL) and CFS alongside relevant antibiotics were loaded onto plates, allowing the diffuse of CFS into the agar for 2 hours at 24°C. Next, the plates were incubated at 37°C for 24 hours, and the diameter of the inhibitory zone was calculated. To determine these zones around the discs a Mitutoyo sliding caliper was employed. and the results were categorized based on the level of resistance relative to the standard antibiotics [ 13 ]. The negative control was a sterile disc containing PBS (pH 7.2) while Azithromycin 30 µg discs were considered as the positive controls for Pseudomonas aeruginosa , and Staphylococcus aureus , and Ampicillin 30 µg discs for Shigella dysenteriyae . 2.4. Characterization of the protein content of CSF To evaluate the effect of protein elements of CFS on its antibacterial and cytotoxic activity, Proteinase K treatment was performed. Briefly, CFS and cro-CFS (200 µl/mL) were treated with Proteinase K (100µg/ml) for 1 hour at 37°C. Next, the enzyme deactivation was done by incubating CFS mixtures at 70°C for 20 min [ 14 ]. The treated CFSs were used for further experiments. 2.5. Cell Culture HCT-116 human colorectal cancer cell line were cultured in RPMI 1640 media. The supplementary components included 10% FBS, penicillin antibiotic (100 U/ml) and streptomycin antibiotic (100 µl/ml) antibiotic. The cultivation environment was a CO 2 incubator providing 80% humidity and 37°C temperature. 2.6. Cell viability (MTT) assay The cytotoxic effects of various concentrations of CFSs on HCT-116 cells was assessed using the MTT test. HCT-116 cells (2.0×10 4 cells per well) were seeded into 96-well cell culture plates and after reaching confluency upon 24 hours of incubation treated with the CFSs. After 24-hour incubation, MTT reagent (2mg/ml solved in PB) was added to the wells and allowed to be incubated for 4 hours. The formazan crystals produced by oxidoreductase enzymes of viable cells were dispersed using DMSO solution and the absorbance of each well at 570 nm wavelength was measured using the Tecan ELISA plate reader. 2.7. Flow cytometry analysis of cell apoptosis To identify the presence of treated cells in early and late stages of apoptosis, or in necrosis state, FITC-labeled annexin V and PI dual staining was done based on the flow cytometric analysis. HCT-116 cells (2.5×10 5 cells per well) were cultured in 6-well culture plates, treated with CFS and cro-CFS, incubated for 24 hours, and harvested. The harvested cells were then washed with PBS and then incubation with 1x binding buffer solution (200 µL) containing 5 µL annexin V-FITC and 5 µL PI for 15 min in a dark place. The stained cells were washed and resuspended in PBS and then subjected to the BD FACS Calibur TM flow cytometer (FACS Quant; Milteny, Germany). Data analysis was performed by FlowJo software Version 10 (TreeStar Inc., USA). 2.8. Flow cytometry analysis of cell cycle progression In order to identify the effects of CFS and cro-CFS on the HCT-116 cell division and proliferation, flow cytometry analysis based on PI staining was performed. To do this, after cultivation and treatment in 6-well culture plates, HCT-116 cells were collected, and washed with cold PBS. Next, they were fixed with 75% ethanol and stored at -20°C for 2 days. Next, the cells were treated with RNase A (100 µg/mL) for 30 min at the room temperature. After that, the cells were incubation in 500 µL PBS solution containing PI (0.1%, v/v) and Triton X-100 (0.1%, v/v). Finally, the samples were subjected to flow cytometry and the obtained data was analyzed using FlowJo software. 2.9. Gene expression analysis To understand the molecular aspects of CFS-mediated cell apoptosis, gene expression analysis was performed using qRT-PCR technique. HCT-116 cells were cultured in 6-well culture plates, treated with IC50 of CFS and cro-CFS, and incubated for 24 hours. After that, RNA extraction and cDNA synthesis were carried out. Using the cDNA samples, gene expression was analyzed by 2X Real-Time PCR Master Mix in StepOne™ Real-Time PCR System. Reverse and forward primers for Bax, Bcl-2, and Caspase-3 genes were generated using oligo 7 software, which are presented in Table 1 . After gathering Threshold Cycle (Ct) values for each sample through duplicated reactions, 2 − ddCt was employed for the comparison of relative gene expression between the samples. GAPDH housekeeping gene was used to normalize gene expression. Table 1 The list and sequences of used primers for gene expression analysis. Gene Forward/ Reverse Sequence (5′-3′) Length Accession Number BAX Forward GACTCCCCCCGAGAGGTCTT 121 NM_004324 Reverse ACAGGGCCTTGAGCACCAGTT BCL-2 Forward CTGTGGATGACTGAGTACCTG 127 NM_000633 Reverse GAGACAGCCAGGAGAAATCA Caspase-9 Forward CTGTCTACGGCACAGATGGAT 177 NM_001229 Reverse GGGACTCGTCTTCAGGGGAA GAPDH Forward CAAGATCATCAGCAATGCCT 166 NM_002046 Reverse GCCATCACGCCACAGTTTCC 2.10. Statistical analysis To determine if there were any significant differences between the groups, we utilized the analysis of variance (ANOVA) method and then followed up with Dennett’s test. We conducted all statistical analyses using GraphPad Prism version 6.01. We considered a P-value less than 0.05 to be statistically significant. In order to ensure accuracy, we conducted three separate tests on each set of data gathered during our investigation. 3. Results 3.1. Preparation of CFS To determine the effectiveness of crocin-treated and intact L. lactic against HCT colon cancer cells, CFS of both intact and crocin-treated L. lactic were used. To this end, L. lactic were exposed to varying concentrations of crocin, gradually increasing the dose to the highest concentration of 150 µg/ml. This was achieved by repeatedly exposing bacterial cultures to increasing concentrations of crocin, until the desired bacterial count was obtained. A reduction in the number of bacterial colonies was observed when crocin was present in the first round of treatment, but the bacterial colonies grew during subsequent treatments and during the adaptation process. Our findings showed that, in the presence of 20 µg/ml of crocin, the log CFU for the bacteria was 9.2, as illustrated in Fig. 1 . When the highest concentration of crocin, 150 µg/ml, was used, the bacteria could adjust and their growth rate only slightly increased up to 100%. However, when the concentration of crocin increased to 200 µg/ml, the bacteria's growth rate significantly decreased. Therefore, the rest of experiments were done with the bacteria which were exposed to crocin dose of 150 µg/ml. 3.2. Resistance to acidic pH The characteristics that set probiotics apart include their ability to tolerate low stomach pH, promote good health, and survive in harsh conditions. To ensure that L. lactic treated with crocin could outlive in the acidic environment of the stomach, an experiment was conducted to test their resistance. The results, as shown in Table 2 , indicate that there was no significant change in the bacteria's survival rate or growth at low pH when treated with crocin. Table 2 The survival rates of L. lactic with/without crocin treatment at different time intervals upon cultivation in acidic environment (pH = 3). Treatment Groups Final count (log cfu/ml) of bacteria 0 hour 1 hour 2 hours 3 hours %Viability crocin -treated L. lactic 7.02 ± 0.2 6.82 ± 0.1 6.92 ± 0.2 6.84 ± 0.1 70.43 Untreated L. lactic 7.02 ± 0.1 6.85 ± 0.2 6.90 ± 0.2 6.90 ± 0.2 73.65 3.3. The antibacterial activity of CFS and cro-CFS Probiotics are renowned for their ability to combat pathogen bacteria. Lactic acid bacteria (LAB) are especially effective in the production if antibacterial substances, such as lactic acid, hydrogen peroxide, acetic acid, and bacteriocins. In this study, the antibacterial properties of CFS and cro-CFS were evaluated against several pathogenic bacteria in order to determine whether crocin treatment had any impact on L. lactic’s probiotic function. The results, as outlined in Table 3 , demonstrate that cro-CFS was significantly more effective at killing all of the targeted bacteria ( Shigella dysenteriyae , Staphylococcus aureus , and Pseudomonas aeruginosa ) than CFS alone (as illustrated in Figs. 2 and 3). These findings confirm that the addition of crocin did not compromise L. Lactic’s probiotic properties. 3.4. The effect of CSF protein content on antibacterial activity This investigation was conducted to understand the biologically active protein composition of CSF and cro-CFS. The results shown in Table 3 indicated that the use of proteinase K on cro-CFS removed its ability to fight off pathogenic bacteria, indicating the significance of the biologically active proteins released by L. lactic . These proteins were found to be responsible for the toxicity against pathogenic bacteria, demonstrating their importance in the antibacterial properties of cro-CFS. Table 3 The results of Zone of inhibition assay. The inhibition diameters caused by CFS and cro-CFS discs against pathogenic bacteria are presented. Pathogenic Bacteria Strain Supernatant Diameter (mm) Pseudomonas aeruginosa CFS 2 ± 0.2 cro-CFS 15 ± 0.6 CFS + PK 0.00 ± 0.0 cro-CFS + PK 0.00 ± 0.0 Positive CTRL (Azithromycin) 35 ± 0.4 Negative CTRL 0.00 ± 0.0 Staphylococ aureus CFS 2 ± 0.3 cro-CFS 15 ± 0.2 CFS + PK 0.00 ± 0.0 cro-CFS + PK 0.00 ± 0.0 Positive CTRL (Azithromycin) 30 ± 0.6 Negative CTRL 0.00 ± 0.0 Shigella dysenteriyae CFS 5 ± 0.2 cro-CFS 14 ± 0.2 CFS + PK 0.00 ± 0.0 cro-CFS + PK 0.00 ± 0.0 Positive CTRL (Azithromycin) 21 ± 0.3 Negative CTRL 0.00 ± 0.0 3.5. Cell cytotoxicity MTT assay was done to reveal anti-tumor impact of CFS and cro-CFS on HCT-116 colorectla cancer cell line. The results indicated that the cytotoxic or anti-proliferative effect of CFS and cro-CFS on HCT cells was dependent on the dosage and time. In the cro-CFS group, a substantial reduction in cell viability was observed at doses ranging from 25–200 µl/ml compared to the CFS group. However, at a concentration of 200 µl/ml, the decrease in cell viability in the cro-CFS group was less significant (P < 0.01) than in the CFS group (Fig. 4 ). The IC50 values for CFS and cro-CFS were 97.41 µl/ml and 72.07 µl/ml, respectively. Therefore, these findings suggest that cro-CFS had a more significant suppressive effect on HCT-116 cell viability than CFS. 3.6. cro-CFS induced apoptosis in HCT cells Annexin V was utilized in order to assess the impact of CFS and cro-CFS on HCT-116 cell apoptosis. By using annexin V-FITC and PI, early and late stages of apoptosis and necrosis were measured in HCT cells treated with CFS and cro-CFS. In apoptotic cells, annexin V protein binds to phosphatidylserines translocated the outer leaflet of the cell membrane. Necrotic cells were quantified by counting only PI-stained cells that had compromised cell membranes. The results (Fig. 5 ) showed that CFS significantly (p < 0.0001) elevated apoptosis rate to 25.42% in HCT-116 cells and cro-CFS significantly (p < 0.0001) increased this rate to 46.8% when compared to control cells (0.95%). These results also evidenced that pretreatment of bacteria with crocin significantly increased CFS-induced apoptosis in HCT-116 cells. 3.7. Cell cycle In order to explore the impact of CFS and cro-CFS on HCT cells, an additional examination utilizing flow cytometry for the quantification of cell cycle arrest was conducted. The findings displayed in Fig. 6 indicate that 16.9% of cells treated with CFS were arrested in the Sub-G1 phase. Conversely, in cells treated with cro-CFS, the proportion of Sub-G1 arrested cells increased by 30.8%. Upon conducting statistical analysis, a notable difference was observed between the amounts of apoptotic cells (Sub-G1 arrested cells) when cells were treated either with CFS (P < 0.001) or with cro-CFS (P < 0.0001) in comparison to the control group. An additional significant difference was noted between the percentages of apoptotic cells in the cro-CFS group in comparison to CFS group (P < 0.001). 3.9. The effect of CFS on expression of genes involved in cell survival and apoptosis The utilization of qPCR aided us in measuring the extent of gene expression alterations and served as a confirmation tool for the results obtained from other experiments. The results established a significant increase in Bax gene expression levels in both the CFS (P < 0.001) and cro-CFS groups (P < 0.0001) in comparison with the control group. Furthermore, the expression of Bax mRNA was found to be higher in the cro-CFS group when compared with the CFS group (P < 0.0001), indicating that cro-CFS intensifies apoptosis by regulating this particular gene. The results also revealed a significant reduction in the expression of Bcl-2 mRNA in both the CFS and cro-CFS groups (P < 0.01 and P < 0.0001, respectively) when compared to the control group, with the decrease in expression being greater in the cro-CFS group than in the CFS group (P < 0.01). Similarly, the expression of the Caspase-9 gene was found to have significantly decreased in both the CFS and cro-CFS groups (P < 0.01 and P < 0.0001, respectively) when compared to the control group, with the decrease being more significant in the cro-CFS group than in the CFS group (P < 0.001), as represented in Fig. 7 . 4. Discussion Colon cancer is a significant global health concern and ranks as the third most widespread malignancy in males and the second most common cancer in females. The incidence rate of colon cancer varies greatly across different regions of the world [ 15 ]. The colon cancer development is initiated by the transformation of normal epithelial cells into neoplastic cells, which can alter the cellular environment. The occurrence of colon cancer is influenced by various risk factors, including nutrition [ 16 ]. Recent research has demonstrated that probiotics can act as a preventative measure for colon cancer and can alleviate its symptoms [ 17 ]. Probiotics are live microorganisms that have beneficial effects on the host's digestive flora when they are used in sufficient amounts. While lactobacilli and bifid bacteria are the most commonly used probiotics, there are many other microorganisms with similar properties [ 18 ]. Probiotics possess great potential to impact the growth, progression, and treatment of colon cancer, but their effectiveness varies in regard to the type of probiotic used. Utilizing probiotics can strengthen lactic acid bacteria in the stomach and intestines, which have various mechanisms that can aid in preventing the development of cancers, particularly colon cancer [ 19 ]. These mechanisms include altering the metabolic activities of the intestinal microflora, changing the physical and chemical conditions of the colon, neutralizing carcinogenic substances, promoting phagocytosis, producing anticancer substances, and enhancing host immune responses [ 20 ]. The most common probiotic bacteria are Lactobacillus, which offers nutritional benefits when consumed in appropriate amounts. Research suggests that the use of Lactobacillus probiotics can reduce the proliferation of colorectal tumor cells in the early stages of cancer [ 21 ]. Crocin, which is found in saffron, is a plant antioxidant that has been identified as the most significant anticancer compound in saffron [ 22 ]. It works by altering genes and inducing apoptosis in cancer cells. Crocin has been shown to be effective in reducing the synthesis of DNA, RNA, and protein, as well as inhibiting RNA polymerase II in neoplastic cells. Additionally, it can interfere with the structure of histone H1 and h1-dna [ 23 ]. In animal models, saffron, crocin, and crostin have demonstrated anti-cancer effects and can help prevent cancer in various types of cancers. It is important to note that the ld50 for saffron and its components against natural antibodies is very high. However, crocin has selective cytotoxic effects on cancer cells and can prevent the development of cancer [ 24 ]. Saffron and its components have a low toxicity towards natural cells and are safe to be consumed orally. Further studies have found that bacteria have a complex mechanism to recognize nutritional signals and adapt their metabolism [ 25 ]. Not only genetics, but changes in diet can also affect metabolomics and microbiomes in human body. Our research team has previously discovered that high doses of food preservatives like TBHQ and PG can alter the metabolomics of Lactobacillus rhamnosus , acquiring considerable anti-tumor properties [ 26 ]. Additionally, we have found that high doses of curcumin, a natural food antioxidant, can alter the metabolomics of Lactobacillus plantarum and have anticancer effects [ 27 ]. The objective of the current research was to expand upon prior research by examining how the natural compound crocin affects the anti-tumor properties of metabolites produced by L. lactis . Results from MTT tests revealed that both cro-CFS and CFS repressed HCT-116 cell growth in a dose-dependent manner. The half-maximum inhibitory concentrations were 97.41 and 72.7 µL/mL, respectively, after 48 hours. The findings were supported by flow cytometry studies, which indicated that cro-CFS-treated cells experienced a higher apoptosis rate (roughly 25.42%) when compared to the cells treated with CFS (approximately 46.8%). In our research, we observed that cro-CFS and CFS had a positive effect on Bax and Caspase-9 expression levels, while reduced the BCL-2 mRNA levels, as confirmed by qPCR. This finding is consistent with the results of previous projects that studied the cytotoxicity, anti-proliferative effects, and apoptotic properties of Lactobacillus rhamnosus and Lactobacillus lactis supernatant on HT-29 cells. The previous studies indicated that the supernatant of L. rhamnosus treated with PG and TBHQ and L. plantarum treated with curcumin hindered HT-29 cancer cell growth dose- and time-dependently. Besides, they confirmed the induction of programmed cell death (apoptosis) using flow cytometry analysis and Real-Time PCR. Our study showed similar results when L. lactis was treated with crocin, which supports the findings of the previous studies. 5. Conclusion Probiotics have been proven to possess anticancer properties against multiple forms of cancer, with a particular emphasis on colon cancer. Research has suggested that the dietary intake of individuals can impact the metabolic response of probiotics within the digestive system. Additionally, prebiotics have demonstrated the ability to enhance the strength of lactic acid bacteria. Crocin, a food ingredient, has demonstrated its potential in fighting cancer. However, its prolonged consummation may alter the biological properties of probiotic bacteria in the human body, leading to changes in their ability to combat cancer cells. Therefore, the purpose of this study was to investigate the effects of crocin treatment on L. lactic bacteria in terms of their probiotic properties. In the current study, L. lactis bacteria were treated with crocin, and their low pH tolerance potency and antibacterial properties were evaluated. In addition, the suppressive effect on proliferation in the CFS of crocin-treated L. lactis was compared to that of L. lactis without crocin treatment. Cytotoxicity and genotoxicity tests demonstrated that L. lactis treated with curcumin induced more apoptosis in HCT-116 colon cancer cells than untreated L. lactis . The results of this study imply that the metabolomics that are produced upon treatment of probiotics with crocin improve the anti-cancer effects of CFS of probiotics on colorectal cancer cells by inducing cell apoptosis. Declarations Data availability All data used in this study are included in the manuscript. Acknowledgements The authors are grateful for the supports provided by Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz, Iran and the Immunology Research Center Tabriz University of Medical Sciences, Tabriz, Iran. Author contributions F.G.: Investigation, Formal analysis, Writing—original draft. M.A.: Investigation, Formal analysis. S.V.: Writing—original draft. B.B.: Writing—review & editing. A.M.: Conceptualization, Supervision, Writing—review & editing. M.E.: Conceptualization, Supervision, Writing—review & editing. Competing interests There is no competing interest to be declared by the authors. Funding: The authors are grateful for the funding supports provided by Immunology Research Center Tabriz University of Medical Sciences, Tabriz, Iran (Grant Number: 71734). References Hossain, M.S., et al., Colorectal cancer: a review of carcinogenesis, global epidemiology, current challenges, risk factors, preventive and treatment strategies. Cancers, 2022. 14 (7): p. 1732. Krasteva, N. and M. Georgieva, Promising Therapeutic Strategies for Colorectal Cancer Treatment Based on Nanomaterials. Pharmaceutics, 2022. 14 (6): p. 1213. Arena, M.P., et al., Immunobiosis and probiosis: antimicrobial activity of lactic acid bacteria with a focus on their antiviral and antifungal properties. Applied microbiology and biotechnology, 2018. 102 : p. 9949-9958. Cristofori, F., et al., Anti-inflammatory and immunomodulatory effects of probiotics in gut inflammation: a door to the body. Frontiers in immunology, 2021. 12 : p. 578386. Zeng, H., et al., Secondary bile acids and short chain fatty acids in the colon: a focus on colonic microbiome, cell proliferation, inflammation, and cancer. International journal of molecular sciences, 2019. 20 (5): p. 1214. Giovannini, M., et al., Infant's growth through the first year of life and maternal pre-pregnancy body mass index. ANNALS OF NUTRITION AND METABOLISM, 2011. 58 (Suppl 3): p. 215-215. de Souza, E.L., et al., Potential interactions among phenolic compounds and probiotics for mutual boosting of their health-promoting properties and food functionalities–A review. Critical reviews in food science and nutrition, 2019. 59 (10): p. 1645-1659. Rahaiee, S., et al., Evaluation of antioxidant activities of bioactive compounds and various extracts obtained from saffron (Crocus sativus L.): a review. Journal of Food Science and Technology, 2015. 52 : p. 1881-1888. Chen, S., et al., Crocin inhibits cell proliferation and enhances cisplatin and pemetrexed chemosensitivity in lung cancer cells. Translational lung cancer research, 2015. 4 (6): p. 775. Bhandari, P.R., Crocus sativus L.(saffron) for cancer chemoprevention: a mini review. Journal of traditional and complementary medicine, 2015. 5 (2): p. 81-87. Kim, Y.J., E.H. Kim, and K.B. Hahm, Oxidative stress in inflammation ‐ based gastrointestinal tract diseases: Challenges and opportunities. Journal of gastroenterology and hepatology, 2012. 27 (6): p. 1004-1010. Nami, A., et al., Modular multilevel converters for HVDC applications: Review on converter cells and functionalities. IEEE Transactions on Power Electronics, 2014. 30 (1): p. 18-36. Reller, L.B., et al., Antimicrobial susceptibility testing: a review of general principles and contemporary practices. Clinical infectious diseases, 2009. 49 (11): p. 1749-1755. Ma, W.-X., T. Huang, and Y. Zhang, A multiple exp-function method for nonlinear differential equations and its application. Physica Scripta, 2010. 82 (6): p. 065003. Ahmed, M., Colon cancer: a clinician’s perspective in 2019. Gastroenterology research, 2020. 13 (1): p. 1-10. Xi, Y. and P. Xu, Global colorectal cancer burden in 2020 and projections to 2040. Translational oncology, 2021. 14 (10): p. 101174. Shang, F., et al., The inhibitory effects of probiotics on colon cancer cells: In vitro and in vivo studies. Journal of Gastrointestinal Oncology, 2020. 11 (6): p. 1224. Sharma, M., A. Wasan, and R.K. Sharma, Recent developments in probiotics: An emphasis on Bifidobacterium. Food Bioscience, 2021. 41 : p. 100993. Javanmard, A., et al., Probiotics and their role in gastrointestinal cancers prevention and treatment; an overview. Gastroenterology and hepatology from bed to bench, 2018. 11 (4): p. 284. Mazziotta, C., et al., Probiotics Mechanism of Action on Immune Cells and Beneficial Effects on Human Health. Cells, 2023. 12 (1): p. 184. Górska, A., et al., Probiotic bacteria: a promising tool in cancer prevention and therapy. Current microbiology, 2019. 76 : p. 939-949. Bolhassani, A., A. Khavari, and S.Z. Bathaie, Saffron and natural carotenoids: Biochemical activities and anti-tumor effects. Biochimica et Biophysica Acta (Bba)-reviews on cancer, 2014. 1845 (1): p. 20-30. Milajerdi, A., K. Djafarian, and B. Hosseini, The toxicity of saffron (Crocus sativus L.) and its constituents against normal and cancer cells. Journal of nutrition & intermediary metabolism, 2016. 3 : p. 23-32. Colapietro, A., et al., Crocetin and crocin from saffron in cancer chemotherapy and chemoprevention. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents), 2019. 19 (1): p. 38-47. Abd El‐Hack, M.E., et al., Curcumin, the active substance of turmeric: its effects on health and ways to improve its bioavailability. Journal of the Science of Food and Agriculture, 2021. 101 (14): p. 5747-5762. Salmanzadeh, R., et al., Propyl gallate (PG) and tert-butylhydroquinone (TBHQ) may alter the potential anti-cancer behavior of probiotics. Food bioscience, 2018. 24 : p. 37-45. Gholipour, F., et al., Anticancer properties of curcumin-treated Lactobacillus plantarum against the HT-29 colorectal adenocarcinoma cells. Scientific Reports, 2023. 13 (1): p. 2860. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 28 Nov, 2024 Read the published version in Naunyn-Schmiedeberg's Archives of Pharmacology → Version 1 posted Editorial decision: Revision requested 19 Aug, 2024 Reviews received at journal 08 Aug, 2024 Reviews received at journal 31 Jul, 2024 Reviewers agreed at journal 31 Jul, 2024 Reviews received at journal 31 Jul, 2024 Reviewers agreed at journal 30 Jul, 2024 Reviewers agreed at journal 30 Jul, 2024 Reviewers agreed at journal 22 Jul, 2024 Reviewers invited by journal 15 Jul, 2024 Editor assigned by journal 01 Jul, 2024 Submission checks completed at journal 01 Jul, 2024 First submitted to journal 01 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4665517","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":330145247,"identity":"d5f1fc95-d6ab-42ce-8ed8-7740a1a7a157","order_by":0,"name":"Faranak Gholipour","email":"","orcid":"","institution":"Higher Education Institute of Rab- Rashid","correspondingAuthor":false,"prefix":"","firstName":"Faranak","middleName":"","lastName":"Gholipour","suffix":""},{"id":330145248,"identity":"c8ba6e23-103a-419c-ac9e-d26bc7c6168f","order_by":1,"name":"Mehdi Entezar","email":"","orcid":"","institution":"Higher Education Institute of Rab- Rashid","correspondingAuthor":false,"prefix":"","firstName":"Mehdi","middleName":"","lastName":"Entezar","suffix":""},{"id":330145249,"identity":"048787be-59e7-475b-a552-a19c54d70f2e","order_by":2,"name":"Mohammad Amini","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Amini","suffix":""},{"id":330145250,"identity":"cff58f6d-6fc2-4625-bb6c-b1038c2e3b93","order_by":3,"name":"Somayeh Vandghanooni","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Somayeh","middleName":"","lastName":"Vandghanooni","suffix":""},{"id":330145251,"identity":"d05c3f8a-87e7-4aea-8467-3dfa963be1e6","order_by":4,"name":"Behzad Baradaran","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Behzad","middleName":"","lastName":"Baradaran","suffix":""},{"id":330145252,"identity":"1440d6e4-134d-4b6f-8845-408b36bd23a4","order_by":5,"name":"Morteza Eskandani","email":"","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Morteza","middleName":"","lastName":"Eskandani","suffix":""},{"id":330145253,"identity":"b8ab90f9-1fe4-4f53-bb72-b2af69f65c0d","order_by":6,"name":"Amir Ali Mokhtarzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABHElEQVRIiWNgGAWjYDACCTBiMDCAcJkZDNgbQHwLIrSwwbTwHADxJUjRIpEAFccB+Gc3P7zBmGNjbC7f/OzjjxprOXPJ51c3/CiQYOBv707AasmdY8YWjNvSzCzb2IxnSBxLN7acnVN2swfoMIkzZzdgteZGgpkE47bDNgbHGIwZDNgOJ264nZN2gweoxUAiF6sW+Rvp36Ba2D8zJPw7XL/h5pm0m3/waDG4kQO2xczgGI8xw8G2wwkGN9iP3cZni+GNnGKLxG1pxgbHcooZG/vSDTecyWG7LWMgwYPLL3I30jfe+LjNxnDD4eObGX98s5Y3OH782c03f2zk+Nt7sXsfBBJQuTzglMCDUzkWwP6AFNWjYBSMglEw/AEAzadkd70Epe0AAAAASUVORK5CYII=","orcid":"","institution":"Tabriz University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Amir","middleName":"Ali","lastName":"Mokhtarzadeh","suffix":""}],"badges":[],"createdAt":"2024-07-01 05:46:41","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4665517/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4665517/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00210-024-03636-0","type":"published","date":"2024-11-28T15:57:43+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60936611,"identity":"fdf4533c-4f78-4777-b66a-0497acfb9880","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43916,"visible":true,"origin":"","legend":"\u003cp\u003eThe results showing that \u003cem\u003eLactobacillus lactis \u003c/em\u003eadapt to different concentrations of crocin food additive.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/d7b09024fd532305662fecfb.png"},{"id":60936612,"identity":"0c647644-8ff3-47a5-8d5e-25472f27f2ee","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":221375,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial Susceptibility Test. The diameter of inhibition zone caused by CFS and cro-CFS on the pathogenic bacterium\u003cem\u003e Shigella dysenteriyae\u003c/em\u003e. \u003cstrong\u003eA)\u003c/strong\u003e CFS \u003cstrong\u003eB) \u003c/strong\u003eAzithromycin \u003cstrong\u003eC)\u003c/strong\u003e PBS as a negative control, \u003cstrong\u003eD)\u003c/strong\u003e Ampicillin \u003cstrong\u003eE)\u003c/strong\u003e cro-CFS, \u003cstrong\u003eF) \u003c/strong\u003eCFS + proteinase k, \u003cstrong\u003eG)\u003c/strong\u003e cro-CFS + proteinase k,\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/8da668c5fa564cecfef9a7b5.png"},{"id":60936616,"identity":"382bbf78-af5d-4375-b32c-65abbc692f52","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":209659,"visible":true,"origin":"","legend":"\u003cp\u003eAntimicrobial Susceptibility Test. The diameter of inhibition zone caused by CFS and cro-CFS on the pathogenic bacterium \u003cem\u003eStaphylococ aureus\u003c/em\u003e. \u003cstrong\u003eA)\u003c/strong\u003e CFS, \u003cstrong\u003eB)\u003c/strong\u003eAzithromycin, \u003cstrong\u003eC)\u003c/strong\u003e PBS as a negative control, \u003cstrong\u003eD)\u003c/strong\u003e Cefazolin \u003cstrong\u003eE)\u003c/strong\u003e cro-CFS, \u003cstrong\u003eF) \u003c/strong\u003eCFS + proteinase k \u003cstrong\u003eG)\u003c/strong\u003e cro-CFS+ proteinase k,\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/c3a8409a988e57e6e9098fd9.png"},{"id":60936979,"identity":"1a97acc1-db26-4d0c-8e3b-fbf5be27ddfb","added_by":"auto","created_at":"2024-07-23 19:28:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":55868,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of cell viability (MTT) assay. The cytotoxic effect of various concentrations of CFS and cro-CFSon HCT-116 cells was determined. ****p˂0.0001, **p\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/24a0d9c9463765c1c4f1d62b.png"},{"id":60936613,"identity":"b85cb60e-1fb1-4797-8b4d-fdd16b3a21a9","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":68760,"visible":true,"origin":"","legend":"\u003cp\u003eAnnexin V / PI staining. Flow cytometry analysis was used to determine the fractions of apoptotic cells upon CFS and cro-CFS treatments. ****p˂0.0001.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/0a8ee867a7bab666cf27df40.png"},{"id":60936614,"identity":"4136898b-31d7-435b-89ae-e0ca4b99b698","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":86803,"visible":true,"origin":"","legend":"\u003cp\u003eFlow cytometry analysis of cell cycle progression in HCT-116 cell upon treatment with CFS and cro-CFS. Data analysis evidenced an increase in proportion of cells accumulated in Sub-G1. ***p ˂0.001.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/6acc54d56ec22d38abc563dc.png"},{"id":60936617,"identity":"78ec0520-c073-43ec-b335-940a01e3ebdf","added_by":"auto","created_at":"2024-07-23 19:20:48","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":34194,"visible":true,"origin":"","legend":"\u003cp\u003eAlteration in Bax, Bcl-2, and Caspase-9 mRNA expression levels in HCT-116 cells upon treatment with CFS and cro-CFS evaluated by qPCR technique. **p\u0026lt;0.01, ***p\u0026lt;0.001, and ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/b4d075d3aa4554cd33cfc156.png"},{"id":70388675,"identity":"d303dbbf-7c2b-4dbc-8ecc-f045eebafaf1","added_by":"auto","created_at":"2024-12-02 17:26:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1499251,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4665517/v1/fe0949be-6678-4df4-85dc-e85c8370a360.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Crocin effects on the anticancer properties of Lactobacillus lactis probiotics against colorectal adenocarcinoma cells","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eColorectal cancer (CRC), which refers to cancer in the colon and/or rectum, is a major health issue. It is the third most frequently diagnosed and second most deadly form of cancer [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In 2022, colorectal cancer was responsible for 9.4% of cancer deaths. Research has shown that factors, such as diet, family history, and chronic inflammation increase the risk of developing this type of cancer [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The digestive system has both beneficial and harmful bacteria, and recent studies suggest that the bacteria present in our gut (gut bacteria) have a significant impact on maintaining overall health. Scientists named the term \"immunobiotics\" to refer to a certain kind of probiotic that belongs to the lactic acid genus [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This probiotic is known for its ability to regulate inflammation and improve the body's immune system. Probiotic bacteria can help prevent colon cancer by stimulating the immune system, changing the microorganisms in the intestine, increasing antioxidant activity, regulating cell growth, and breaking down harmful substances like mutagenic compounds and secondary bile acids produced by gut bacteria [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Colon cells use short-chain fatty acids (SCFA) as a source of energy, which regulate the pH level of the intestine, prevent excessive production of secondary bile acids, and encourage the elimination of cancer cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Probiotics intake increases the production of SCFAs on a daily basis, which can impact inflammation via interaction with certain receptors that are expressed in the intestine and the regulation of the immune system. Both linoleic acid (LA) and conjugated linoleic acid (CLA) are capable of activating genes that cause apoptosis, such as Bcl-2, caspase 3, and caspase 9, which in turn can reduce the growth of colon cancer cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. A number of studies have found that certain bacteria such as \u003cem\u003eLactobacillus\u003c/em\u003e, \u003cem\u003eBifid bacterium\u003c/em\u003e, \u003cem\u003eStreptococcus salivary\u003c/em\u003e, and \u003cem\u003ePropionibacterium freudenreichii\u003c/em\u003e subspecies have the ability to produce CLA in the terminal ileum. The CLA can be absorbed by the cells in the colon or interact with them to generate beneficial results [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Research suggests that certain dietary substances can cause at least 50% of cancers. Clinical trials have shown that prebiotics can increase the number and activity of beneficial bacteria in the gut and change the metabolomics released by these bacteria. Further studies have found that bacteria possess an advanced system that enables them to identify nutritional signals and regulate their metabolic activities accordingly [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Food additives have the potential to alter the microbiome, including LAB, as well as secondary metabolites and metabolic pathways. For centuries, crocin has been utilized as a food additive to treat several diseases. Crocin is gained from the dried stigmas of \u003cem\u003eCrocus sativa\u003c/em\u003e L., which is also known as saffron. Although crocin is recognized as a powerful anticancer element in saffron stigma, the molecular mechanisms behind its effectiveness are not yet understood [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Research has revealed that it possesses anti-cancer attributes in cultured human malignant cell lines and animal models,, as well as anti-oxidative, anti-atherosclerotic, anti-hyperlipidemia, cardio-protective, hepato-protective, and neuroprotective effects [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The ability of crocin to alter gene expression and trigger programmed cell death (apoptosis) in animals during preclinical studies suggests that it could potentially be a highly efficacious treatment option to prevent cancer and for chemotherapy treatment in humans [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Antioxidants can enhance the performance of LAB in the digestive system, thereby increasing their ability to fight cancer [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe study aimed to delve deeper into the potential of crocin in augmenting the anticancer properties of probiotics. The bacterial species used in this study as a probiotic was \u003cem\u003eLactobacillus lactic\u003c/em\u003e. The study compared the ability of bacterial metabolites produced by \u003cem\u003eL. lactic\u003c/em\u003e that were treated with crocin to hinder growth of colon cancer cells to that of metabolites produced by untreated \u003cem\u003eL. lactic\u003c/em\u003e used as a control. The MTT assay was used to evaluate the toxicity of the secreted metabolites of probiotics on the HCT human colorectal adenocarcinoma cell line. The analysis of apoptosis/necrosis using flow cytometry was performed through staining of annexin V/PI. As the final step, qPCR was utilized to investigate the expression level of genes contributing to the apoptosis and survival of malignant cells to unveil the molecular mechanisms underlying anti-tumor activity of bioactive metabolites of bacteria.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials and Instruments\u003c/h2\u003e \u003cp\u003eThe Pasteur Institute was where HCT-116 colorectal cancer cell line was bought. All of the \u003cem\u003eShigella dysenteriae, Staphylococ aureus, Pseudomonas aeruginosa and Lactobacillus lactis\u003c/em\u003e PTCC 1057, were provided by the Iranian Research Organization for Science and Technology (Tehran, Iran). From SPL Life Sciences, we bought tissue culture flasks, 96-well culture plates, 6-well culture plates, and pipettes (Gyeonggi-do, South Korea). Invitrogen supplied RPMI 1640 medium, trypsin, penicillin, streptomycin, and FBS (Waltham, MA, USA). Sigma Aldrich was where we got MTT powder, Triton-X100, diethylpyrocarbonate (DEPC), Proteinase K, trypan blue, and sterile discs (St. Louis, MI, USA). Merck gave us the DMSO, the crocin, and the de Man, Rogosa, and Sharpe (MRS) media (Darmstadt, Germany). RNA isolation kit (RiboEx) was purchased from GeneAll company (Korea). InterLabService was where the Reverta-L reagent kit was bought (Moscow, Russia). Complementary DNA (cDNA) synthesis kit (BioFact\u0026trade; RT-Kit) and 2X Real-Time PCR Master Mix were bought from BioFact company (Korea). Bio-Rad T100 Thermal Cycler (USA) and Applied Biosystems\u0026trade; StepOne\u0026trade; Real-Time PCR System (USA) were used to carry out cDNA synthesis and qPCR reactions. An ELx 800 spectrophotometer (Biotek, USA) was used to evaluate optical density (OD). Annexin V-fluorescein isothiocyanate (FITC) Propidium iodide (PI) dual staining kit was provided from EBioscience (Waltham, MA, USA). Unless stated otherwise, all extra materials were bought from Fermentas Life Science (Waltham, MA, USA) or Merck (Darmstadt, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Cell-free supernatant (CFS) preparation\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL. lactis\u003c/em\u003e was cultivated at a temperature of 37\u0026deg;C in a modified MRS broth medium until it reached 0.7\u0026ndash;0.8 OD at 600 nm wavelength. MRS agar, which is a defined medium, was created to grow lactobacilli from various sources as a substitute for tomato juice agar. The OD (0.8) yield on MRS agar was determined to be 10\u003csup\u003e9\u003c/sup\u003e colony-forming units (CFU) per milliliter, which corresponds to the bacterial density found in the large intestine (i.e., around 10\u003csup\u003e9\u003c/sup\u003e \u0026ndash; 10\u003csup\u003e11\u003c/sup\u003e CFU/ml). During multiple cultures, bacteria grown in the presence of crocin showed resistance to increasing concentrations of crocin, including 25 \u0026micro;g/ml, 50 \u0026micro;g/ml, 75 \u0026micro;g/ml, 100 \u0026micro;g/ml, 125 \u0026micro;g/ml, 150 \u0026micro;g/ml, and 200 \u0026micro;g/ml. For 48 hours, the bacteria were cultured in the mentioned concentrations of crocin, or until 10\u003csup\u003e9\u003c/sup\u003e CFU/ml of bacterial colonies were cultivated in MRS broth. After that, the supernatants and sediments of the resistance bacteria to the highest concentration of crocin (200 \u0026micro;g/ml) and untreated bacteria were collected, and then adjusted to 7.4 pH. Next, to produce cell-free supernatant (CFS) and crocin-resistant bacteria supernatant (cro-CFS), the supernatants were passed through 0.2-micron sterile filters. Besides, bacterial sediments were PBS-washed two times and the resistance of recovered bacteria to low pH was evaluated. To conduct cellular investigations, both untreated and crocin-treated bacteria were harvested and transferred to RPMI medium 24 hours prior to treatment. Following, the supernatants were centrifuged to collect CFS and cro-CFS, their pH was adjusted to 7.4 and they were filtered via a 0.2-micron filter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Evaluating the resistance of corcin-treated bacteria to the acidic environments\u003c/h2\u003e \u003cp\u003eThe resilience of bacteria treated with crocin to the acidic environment of the stomach was investigated. Briefly, the bacteria that showed the greatest resistance to crocin at pH 7.2 were isolated and washed with PBS. They were then exposed to pH 3.0 PBS for 0, 1, 2, and 3 hours. The rate of bacterial resistance was determined using the MRS agar-based pour plate method in regard to the survival of bacteria. The following equation explains how the survival rates of the bacteria were determined [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEquation I: Survival rate% = log CFUN1/log CFUN0\u0026times;100.\u003c/p\u003e \u003cp\u003eIn this equation, N1 signifies the counts viable bacteria isolated on MRS agar at low pH, and N0 represents the counts of viable bacteria prior to culturing in an acidic environment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Antimicrobial Susceptibility Test\u003c/h2\u003e \u003cp\u003eThe effectiveness of CFS in fighting pathogen bacteria commonly found in medical settings was tested using an antimicrobial susceptibility test, also known as disc diffusion and zone of inhibition assay. Gram-negative bacteria \u003cem\u003eShigella dysenteriyae\u003c/em\u003e, gram-positive bacteria \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] were used in the experiment. All bacterial strains were grown in nutritious broths and a germ-free disc covered by cro-CSF (10 \u0026micro;l/mL) and CFS alongside relevant antibiotics were loaded onto plates, allowing the diffuse of CFS into the agar for 2 hours at 24\u0026deg;C. Next, the plates were incubated at 37\u0026deg;C for 24 hours, and the diameter of the inhibitory zone was calculated. To determine these zones around the discs a Mitutoyo sliding caliper was employed. and the results were categorized based on the level of resistance relative to the standard antibiotics [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The negative control was a sterile disc containing PBS (pH 7.2) while Azithromycin 30 \u0026micro;g discs were considered as the positive controls for \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and Ampicillin 30 \u0026micro;g discs for \u003cem\u003eShigella dysenteriyae\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Characterization of the protein content of CSF\u003c/h2\u003e \u003cp\u003eTo evaluate the effect of protein elements of CFS on its antibacterial and cytotoxic activity, Proteinase K treatment was performed. Briefly, CFS and cro-CFS (200 \u0026micro;l/mL) were treated with Proteinase K (100\u0026micro;g/ml) for 1 hour at 37\u0026deg;C. Next, the enzyme deactivation was done by incubating CFS mixtures at 70\u0026deg;C for 20 min [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The treated CFSs were used for further experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Cell Culture\u003c/h2\u003e \u003cp\u003eHCT-116 human colorectal cancer cell line were cultured in RPMI 1640 media. The supplementary components included 10% FBS, penicillin antibiotic (100 U/ml) and streptomycin antibiotic (100 \u0026micro;l/ml) antibiotic. The cultivation environment was a CO\u003csub\u003e2\u003c/sub\u003e incubator providing 80% humidity and 37\u0026deg;C temperature.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Cell viability (MTT) assay\u003c/h2\u003e \u003cp\u003eThe cytotoxic effects of various concentrations of CFSs on HCT-116 cells was assessed using the MTT test. HCT-116 cells (2.0\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per well) were seeded into 96-well cell culture plates and after reaching confluency upon 24 hours of incubation treated with the CFSs. After 24-hour incubation, MTT reagent (2mg/ml solved in PB) was added to the wells and allowed to be incubated for 4 hours. The formazan crystals produced by oxidoreductase enzymes of viable cells were dispersed using DMSO solution and the absorbance of each well at 570 nm wavelength was measured using the Tecan ELISA plate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Flow cytometry analysis of cell apoptosis\u003c/h2\u003e \u003cp\u003eTo identify the presence of treated cells in early and late stages of apoptosis, or in necrosis state, FITC-labeled annexin V and PI dual staining was done based on the flow cytometric analysis. HCT-116 cells (2.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per well) were cultured in 6-well culture plates, treated with CFS and cro-CFS, incubated for 24 hours, and harvested. The harvested cells were then washed with PBS and then incubation with 1x binding buffer solution (200 \u0026micro;L) containing 5 \u0026micro;L annexin V-FITC and 5 \u0026micro;L PI for 15 min in a dark place. The stained cells were washed and resuspended in PBS and then subjected to the BD FACS Calibur TM flow cytometer (FACS Quant; Milteny, Germany). Data analysis was performed by FlowJo software Version 10 (TreeStar Inc., USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Flow cytometry analysis of cell cycle progression\u003c/h2\u003e \u003cp\u003eIn order to identify the effects of CFS and cro-CFS on the HCT-116 cell division and proliferation, flow cytometry analysis based on PI staining was performed. To do this, after cultivation and treatment in 6-well culture plates, HCT-116 cells were collected, and washed with cold PBS. Next, they were fixed with 75% ethanol and stored at -20\u0026deg;C for 2 days. Next, the cells were treated with RNase A (100 \u0026micro;g/mL) for 30 min at the room temperature. After that, the cells were incubation in 500 \u0026micro;L PBS solution containing PI (0.1%, v/v) and Triton X-100 (0.1%, v/v). Finally, the samples were subjected to flow cytometry and the obtained data was analyzed using FlowJo software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Gene expression analysis\u003c/h2\u003e \u003cp\u003eTo understand the molecular aspects of CFS-mediated cell apoptosis, gene expression analysis was performed using qRT-PCR technique. HCT-116 cells were cultured in 6-well culture plates, treated with IC50 of CFS and cro-CFS, and incubated for 24 hours. After that, RNA extraction and cDNA synthesis were carried out. Using the cDNA samples, gene expression was analyzed by 2X Real-Time PCR Master Mix in StepOne\u0026trade; Real-Time PCR System. Reverse and forward primers for Bax, Bcl-2, and Caspase-3 genes were generated using oligo 7 software, which are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. After gathering Threshold Cycle (Ct) values for each sample through duplicated reactions, 2\u003csup\u003e\u0026minus;\u0026thinsp;ddCt\u003c/sup\u003e was employed for the comparison of relative gene expression between the samples. GAPDH housekeeping gene was used to normalize gene expression.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe list and sequences of used primers for gene expression analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward/ Reverse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAccession Number\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTCCCCCCGAGAGGTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_004324\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGGGCCTTGAGCACCAGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBCL-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTGGATGACTGAGTACCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e127\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_000633\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGACAGCCAGGAGAAATCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCaspase-9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTCTACGGCACAGATGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e177\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_001229\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGACTCGTCTTCAGGGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAGATCATCAGCAATGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e166\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNM_002046\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCATCACGCCACAGTTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Statistical analysis\u003c/h2\u003e \u003cp\u003eTo determine if there were any significant differences between the groups, we utilized the analysis of variance (ANOVA) method and then followed up with Dennett\u0026rsquo;s test. We conducted all statistical analyses using GraphPad Prism version 6.01. We considered a P-value less than 0.05 to be statistically significant. In order to ensure accuracy, we conducted three separate tests on each set of data gathered during our investigation.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Preparation of CFS\u003c/h2\u003e \u003cp\u003eTo determine the effectiveness of crocin-treated and intact \u003cem\u003eL. lactic\u003c/em\u003e against HCT colon cancer cells, CFS of both intact and crocin-treated L. lactic were used. To this end, L. lactic were exposed to varying concentrations of crocin, gradually increasing the dose to the highest concentration of 150 \u0026micro;g/ml. This was achieved by repeatedly exposing bacterial cultures to increasing concentrations of crocin, until the desired bacterial count was obtained. A reduction in the number of bacterial colonies was observed when crocin was present in the first round of treatment, but the bacterial colonies grew during subsequent treatments and during the adaptation process. Our findings showed that, in the presence of 20 \u0026micro;g/ml of crocin, the log CFU for the bacteria was 9.2, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. When the highest concentration of crocin, 150 \u0026micro;g/ml, was used, the bacteria could adjust and their growth rate only slightly increased up to 100%. However, when the concentration of crocin increased to 200 \u0026micro;g/ml, the bacteria's growth rate significantly decreased. Therefore, the rest of experiments were done with the bacteria which were exposed to crocin dose of 150 \u0026micro;g/ml.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Resistance to acidic pH\u003c/h2\u003e \u003cp\u003eThe characteristics that set probiotics apart include their ability to tolerate low stomach pH, promote good health, and survive in harsh conditions. To ensure that \u003cem\u003eL. lactic\u003c/em\u003e treated with crocin could outlive in the acidic environment of the stomach, an experiment was conducted to test their resistance. The results, as shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, indicate that there was no significant change in the bacteria's survival rate or growth at low pH when treated with crocin.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe survival rates of \u003cem\u003eL. lactic\u003c/em\u003e with/without crocin treatment at different time intervals upon cultivation in acidic environment (pH\u0026thinsp;=\u0026thinsp;3).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTreatment Groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c6\" namest=\"c2\"\u003e \u003cp\u003eFinal count (log cfu/ml) of bacteria\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0 hour\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 hour\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2 hours\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 hours\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e%Viability\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecrocin -treated \u003cem\u003eL.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003elactic\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e70.43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUntreated \u003cem\u003eL.\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003elactic\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e73.65\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e\u003cem\u003e3.3. The antibacterial activity of CFS and\u003c/em\u003e cro-CFS\u003c/h2\u003e \u003cp\u003eProbiotics are renowned for their ability to combat pathogen bacteria. Lactic acid bacteria (LAB) are especially effective in the production if antibacterial substances, such as lactic acid, hydrogen peroxide, acetic acid, and bacteriocins. In this study, the antibacterial properties of CFS and cro-CFS were evaluated against several pathogenic bacteria in order to determine whether crocin treatment had any impact on \u003cem\u003eL. lactic\u0026rsquo;s\u003c/em\u003e probiotic function. The results, as outlined in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, demonstrate that cro-CFS was significantly more effective at killing all of the targeted bacteria (\u003cem\u003eShigella dysenteriyae\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e) than CFS alone (as illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and 3). These findings confirm that the addition of crocin did not compromise \u003cem\u003eL. Lactic\u0026rsquo;s\u003c/em\u003e probiotic properties.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.4. The effect of CSF protein content on antibacterial activity\u003c/h2\u003e \u003cp\u003eThis investigation was conducted to understand the biologically active protein composition of CSF and cro-CFS. The results shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e indicated that the use of proteinase K on cro-CFS removed its ability to fight off pathogenic bacteria, indicating the significance of the biologically active proteins released by \u003cem\u003eL. lactic\u003c/em\u003e. These proteins were found to be responsible for the toxicity against pathogenic bacteria, demonstrating their importance in the antibacterial properties of cro-CFS.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe results of Zone of inhibition assay. The inhibition diameters caused by CFS and cro-CFS discs against pathogenic bacteria are presented.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePathogenic Bacteria Strain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSupernatant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDiameter (mm)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive CTRL (Azithromycin)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNegative CTRL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cem\u003eStaphylococ aureus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive CTRL (Azithromycin)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNegative CTRL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"5\" rowspan=\"6\"\u003e \u003cp\u003e\u003cem\u003eShigella dysenteriyae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecro-CFS\u0026thinsp;+\u0026thinsp;PK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePositive CTRL (Azithromycin)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNegative CTRL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Cell cytotoxicity\u003c/h2\u003e \u003cp\u003eMTT assay was done to reveal anti-tumor impact of CFS and cro-CFS on HCT-116 colorectla cancer cell line. The results indicated that the cytotoxic or anti-proliferative effect of CFS and cro-CFS on HCT cells was dependent on the dosage and time. In the cro-CFS group, a substantial reduction in cell viability was observed at doses ranging from 25\u0026ndash;200 \u0026micro;l/ml compared to the CFS group. However, at a concentration of 200 \u0026micro;l/ml, the decrease in cell viability in the cro-CFS group was less significant (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) than in the CFS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The IC50 values for CFS and cro-CFS were 97.41 \u0026micro;l/ml and 72.07 \u0026micro;l/ml, respectively. Therefore, these findings suggest that cro-CFS had a more significant suppressive effect on HCT-116 cell viability than CFS.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e3.6. cro-CFS induced apoptosis in\u003c/b\u003e HCT \u003cb\u003ecells\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eAnnexin V was utilized in order to assess the impact of CFS and cro-CFS on HCT-116 cell apoptosis. By using annexin V-FITC and PI, early and late stages of apoptosis and necrosis were measured in HCT cells treated with CFS and cro-CFS. In apoptotic cells, annexin V protein binds to phosphatidylserines translocated the outer leaflet of the cell membrane. Necrotic cells were quantified by counting only PI-stained cells that had compromised cell membranes. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e) showed that CFS significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) elevated apoptosis rate to 25.42% in HCT-116 cells and cro-CFS significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) increased this rate to 46.8% when compared to control cells (0.95%). These results also evidenced that pretreatment of bacteria with crocin significantly increased CFS-induced apoptosis in HCT-116 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Cell cycle\u003c/h2\u003e \u003cp\u003eIn order to explore the impact of CFS and cro-CFS on HCT cells, an additional examination utilizing flow cytometry for the quantification of cell cycle arrest was conducted. The findings displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003e indicate that 16.9% of cells treated with CFS were arrested in the Sub-G1 phase. Conversely, in cells treated with cro-CFS, the proportion of Sub-G1 arrested cells increased by 30.8%. Upon conducting statistical analysis, a notable difference was observed between the amounts of apoptotic cells (Sub-G1 arrested cells) when cells were treated either with CFS (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) or with cro-CFS (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) in comparison to the control group. An additional significant difference was noted between the percentages of apoptotic cells in the cro-CFS group in comparison to CFS group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.9. The effect of CFS on expression of genes involved in cell survival and apoptosis\u003c/h2\u003e \u003cp\u003eThe utilization of qPCR aided us in measuring the extent of gene expression alterations and served as a confirmation tool for the results obtained from other experiments. The results established a significant increase in Bax gene expression levels in both the CFS (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and cro-CFS groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) in comparison with the control group. Furthermore, the expression of Bax mRNA was found to be higher in the cro-CFS group when compared with the CFS group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating that cro-CFS intensifies apoptosis by regulating this particular gene. The results also revealed a significant reduction in the expression of Bcl-2 mRNA in both the CFS and cro-CFS groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively) when compared to the control group, with the decrease in expression being greater in the cro-CFS group than in the CFS group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Similarly, the expression of the Caspase-9 gene was found to have significantly decreased in both the CFS and cro-CFS groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, respectively) when compared to the control group, with the decrease being more significant in the cro-CFS group than in the CFS group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), as represented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eColon cancer is a significant global health concern and ranks as the third most widespread malignancy in males and the second most common cancer in females. The incidence rate of colon cancer varies greatly across different regions of the world [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The colon cancer development is initiated by the transformation of normal epithelial cells into neoplastic cells, which can alter the cellular environment. The occurrence of colon cancer is influenced by various risk factors, including nutrition [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recent research has demonstrated that probiotics can act as a preventative measure for colon cancer and can alleviate its symptoms [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Probiotics are live microorganisms that have beneficial effects on the host's digestive flora when they are used in sufficient amounts. While lactobacilli and bifid bacteria are the most commonly used probiotics, there are many other microorganisms with similar properties [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eProbiotics possess great potential to impact the growth, progression, and treatment of colon cancer, but their effectiveness varies in regard to the type of probiotic used. Utilizing probiotics can strengthen lactic acid bacteria in the stomach and intestines, which have various mechanisms that can aid in preventing the development of cancers, particularly colon cancer [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These mechanisms include altering the metabolic activities of the intestinal microflora, changing the physical and chemical conditions of the colon, neutralizing carcinogenic substances, promoting phagocytosis, producing anticancer substances, and enhancing host immune responses [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The most common probiotic bacteria are Lactobacillus, which offers nutritional benefits when consumed in appropriate amounts. Research suggests that the use of Lactobacillus probiotics can reduce the proliferation of colorectal tumor cells in the early stages of cancer [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCrocin, which is found in saffron, is a plant antioxidant that has been identified as the most significant anticancer compound in saffron [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. It works by altering genes and inducing apoptosis in cancer cells. Crocin has been shown to be effective in reducing the synthesis of DNA, RNA, and protein, as well as inhibiting RNA polymerase II in neoplastic cells. Additionally, it can interfere with the structure of histone H1 and h1-dna [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In animal models, saffron, crocin, and crostin have demonstrated anti-cancer effects and can help prevent cancer in various types of cancers. It is important to note that the ld50 for saffron and its components against natural antibodies is very high. However, crocin has selective cytotoxic effects on cancer cells and can prevent the development of cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Saffron and its components have a low toxicity towards natural cells and are safe to be consumed orally. Further studies have found that bacteria have a complex mechanism to recognize nutritional signals and adapt their metabolism [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Not only genetics, but changes in diet can also affect metabolomics and microbiomes in human body. Our research team has previously discovered that high doses of food preservatives like TBHQ and PG can alter the metabolomics of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e, acquiring considerable anti-tumor properties [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Additionally, we have found that high doses of curcumin, a natural food antioxidant, can alter the metabolomics of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and have anticancer effects [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe objective of the current research was to expand upon prior research by examining how the natural compound crocin affects the anti-tumor properties of metabolites produced by \u003cem\u003eL. lactis\u003c/em\u003e. Results from MTT tests revealed that both cro-CFS and CFS repressed HCT-116 cell growth in a dose-dependent manner. The half-maximum inhibitory concentrations were 97.41 and 72.7 \u0026micro;L/mL, respectively, after 48 hours. The findings were supported by flow cytometry studies, which indicated that cro-CFS-treated cells experienced a higher apoptosis rate (roughly 25.42%) when compared to the cells treated with CFS (approximately 46.8%).\u003c/p\u003e \u003cp\u003eIn our research, we observed that cro-CFS and CFS had a positive effect on Bax and Caspase-9 expression levels, while reduced the BCL-2 mRNA levels, as confirmed by qPCR. This finding is consistent with the results of previous projects that studied the cytotoxicity, anti-proliferative effects, and apoptotic properties of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e and \u003cem\u003eLactobacillus lactis\u003c/em\u003e supernatant on HT-29 cells. The previous studies indicated that the supernatant of \u003cem\u003eL. rhamnosus\u003c/em\u003e treated with PG and TBHQ and \u003cem\u003eL. plantarum\u003c/em\u003e treated with curcumin hindered HT-29 cancer cell growth dose- and time-dependently. Besides, they confirmed the induction of programmed cell death (apoptosis) using flow cytometry analysis and Real-Time PCR. Our study showed similar results when \u003cem\u003eL. lactis\u003c/em\u003e was treated with crocin, which supports the findings of the previous studies.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eProbiotics have been proven to possess anticancer properties against multiple forms of cancer, with a particular emphasis on colon cancer. Research has suggested that the dietary intake of individuals can impact the metabolic response of probiotics within the digestive system. Additionally, prebiotics have demonstrated the ability to enhance the strength of lactic acid bacteria. Crocin, a food ingredient, has demonstrated its potential in fighting cancer. However, its prolonged consummation may alter the biological properties of probiotic bacteria in the human body, leading to changes in their ability to combat cancer cells. Therefore, the purpose of this study was to investigate the effects of crocin treatment on \u003cem\u003eL. lactic\u003c/em\u003e bacteria in terms of their probiotic properties. In the current study, \u003cem\u003eL. lactis\u003c/em\u003e bacteria were treated with crocin, and their low pH tolerance potency and antibacterial properties were evaluated. In addition, the suppressive effect on proliferation in the CFS of crocin-treated \u003cem\u003eL. lactis\u003c/em\u003e was compared to that of \u003cem\u003eL. lactis\u003c/em\u003e without crocin treatment. Cytotoxicity and genotoxicity tests demonstrated that \u003cem\u003eL. lactis\u003c/em\u003e treated with curcumin induced more apoptosis in HCT-116 colon cancer cells than untreated \u003cem\u003eL. lactis\u003c/em\u003e. The results of this study imply that the metabolomics that are produced upon treatment of probiotics with crocin improve the anti-cancer effects of CFS of probiotics on colorectal cancer cells by inducing cell apoptosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data used in this study are included in the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful for the supports provided by Research Center for Pharmaceutical Nanotechnology, Tabriz University of Medical Sciences, Tabriz, Iran and the Immunology Research Center Tabriz University of Medical Sciences, Tabriz, Iran.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eF.G.: Investigation, Formal analysis, Writing\u0026mdash;original draft. M.A.: Investigation, Formal analysis. S.V.: Writing\u0026mdash;original draft. B.B.: Writing\u0026mdash;review \u0026amp; editing. A.M.: Conceptualization, Supervision, Writing\u0026mdash;review \u0026amp; editing. \u0026nbsp;M.E.: Conceptualization, Supervision, Writing\u0026mdash;review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere is no competing interest to be declared by the authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors are grateful for the funding supports provided by Immunology Research Center Tabriz University of Medical Sciences, Tabriz, Iran (Grant Number: 71734).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHossain, M.S., et al., \u003cem\u003eColorectal cancer: a review of carcinogenesis, global epidemiology, current challenges, risk factors, preventive and treatment strategies.\u003c/em\u003e Cancers, 2022. \u003cstrong\u003e14\u003c/strong\u003e(7): p. 1732.\u003c/li\u003e\n\u003cli\u003eKrasteva, N. and M. Georgieva, \u003cem\u003ePromising Therapeutic Strategies for Colorectal Cancer Treatment Based on Nanomaterials.\u003c/em\u003e Pharmaceutics, 2022. \u003cstrong\u003e14\u003c/strong\u003e(6): p. 1213.\u003c/li\u003e\n\u003cli\u003eArena, M.P., et al., \u003cem\u003eImmunobiosis and probiosis: antimicrobial activity of lactic acid bacteria with a focus on their antiviral and antifungal properties.\u003c/em\u003e Applied microbiology and biotechnology, 2018. \u003cstrong\u003e102\u003c/strong\u003e: p. 9949-9958.\u003c/li\u003e\n\u003cli\u003eCristofori, F., et al., \u003cem\u003eAnti-inflammatory and immunomodulatory effects of probiotics in gut inflammation: a door to the body.\u003c/em\u003e Frontiers in immunology, 2021. \u003cstrong\u003e12\u003c/strong\u003e: p. 578386.\u003c/li\u003e\n\u003cli\u003eZeng, H., et al., \u003cem\u003eSecondary bile acids and short chain fatty acids in the colon: a focus on colonic microbiome, cell proliferation, inflammation, and cancer.\u003c/em\u003e International journal of molecular sciences, 2019. \u003cstrong\u003e20\u003c/strong\u003e(5): p. 1214.\u003c/li\u003e\n\u003cli\u003eGiovannini, M., et al., \u003cem\u003eInfant\u0026apos;s growth through the first year of life and maternal pre-pregnancy body mass index.\u003c/em\u003e ANNALS OF NUTRITION AND METABOLISM, 2011. \u003cstrong\u003e58\u003c/strong\u003e(Suppl 3): p. 215-215.\u003c/li\u003e\n\u003cli\u003ede Souza, E.L., et al., \u003cem\u003ePotential interactions among phenolic compounds and probiotics for mutual boosting of their health-promoting properties and food functionalities\u0026ndash;A review.\u003c/em\u003e Critical reviews in food science and nutrition, 2019. \u003cstrong\u003e59\u003c/strong\u003e(10): p. 1645-1659.\u003c/li\u003e\n\u003cli\u003eRahaiee, S., et al., \u003cem\u003eEvaluation of antioxidant activities of bioactive compounds and various extracts obtained from saffron (Crocus sativus L.): a review.\u003c/em\u003e Journal of Food Science and Technology, 2015. \u003cstrong\u003e52\u003c/strong\u003e: p. 1881-1888.\u003c/li\u003e\n\u003cli\u003eChen, S., et al., \u003cem\u003eCrocin inhibits cell proliferation and enhances cisplatin and pemetrexed chemosensitivity in lung cancer cells.\u003c/em\u003e Translational lung cancer research, 2015. \u003cstrong\u003e4\u003c/strong\u003e(6): p. 775.\u003c/li\u003e\n\u003cli\u003eBhandari, P.R., \u003cem\u003eCrocus sativus L.(saffron) for cancer chemoprevention: a mini review.\u003c/em\u003e Journal of traditional and complementary medicine, 2015. \u003cstrong\u003e5\u003c/strong\u003e(2): p. 81-87.\u003c/li\u003e\n\u003cli\u003eKim, Y.J., E.H. Kim, and K.B. Hahm, \u003cem\u003eOxidative stress in inflammation\u003c/em\u003e\u003cem\u003e‐\u003c/em\u003e\u003cem\u003ebased gastrointestinal tract diseases: Challenges and opportunities.\u003c/em\u003e Journal of gastroenterology and hepatology, 2012. \u003cstrong\u003e27\u003c/strong\u003e(6): p. 1004-1010.\u003c/li\u003e\n\u003cli\u003eNami, A., et al., \u003cem\u003eModular multilevel converters for HVDC applications: Review on converter cells and functionalities.\u003c/em\u003e IEEE Transactions on Power Electronics, 2014. \u003cstrong\u003e30\u003c/strong\u003e(1): p. 18-36.\u003c/li\u003e\n\u003cli\u003eReller, L.B., et al., \u003cem\u003eAntimicrobial susceptibility testing: a review of general principles and contemporary practices.\u003c/em\u003e Clinical infectious diseases, 2009. \u003cstrong\u003e49\u003c/strong\u003e(11): p. 1749-1755.\u003c/li\u003e\n\u003cli\u003eMa, W.-X., T. Huang, and Y. Zhang, \u003cem\u003eA multiple exp-function method for nonlinear differential equations and its application.\u003c/em\u003e Physica Scripta, 2010. \u003cstrong\u003e82\u003c/strong\u003e(6): p. 065003.\u003c/li\u003e\n\u003cli\u003eAhmed, M., \u003cem\u003eColon cancer: a clinician\u0026rsquo;s perspective in 2019.\u003c/em\u003e Gastroenterology research, 2020. \u003cstrong\u003e13\u003c/strong\u003e(1): p. 1-10.\u003c/li\u003e\n\u003cli\u003eXi, Y. and P. Xu, \u003cem\u003eGlobal colorectal cancer burden in 2020 and projections to 2040.\u003c/em\u003e Translational oncology, 2021. \u003cstrong\u003e14\u003c/strong\u003e(10): p. 101174.\u003c/li\u003e\n\u003cli\u003eShang, F., et al., \u003cem\u003eThe inhibitory effects of probiotics on colon cancer cells: In vitro and in vivo studies.\u003c/em\u003e Journal of Gastrointestinal Oncology, 2020. \u003cstrong\u003e11\u003c/strong\u003e(6): p. 1224.\u003c/li\u003e\n\u003cli\u003eSharma, M., A. Wasan, and R.K. Sharma, \u003cem\u003eRecent developments in probiotics: An emphasis on Bifidobacterium.\u003c/em\u003e Food Bioscience, 2021. \u003cstrong\u003e41\u003c/strong\u003e: p. 100993.\u003c/li\u003e\n\u003cli\u003eJavanmard, A., et al., \u003cem\u003eProbiotics and their role in gastrointestinal cancers prevention and treatment; an overview.\u003c/em\u003e Gastroenterology and hepatology from bed to bench, 2018. \u003cstrong\u003e11\u003c/strong\u003e(4): p. 284.\u003c/li\u003e\n\u003cli\u003eMazziotta, C., et al., \u003cem\u003eProbiotics Mechanism of Action on Immune Cells and Beneficial Effects on Human Health.\u003c/em\u003e Cells, 2023. \u003cstrong\u003e12\u003c/strong\u003e(1): p. 184.\u003c/li\u003e\n\u003cli\u003eG\u0026oacute;rska, A., et al., \u003cem\u003eProbiotic bacteria: a promising tool in cancer prevention and therapy.\u003c/em\u003e Current microbiology, 2019. \u003cstrong\u003e76\u003c/strong\u003e: p. 939-949.\u003c/li\u003e\n\u003cli\u003eBolhassani, A., A. Khavari, and S.Z. Bathaie, \u003cem\u003eSaffron and natural carotenoids: Biochemical activities and anti-tumor effects.\u003c/em\u003e Biochimica et Biophysica Acta (Bba)-reviews on cancer, 2014. \u003cstrong\u003e1845\u003c/strong\u003e(1): p. 20-30.\u003c/li\u003e\n\u003cli\u003eMilajerdi, A., K. Djafarian, and B. Hosseini, \u003cem\u003eThe toxicity of saffron (Crocus sativus L.) and its constituents against normal and cancer cells.\u003c/em\u003e Journal of nutrition \u0026amp; intermediary metabolism, 2016. \u003cstrong\u003e3\u003c/strong\u003e: p. 23-32.\u003c/li\u003e\n\u003cli\u003eColapietro, A., et al., \u003cem\u003eCrocetin and crocin from saffron in cancer chemotherapy and chemoprevention.\u003c/em\u003e Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents), 2019. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 38-47.\u003c/li\u003e\n\u003cli\u003eAbd El‐Hack, M.E., et al., \u003cem\u003eCurcumin, the active substance of turmeric: its effects on health and ways to improve its bioavailability.\u003c/em\u003e Journal of the Science of Food and Agriculture, 2021. \u003cstrong\u003e101\u003c/strong\u003e(14): p. 5747-5762.\u003c/li\u003e\n\u003cli\u003eSalmanzadeh, R., et al., \u003cem\u003ePropyl gallate (PG) and tert-butylhydroquinone (TBHQ) may alter the potential anti-cancer behavior of probiotics.\u003c/em\u003e Food bioscience, 2018. \u003cstrong\u003e24\u003c/strong\u003e: p. 37-45.\u003c/li\u003e\n\u003cli\u003eGholipour, F., et al., \u003cem\u003eAnticancer properties of curcumin-treated Lactobacillus plantarum against the HT-29 colorectal adenocarcinoma cells.\u003c/em\u003e Scientific Reports, 2023. \u003cstrong\u003e13\u003c/strong\u003e(1): p. 2860.\u003c/li\u003e\n\u003c/ol\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Crocin, Probiotics, Lactobacillus lactis, Anticancer, colorectal cancer, Treatment","lastPublishedDoi":"10.21203/rs.3.rs-4665517/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4665517/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThere are numerous potential mechanisms that can account for the propensity of probiotics to prevent the onset of colorectal cancer. These effects include but are not limited to deactivation of cancer-causing agents, competition with harmful bacteria, boosting the immune system, and reducing cell proliferation by controlling apoptosis and cell differentiation. Other benefits include fermenting undigested food and limiting the activity of certain signaling pathways. Research has shown that the gut microbiota is impacted by nutrition, which subsequently affects the metabolomics, thereby establishing a connection between diet, microbiota, and overall health. The objective of this study was to assess the resistance of \u003cem\u003eLactobacillus lactis\u003c/em\u003e to Crocin. The study involved extracting cell-free supernatants from untreated bacteria and bacteria treated with crocin, and then examining their ability to prevent the growth of HCT-116 colon cancer cells. It was proven that \u003cem\u003eL. lactic\u003c/em\u003e, when treated with crocin, can effectively fight against various types of harmful bacteria and can survive in acidic conditions. After 48 hours, both CFS and cro-CFS showed a dose-dependent inhibition of HCT-116 cell growth. The half-maximal inhibitory concentration was 97.41 \u0026micro;L/mL for CFS and 72.07 \u0026micro;L/mL for cro-CFS. The results of flow cytometry tests confirmed the MTT assay findings, showing that cro-CFS-treated cells had a higher rate of apoptosis at 46.8% compared to CFS-treated cells at 25.42%. The results were confirmed by qPCR, which showed that the Caspase 9 and BAX genes were upregulated and the BCL-2 expression level was reduced in cells treated with cro-CFS and CFS. Crocin could alter the metabolomics of probiotics present in the gut, potentially impacting their ability to fight cancer.\u003c/p\u003e","manuscriptTitle":"Crocin effects on the anticancer properties of Lactobacillus lactis probiotics against colorectal adenocarcinoma cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-23 19:20:44","doi":"10.21203/rs.3.rs-4665517/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-19T09:05:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-08T13:22:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-31T06:35:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"168950138865023302833719991086820671200","date":"2024-07-31T04:19:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-31T04:13:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"94072125721544196260191256079496074681","date":"2024-07-30T09:59:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"253158111167414593886280304683659183520","date":"2024-07-30T09:46:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"261802006460940508460354097971061662071","date":"2024-07-22T10:01:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-15T09:50:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-01T10:57:02+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-01T10:56:02+00:00","index":"","fulltext":""},{"type":"submitted","content":"Naunyn-Schmiedeberg's Archives of Pharmacology","date":"2024-07-01T05:45:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"naunyn-schmiedebergs-archives-of-pharmacology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nsap","sideBox":"Learn more about [Naunyn-Schmiedeberg's Archives of Pharmacology](https://www.springer.com/journal/210)","snPcode":"210","submissionUrl":"https://submission.nature.com/new-submission/210/3","title":"Naunyn-Schmiedeberg's Archives of Pharmacology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"791783a2-2748-4138-8b18-f78231a4ca93","owner":[],"postedDate":"July 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-02T17:21:29+00:00","versionOfRecord":{"articleIdentity":"rs-4665517","link":"https://doi.org/10.1007/s00210-024-03636-0","journal":{"identity":"naunyn-schmiedebergs-archives-of-pharmacology","isVorOnly":false,"title":"Naunyn-Schmiedeberg's Archives of Pharmacology"},"publishedOn":"2024-11-28 15:57:43","publishedOnDateReadable":"November 28th, 2024"},"versionCreatedAt":"2024-07-23 19:20:44","video":"","vorDoi":"10.1007/s00210-024-03636-0","vorDoiUrl":"https://doi.org/10.1007/s00210-024-03636-0","workflowStages":[]},"version":"v1","identity":"rs-4665517","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4665517","identity":"rs-4665517","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}