The METTL3/TRAP1 Axis as a Key Regulator of 5-Fluorouracil Chemosensitivity in Colorectal Cancer

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Abstract 5-Fluorouracil (5-FU) stands as the frontline chemotherapeutic for colorectal cancer (CRC). However, the enduring challenge of chemoresistance to 5-FU persists in clinical practice, and the precise regulatory mechanisms governing 5-FU response and resistance in CRC remain elusive. This study aims to investigate the role and mechanisms of METTL3 in regulating 5-FU chemosensitivity in CRC cells. Practically, 5-FU treatment not only hindered cell viability and induced apoptosis but also led to a reduction in METTL3 expression in HCT-116 and HCT-8 cells. Through a range of assays including drug sensitivity, EdU, colony formation, TUNEL staining, and flow cytometry, we unveiled that METTL3 depletion heightened 5-FU sensitivity and augmented apoptosis induction in vitro and in vivo. Conversely, METTL3 overexpression conferred HCT-116 and HCT-8 cells with resistance to 5-FU. Mechanistically, METTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression. Further, m6A colorimetric ELISA and MeRIP-qPCR assays demonstrated that METTL3 regulated TRAP1 expression in an m6A-dependent manner. Furthermore, the overexpression of TRAP1 mitigated the cytotoxic effects of 5-FU on HCT-116 and HCT-8 cells. In conclusion, this study uncovers the pivotal role of the METTL3/TRAP1 axis in modulating 5-FU chemosensitivity in CRC.
Full text 151,676 characters · extracted from preprint-html · click to expand
The METTL3/TRAP1 Axis as a Key Regulator of 5-Fluorouracil Chemosensitivity in Colorectal Cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The METTL3/TRAP1 Axis as a Key Regulator of 5-Fluorouracil Chemosensitivity in Colorectal Cancer Qingjie Kang, Xiaoyu Hu, Zhenzhou Chen, Xiaolong Liang, Song Xiang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3853872/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Sep, 2024 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted 8 You are reading this latest preprint version Abstract 5-Fluorouracil (5-FU) stands as the frontline chemotherapeutic for colorectal cancer (CRC). However, the enduring challenge of chemoresistance to 5-FU persists in clinical practice, and the precise regulatory mechanisms governing 5-FU response and resistance in CRC remain elusive. This study aims to investigate the role and mechanisms of METTL3 in regulating 5-FU chemosensitivity in CRC cells. Practically, 5-FU treatment not only hindered cell viability and induced apoptosis but also led to a reduction in METTL3 expression in HCT-116 and HCT-8 cells. Through a range of assays including drug sensitivity, EdU, colony formation, TUNEL staining, and flow cytometry, we unveiled that METTL3 depletion heightened 5-FU sensitivity and augmented apoptosis induction in vitro and in vivo. Conversely, METTL3 overexpression conferred HCT-116 and HCT-8 cells with resistance to 5-FU. Mechanistically, METTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression. Further, m6A colorimetric ELISA and MeRIP-qPCR assays demonstrated that METTL3 regulated TRAP1 expression in an m6A-dependent manner. Furthermore, the overexpression of TRAP1 mitigated the cytotoxic effects of 5-FU on HCT-116 and HCT-8 cells. In conclusion, this study uncovers the pivotal role of the METTL3/TRAP1 axis in modulating 5-FU chemosensitivity in CRC. METTL3 TRAP1 5-FU Chemosensitivity CRC Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Colorectal cancer (CRC) stands out as one of the most prevalent malignancies worldwide. According to the 2020 Chinese Cancer Statistics Report, China witnessed the second-highest incidence and fifth-highest mortality rates for colorectal cancer among all malignancies[1]. Additionally, the American Colorectal Cancer Statistics report reveals that CRC holds the third position in both the diagnosis frequency and cancer-related mortality for both men and women in the United States[2]. Despite the remarkable progress in surgical procedures, radiochemotherapy, and targeted therapies, all of which have significantly bolstered survival rates for colon cancer patients[3], the survival rates for late-stage disease remain unsatisfactory[4-6]. Drug resistance emerges as a major impediment in late-stage CRC treatment. Hence, gaining insights into the molecular mechanisms of drug resistance is imperative for enhancing the prognosis of CRC. 5-Fluorouracil (5-FU) stands at the forefront of chemotherapeutic agents for treating advanced and metastatic CRC[7]. Patients with advanced CRC typically undergo a sequential administration of fluoropyrimidines-based regimens as part of systemic palliative care, leading to an extended survival period of about 20 months[8]. The cytotoxic effects of 5-FU on cancer cells primarily involve inhibiting thymidylate synthase, inducing DNA lesions through base mismatch, and, in certain instances, directly triggering apoptosis[9-10]. Apoptosis, characterized as programmed cell death, is a prime target of various chemotherapeutic drugs[11]. Despite the numerous merits of 5-FU in cancer management, a significant hurdle in its clinical application is the emergence of chemotherapeutic drug resistance in CRC. This resistance is believed to stem from factors such as hindered drug uptake, alterations in targets, enhanced DNA damage repair capability, and a developed resistance to apoptosis[12]. In CRC, an important mechanism contributing to 5-FU resistance revolves around acquiring the ability to evade apoptosis[13-14]. Hence, comprehending the molecular mechanism of 5-FU-induced apoptosis is crucial for devising more effective strategies against drug resistance. M6A methylation, a prevalent RNA modification, was first discovered and comprehensively studied in the 1970s[15-16]. This modification intricately influences gene expression by overseeing alternative splicing, enhancing translation efficiency, and bolstering mRNA stability[17]. The m6A modification process is orchestrated by various regulators including methyltransferase complexes (often referred to as "writers"), demethylases ("erasers"), and RNA-binding proteins ("readers")[18]. Methyltransferase-like3 (METTL3), as a significant member of m6A "writers," not only impacts physiological functions like tissue development and circadian clock regulation but also plays a role in tumorigenesis[19-20]. Recent studies have illuminated its dysregulation in diverse cancers, including lung, breast, acute myeloid leukemia, glioma, and colorectal cancer[21]. This dysregulation influences a spectrum of pivotal biological processes in cancer cells, encompassing cellular transformation, proliferation, invasion, metastasis, and the renewal of cancer stem cells. A particularly compelling revelation is the emerging understanding that METTL3-mediated m6A modification regulates the translation and stability of mRNAs encoding proteins vital in apoptosis, autophagy, and DNA repair[20]. This intricate regulatory network contributes significantly to the development of chemoresistance across diverse cancer types[22]. For instance, METTL3 depletion prompts heightened apoptosis rates, achieved by reducing the translation of MYC, BCL2, and PTEN in leukemia cells[23], or by suppressing BCL-2 translation in breast cancer cells[24]. Moreover, METTL3 has been implicated in conferring resistance to cisplatin in lung cancer[25], sorafenib resistance in liver cancer[26], and resistance to gemcitabine, 5-fluorouracil, and cisplatin in pancreatic cancer[27]. Despite the significant progress made in comprehending the involvement of METTL3-m6A modification in the advancement of malignant cancers and the development of chemoresistance, the specific contributions of METTL3 in 5-FU resistance, as well as 5-FU-triggered apoptosis in CRC, and its subsequent downstream targets, remain incompletely elucidated. Tumor necrosis factor (TNF) receptor associated protein 1 (TRAP1) , a mitochondrial protein, is a member of the Hsp90 family. Initially identified for its interaction with the intracellular domain of type I TNF receptor[28], it was later recognized as Hsp75[29] and found to play a role in processes such as mitochondrial bioenergy regulation, response to oxidative stress, apoptosis, and inflammation[30-31]. TRAP1 typically maintains low expression in normal tissue; however, its expression becomes dysregulated in various cancers, including colorectal carcinomas[32-33]. Elevated TRAP1 levels have been linked to reduced disease-specific survival in colorectal cancer[33]. Throughout tumor progression, TRAP1 assumes a vital role in protecting cancer cells by diminishing the production of reactive oxygen species (ROS)[30]. Moreover, it has been proposed that TRAP1 might also play a role in chemo-resistance, potentially obstructing drug-induced apoptosis in various tumors, including prostate cancer[34], osteosarcoma[35] and colorectal cancer[36]. In the case of CRC cells, lab studies indicate that increased TRAP1 levels lead to resistance against oxaliplatin, irinotecan, and 5-FU[36]. However, the precise regulatory mechanisms of TRAP1 in the context of 5-FU resistance in CRC cells remain unclear. Recent research has highlighted the vital role of m6A modification in governing the heat shock response. Knockdown of METTL3 has been shown to alter the methylation patterns of HSPs transcripts[37]. Whether METTL3-mediated m6A modification directly impacts the expression of TRAP1 in CRC remains unclear. Therefore, this study aims to uncover the role and mechanism of METTL3 in regulating 5-FU sensitivity in CRC cells, particularly investigating whether METTL3 contributes to modulate 5-FU-induced apoptosis and whether this mechanism involves the regulation of TRAP1 expression. Materials and methods Cell lines and Culture The human CRC HCT-116 and HCT-8 cell lines were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). All the cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Procell Biotech, Wuhan, China), 1% penicillin and streptomycin ((Beyotime Biotech, Shanghai, China),and kept in a humidified incubator containing 5% CO 2 at 37°C. Cell Transfection The METTL3-shRNA expression vectors, custom-designed and constructed by TsingKe (Chongqing, China), were integrated into the pGreen-Puro vector provided by GenePharma (Shanghai, China).The target sequences of shRNA are listed as follows:shMETTL3#1:5'‑GCAAGTATGTTCACTATGAAA‑3',shMETTL3#2: 5'‑GCTGCACTTCAGACGAATTAT‑3'. To achieve METTL3 overexpression, TsingKe synthesized the cDNA sequence containing METTL3 ORF. This sequence was then inserted into the lentiviral vector pCDH-CMV-MCS-EF1-CopGFP-T2A-puro at EcoRI and BamHI sites. HEK-293T cells were seeded 24 hours prior to lentiviral particle production, and the lentiviruses were packaged by transfecting these cells with pGreen-Puro shRNA vectors or overexpression plasmids along with psPAX2 and pMD2.G (Addgene, Cambridge, MA, USA). After 48 or 72 hours, the viral supernatant was harvested and mixed with 5μg/mL of polybrene for subsequent infection of target cells. Then, the infected cells were screened using 1 µg/mL puromycin (Sigma-Aldrich, St. Louis, MO, USA) for 14days.The plasmid encoding human TRAP1 was obtained from TsingKe (Chongqing, China). Transfections were performed using the Lipofectamine 2000 kit (Invitrogen, Carlsbad, CA, USA)according to the manufacturer's protocol. The efficiency of knockdown and overexpression in stable cell lines was assessed through RT-qPCR and western blot analysis. All cells within each group were collected following a specified incubation period for subsequent experiments. Colony Formation Assay The colony-forming assay was employed to assess cell proliferation in the treated cells. Initially, 500 cells were seeded in 12-well plates and allowed to adhere for 24 hours at 37°C. Subsequently, the cells underwent a 24-hour treatment with 5-Fu. Following the treatment, the medium was replaced with fresh medium without 5-FU, and the cells were cultured for an additional 10 days. After this period, colonies in each well were washed with PBS, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.1% crystal violet for 30 minutes, and subsequently washed with PBS once more. The colonies were photographed, and the number of colonies with more than 50 cells was recorded. EdU Staining The EdU proliferation assay was conducted to further assess cell proliferation. EdU staining was performed using the EdU Apollo DNA In-vitro Kit (RiboBio, Guangzhou, China) according to the manufacturer's protocol. Briefly, the treated cells (2x10 4 ) were seeded and cultured in 96-well plates for 24 hours. After achieving adhesion, cells were exposed to 5-FU for 24 hours. Subsequently, the cells were incubated with 50µM EdU for 2 hours, followed by fixation with 4% paraformaldehyde and permeabilization with 0.5% Triton X-100. They were then stained with the Apollo® reaction cocktail. Finally, Hoechst 33342 was used for nucleic acid staining. The stained cells were observed using a fluorescence microscope (Olympus, Tokyo, Japan). Drug Sensitivity Assay Cell sensitivity to 5-FU was assessed using a Cell Counting Kit-8 (CCK-8) kit (MCE, Shanghai, China), following the provided instructions. Initially, cells (5x10 4 ) were seeded into 96-well plates and left to incubate at 37°C for 24 hours. Upon achieving adherence, cells were exposed to various concentrations of 5-FU for 24 hours, considering their distinct sensitivities. After treatment, the drug-containing solution was replaced with fresh medium. Then, 10µL/well of CCK-8 solution was added, followed by a 2-hour incubation at 37°C. The optical density (OD) at 450nm was measured using a spectrophotometer (Synergy2, BioTek, USA). The Cell viability rate was calculated using the formula: Cell viability(%) = [(OD450 of the test well–OD450 of the blank well)/(OD450 of the control well–OD450 of the blank well)] x 100%. The half-maximal inhibitory concentration (IC50) was calculated using GraphPad Prism 8.0 software. Flow Cytometry Analysis Cells were seeded in 6-well plates and cultured until they reached 90% confluence. After treatment with various concentrations of 5-FU, the cells were collected and washed twice with ice-cold PBS. Subsequently, they were resuspended in ice-cold PBS and promptly sent to the Academy of Life Sciences at Chongqing Medical University (Chongqing, China) for apoptosis detection using flow cytometry. Real-time quantitative PCR Total RNA was isolated from the cell samples following the precise protocols outlined in the TRIzol reagent kit (Takara, Dalian, China). Subsequently, this RNA underwent reverse transcription using the PrimeScript RT Reagent Kit (Takara, Dalian, China). The subsequent real-time polymerase chain reaction (PCR) was performed with the 2×SYBR Green qPCR Master Mix (Bimake, Houston, USA) on the CFX96 Real Time PCR System (Bio-Rad, CA, USA). The results were normalized using the GAPDH reference gene, and data analysis was conducted using the 2-ΔΔCT method. All gene-specific primers used in qPCR analysis are listed below:METTL3: forward 5'-GTCCATCTGTCTTGCCATCTC-3' and reverse 5'-GAGACCTCGCTTTACCTCAATC-3', TRAP1: forward 5'-CAGGGTTCCACTTCCAAACA-3' and reverse 5'-TGGAGATCAGCTCCCGTATAA-3',GAPDH:5'-CTTTGGTATCGTGGAAGGACTC-3' and reverse 5'-GTAGAGGCAGGGATGATGTTCT-3'. Total m6A Measurement The total RNA m6A levels were quantified using a colorimetric ELISA assay with the m6A RNA Methylation Quantification Kit (Epigentek, NY, USA) following the provided protocols. Briefly, 200 ng of sample RNA, along with negative and diluted positive controls, were loaded into designated wells using RNA high-binding solution. After incubation at 37°C for 90 minutes, m6A levels were captured and assessed using specific capture and detection antibodies. Subsequently, developer solution was introduced and left to incubate at room temperature for 10 minutes in darkness. Once the positive control reaction liquid turned light blue, 100 µL of stop solution was applied to halt the reaction. The optical density (OD) value at 450 nm was promptly measured using a microplate reader within 10 minutes. The relative abundance of m6A was determined based on the obtained OD value.. MeRIP-qPCR The MeRIP-qPCR procedure closely followed a prior protocol[38]. Initially, total RNA was extracted using the TRIzol reagent kit (Takara, Dalian, China). The isolated mRNAs were enzymatically fragmented into approximately 100-nucleotide segments. These fragmented RNAs then underwent standard precipitation. Subsequently, the RNA was reconstituted in nuclease-free water, with one-tenth of this solution preserved as the Input control and stored at −80°C. The remaining fragmented RNA was then subjected to an incubation process with an anti-m6A antibody (Synaptic Systems, Germany). The resulting mixture was immunoprecipitated using protein A/G magnetic beads (Bimake, USA). After a series of washes, the bound RNA was released from the beads with elution buffer and subsequently precipitated using ethanol. The precipitated RNA was then reconstituted in RNase-free water. Following this, both the immunoprecipitated RNA fragments and the input fragments prepared earlier were reverse-transcribed into cDNA, and then quantified by real-time qPCR. The qPCR primer sequences are provided below: forward 5'-GCAGCACAGAGAGCGTGC-3' and reverse 5'-TTCTGAGTACAGGGACCG-3'. The results were calculated by normalizing to a tenfold input. Western Blot The cells were lysed using RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease and phosphatase inhibitors (Beyotime, Shanghai, China). After collecting the supernatant, protein concentration was determined using the bicinchoninic acid (BCA) assay (Beyotime, China). Equivalent amounts of protein were loaded onto a 10% SDS-PAGE gel and subsequently transferred to a PVDF membrane. The membranes were then blocked with 5% non-fat milk at room temperature for 1.5 hours, followed by overnight incubation with primary antibodies at 4°C. The primary antibodies used included METTL3 (ab195352, Abcam, 1:1000), Bax (#5023, CST, 1:1000), Bcl-2 (#15071, CST, 1:1000), TRAP1 (10325-1-AP, Proteintech,1:3000),Cleaved caspase-3 (#9664, CST, 1:1000), and β-actin (66009-1-Ig, Proteintech, 1:5000). HRP-conjugated secondary antibodies (SA00001-1 or SA00001-2, Proteintech,1:5000) were applied for protein detection. Bands were visualized using Enhanced Chemiluminescence reagent (Beyotime, China) and quantified using fusion imaging software (EvolutionCapt-v18.02, Vilber, Germany). Hematoxylin and Eosin(HE) ,Immunohistochemistry(IHC) and TUNEL Staining The xenografted tumors were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned into 4-µm slices for subsequent experiments. Initially, the paraffin sections were deparaffinized in xylene and then dehydrated in a series of graded ethanol solutions. For H&E staining, the dehydrated sections were stained with Hematoxylin and Eosin, and subsequently photographed under light microscopy (Olympus, Tokyo, Japan). For IHC staining, the sections were subjected to a biotin-streptavidin horseradish peroxidase (HRP) detection kit (ZSGB, Beijing, China) following the provided protocol. After an 8-minute treatment with 3% H 2 O 2 , the sections were blocked with 3% goat serum for 1 hour. They were then incubated with primary antibodies against METTL3 (ab195352, Abcam, 1:200), TRAP1 (10325-1-AP, Proteintech,1:200) and Ki-67 (#9449, CST, 1:400) at 4°C overnight. Following this, they were treated with HRP-conjugated secondary antibodies for 30 minutes at room temperature, visualized using DAB chromogen, and counterstained with hematoxylin. The stained sections were examined at an appropriate magnification using a microscope (Olympus, Tokyo, Japan).Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of xenograft sections and cell lines was performed using a One-step TUNEL cell apoptosis detection kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. The stained cells and sections were then photographed under a fluorescence microscope (Olympus, Tokyo, Japan). Tumor Xenograft Model Female BALB/c nude mice (4-6 weeks old) were obtained from the Animal Experimental Laboratory at Chongqing Medical University and housed in a specialized pathogen-free environment. These mice were then randomly assigned to four groups, each consisting of five individuals. Xenograft tumors were established by subcutaneously injecting either shNC or shMETT3-1 HCT-116 cells (5x10 6 cells/mouse) in a total volume of 150μL PBS. Xenograft dimensions were measured every 3 days and calculated using the formula V (mm 3 ) = (length×width 2 )/2. Once the tumors reached a size of 50 mm 3 , mice were treated with either 5-FU or a Vehicle (PBS) solution. In the 5-FU administration group, 5-FU was administered via intraperitoneal injection at a concentration of 5 mg/kg every three days for a span of 18 days. The control group received 200 μL PBS. Tumor growth was carefully monitored for approximately one month. After 30 days, the mice were humanely euthanized. Subsequently, the tumors were carefully excised, photographed, weighed, and prepared for subsequent analyses. All experiments were conducted in compliance with applicable regulatory standards. Bioinformatic Analysis Microarray data can be accessed under the accession numbers GSE81005 from the Gene Expression Omnibus database (GEO, http://www.ncbi.nlm.nih.gov/geo/). These datasets, based on the GPL15270 platform , elucidate epigenomic alterations in HCT-8 cells after 0, 24, and 48 hours of 5-fluorouracil stimulation. Raw data were obtained as MINiML files. The m6A-related genes were sourced from Juan Xu's comprehensive study on the molecular characterization and clinical relevance of m6A modulators across 33 cancer types[39]. For heatmap visualization, the R software's pheatmap package was employed. RNA-sequencing expression profiles (level 3) and corresponding clinical information for CRC were sourced from the TCGA dataset (https://portal.gdc.cancer.gov). Genes encompassed in the apoptosis-related pathway were collected. The R software's GSVA package was employed for analysis, utilizing parameters set to method='ssgsea'. Spearman correlation was used to analyze the association between METTL3, TRAP1, and apoptosis-related pathway scores. The correlation map between METTL3 and TRAP1 was generated using the R software package ggstatsplot. All analyses and the use of R packages were conducted with R version 4.0.3. A p-value < 0.05 was considered statistically significant. Statistical Analysis Each experiment was independently repeated at least three times.Statistical analyses were performed using SPSS 19.0 (IBM Corp, Chicago, IL) and GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA). Data are presented as mean ± standard deviation(SD). Differences between two groups were assessed using a two-tailed Student's t-test, while distinctions among multiple groups were evaluated using one-way analysis of variance (ANOVA). The statistical difference of two groups from GEO datasets was compared through the Wilcoxon test, and the significance difference of three groups was tested with the Kruskal-Wallis test. Significance levels were indicated as follows: *P < 0.05, **P < 0.01, ***P < 0.001. Results 5-FU induces cell apoptosis and down-regulates METTL3 expression in CRC cells 5-FU is a widely used cancer chemotherapeutic drug known for its universal induction of apoptosis. In order to investigate the contribution of apoptosis to 5-FU-induced colorectal cancer cell death, HCT-116 and HCT-8 cells were subjected to varying doses (0, 2, 4, 8µM) of 5-FU for 24 hours. Flow cytometry and TUNEL assay were conducted to identify apoptotic cells. The results from flow cytometry demonstrated a concentration-dependent increase in apoptotic rate for both HCT-116 and HCT-8 cells following 24-hour 5-FU treatment(Fig. 1A). Likewise, the number of TUNEL-positive cells exhibited a significant rise corresponding to the concentration of 5-FU treatment(Fig. 1C-F). Further confirmation of 5-FU-induced apoptosis in HCT-116 and HCT-8 cells was sought through an analysis of the anti-apoptotic protein, Bcl-2, a hallmark of cell apoptosis. Western blotting revealed a dose-dependent reduction in Bcl-2 expression upon 5-FU treatment (0-8µM). In parallel, the cleaved Caspase-3 and Bax, indicative of cells undergoing apoptosis, demonstrated a remarkable increase post 5-FU treatment (Fig. 1G-J). These findings strongly suggest that 5-FU can induce apoptotic cell death in CRC cells. Previous studies have provided substantial evidence supporting the crucial role of m6A methylation in the regulation of apoptosis and drug resistance in tumor cells[20,22-27]. To further clarify whether m6A methylation is involved in 5-FU-induced apoptosis in CRC cells. we analyzed the m6A-related genes expression in CRC datasets from GSE81005, and found a time-dependent reduction in METTL3 and a concomitant increase in the levels of YTHDF2, WTAP, and YTHDF3 in HCT-8 cells after 24 and 48 hours of 5-FU treatment (Fig. 1B). Considering that METTL3 is a crucial m6A methyltransferase, we focused on investigating its involvement in 5-FU-induced apoptosis in CRC cells. Subsequently, we assessed METTL3 expression levels in HCT-116 and HCT-8 cells following 5-FU treatment. Similarly, Western blot results demonstrated a significant decrease after a 24-hour treatment with 5-FU(Fig. 1G-J). This result strongly imply that METTL3 plays a pivotal role in 5-FU-induced apoptosis. METTL3 downregulation enhances the sensitivity of CRC cells to 5-FU treatment and facilitates 5-FU-induced apoptosis Considering that METTL3 is involved in 5‑FU‑dependent responses, it led us to hypothesize that manipulating METTL3 levels could influence the sensitivity of CRC cells to 5-FU. To test this hypothesis, we created stable METTL3 knockdown cell lines (shMETTL3-1 and -2) in HCT-116 and HCT-8 cells using different shRNA sequences. Both mRNA and protein analyses confirmed the successful knockdown of METTL3 (Fig. 2A-C). We utilized the CCK-8 assay to assess 5-FU sensitivity. The results demonstrated a significant decrease in cell viability and IC50 value upon METTL3 silencing (Fig. 2D-E). Moreover, colony formation assays showed a notable reduction in colony numbers in shMETTL3-1 and shMETTL3-2 transfected groups compared to the shNC group after 5-FU treatment for 24 hours (Fig. 2F-H). Similarly, EdU assay revealed a lower percentage of proliferative cells in HCT-116 and HCT-8 cells with METTL3 knockdown compared to the shNC group after exposure to 5-FU for 24 hours (Fig. 2I-K). Additionally, the knockdown of METTL3 resulted in heightened cell apoptosis when exposed to 5-FU (Fig. 2L). This observation was in line with the western blot analysis, which exhibited elevated levels of pro-apoptotic proteins Bax and cleaved Caspase-3, along with a decrease in the anti-apoptotic protein Bcl-2 in 5-FU-treated METTL3 knockdown cells (Fig. 2M-O). These findings suggest that silencing METTL3 induces cell death through Bcl-2-dependent apoptotic pathways. In summary, these results collectively indicate that suppressing METTL3 expression heightens the sensitivity of CRC cells to 5-FU and promotes apoptotic responses . METTL3 overexpression mitigates the inhibitory effect of 5-FU on the viability of CRC cells and enhances its protective role in apoptosis To further characterize the role of METTL3 in CRC cells with 5-FU treatment, we next examined whether ectopic expression of METTL3 could counteract 5-FU-induced apoptosis and increase 5-FU resistance in CRC cells. HCT-116 and HCT-8 cells were transduced with lentivirus carrying METTL3 for overexpression. Validation of METTL3 overexpression occurred at both mRNA and protein levels(Fig. 3A-C). As anticipated, heightened METTL3 levels increased the cell viability and 5-FU IC50 value in HCT-116 and HCT-8 cells (Fig. 3D-E). Additionally, cells with METTL3 overexpression exhibited a greater propensity to form colonies compared to the control cells after 5-FU treatment (Fig. 3F,H-I). This was consistently supported by EdU immunofluorescence staining, which indicated a higher percentage of proliferative cells in HCT-116 and HCT-8 cells with METTL3 overexpression compared to the control cells following 5-FU exposure(Fig. 3J-L).To examine whether the enhanced cell viability observed in the METTL3 overexpression group following 5-Fu treatment correlated with alterations in apoptosis, a flow cytometry apoptosis analysis was conducted. The data revealed a notable decrease in the apoptotic rate of HCT-116 and HCT-8 cells after METTL3 upregulation in the presence of 5-FU treatment(Fig. 3G). In line with this, western blot analysis demonstrated that METTL3 overexpression could reverse the inhibitory effect on Bcl-2 expression and the facilitative effect on Bax and cleaved Caspase-3 expression caused by 5-FU treatment(Fig. 3M-O).In summary, METTL3 overexpression attenuated 5-FU-induced apoptosis and diminished the sensitivity of CRC cells to 5-FU. METTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression in an m6A-dependent manner TRAP1 is implicated in colorectal cancer metastasis and prognosis, inducing a multidrug-resistant phenotype. Previous research highlights its crucial role in regulating apoptosis, leading to 5-FU resistance in CRC cells when overexpressed[36]. Hence, we hypothesized whether METTL3 could modulate TRAP1 expression in CRC cells, thereby influencing 5-FU sensitivity and apoptosis induction. To verify our hypothesis, we initially utilized RNA-sequencing expression profiles (level 3) from TCGA, encompassing 620 CRC samples, to analyze correlations between METTL3, TRAP1, and the apoptosis-related pathway score. Results unveiled a significant positive correlation between TRAP1 and METTL3 expression(Fig. 4A), along with a negative correlation between METTL3 and TRAP1 with the apoptosis-related pathway(Fig. 4B-C). Subsequently, we analyzed TRAP1 expression in cells with altered METTL3 levels following 5-FU treatment. Western blot results showed elevated TRAP1 protein levels in METTL3-overexpressing HCT-116 and HCT-8 cells, while knockdown of METTL3 resulted in decreased TRAP1 protein levels(Fig. 4E,R-S). qPCR analysis aligned with these findings, indicating a corresponding pattern in mRNA expression after altering METTL3 levels(Fig. 4T-U). Thus, the above findings indicate that METTL3 could regulate TRAP1 expression in CRC cells following 5-FU treatment. To further investigate whether METTL3 regulates 5-FU sensitivity and apoptosis induction in CRC cells by modulating TRAP1 expression, we firstly examined the impact of inhibiting TRAP1 with G-TPP (gamitrinib-triphenylphosphonium) in HCT-116 cells with METTL3 overexpression. G-TPP is a pharmacological inhibitor known for its ability to hinder TRAP1 signaling pathways in colon cancer, as demonstrated in previous studies[40]. Our aim was to assess whether this inhibition could modify the protective influence of METTL3 during 5-FU treatment. As expected, G-TPP pretreatment in HCT-116 attenuated the protection provided by METTL3 against 5-FU treatment (Fig. 4F,H). Mechanistically, G-TPP pretreatment also abolished the upregulation of Bcl-2 and suppression of Bax and cleaved Caspase-3 afforded by METTL3 overexpression in HCT-116 cells after 5-FU treatment (Fig. 4J,M). Subsequently, we investigated whether the ectopic expression of TRAP1 could counteract the influence observed following METTL3 knockdown in HCT-8 cells during 5-FU treatment by transfecting them with a TRAP1 overexpression plasmid. As anticipated, TRAP1 overexpression counteracted the inhibitory effect induced by METTL3 knockdown post 5-FU treatment(Fig. 4G, I), reversing alterations in Bcl-2, Bax, and cleaved Caspase-3 caused by METTL3 downregulation(Fig. 4K, N).Collectively, these results strongly support the notion that METTL3 regulates 5-FU sensitivity and protects against 5-FU-induced apoptosis in CRC cells by boosting TRAP1 expression. Considering that mRNA transcript stability is regulated by METTL3 through m6A modification, we next investigated whether METTL3 regulates the expression of TRAP1 in an m6A-dependent manner. We utilized the online bioinformatics tool, the sequence-based N6-methyladenosine (m6A) modification site predictor (http://www.cuilab.cn/sramp) to perform m6A site prediction analysis on TRAP1 mRNA. The results revealed the presence of multiple m6A modification sites within TRAP1 mRNA(Fig.4L). Among them, the highest confidence binding sites "GGACU" were located at 2149–2153bp(Fig. 4O). To validate these results, we employed m6A colorimetric ELISA assays to examine alterations in total RNA m6A modification levels in METTL3-overexpressing HCT-116 and METTL3-downregulated HCT-8 cells following 5-FU treatment. The results demonstrated a significant increase in total RNA m6A levels upon METTL3 up-regulation in HCT-116 cell lines, but a significant decrease in HCT-8 cells(Fig. 4D). Additionally, MeRIP-qPCR assays were deployed to detect gene-specific m6A modifications on TRAP1 mRNA. The results showed that m6A antibody enrichment on TRAP1 mRNA was significantly increased in METTL3-upregulated HCT-116 cells and decreased in METTL3-downregulated HCT-8 cells upon 5-FU treatment (Fig. 4P-Q). In summary, all the gathered data indicate that METTL3 regulates 5-FU sensitivity and protects against 5-FU-induced apoptosis by modulating TRAP1 in an m6A-dependent manner in CRC cells. TRAP1 overexpression attenuate s chemotherapeutic sensitivity of 5-FU in CRC cells To further validate the role of TRAP1 in regulating 5-FU sensitivity, we constructed a TRAP1 overexpression plasmid (pcDNA3.1-TRAP1). Both qRT-PCR and western blotting confirmed a substantial increase in TRAP1 mRNA and protein levels in HCT-116 and HCT-8 cells transfected with the TRAP1 overexpression plasmid, compared to the vector group (Fig. 5A-B). Notably, TRAP1 expression has been found to be elevated in drug-resistant human colorectal carcinoma cells, and its upregulation protected cells from the cytotoxic effects of 5-FU and L-OHP in HT-29 colorectal carcinoma cells[36]. In line with these observations, our current study disclosed that TRAP1 overexpression increased the cell viability and 5-FU IC50 value in HCT-116 and HCT-8 cells (Fig. 5C-D). Through colony formation assays (Fig. 5E,G-H) and EdU immunofluorescence staining (Fig. 5F,I-J), we demonstrated that TRAP1 overexpression conferred heightened resistance to 5-FU in both HCT-116 and HCT-8 cells.One hallmark of drug resistance is an increased capacity to inhibit apoptosis in response to drug treatment. Accordingly, a flow cytometry assay was conducted to evaluate cell apoptosis. Post 5-FU treatment, TRAP1 overexpression resulted in a reduced apoptosis ratio (Fig. 5K-L). Simultaneously, we assessed the expression of apoptosis-related proteins—Bax, Caspase-3, and Bcl-2—via Western blot analysis. The results revealed that TRAP1 overexpression significantly increased Bcl-2 expression, while inhibiting the expression of Bax and cleaved Caspase-3 in 5-FU treated cells. These findings imply that TRAP1 might play a role in conferring a 5-FU resistant phenotype in CRC cells. METTL3 knockdown enhances 5-FU sensitivity of CRC cells and diminishes tumor growth in vivo Based on the findings mentioned above, it has been demonstrated that METTL3 can regulate 5-FU sensitivity by modulating TRAP1 protein expression in CRC cells in vitro. To further ascertain the interplay between METTL3, 5-FU sensitivity, and tumor growth in CRC, we initiated a mouse xenograft model. This was achieved by injecting HCT-116 cells with silenced METTL3 into nude mice, followed by the administration of either 5-FU or a control substance(PBS). As depicted in Fig. 4A-C, 5-FU significantly reduced tumor volume and weight compared to the control, whereas tumors stemming from METTL3 down-regulation cells displayed decelerated growth and smaller mass. This corroborates the findings of a previous study by Song Xiang et al[41], which delineated that METTL3 silencing inhibited CRC cell proliferation in vivo. Additionally, in comparison to the control group, the downregulation of METTL3 increased the suppressive effect of 5-FU on tumor growth, signifying METTL3's role in conferring 5-FU tolerance to CRC cells. Further supporting this, analysis of xenografted tumors through immunohistochemistry (IHC) and TUNEL assay revealed that HCT-116 cells with METTL3 downregulation exhibited significantly lower levels of cell proliferation (Ki-67) and higher levels of apoptosis compared to the control group when treated with 5-FU(Fig. 6D).Additionally, there was a significant decrease in the protein expression levels of METTL3, TRAP1, and Bcl-2, while Bax expression increased after treatment with 5-FU(Fig. 6D-F).Similarly, in comparison to the control group, in the METTL3 silencing group following 5-FU treatment, the expression of METTL3, TRAP1, and Bcl-2 showed marked downregulation, while the expression of Bax was upregulated (Fig. 6D-F). These results are consistent with our prior in vitro findings. In summary, the in vivo data further substantiates that METTL3 knockdown enhances 5-FU sensitivity and apoptosis induction in CRC cells by inhibiting TRAP1 expression. Discussion Colorectal cancer (CRC) is a prominent global health concern, particularly in Asia where incidence and mortality rates have been steadily rising[42]. The primary approach to managing CRC involves surgery, often complemented with chemotherapy for advanced cases[43]. Among patients with unresectable or metastatic tumors, 5-FU-based chemotherapy is the standard of care[44]. However, the clinical efficacy of 5-FU is hampered by the emergence of chemoresistance, a formidable challenge that can arise either inherently or through treatment exposure. This resistance significantly contributes to treatment failure and disease progression in cancer patients[45]. Chemotherapy resistance can be attributed to various mechanisms, including enhanced drug expulsion, heightened DNA damage repair, activation of detoxification systems, and the ability to evade drug-induced apoptosis[45-47]. While 5-FU's anti-cancer effect has long been associated with its ability to induce cell apoptosis, a substantial body of evidence supports a connection between the downregulation of proapoptotic pathways and 5-FU resistance[36]. Despite these insights, the precise mechanisms governing 5-FU resistance and 5-FU-induced apoptosis in CRC cells remain elusive. Therefore, there is an urgent need to investigate the pathways through which CRC cells acquire 5-FU resistance and develop therapeutic strategies to overcome this challenge. This study illuminates the fact that 5-FU induces apoptotic cell death in HCT-116 and HCT-8 CRC cells. Furthermore, our findings suggest that METTL3 plays a pivotal role in mediating the apoptotic responses triggered by 5-FU. Notably, there is a significant reduction in METTL3 protein expression after 24 hours of 5-FU treatment. A series of gain- and loss-of-function experiments, both in vitro and in vivo, provide compelling evidence that METTL3 is intricately involved in suppressing 5-FU-induced apoptosis and in the regulation of 5-FU sensitivity in CRC cells. METTL3, the pioneering methyltransferase identified in RNA modification, operates in conjunction with METTL14 and WTAP, playing a crucial role in RNA methylation processes[48]. Its involvement spans various critical biological functions like cell cycle regulation, proliferation, apoptosis, and cell mobility[49]. Recently, the altered expression of METTL3 has been observed in various tumors, indicating its significant role in tumorigenesis[50]. Moreover, it has garnered attention as a promising target for therapeutic interventions in a wide range of human cancers[49]. Similarly, in the context of CRC, a significant body of research has examined METTL3's role. Some studies suggest that heightened METTL3 expression boosts CRC cell growth, fostering carcinogenesis[41,52-54]. Conversely, there is a study reporting a tumor-suppressive effect of METTL3 in CRC, inhibiting cell proliferation, migration, and invasion via the p38/ERK pathway[55]. The authors posit that the dual role of METTL3 in cancer regulation could be attributed to variations in targeting pathways and the inherent heterogeneity of cancer[55]. Therefore, further investigation is warranted to elucidate the precise role of METTL3 in CRC. Emerging evidence links METTL3 to drug resistance in various cancer cells. For instance, it governs resistance to cisplatin in lung cancer by inducing mitophagy[25]. Moreover, METTL3 has implications in drug resistance within pancreatic cancer[27]. In MCF-7 breast cancer cells, METTL3 even promotes resistance to adriamycin through m6A-dependent pri-microRNA-221-3p maturation[56]. Nonetheless, its role in 5-FU sensitivity in CRC remains somewhat elusive. Our study sheds light on this aspect, showing that inhibiting METTL3 using RNA interference heightens 5-FU sensitivity in CRC HCT-116 and HCT-8 cells, as confirmed by CCK-8, EdU, and colony formation assays. Conversely, overexpressing METTL3 weakened 5-FU sensitivity. Previous studies have indicated METTL3's influence on cell death; its knockdown induces apoptosis in HepG2 cells by modulating P53 signaling[57]. Our research validates that METTL3 knockdown aggravates 5-FU-induced apoptosis in HCT-116 and HCT-8 cells. To gain further insights into METTL3's role in apoptosis, we overexpressed it in these cells, observing a decrease in 5-FU-induced apoptosis. In line with the in vitro findings, We found that METTL3 down-regulation enhanced 5-FU-induced apoptosis and attenuated xenograft tumor volume in a nude mouse model, suggesting METTL3 may protect CRC cells from 5-FU induced apoptosis and regulate the sensitivity of CRC cells to 5-FU treatment in a nude mouse model. However, the potential of METTL3 in anti-apoptosis and chemotherapy resistance may vary in different cell types. For example, elevating METTL3 levels significantly heightened cisplatin sensitivity in SiHa-DDP cells. In SiHa cells, increased METTL3 expression inhibited viability and promoted apoptosis when treated with cisplatin, whereas METTL3 knockdown led to reduced sensitivity to cisplatin[58]. Another study demonstrated that METTL3 knockdown increased sorafenib resistance in hepatocellular carcinoma by eliminating METTL3-mediated FOXO3 mRNA stabilization[26]. This disparity between our findings and previous studies highlights the intricate and diverse role of METTL3 in chemotherapy resistance, warranting further in-depth exploration. The preceding experiments conclusively demonstrate that METTL3 profoundly influences the response of CRC cells to 5-FU treatment. This prompted us to delve into the underlying mechanisms. TRAP1, a key player associated with metastasis and prognosis in colorectal cancers, has been found to induce a multidrug-resistant phenotype in colon carcinoma cells[33,36]. Previous research has underscored the pivotal roles of TRAP1 in regulating apoptosis in CRC, as well as its involvement in modulating chemotherapy sensitivity in various tumor cells[36,59-60]. Costantino et al. discovered that overexpression of TRAP1 led to resistance against 5-FU, oxaliplatin, and irinotecan in colon carcinoma cells[36]. Additionally, elevated levels of TRAP1 were observed in cisplatin-resistant ovarian carcinoma cell lines[57], as well as paclitaxel-resistant breast carcinoma cells[60]. This body of evidence leads us to speculate that METTL3 could regulate 5-FU sensitivity and apoptosis induction by influencing TRAP1 expression in CRC cells. In our study, we observed that altering METTL3 expression led to a corresponding change in TRAP1 expression in both HCT-116 and HCT-8 cells after 5-FU treatment. Furthermore, scrutiny based on TCGA data unveiled a positive correlation between METTL3 and TRAP1 expression in CRC. Most notably, pretreatment with the specific TRAP1 inhibitor G-TPP significantly reduced the protective effect of METTL3 against both 5-FU-induced apoptosis and the cytotoxic effects of 5-FU. Conversely, TRAP1 overexpression counteracted the inhibitory effect induced by METTL3 knockdown post 5-FU treatment. These findings substantiate our hypothesis that METTL3 regulates 5-FU sensitivity and provides protection against 5-FU-induced apoptosis by modulating TRAP1 expression in CRC cells. As a crucial component of the m6A methyltransferase complex, METTL3 primarily regulates tumor progression through its m6A methyltransferase activity. Therefore, We speculate that METTL3 regulates 5-FU sensitivity by modulating TRAP1 expression in an m6A-dependent manner in CRC cells. Initially, we employed the online bioinformatics tool SRAMP to identify potential m6A modification sites on TRAP1. Subsequently, we assessed the total RNA m6A levels in both METTL3-overexpressing HCT-116 and METTL3-downregulated HCT-8 cells after 5-FU treatment. The results demonstrated a substantial rise in total RNA m6A levels following METTL3 up-regulation, but a significant decrease after METTL3 knockdown. Furthermore, MeRIP-qPCR assays provided additional confirmation that METTL3 modulates TRAP1 expression through an m6A-dependent mechanism. These findings reveal a novel post-transcriptional regulator of TRAP1. We then conducted a comprehensive analysis of TRAP1's effects on CRC cells following 5-FU treatment. As expected, the upregulation of TRAP1 mitigated the cytotoxic impact of 5-FU on HCT-116 and HCT-8 cells. Additionally, the utilization of G-TPP led to reduced cell viability and increased apoptotic rates in CRC cells subjected to 5-FU. These outcomes further support that TRAP1 can indeed regulate the sensitivity of CRC cells to 5-FU. Our data are still in agreement with prior reports emphasizing the crucial role of TRAP1 in protecting from apoptosis and inducing chemo-resistance[61]. Recent studies have indicated that TRAP1 is implicated in mitochondrial anti-apoptotic mechanisms[36], which may account for TRAP1-related chemo-resistance. In summary, our study demonstrates the pivotal role of METTL3 in regulating 5-FU sensitivity in CRC cells. This novel mechanism sheds light on 5-FU resistance in CRC, presenting fresh perspectives and targets for future therapeutic approaches and drug development. However, some questions warrant further exploration to comprehensively grasp the role of METTL3 in CRC. Which specific m6A 'reader' proteins recognize the m6A sites in TRAP1 mRNA? What are the downstream mechanisms of TRAP1? There might be other downstream gene or chemo-resistance related signaling pathway regulated by METTL3, which necessitates a thorough transcriptome-wide mapping of N6-methyladenosine through m6A-seq. Additionally, a potent METTL3 inhibitor has recently been introduced[62], exploring its combination with a TRAP1 inhibitor for CRC treatment holds promise for future investigation. Declarations Acknowledgements We thank Dr. Baohong Yuan for her assistance in the preparation of this manuscript. Author contributions Qingjie Kang designed the study and drafted the manuscript; Qingjie Kang and Zhenzhou Chen performed the cell experiments. Xiaolong Liang and Xiaoyu Hu conducted the animal study. Song Xiang performed the statistical analysis. Ziwei Wang designed the study and revised the manuscript. All authors read and gave final approval to the manuscript. Funding This work was supported by the National Natural Science Foundation of China (81974385). Data availability The data that support the findings of this study are available upon reasonable request from the corresponding author. Conflict of interest The authors declared no conflict of interest in this study. Ethical Approval All animal-related procedures were approved by the Ethics Committee of The First Affiliated Hospital of Chongqing Medical University. References Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71:209-249.https://doi.org/10.3322/caac.21660. Siegel RL, Wagle NS, Cercek A, Smith RA, Jemal A (2023) Colorectal cancer statistics, 2023. CA Cancer J Clin 73:233-254.https://doi.org/10.3322/caac.21772. A. Hadjipetrou, D. Anyfantakis, C.G. Galanakis, M. Kastanakis, S (2017) Colorectal cancer, screening and primary care: a mini literature review. World J Gastroenterol. 23:6049-6058.https://doi.org/10.3748/wjg.v23.i33.6049 Bhandari A, Woodhouse M, Gupta S(2017) Colorectal cancer is a leading cause of cancer incidence and mortality among adults younger than 50 years in the USA: a SEER-based analysis with comparison to other young-onset cancers.J Investig Med. 65:311-315.https://doi.org/10.1136/jim-2016-000229 C. Franzese, T. Comito, E. Toska, A. Tozzi, E. Clerici, F. De Rose, D. Franceschini, P. Navarria, G. Reggiori, S. Tomatis, et al (2019) Predictive factors for survival of oligometastatic colorectal cancer treated with Stereotactic body radiation therapy. Radiother. Oncol. 133:220-226. https://doi.org/10.1016/j.radonc.2018.10.024. S. Advani, S. Kopetz (2019) Ongoing and future directions in the management of metastatic colorectal cancer: update on clinical trials. J. Surg. Oncol. 119:642–652.https://doi.org/10.1002/jso.25441. Xie YH, Chen YX and Fang JY (2020) Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Target Ther .5:22. https://doi.org/10.1038/s41392-020-0116-z. Hammond WA, Swaika A, and Mody K (2016) Pharmacologic resistance in colorectal cancer: a review. Ther Adv Med Oncol. 8:57-84. https://doi.org/10.1177/1758834015614530. Dai W, Gao Q, Qiu J, Yuan J, Wu G, Shen G (2015) Quercetin induces apoptosis and enhances 5-FU therapeutic efficacy in hepatocellular carcinoma. Tumour Biol. 37:6307-13. https://doi.org/10.1007/s13277-015-4501-0. Vodenkova S, Buchler T, Cervena K, Veskrnova V, Vodicka P, and Vymetalkova V (2020) 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future. Pharmacol Ther. 206:107447. https://doi.org/10.1016/j.pharmthera.2019.107447. Alasar AA, Tüncel Ö, Gelmez AB, Sağlam B, Vatansever İE, Akgül B (2022) Genomewide m6A Mapping Uncovers Dynamic Changes in the m6A Epitranscriptome of Cisplatin-Treated Apoptotic HeLa Cells. Cells. 11:3905. https://doi.org/10.3390/cells11233905. Sethy C, Kundu CN (2021) 5-Fluorouracil (5-FU) resistance and the new strategy to enhance the sensitivity against cancer: Implication of DNA repair inhibition. Biomed Pharmacother. 137:111285. https://doi.org/10.1016/j.biopha.2021.111285. Skarkova V, Kralova V, Vitovcova B, Rudolf E (2019) Selected Aspects of Chemoresistance Mechanisms in Colorectal Carcinoma-A Focus on Epithelial-to-Mesenchymal Transition, Autophagy, and Apoptosis. Cells. 8:234. https://doi.org/10.3390/cells8030234. Zhang L, Yu J (2013) Role of apoptosis in colon cancer biology, therapy, and prevention. Curr Colorectal Cancer Rep. 9:10. https://doi.org/10.1007/s11888-013-0188-z. Min KW, Zealy RW, Davila S, Fomin M, Cummings JC, Makowsky D, Mcdowell CH, Thigpen H, Hafner M, Kwon SH, et al (2018) Profiling of m6A RNA modifications identified an age-associated regulation of AGO2 mRNA stability. Aging Cell. 17:e12753. https://doi.org/10.1111/acel.12753. Ma S, Chen C, Ji X, Liu J, Zhou Q, Wang G, Yuan W, Kan Q, Sun Z (2019) The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 12:121. https://doi.org/10.1186/s13045-019-0805-7. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, et al (2014) N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 505:117-20. https://doi.org/10.1038/nature12730. Roundtree IA, Evans ME, Pan T, He C (2017) Dynamic RNA Modifications in Gene Expression Regulation. Cell. 169:1187-1200. https://doi.org/10.1016/j.cell.2017.05.045. Fustin JM, Kojima R, Itoh K, Chang HY, Ye S, Zhuang B, Oji A, Gibo S, Narasimamurthy R, Virshup D, et al. (2018) Two Ck1δ transcripts regulated by m6A methylation code for two antagonistic kinases in the control of the circadian clock. Proc Natl Acad Sci U S A.115:5980-5985. https://doi.org/10.1073/pnas.1721371115. Barbieri I, Tzelepis K, Pandolfini L, Shi J, Millán-Zambrano G, Robson SC, Aspris D, Migliori V, Bannister AJ, Han N, et al (2017) Promoter-bound METTL3 maintains myeloid leukaemia by m6A-dependent translation control. Nature. 552:126-131. https://doi.org/10.1038/nature24678. Zheng W, Dong X, Zhao Y, Wang S, Jiang H, Zhang M, Zheng X, Gu M (2019) Multiple Functions and Mechanisms Underlying the Role of METTL3 in Human Cancers. Front Oncol. 9:1403. https://doi.org/10.3389/fonc.2019.01403. Xiang M, Liu W, Tian W, You A, Deng D (2020).RNA N-6-methyladenosine enzymes and resistance of cancer cells to chemotherapy and radiotherapy. Epigenomics. 12:801-809. https://doi.org/10.2217/epi-2019-0358. Vu LP, Pickering BF, Cheng Y, Zaccara S, Nguyen D, Minuesa G, Chou T, Chow A, Saletore Y, MacKay M,et al(2017) The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 23:1369-1376. https://doi.org/10.1038/nm.4416. Wang H, Xu B, Shi J (2019) N6-methyladenosine METTL3 promotes the breast cancer progression via targeting Bcl-2. Gene. 722:144076. https://doi.org/10.1016/j.gene.2019. Sun Y, Shen W, Hu S, Lyu Q, Wang Q, Wei T, Zhu W, Zhang J (2023) METTL3 promotes chemoresistance in small cell lung cancer by inducing mitophagy. J Exp Clin Cancer Res. 42:65. https://doi.org/10.1186/s13046-023-02638-9. Lin Z, Niu Y, Wan A, Chen D, Liang H, Chen X, Sun L, Zhan S, Chen L, Cheng C, et al (2020) RNA m6 A methylation regulates sorafenib resistance in liver cancer through FOXO3-mediated autophagy. EMBO J.39:e103181. https://doi.org/10.15252/embj.2019103181. Taketo K, Konno M, Asai A, Koseki J, Toratani M, Satoh T, Doki Y, Mori M, Ishii H, Ogawa K (2018) The epitranscriptome m6A writer METTL3 promotes chemo- and radioresistance in pancreatic cancer cells. Int J Oncol. 52:621-629. https://doi.org/ 10.3892/ijo.2017.4219. Song HY, Dunbar JD, Zhang YX, Guo D, Donner DB (1995) Identification of a protein with homology to hsp90 that binds the type 1 tumor necrosis factor receptor. J Biol Chem. 270:3574-81.https://doi.org/10.1074/jbc.270.8.3574 Felts SJ, Owen BA, Nguyen P, Trepel J, Donner DB, Toft DO (2000) The hsp90-related protein TRAP1 is a mitochondrial protein with distinct functional properties. J Biol Chem. 275:3305-12. https://doi.org/10.1074/jbc.275.5.3305. Masgras I, Sanchez-Martin C, Colombo G, Rasola A (2017) The Chaperone TRAP1 As a Modulator of the Mitochondrial Adaptations in Cancer Cells. Front Oncol. 7:58. https://doi.org/10.3389/fonc.2017.00058. Matassa DS, Amoroso MR, Maddalena F, Landriscina M, Esposito F (2012) New insights into TRAP1 pathway. Am J Cancer Res. 2:235-48. Chen R, Pan S, Lai K, Lai LA, Crispin DA, Bronner MP, Brentnall TA (2014) Up-regulation of mitochondrial chaperone TRAP1 in ulcerative colitis associated colorectal cancer. World J Gastroenterol. 20:17037-48. https://doi.org/10.3748/wjg.v20.i45.17037. Pak MG, Koh HJ, Roh MS (2017) Clinicopathologic significance of TRAP1 expression in colorectal cancer: a large scale study of human colorectal adenocarcinoma tissues. Diagn Pathol. 12:6. https://doi.org/10.1186/s13000-017-0598-3. Leav I, Plescia J, Goel HL, Li J, Jiang Z, Cohen RJ, Languino LR, Altieri DC (2010) Cytoprotective mitochondrial chaperone TRAP-1 as a novel molecular target in localized and metastatic prostate cancer. Am J Pathol. 176:393-401. https://doi.org/10.2353/ajpath.2010.090521. Montesano Gesualdi N, Chirico G, Pirozzi G, Costantino E, Landriscina M, Esposito F (2007) Tumor necrosis factor-associated protein 1 (TRAP-1) protects cells from oxidative stress and apoptosis. Stress. 10:342-350. https://doi.org/10.1080/10253890701314863. Costantino E, Maddalena F, Calise S, Piscazzi A, Tirino V, Fersini A, Ambrosi A, Neri V, Esposito F, Landriscina M (2009) TRAP1, a novel mitochondrial chaperone responsible for multi-drug resistance and protection from apoptotis in human colorectal carcinoma cells. Cancer Lett.279:39-46. https://doi.org/10.1016/j.canlet.2009.01.018. Yu J, Li Y, Wang T, Zhong X (2018).Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLoS One. 13:e0198604. https://doi.org/10.1371/journal.pone.0198604. Xiang S, Wang Y, Lei D, Luo Y, Peng D, Zong K, Liu Y, Huang Z, Mo S, Pu X, et al (2023) Donor graft METTL3 gene transfer ameliorates rat liver transplantation ischemia-reperfusion injury by enhancing HO-1 expression in an m6A-dependent manner. Clin Immunol. 251:109325.https://doi.org/10.1016/j.clim.2023.109325. Li Y, Xiao J, Bai J, Tian Y, Qu Y, Chen X, Wang Q, Li X, Zhang Y, Xu J (2019) Molecular characterization and clinical relevance of m6A regulators across 33 cancer types. 18:137. https://doi.org/10.1186/s12943-019-1066-3. Tsai HY, Bronner MP, March JK, Valentine JF, Shroyer NF, Lai LA, Brentnall TA, Pan S, Chen R (2022) Metabolic targeting of NRF2 potentiates the efficacy of the TRAP1 inhibitor G-TPP through reduction of ROS detoxification in colorectal cancer. Cancer Lett. 549:215915. https://doi.org/10.1016/j.canlet.2022.215915. Xiang S, Liang X, Yin S, Liu J, Xiang Z (2020) N6-methyladenosine methyltransferase METTL3 promotes colorectal cancer cell proliferation through enhancing MYC expression. Am J Transl Res. 12:1789-1806. Onyoh EF, Hsu WF, Chang LC, Lee YC, Wu MS, Chiu HM (2019) The Rise of Colorectal Cancer in Asia: Epidemiology, Screening, and Management. Curr Gastroenterol Rep.21:36. https://doi.org/10.1007/s11894-019-0703-8. Siegel RL, Jakubowski CD, Fedewa SA, Davis A, Azad NS (2020) Colorectal Cancer in the Young: Epidemiology, Prevention, Management. Am Soc Clin Oncol Educ Book. 40:1-14.https://doi.org/10.1200/EDBK_279901. Chang CK, Chiu PF, Yang HY, Juang YP, Lai YH, Lin TS, Hsu LC, Yu LC, Liang PH (2021) Targeting Colorectal Cancer with Conjugates of a Glucose Transporter Inhibitor and 5-Fluorouracil. J Med Chem. 64:4450-4461. https://doi.org/10.1021/acs.jmedchem.0c00897. Xie T, Geng J, Wang Y, Wang L, Huang M, Chen J, Zhang K, Xue L, Liu X, Mao X, et al (2017) FOXM1 evokes 5-fluorouracil resistance in colorectal cancer depending on ABCC10. Oncotarget.8:8574-8589. https://doi.org/10.18632/oncotarget.14351. Baguley BC (2010) Multidrug resistance in cancer. Methods Mol Biol. 596:1-14. https://doi.org/10.1007/s12033-010-9321-2. Bukowski K, Kciuk M, Kontek R (2020) Mechanisms of Multidrug Resistance in Cancer Chemotherapy. Int J Mol Sci. 21:3233.https://doi.org/10.3390/ijms21093233. Chen CJ, Huang JY, Huang JQ, Deng JY, Shangguan XH, Chen AZ, Chen LT, Wu WH (2023) Metformin attenuates multiple myeloma cell proliferation and encourages apoptosis by suppressing METTL3-mediated m6A methylation of THRAP3, RBM25, and USP4. Cell Cycle. 22:986-1004. https://doi.org/10.1080/15384101.2023.2170521. Liu S, Zhuo L, Wang J, Zhang Q, Li Q, Li G, Yan L, Jin T, Pan T, Sui X, et al (2020) METTL3 plays multiple functions in biological processes. Am J Cancer Res. 10:1631-1646. Deng X, Su R, Weng H, Huang H, Li Z and Chen J (2018) RNA N(6)-methyladenosine modification in cancers: current status and perspectives. Cell Res. 28:507-517. https://doi.org/10.1038/s41422-018-0034-6. Zeng C, Huang W, Li Y, Weng H (2020) Roles of METTL3 in cancer: mechanisms and therapeutic targeting. J Hematol Oncol. 13:117. https://doi.org/10.1186/s13045-020-00951-w. Xu J, Chen Q, Tian K, Liang R, Chen T, Gong A, Mathy NW, Yu T, Chen X (2020) m6A methyltransferase METTL3 maintains colon cancer tumorigenicity by suppressing SOCS2 to promote cell proliferation. Oncol Rep. 44:973-986. https://doi.org/10.3892/or.2020.7665. Zhou D, Tang W, Xu Y, Xu Y, Xu B, Fu S, Wang Y, Chen F, Chen Y, Han Y, et al (2021) METTL3/YTHDF2 m6A axis accelerates colorectal carcinogenesis through epigenetically suppressing YPEL5. Mol Oncol. 15:2172-2184. https://doi.org/10.1002/1878-0261.12898. Chen H, Gao S, Liu W, Wong CC, Wu J, Wu J, Liu D, Gou H, Kang W, Zhai J, et al (2021) RNA N6-Methyladenosine Methyltransferase METTL3 Facilitates Colorectal Cancer by Activating the m6A-GLUT1-mTORC1 Axis and Is a Therapeutic Target. Gastroenterology. 160:1284-1300. https://doi.org/10.1053/j.gastro.2020.11.013. Deng R, Cheng Y, Ye S, Zhang J, Huang R, Li P, Liu H, Deng Q, Wu X, Lan P, et al (2019) m6A methyltransferase METTL3 suppresses colorectal cancer proliferation and migration through p38/ERK pathways. Onco Targets Ther. 12:4391-4402. https://doi.org/10.2147/OTT.S201052. Pan X, Hong X, Li S, Meng P, Xiao F (2021) METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. Exp Mol Med. 53:91-102. https://doi.org/10.1038/s12276-020-00510-w. Dominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, et al (2012) Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature.485:201-206. https://doi.org/10.1038/nature11112. Li R, Song Y, Chen X, Chu M, Wang ZW, Zhu X. (2021). METTL3 increases cisplatin chemosensitivity of cervical cancer cells via downregulation of the activity of RAGE. Mol Ther Oncolytics. 22:245-255. doi: 10.1016/j.omto.2021.05.013. Landriscina M, Amoroso MR, Piscazzi A, Esposito F (2010) Heat shock proteins, cell survival and drug resistance: the mitochondrial chaperone TRAP1, a potential novel target for ovarian cancer therapy. Gynecol Oncol. 117:177-82. https://doi.org/10.1016/j.ygyno.2009.10.078. Maddalena F, Sisinni L, Lettini G, Condelli V, Matassa DS, Piscazzi A, Amoroso MR, La Torre G, Esposito F, Landriscina M (2013) Resistance to paclitxel in breast carcinoma cells requires a quality control of mitochondrial antiapoptotic proteins by TRAP1. Mol Oncol. 7:895-906. https://doi.org/10.1016/j.molonc.2013.04.009. Agorreta J, Hu J, Liu D, Delia D, Turley H, Ferguson DJ, Iborra F, Pajares MJ, Larrayoz M, Zudaire I, et al (2014) TRAP1 regulates proliferation, mitochondrial function, and has prognostic significance in NSCLC. Mol Cancer Res. 12:660-669.https://doi.org/10.1158/1541-7786. Bhattarai PY, Kim G, Poudel M, Lim SC, Choi HS (2021) METTL3 induces PLX4032 resistance in melanoma by promoting m6A-dependent EGFR translation. Cancer Lett.522:44-56. https://doi.org/10.1016/j.canlet.2021.09.015. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 17 Sep, 2024 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted Editorial decision: Revision requested 07 Mar, 2024 Reviews received at journal 20 Feb, 2024 Reviewers agreed at journal 18 Feb, 2024 Reviewers agreed at journal 05 Feb, 2024 Reviewers invited by journal 03 Feb, 2024 Editor assigned by journal 26 Jan, 2024 Submission checks completed at journal 11 Jan, 2024 First submitted to journal 11 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3853872","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":266591324,"identity":"10e25a98-bf90-4b9b-b32f-306f2c5694d9","order_by":0,"name":"Qingjie Kang","email":"","orcid":"","institution":"The First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qingjie","middleName":"","lastName":"Kang","suffix":""},{"id":266591325,"identity":"8f8c4ba5-f42b-4bba-89e6-594c4f9a9a7e","order_by":1,"name":"Xiaoyu Hu","email":"","orcid":"","institution":"Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"Hu","suffix":""},{"id":266591326,"identity":"474c7606-70db-4bdc-be72-2eb5f4b7688c","order_by":2,"name":"Zhenzhou Chen","email":"","orcid":"","institution":"The First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhenzhou","middleName":"","lastName":"Chen","suffix":""},{"id":266591327,"identity":"762350b5-1687-4779-86ba-cd2890df5a46","order_by":3,"name":"Xiaolong Liang","email":"","orcid":"","institution":"The First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaolong","middleName":"","lastName":"Liang","suffix":""},{"id":266591328,"identity":"87b794c4-9697-4f1c-bc3a-a987c170a9be","order_by":4,"name":"Song Xiang","email":"","orcid":"","institution":"The First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Song","middleName":"","lastName":"Xiang","suffix":""},{"id":266591329,"identity":"82df01f8-f207-4832-996f-ab1425e34901","order_by":5,"name":"Ziwei Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYNACAwYGNjCjQkJOnkQtZyyMDRtIso2xrSKR4QAh84+fPfzyR8FhOT72w1s3886TSGBsYH746AY+LWfy0iwkDA4bs/Gkld3m3SaRx87AZmycg0eL2YEcMwMDg9uJbRI8ZiAtxYwNPGzSeLWcf2NmkGBwux6iZY5EYsMBQlpu5Bg/OGBwO4ENrKWBCC32N96YMTYY/DdsA/rl5pxjEsaGzQT8ItmfY/zxx580efn2w9tuvKmpk5Nnb374GJ8WIGCTgDIMIBQzfuVgJR9QtYyCUTAKRsEoQAMAJCxJlzFjtQcAAAAASUVORK5CYII=","orcid":"","institution":"The First Affiliated Hospital of Chongqing Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Ziwei","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-01-11 15:05:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3853872/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3853872/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11010-024-05116-8","type":"published","date":"2024-09-17T15:57:57+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49616647,"identity":"c573cc53-4de4-444e-9cb8-7f92fbbcb21d","added_by":"auto","created_at":"2024-01-15 10:42:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3820107,"visible":true,"origin":"","legend":"\u003cp\u003e5-FU induces cell apoptosis and down-regulates METTL3 expression in CRC cells. \u003cstrong\u003e(A)\u003c/strong\u003e CRC cell lines HCT-116 and HCT-8 were treated with 5-FU at various concentrations (0, 2, 4, and 8µM) for 24 h, and then cell apoptosis was assessed using Flow cytometry \u003cstrong\u003e(A)\u003c/strong\u003e and TUNEL assay \u003cstrong\u003e(C-F).\u003c/strong\u003e Scale bar:50µm. \u003cstrong\u003e(B)\u003c/strong\u003e The heatmap of m6A-related genes in HCT-8 cells after 24 and 48 hours of 5-FU treatment from GEO datasets(GSE81005). The different colors represent the trend of gene expression in different samples. \u003cstrong\u003e(G-J) \u003c/strong\u003eWestern blot was applied to determine the levels of Bcl-2, Bax and Cleaved caspase-3 protein in HCT-116 and HCT-8 cells after 5-FU treatment at various concentrations (0, 2, 4, and 8µM) for 24 h. \u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01,***P\u0026lt;0.001\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.1.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/830829a4280211c2c96b6f1b.png"},{"id":49616881,"identity":"9e2b5efa-168f-4df5-abed-52a49a1372c0","added_by":"auto","created_at":"2024-01-15 10:50:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3214821,"visible":true,"origin":"","legend":"\u003cp\u003eMETTL3 downregulation enhances the sensitivity of CRC cells to 5-FU treatment and facilitates 5-FU-induced apoptosis.\u003cstrong\u003e \u003c/strong\u003eTwo shRNAs targeting METTL3 (shMETTL3-1 and shMETTL3-2) were designed to knock down the expression of METTL3. Knockdown efficiency was confirmed by Western blot \u003cstrong\u003e(A, B) \u003c/strong\u003eand QRT-PCR \u003cstrong\u003e(C)\u003c/strong\u003e.Cell viability \u003cstrong\u003e(D) \u003c/strong\u003eand IC50 value \u003cstrong\u003e(E)\u003c/strong\u003e were tested using CCK-8 assay. Colony formation assay \u003cstrong\u003e(F-H)\u003c/strong\u003e and EdU immunofluorescence staining \u003cstrong\u003e(I-K) \u003c/strong\u003ewere conducted to evaluate the cell proliferation of HCT-116 and HCT-8 cells in different groups with or without 5-FU treatment. Scale bar:50µm. \u003cstrong\u003e(L)\u003c/strong\u003e Effects of METTL3 knockdown on HCT-116 and HCT-8 cell apoptosis after 5-FU treatment were assessed via flow cytometry. \u003cstrong\u003e(M-O)\u003c/strong\u003e Western blot was applied to evaluate the effect of METTL3 knockdown on the protein expression of Bcl-2, Bax and Cleaved caspase-3 in HCT-116 and HCT-8 cells after 5-FU treatment.\u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.2.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/045b560559e7ef428a40e72f.png"},{"id":49616653,"identity":"49568340-2d39-4127-8192-214f12a396a4","added_by":"auto","created_at":"2024-01-15 10:42:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3099991,"visible":true,"origin":"","legend":"\u003cp\u003eMETTL3 overexpression mitigates the inhibitory effect of 5-FU on the viability of CRC cells and enhances its protective role in apoptosis. Overexpression of METTL3 in HCT-116 and HCT-8 cells was achieved by the lentiviral vector pCDH plasmid. Overexpression efficiency was confirmed by Western blot \u003cstrong\u003e(A,B) \u003c/strong\u003eand QRT-PCR \u003cstrong\u003e(C)\u003c/strong\u003e. CCK-8 assay was used to test cell viability\u003cstrong\u003e (D)\u003c/strong\u003e and IC50 value \u003cstrong\u003e(E)\u003c/strong\u003ein HCT-116 and HCT-8 cells post 5-FU treatment. Colony formation assay \u003cstrong\u003e(F, H-I)\u003c/strong\u003e and EdU immunofluorescence staining \u003cstrong\u003e(J-L)\u003c/strong\u003e were conducted to evaluate the cell proliferation of HCT-116 and HCT-8 cells following METTL3 overexpression with or without 5-FU treatment. scale bar,50µm. \u003cstrong\u003e(G)\u003c/strong\u003eEffects of METTL3 overexpression on HCT-116 and HCT-8 cell apoptosis after 5-FU treatment assessed via flow cytometry. \u003cstrong\u003e(M-O)\u003c/strong\u003e Western blot analysis was employed to assess the impact of METTL3 overexpression on the protein expression of Bcl-2, Bax, and Cleaved caspase-3 in HCT-116 and HCT-8 cells following 5-FU treatment.\u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01,***P\u0026lt;0.001.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.3.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/eb54c623beac6a204ead4296.png"},{"id":49616650,"identity":"c34122a3-3038-4ced-808b-f8d88e97fe69","added_by":"auto","created_at":"2024-01-15 10:42:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2781803,"visible":true,"origin":"","legend":"\u003cp\u003eMETTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression in an m6A-dependent manner. \u003cstrong\u003e(A-C) \u003c/strong\u003eAnalyze the correlations between METTL3, TRAP1, and the apoptosis-related pathway score in the TCGA dataset using Spearman correlation\u003cstrong\u003e.\u003c/strong\u003e The x-axis and y-axis represent the expression distribution of the gene or the pathway score. The density curve illustrates the trend in the distribution of the corresponding genes or the pathway score. The values at the top indicate the correlation p-value, correlation coefficient, and the method used for the correlation calculation. \u003cstrong\u003e(D)\u003c/strong\u003em6A ELISA assays were utilized to determine the RNA m6A levels in HCT-116 METTL3-overexpression and HCT-8 METTL3-knockdown cells following 5-FU treatment. Western blot \u003cstrong\u003e(E,R-S)\u003c/strong\u003eand QRT-PCR\u003cstrong\u003e (T-U) \u003c/strong\u003ewere employed to assess the impact of METTL3 knockdown and overexpression on TRAP1 expression in HCT-116 and HCT-8 cells. Flow cytometry \u003cstrong\u003e(F)\u003c/strong\u003e and EdU immunofluorescence staining \u003cstrong\u003e(H)\u003c/strong\u003e assessed the impact of G-TPP (TRAP1 inhibitor) on apoptosis and proliferation in HCT-116 METTL3-overexpression cells after 5-FU treatment. Scale bar:50µm. Flow cytometry\u003cstrong\u003e (G)\u003c/strong\u003e and EdU immunofluorescence staining \u003cstrong\u003e(I) \u003c/strong\u003ewere used to evaluate the effects of TRAP1 overexpression on apoptosis and proliferation in HCT-8 METTL3-knockdown cells post-5-FU treatment. scale bar,50µm. \u003cstrong\u003e(J,M) \u003c/strong\u003eWestern blot was employed to assess the impact of G-TPP intervention on the protein expression of Bcl-2, Bax, and Cleaved caspase-3 in HCT-116 METTL3-overexpression cells after 5-FU treatment. \u003cstrong\u003e(K,N) \u003c/strong\u003eWestern blot was applied to evaluate the effect of TRAP1 overexpression on the protein expression of Bcl-2, Bax, and Cleaved caspase-3 in HCT-8 METTL3-knockdown cells after 5-FU treatment.\u003cstrong\u003e (L-O) \u003c/strong\u003em6A binding sites on the mRNA of TRAP1 and m6A peak profiles were predicted by online bioinformatics tools (http://www.cuilab.cn/sramp).The gene-specific m6A modification level of TRAP1 in HCT-116 METTL3-overexpression \u003cstrong\u003e(P)\u003c/strong\u003eand HCT-8 METTL3-knockdown cells \u003cstrong\u003e(Q) \u003c/strong\u003efollowing 5-FU treatment was determined using MeRIP-qPCR\u003cem\u003e.*P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.4.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/bfa81bab6008edf95e3a3744.png"},{"id":49617172,"identity":"d7f80d83-22eb-497d-9b39-38521fcdc49a","added_by":"auto","created_at":"2024-01-15 10:58:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3049729,"visible":true,"origin":"","legend":"\u003cp\u003eTRAP1 overexpression attenuates chemotherapeutic sensitivity of 5-FU in CRC cells. TRAP1 overexpression in HCT-116 and HCT-8 cells was achieved using the pcDNA3.1 plasmid. The efficiency of overexpression was validated through Western blot and QRT-PCR analyses \u003cstrong\u003e(A,B) \u003c/strong\u003e. Cell viability\u003cstrong\u003e (C)\u003c/strong\u003e and determination of IC50 value\u003cstrong\u003e(D)\u003c/strong\u003e in HCT-116 TRAP1-overexpression and HCT-8 TRAP1-overexpression cells after 5-FU treatment were assessed using the CCK-8 assay. Colony formation assay \u003cstrong\u003e(E, G-H)\u003c/strong\u003e and EdU immunofluorescence staining \u003cstrong\u003e(F,I-J)\u003c/strong\u003e were performed to evaluate the cell proliferation of HCT-116 TRAP1-overexpressing and HCT-8 TRAP1-overexpressing cells with or without 5-FU treatment. Scale bar:50µm. Flow cytometry was conducted to assess the cell apoptosis of HCT-116 TRAP1-overexpressing \u003cstrong\u003e(K)\u003c/strong\u003e and HCT-8 TRAP1-overexpressing \u003cstrong\u003e(L) \u003c/strong\u003ecells following 5-FU treatment. \u003cstrong\u003e(M-O)\u003c/strong\u003eWestern blot analysis was employed to assess the impact of TRAP1 overexpression on the protein expression of Bcl-2, Bax, and Cleaved caspase-3 in HCT-116 and HCT-8 cells following 5-FU treatment.\u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01,***P\u0026lt;0.001\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.5.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/9ee81c4f2e3e44c0711c110e.png"},{"id":49616884,"identity":"ba8e24fe-f4d0-4257-bf0c-031e1f8e0239","added_by":"auto","created_at":"2024-01-15 10:50:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6563721,"visible":true,"origin":"","legend":"\u003cp\u003eMETTL3 knockdown enhances 5-FU sensitivity of CRC cells and diminishes tumor growth in vivo. HCT-116 cells stably transfected with shMETTL3-1 were delivered into mice with or without the treatment of 5-FU. \u003cstrong\u003e(A) \u003c/strong\u003eRepresentative images of xenograft tumors from different groups. \u003cstrong\u003e(B,C) \u003c/strong\u003eTumor volume and weight of different groups. \u003cstrong\u003e(D) \u003c/strong\u003eTUNEL staining, along with immunostaining for Ki-67, METTL3, and TRAP1 in xenograft tumor sections from various experimental groups. Scale bar:50µm. \u003cstrong\u003e(E) \u003c/strong\u003eProtein level analysis of METTL3, TRAP1, Bcl-2 and Bax in xenograft tumors from different experimental groups. \u003cem\u003e*P\u0026lt;0.05, **P\u0026lt;0.01,***P\u0026lt;0.001.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure.6.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/b1a6a5927fd8ed94067dde00.png"},{"id":49617171,"identity":"f7237162-0a96-41f9-9fcb-f4e6f72cad2d","added_by":"auto","created_at":"2024-01-15 10:58:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":479573,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProposed working model of METTL3 regulating 5-FU sensitivity and apoptosis induction in CRC cells. METTL3 is frequently upregulated in CRC cells and is mainly localized in the nucleus of tumor cells[41]. METTL3 downregulation decreases the m6A modification level on TRAP1 mRNA in CRC cells, which further diminishes TRAP1 mRNA stability, finally resulting in increased sensitivity of CRC cells to 5-FU treatment and promoting 5-FU-induced apoptosis.\u003c/p\u003e","description":"","filename":"Figure.7.png","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/2b1f3a2f9ded01a74ab2f24f.png"},{"id":65104140,"identity":"40bbd676-2e35-4d64-8da2-f09710514939","added_by":"auto","created_at":"2024-09-23 16:12:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":27228035,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3853872/v1/dba05069-86c6-40a8-a383-9a6ee8424a97.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The METTL3/TRAP1 Axis as a Key Regulator of 5-Fluorouracil Chemosensitivity in Colorectal Cancer","fulltext":[{"header":"Introduction","content":"\u003cp\u003eColorectal cancer (CRC) stands out as one of the most prevalent malignancies worldwide. According to the 2020 Chinese Cancer Statistics Report, China witnessed the second-highest incidence and fifth-highest mortality rates for colorectal cancer among all malignancies[1]. Additionally, the American Colorectal Cancer Statistics report reveals that CRC holds the third position in both the diagnosis frequency and cancer-related mortality for both men and women in the United States[2]. Despite the remarkable progress in surgical procedures, radiochemotherapy, and targeted therapies, \u0026nbsp;all of which have significantly bolstered survival rates for colon cancer patients[3], the survival rates for late-stage disease remain unsatisfactory[4-6]. Drug resistance emerges as a major impediment in late-stage CRC treatment. Hence, gaining insights into the molecular mechanisms of drug resistance is imperative for enhancing the prognosis of CRC.\u003c/p\u003e\n\u003cp\u003e5-Fluorouracil (5-FU) stands at the forefront of chemotherapeutic agents for treating advanced and metastatic CRC[7]. Patients with advanced CRC typically undergo a sequential administration of fluoropyrimidines-based regimens as part of systemic palliative care, leading to an extended survival period of about 20 months[8]. The cytotoxic effects of 5-FU on cancer cells primarily involve inhibiting thymidylate synthase, inducing DNA lesions through base mismatch, and, in certain instances, directly triggering apoptosis[9-10]. Apoptosis, characterized as programmed cell death, is a prime target of various chemotherapeutic drugs[11]. Despite the numerous merits of 5-FU in cancer management, a significant hurdle in its clinical application is the emergence of chemotherapeutic drug resistance in CRC. This resistance is believed to stem from factors such as hindered drug uptake, alterations in targets, enhanced DNA damage repair capability, and a developed resistance to apoptosis[12]. In CRC, an important mechanism contributing to 5-FU resistance revolves around acquiring the ability to evade apoptosis[13-14]. Hence, comprehending the molecular mechanism of 5-FU-induced apoptosis is crucial for devising more effective strategies against drug resistance.\u003c/p\u003e\n\u003cp\u003eM6A methylation, a prevalent RNA modification, was first discovered and comprehensively studied in the 1970s[15-16]. This modification intricately influences gene expression by overseeing alternative splicing, enhancing translation efficiency, and bolstering mRNA stability[17]. The m6A modification process is orchestrated by various regulators including methyltransferase complexes (often referred to as \u0026quot;writers\u0026quot;), demethylases (\u0026quot;erasers\u0026quot;), and RNA-binding proteins (\u0026quot;readers\u0026quot;)[18]. Methyltransferase-like3 (METTL3), as a significant member of m6A \u0026quot;writers,\u0026quot; not only impacts physiological functions like tissue development and circadian clock regulation but also plays a role in tumorigenesis[19-20]. Recent studies have illuminated its dysregulation in diverse cancers, including lung, breast, acute myeloid leukemia, glioma, and colorectal cancer[21]. This dysregulation influences a spectrum of pivotal biological processes in cancer cells, encompassing cellular transformation, proliferation, invasion, metastasis, and the renewal of cancer stem cells. A particularly compelling revelation is the emerging understanding that METTL3-mediated m6A modification regulates the translation and stability of mRNAs encoding proteins vital in apoptosis, autophagy, and DNA repair[20]. This intricate regulatory network contributes significantly to the development of chemoresistance across diverse cancer types[22]. For instance, METTL3 depletion prompts heightened apoptosis rates, achieved by reducing the translation of MYC, BCL2, and PTEN in leukemia cells[23], or by suppressing BCL-2 translation in breast cancer cells[24]. Moreover, METTL3 has been implicated in conferring resistance to cisplatin in lung cancer[25], sorafenib resistance in liver cancer[26], and resistance to gemcitabine, 5-fluorouracil, and cisplatin in pancreatic cancer[27]. Despite the significant progress made in comprehending the involvement of METTL3-m6A modification in the advancement of malignant cancers and the development of chemoresistance, the specific contributions of METTL3 in 5-FU resistance, as well as 5-FU-triggered apoptosis in CRC, and its subsequent downstream targets, remain incompletely elucidated.\u003c/p\u003e\n\u003cp\u003eTumor necrosis factor (TNF) receptor associated protein 1 (TRAP1) , a mitochondrial protein, is a member of the Hsp90 family. Initially identified for its interaction with the intracellular domain of type I TNF receptor[28], it was later recognized as Hsp75[29] and found to play a role in processes such as mitochondrial bioenergy regulation, response to oxidative stress, apoptosis, and inflammation[30-31]. TRAP1 typically maintains low expression in normal tissue; however, its expression becomes dysregulated in various cancers, including colorectal carcinomas[32-33]. Elevated TRAP1 levels have been linked to reduced disease-specific survival in colorectal cancer[33]. Throughout tumor progression, TRAP1 assumes a vital role in protecting cancer cells by diminishing the production of reactive oxygen species (ROS)[30]. Moreover, it has been proposed that TRAP1 might also play a role in chemo-resistance, potentially obstructing drug-induced apoptosis in various tumors, including prostate cancer[34], osteosarcoma[35] and colorectal cancer[36]. In the case of CRC cells, lab studies indicate that increased TRAP1 levels lead to resistance against oxaliplatin, irinotecan, and 5-FU[36]. However, the precise regulatory mechanisms of TRAP1 in the context of 5-FU resistance in CRC cells remain unclear. Recent research has highlighted the vital role of m6A modification in governing the heat shock response. Knockdown of METTL3 has been shown to alter the methylation patterns of HSPs transcripts[37]. Whether METTL3-mediated m6A modification directly impacts the expression of TRAP1 in CRC remains unclear. Therefore, this study aims to uncover the role and mechanism of METTL3 in regulating 5-FU sensitivity in CRC cells, particularly investigating whether METTL3 contributes to modulate 5-FU-induced apoptosis and whether this mechanism involves the regulation of TRAP1 expression.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eCell lines and Culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human CRC HCT-116 and HCT-8 cell lines were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). All the cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) (Gibco, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Procell Biotech, Wuhan, China), 1% penicillin and streptomycin ((Beyotime Biotech, Shanghai, China),and kept in a humidified incubator containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe METTL3-shRNA expression vectors, custom-designed and constructed by TsingKe (Chongqing, China), were integrated into the pGreen-Puro vector provided by GenePharma (Shanghai, China).The target sequences of shRNA are listed as follows:shMETTL3#1:5\u0026apos;‑GCAAGTATGTTCACTATGAAA‑3\u0026apos;,shMETTL3#2: 5\u0026apos;‑GCTGCACTTCAGACGAATTAT‑3\u0026apos;. To achieve METTL3 overexpression, TsingKe synthesized the cDNA sequence containing METTL3 ORF. This sequence was then inserted into the lentiviral vector pCDH-CMV-MCS-EF1-CopGFP-T2A-puro at EcoRI and BamHI sites. HEK-293T cells were seeded 24 hours prior to lentiviral particle production, and the lentiviruses were packaged by transfecting these cells with pGreen-Puro shRNA vectors or overexpression plasmids along with psPAX2 and pMD2.G (Addgene, Cambridge, MA, USA). After 48 or 72 hours, the viral supernatant was harvested and mixed with 5\u0026mu;g/mL of polybrene for subsequent infection of target cells. Then, the infected cells were screened using 1 \u0026micro;g/mL puromycin (Sigma-Aldrich, St. Louis, MO, USA) for 14days.The plasmid encoding human TRAP1 was obtained from TsingKe (Chongqing, China). Transfections were performed using the Lipofectamine 2000 kit (Invitrogen, Carlsbad, CA, USA)according to the manufacturer\u0026apos;s protocol. The efficiency of knockdown and overexpression in stable cell lines was assessed through RT-qPCR and western blot analysis. All cells within each group were collected following a specified incubation period for subsequent experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eColony Formation Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe colony-forming assay was employed to assess cell proliferation in the treated cells. Initially, 500 cells were seeded in 12-well plates and allowed to adhere for 24 hours at 37\u0026deg;C. Subsequently, the cells underwent a 24-hour treatment with 5-Fu. Following the treatment, the medium was replaced with fresh medium without 5-FU, and the cells were cultured for an additional 10 days. After this period, colonies in each well were washed with PBS, fixed with 4% paraformaldehyde for 20 minutes,\u0026nbsp;stained with 0.1% crystal violet for 30 minutes,\u0026nbsp;and subsequently washed with PBS once more. The colonies were photographed, and the number of colonies with more than 50 cells was recorded.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEdU Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe EdU proliferation assay was conducted to further assess cell proliferation. EdU staining was performed using the EdU Apollo DNA In-vitro Kit (RiboBio, Guangzhou, China) according to the manufacturer\u0026apos;s protocol. Briefly, the treated cells (2x10\u003csup\u003e4\u003c/sup\u003e) were seeded and cultured in 96-well plates for 24 hours. After achieving adhesion, cells were exposed to 5-FU for 24 hours. Subsequently, the cells were incubated with 50\u0026micro;M EdU for 2 hours, followed by fixation with 4% paraformaldehyde and permeabilization with 0.5% Triton X-100. They were then stained with the Apollo\u0026reg; reaction cocktail. Finally, Hoechst 33342 was used for nucleic acid staining. \u0026nbsp;The stained cells were observed using a fluorescence microscope (Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDrug Sensitivity Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell sensitivity to 5-FU was assessed using a Cell Counting Kit-8 (CCK-8) kit (MCE, Shanghai, China), following the provided instructions. Initially, cells (5x10\u003csup\u003e4\u003c/sup\u003e) were seeded into 96-well plates and left to incubate at 37\u0026deg;C for 24 hours. Upon achieving adherence, cells were exposed to various concentrations of 5-FU for 24 hours, considering their distinct sensitivities. After treatment, the drug-containing solution was replaced with fresh medium. Then, 10\u0026micro;L/well of CCK-8 solution was added, followed by a 2-hour incubation at 37\u0026deg;C. The optical density (OD) at 450nm was measured using a spectrophotometer (Synergy2, BioTek, USA). The Cell viability rate was calculated using the formula: Cell viability(%) = [(OD450 of the test well\u0026ndash;OD450 of the blank well)/(OD450 of the control well\u0026ndash;OD450 of the blank well)] x 100%. The half-maximal inhibitory concentration (IC50) was calculated using GraphPad Prism 8.0 software.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow Cytometry Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded in 6-well plates and cultured until they reached 90% confluence. After treatment with various concentrations of 5-FU, the cells were collected and washed twice with ice-cold PBS. Subsequently, they were resuspended in ice-cold PBS and promptly sent to the Academy of Life Sciences at Chongqing Medical University (Chongqing, China) for apoptosis detection using flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time quantitative PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was isolated from the cell samples following the precise protocols outlined in the TRIzol reagent kit (Takara, Dalian, China). Subsequently, this RNA underwent reverse transcription using the PrimeScript RT Reagent Kit (Takara, Dalian, China). The subsequent real-time polymerase chain reaction (PCR) was performed with the 2\u0026times;SYBR Green qPCR Master Mix (Bimake, Houston, USA) on the CFX96 Real Time PCR System (Bio-Rad, CA, USA). The results were normalized using the GAPDH reference gene, and data analysis was conducted using the 2-\u0026Delta;\u0026Delta;CT method. All gene-specific primers used in qPCR analysis are listed below:METTL3: forward 5\u0026apos;-GTCCATCTGTCTTGCCATCTC-3\u0026apos; and reverse 5\u0026apos;-GAGACCTCGCTTTACCTCAATC-3\u0026apos;, TRAP1: forward 5\u0026apos;-CAGGGTTCCACTTCCAAACA-3\u0026apos; and reverse 5\u0026apos;-TGGAGATCAGCTCCCGTATAA-3\u0026apos;,GAPDH:5\u0026apos;-CTTTGGTATCGTGGAAGGACTC-3\u0026apos; and reverse 5\u0026apos;-GTAGAGGCAGGGATGATGTTCT-3\u0026apos;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTotal m6A Measurement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total RNA m6A levels were quantified using a colorimetric ELISA assay with the m6A RNA Methylation Quantification Kit (Epigentek, NY, USA) following the provided protocols. Briefly, 200 ng of sample RNA, along with negative and diluted positive controls, were loaded into designated wells using RNA high-binding solution. After incubation at 37\u0026deg;C for 90 minutes, m6A levels were captured and assessed using specific capture and detection antibodies. Subsequently, developer solution was introduced and left to incubate at room temperature for 10 minutes in darkness. Once the positive control reaction liquid turned light blue, 100 \u0026micro;L of stop solution was applied to halt the reaction. The optical density (OD) value at 450 nm was promptly measured using a microplate reader within 10 minutes. The relative abundance of m6A was determined based on the obtained OD value..\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeRIP-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe MeRIP-qPCR procedure closely followed a prior protocol[38]. Initially, total RNA was extracted using the TRIzol reagent kit (Takara, Dalian, China). The isolated mRNAs were enzymatically fragmented into approximately 100-nucleotide segments. These fragmented RNAs then underwent standard precipitation. Subsequently, the RNA was reconstituted in nuclease-free water, with one-tenth of this solution preserved as the Input control and stored at\u0026nbsp;\u0026minus;80\u0026deg;C. The remaining fragmented RNA was then subjected to an incubation process with an anti-m6A antibody (Synaptic Systems, Germany). The resulting mixture was immunoprecipitated using protein A/G magnetic beads (Bimake, USA). After a series of washes, the bound RNA was released from the beads with elution buffer and subsequently precipitated using ethanol. The precipitated RNA was then reconstituted in RNase-free water. Following this, both the immunoprecipitated RNA fragments and the input fragments prepared earlier were reverse-transcribed into cDNA, and then quantified by real-time qPCR. The qPCR primer sequences are provided below: forward 5\u0026apos;-GCAGCACAGAGAGCGTGC-3\u0026apos; and reverse 5\u0026apos;-TTCTGAGTACAGGGACCG-3\u0026apos;. The results were calculated by normalizing to a tenfold input.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe cells were lysed using RIPA lysis buffer (Beyotime, Shanghai, China) supplemented with protease and phosphatase inhibitors (Beyotime, Shanghai, China). After collecting the supernatant, protein concentration was determined using the bicinchoninic acid (BCA) assay (Beyotime, China). Equivalent amounts of protein were loaded onto a 10% SDS-PAGE gel and subsequently transferred to a PVDF membrane. The membranes were then blocked with 5% non-fat milk at room temperature for 1.5 hours, followed by overnight incubation with primary antibodies at 4\u0026deg;C. The primary antibodies used included METTL3 (ab195352, Abcam, 1:1000), Bax (#5023, CST, 1:1000), Bcl-2 (#15071, CST, 1:1000), TRAP1 (10325-1-AP, Proteintech,1:3000),Cleaved caspase-3 (#9664, CST, 1:1000), and \u0026beta;-actin (66009-1-Ig, Proteintech, 1:5000). HRP-conjugated secondary antibodies (SA00001-1 or SA00001-2, Proteintech,1:5000) were applied for protein detection. Bands were visualized using Enhanced Chemiluminescence reagent (Beyotime, China) and quantified using fusion imaging software (EvolutionCapt-v18.02, Vilber, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHematoxylin and Eosin(HE) ,Immunohistochemistry(IHC) and TUNEL Staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe xenografted tumors were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned into 4-\u0026micro;m slices for subsequent experiments. Initially, the paraffin sections were deparaffinized in xylene and then dehydrated in a series of graded ethanol solutions. For H\u0026amp;E staining, the dehydrated sections were stained with Hematoxylin and Eosin, and subsequently photographed under light microscopy (Olympus, Tokyo, Japan). For IHC staining, the sections were subjected to a biotin-streptavidin horseradish peroxidase (HRP) detection kit (ZSGB, Beijing, China) following the provided protocol. After an 8-minute treatment with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e, the sections were blocked with 3% goat serum for 1 hour. They were then incubated with primary antibodies against METTL3 (ab195352, Abcam, 1:200), TRAP1 (10325-1-AP, Proteintech,1:200) and Ki-67 (#9449, CST, 1:400) at 4\u0026deg;C overnight. Following this, they were treated with HRP-conjugated secondary antibodies for 30 minutes at room temperature, visualized using DAB chromogen, and counterstained with hematoxylin. The stained sections were examined at an appropriate magnification using a microscope (Olympus, Tokyo, Japan).Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining of xenograft sections and cell lines was performed using a One-step TUNEL cell apoptosis detection kit (Beyotime, Shanghai, China) according to the manufacturer\u0026apos;s instructions. The stained cells and sections were then photographed under a fluorescence microscope (Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTumor Xenograft Model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFemale BALB/c nude mice (4-6 weeks old) were obtained from the Animal Experimental Laboratory at Chongqing Medical University and housed in a specialized pathogen-free environment. These mice were then randomly assigned to four groups, each consisting of five individuals. Xenograft tumors were established by subcutaneously injecting either shNC or shMETT3-1 HCT-116 cells (5x10\u003csup\u003e6\u003c/sup\u003e cells/mouse) in a total volume of 150\u0026mu;L PBS. Xenograft dimensions were measured every 3 days and calculated using the formula V (mm\u003csup\u003e3\u003c/sup\u003e) = (length\u0026times;width\u003csup\u003e2\u003c/sup\u003e)/2. Once the tumors reached a size of 50 mm\u003csup\u003e3\u003c/sup\u003e, mice were treated with either 5-FU or a Vehicle (PBS) solution. In the 5-FU administration group, 5-FU was administered via intraperitoneal injection at a concentration of 5 mg/kg every three days for a span of 18 days. The control group received 200 \u0026mu;L PBS. Tumor growth was carefully monitored for approximately one month. After 30 days, the mice were humanely euthanized. Subsequently, the tumors were carefully excised, photographed, weighed, and prepared for subsequent analyses. All experiments were conducted in compliance with applicable regulatory standards.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatic Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMicroarray data can be accessed under the accession numbers GSE81005 from the Gene Expression Omnibus database (GEO, http://www.ncbi.nlm.nih.gov/geo/). These datasets, based on the GPL15270 platform , elucidate epigenomic alterations in HCT-8 cells after 0, 24, and 48 hours of 5-fluorouracil stimulation. Raw data were obtained as MINiML files. The m6A-related genes were sourced from Juan Xu\u0026apos;s comprehensive study on the molecular characterization and clinical relevance of m6A modulators across 33 cancer types[39]. For heatmap visualization, the R software\u0026apos;s pheatmap package was employed. RNA-sequencing expression profiles (level 3) and corresponding clinical information for CRC were sourced from the TCGA dataset (https://portal.gdc.cancer.gov). Genes encompassed in the apoptosis-related pathway were collected. The R software\u0026apos;s GSVA package was employed for analysis, utilizing parameters set to method=\u0026apos;ssgsea\u0026apos;. Spearman correlation was used to analyze the association between METTL3, TRAP1, and apoptosis-related pathway scores. The correlation map between METTL3 and TRAP1 was generated using the R software package ggstatsplot. All analyses and the use of R packages were conducted with R version 4.0.3. A p-value \u0026lt; 0.05 was considered statistically significant.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEach experiment was independently repeated at least three times.Statistical analyses were performed using SPSS 19.0 (IBM Corp, Chicago, IL) and GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA). Data are presented as mean \u0026plusmn; standard deviation(SD). Differences between two groups were assessed using a two-tailed Student\u0026apos;s t-test, while distinctions among multiple groups were evaluated using one-way analysis of variance (ANOVA). The statistical difference of two groups from GEO datasets was compared through the Wilcoxon test, and the significance difference of three groups was tested with the Kruskal-Wallis test. Significance levels were indicated as follows: \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u0026nbsp;\u003c/em\u003e\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e5-FU induces cell apoptosis and down-regulates\u0026nbsp;METTL3 expression in CRC cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e5-FU is a widely used cancer chemotherapeutic drug known for its universal induction of apoptosis. In order to investigate the contribution of apoptosis to 5-FU-induced colorectal cancer cell death, HCT-116 and HCT-8 cells were subjected to varying doses (0, 2, 4, 8\u0026micro;M) of 5-FU for 24 hours.\u0026nbsp;Flow cytometry and TUNEL assay were conducted to identify apoptotic cells. The results from flow cytometry demonstrated a concentration-dependent increase in apoptotic rate for both HCT-116 and HCT-8 cells following 24-hour 5-FU treatment(Fig. 1A). Likewise, the number of TUNEL-positive cells exhibited a significant rise corresponding to the concentration of 5-FU treatment(Fig. 1C-F). Further confirmation of 5-FU-induced apoptosis in HCT-116 and HCT-8 cells was sought through an analysis of the anti-apoptotic protein, Bcl-2, a hallmark of cell apoptosis. Western blotting revealed a dose-dependent reduction in Bcl-2 expression upon 5-FU treatment (0-8\u0026micro;M). In parallel, the cleaved Caspase-3 and Bax, indicative of cells undergoing apoptosis, demonstrated a remarkable increase post 5-FU treatment (Fig. 1G-J). These findings strongly suggest that 5-FU can induce apoptotic cell death in CRC cells.\u003c/p\u003e\n\u003cp\u003ePrevious studies have provided substantial evidence supporting the crucial role of m6A methylation in the regulation of apoptosis and drug resistance in tumor cells[20,22-27].\u003cstrong\u003e\u003csub\u003e\u0026nbsp;\u003c/sub\u003e\u003c/strong\u003eTo further clarify whether m6A methylation is involved in 5-FU-induced apoptosis in CRC cells. we analyzed the m6A-related genes expression in CRC datasets from GSE81005, and found a time-dependent reduction in METTL3 and a concomitant increase in the levels of YTHDF2, WTAP, and YTHDF3 in HCT-8 cells after 24 and 48 hours of 5-FU treatment (Fig. 1B). Considering that METTL3 is a crucial m6A methyltransferase, we focused on investigating its involvement in 5-FU-induced apoptosis in CRC cells.\u0026nbsp;Subsequently, we assessed METTL3 expression levels in HCT-116 and HCT-8 cells following 5-FU treatment. Similarly, Western blot results demonstrated a significant decrease after a 24-hour treatment with 5-FU(Fig. 1G-J). This result strongly imply that METTL3 plays a pivotal role in 5-FU-induced apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMETTL3 downregulation enhances the sensitivity of CRC cells to 5-FU treatment and facilitates 5-FU-induced apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsidering that METTL3 is involved in 5‑FU‑dependent responses, it led us to hypothesize that manipulating METTL3 levels could influence the sensitivity of CRC cells to 5-FU. To test this hypothesis, we created stable METTL3 knockdown cell lines (shMETTL3-1 and -2) in HCT-116 and HCT-8 cells using different shRNA sequences. Both mRNA and protein analyses confirmed the successful knockdown of METTL3 (Fig. 2A-C). We utilized the CCK-8 assay to assess 5-FU sensitivity. The results demonstrated a significant decrease in cell viability and IC50 value upon METTL3 silencing (Fig. 2D-E). Moreover, colony formation assays showed a notable reduction in colony numbers in shMETTL3-1 and shMETTL3-2 transfected groups compared to the shNC group after 5-FU treatment for 24 hours (Fig. 2F-H). Similarly, EdU assay revealed a lower percentage of proliferative cells in HCT-116 and HCT-8 cells with METTL3 knockdown compared to the shNC group after exposure to 5-FU for 24 hours (Fig. 2I-K). Additionally, the knockdown of METTL3 resulted in heightened cell apoptosis when exposed to 5-FU (Fig. 2L). This observation was in line with the western blot analysis, which exhibited elevated levels of pro-apoptotic proteins Bax and cleaved Caspase-3, along with a decrease in the anti-apoptotic protein Bcl-2 in 5-FU-treated METTL3 knockdown cells (Fig. 2M-O). These findings suggest that silencing METTL3 induces cell death through Bcl-2-dependent apoptotic pathways. In summary, these results collectively indicate that suppressing METTL3 expression heightens the sensitivity of CRC cells to 5-FU and promotes apoptotic responses .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMETTL3 overexpression mitigates the inhibitory effect of 5-FU on the viability of CRC cells and enhances its protective role in apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further characterize the role of METTL3 in CRC cells with 5-FU treatment, we next examined whether ectopic expression of METTL3 could counteract 5-FU-induced apoptosis and increase 5-FU resistance in CRC cells. HCT-116 and HCT-8 cells were transduced with lentivirus carrying METTL3 for overexpression. Validation of METTL3 overexpression occurred at both mRNA and protein levels(Fig. 3A-C). As anticipated, heightened METTL3 levels increased the cell viability and 5-FU IC50 value in HCT-116 and HCT-8 cells (Fig. 3D-E). Additionally, cells with METTL3 overexpression exhibited a greater propensity to form colonies compared to the control cells after 5-FU treatment (Fig. 3F,H-I). This was consistently supported by EdU immunofluorescence staining, which indicated a higher percentage of proliferative cells in HCT-116 and HCT-8 cells with METTL3 overexpression compared to the control cells following 5-FU exposure(Fig. 3J-L).To examine whether the enhanced cell viability observed in the METTL3 overexpression group following 5-Fu treatment correlated with alterations in apoptosis, a flow cytometry apoptosis analysis was conducted. The data revealed a notable decrease in the apoptotic rate of HCT-116 and HCT-8 cells after METTL3 upregulation in the presence of 5-FU treatment(Fig. 3G). In line with this, western blot analysis demonstrated that METTL3 overexpression could reverse the inhibitory effect on Bcl-2 expression and the facilitative effect on Bax and cleaved Caspase-3 expression caused by 5-FU treatment(Fig. 3M-O).In summary, METTL3 overexpression attenuated 5-FU-induced apoptosis and diminished the sensitivity of CRC cells to 5-FU.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMETTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression in an m6A-dependent manner\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRAP1 is implicated in colorectal cancer metastasis and prognosis, inducing a multidrug-resistant phenotype. Previous research highlights its crucial role in regulating apoptosis, leading to 5-FU resistance in CRC cells when overexpressed[36]. Hence, we hypothesized whether METTL3 could modulate TRAP1 expression in CRC cells, thereby influencing 5-FU sensitivity and apoptosis induction.\u0026nbsp;To verify our hypothesis, we initially utilized RNA-sequencing expression profiles (level 3) from TCGA, encompassing 620 CRC samples, to analyze correlations between METTL3, TRAP1, and the apoptosis-related pathway score. Results unveiled a significant positive correlation between TRAP1 and METTL3 expression(Fig. 4A), along with a negative correlation between METTL3 and TRAP1 with the apoptosis-related pathway(Fig. 4B-C). Subsequently, we analyzed TRAP1 expression in cells with altered METTL3 levels\u0026nbsp;following 5-FU treatment.\u0026nbsp;Western blot results showed elevated TRAP1 protein levels in METTL3-overexpressing HCT-116 and HCT-8 cells, while knockdown of METTL3 resulted in decreased TRAP1 protein levels(Fig. 4E,R-S). qPCR analysis aligned with these findings, indicating a corresponding pattern in mRNA expression after altering METTL3 levels(Fig. 4T-U). Thus, the above findings indicate that METTL3 could regulate TRAP1 expression in CRC cells following 5-FU treatment.\u003c/p\u003e\n\u003cp\u003eTo further investigate whether METTL3\u0026nbsp;regulates\u0026nbsp;5-FU sensitivity and apoptosis induction in CRC cells by modulating TRAP1 expression, we firstly examined the impact of inhibiting TRAP1 with G-TPP (gamitrinib-triphenylphosphonium) in HCT-116 cells with METTL3 overexpression. G-TPP is a pharmacological inhibitor known for its ability to hinder TRAP1 signaling pathways in colon cancer, as demonstrated in previous studies[40].\u0026nbsp;Our aim was to assess whether this inhibition could modify the protective influence of METTL3 during 5-FU treatment. As expected, G-TPP pretreatment in HCT-116 attenuated the protection provided by METTL3 against 5-FU treatment (Fig. 4F,H). Mechanistically, G-TPP pretreatment also abolished the upregulation of Bcl-2 and suppression of Bax and cleaved Caspase-3 afforded by METTL3 overexpression in HCT-116 cells after 5-FU treatment (Fig. 4J,M). Subsequently,\u0026nbsp;we investigated whether the ectopic expression of TRAP1 could counteract the influence observed following METTL3 knockdown in HCT-8 cells during 5-FU treatment by transfecting them with a TRAP1 overexpression plasmid. As anticipated, TRAP1 overexpression counteracted the inhibitory effect induced by METTL3 knockdown post 5-FU treatment(Fig. 4G, I), reversing alterations in Bcl-2, Bax, and cleaved Caspase-3 caused by METTL3 downregulation(Fig. 4K, N).Collectively, these results strongly support the notion that METTL3 regulates 5-FU sensitivity and protects against 5-FU-induced apoptosis in CRC cells by boosting TRAP1 expression.\u003c/p\u003e\n\u003cp\u003eConsidering that mRNA transcript stability is regulated by METTL3 through m6A modification, we next investigated whether METTL3 regulates the expression of TRAP1 in an m6A-dependent manner. We utilized the online bioinformatics tool, the sequence-based N6-methyladenosine (m6A) modification site predictor (http://www.cuilab.cn/sramp) to perform m6A site prediction analysis on TRAP1 mRNA. The results revealed the presence of multiple m6A modification sites within TRAP1 mRNA(Fig.4L). Among them, the highest confidence binding sites \u0026quot;GGACU\u0026quot; were located at 2149\u0026ndash;2153bp(Fig. 4O). To validate these results, we employed m6A colorimetric ELISA assays to examine alterations in total RNA m6A modification levels in METTL3-overexpressing HCT-116\u0026nbsp;and METTL3-downregulated HCT-8 cells following 5-FU treatment. The results demonstrated a significant increase in total RNA m6A levels upon METTL3 up-regulation in HCT-116 cell lines, but a significant decrease in HCT-8 cells(Fig. 4D). Additionally, MeRIP-qPCR assays were deployed to detect gene-specific m6A modifications on TRAP1 mRNA. The results showed that m6A antibody enrichment on TRAP1 mRNA was significantly increased in METTL3-upregulated HCT-116 cells and decreased in METTL3-downregulated HCT-8 cells upon 5-FU treatment (Fig. 4P-Q). In summary, all the gathered data indicate that\u0026nbsp;METTL3 regulates 5-FU sensitivity and\u0026nbsp;protects against\u0026nbsp;5-FU-induced apoptosis by modulating\u0026nbsp;TRAP1 in an m6A-dependent manner in CRC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTRAP1 overexpression\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eattenuate\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;chemotherapeutic sensitivity of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e5-FU\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ein CRC cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further validate the role of TRAP1 in regulating 5-FU sensitivity, we constructed a TRAP1 overexpression plasmid (pcDNA3.1-TRAP1). Both qRT-PCR and western blotting confirmed a substantial increase in TRAP1 mRNA and protein levels in HCT-116 and HCT-8 cells transfected with the TRAP1 overexpression plasmid, compared to the vector group (Fig. 5A-B). Notably, TRAP1 expression has been found to be elevated in drug-resistant human colorectal carcinoma cells, and its upregulation protected cells from the cytotoxic effects of 5-FU and L-OHP in HT-29 colorectal carcinoma cells[36].\u0026nbsp;In line with these observations, our current study disclosed that TRAP1 overexpression increased the cell viability and 5-FU IC50 value in HCT-116 and HCT-8 cells (Fig. 5C-D). Through colony formation assays (Fig. 5E,G-H) and EdU immunofluorescence staining (Fig. 5F,I-J), we demonstrated that TRAP1 overexpression conferred heightened resistance to 5-FU in both HCT-116 and HCT-8 cells.One hallmark of drug resistance is an increased capacity to inhibit apoptosis in response to drug treatment. Accordingly, a flow cytometry assay was conducted to evaluate cell apoptosis. Post 5-FU treatment, TRAP1 overexpression resulted in a reduced apoptosis ratio (Fig. 5K-L). Simultaneously, we assessed the expression of apoptosis-related proteins\u0026mdash;Bax,\u0026nbsp;Caspase-3,\u0026nbsp;and Bcl-2\u0026mdash;via Western blot analysis. The results revealed that TRAP1 overexpression significantly increased Bcl-2 expression, while inhibiting the expression of Bax and cleaved Caspase-3 in 5-FU treated cells. These findings imply that TRAP1 might play a role in conferring a 5-FU resistant phenotype in CRC cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMETTL3 knockdown enhances 5-FU sensitivity of CRC cells and diminishes tumor growth in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the findings mentioned above, it has been demonstrated that METTL3 can regulate 5-FU sensitivity by modulating TRAP1 protein expression in CRC cells in vitro. To further ascertain the interplay between METTL3, 5-FU sensitivity, and tumor growth in CRC, we initiated a mouse xenograft model. This was achieved by injecting HCT-116 cells with silenced METTL3 into nude mice, followed by the administration of either 5-FU or a control substance(PBS). As depicted in Fig. 4A-C, 5-FU significantly reduced tumor volume and weight compared to the control, whereas tumors stemming from METTL3 down-regulation cells displayed decelerated growth and smaller mass. This corroborates the findings of a previous study by Song Xiang et al[41], which delineated that METTL3 silencing inhibited CRC cell proliferation in vivo. Additionally, in comparison to the control group, the downregulation of METTL3 increased the suppressive effect of 5-FU on tumor growth, signifying METTL3\u0026apos;s role in conferring 5-FU tolerance to CRC cells. Further supporting this, analysis of xenografted tumors through immunohistochemistry (IHC) and TUNEL assay revealed that HCT-116 cells with METTL3 downregulation exhibited significantly lower levels of cell proliferation (Ki-67) and higher levels of apoptosis compared to the control group when treated with 5-FU(Fig. 6D).Additionally, there was a significant decrease in the protein expression levels of METTL3, TRAP1, and Bcl-2, while Bax expression increased after treatment with 5-FU(Fig. 6D-F).Similarly, in comparison to the control group, in the METTL3 silencing group following 5-FU treatment, the expression of METTL3, TRAP1, and Bcl-2 showed marked downregulation, while the expression of Bax was upregulated (Fig. 6D-F). These results are consistent with our prior in vitro findings. In summary, the in vivo data further substantiates that METTL3 knockdown enhances 5-FU sensitivity and apoptosis induction in CRC cells by inhibiting TRAP1 expression.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eColorectal cancer (CRC) is a prominent global health concern, particularly in Asia where incidence and mortality rates have been steadily rising[42]. The primary approach to managing CRC involves surgery, often complemented with chemotherapy for advanced cases[43]. Among patients with unresectable or metastatic tumors, 5-FU-based chemotherapy is the standard of care[44]. However, the clinical efficacy of 5-FU is hampered by the emergence of chemoresistance, a formidable challenge that can arise either inherently or through treatment exposure. This resistance significantly contributes to treatment failure and disease progression in cancer patients[45]. Chemotherapy resistance can be attributed to various mechanisms, including enhanced drug expulsion, heightened DNA damage repair, activation of detoxification systems, and the ability to evade drug-induced apoptosis[45-47]. While 5-FU\u0026apos;s anti-cancer effect has long been associated with its ability to induce cell apoptosis, a substantial body of evidence supports a connection between the downregulation of proapoptotic pathways and 5-FU resistance[36]. Despite these insights, the precise mechanisms governing 5-FU resistance and 5-FU-induced apoptosis in CRC cells remain elusive. Therefore, there is an urgent need to investigate the pathways through which CRC cells acquire 5-FU resistance and develop therapeutic strategies to overcome this challenge. This study illuminates the fact that 5-FU induces apoptotic cell death in HCT-116 and HCT-8 CRC cells. Furthermore, our findings suggest that METTL3 plays a pivotal role in mediating the apoptotic responses triggered by 5-FU. Notably, there is a significant reduction in METTL3 protein expression after 24 hours of 5-FU\u0026nbsp;treatment. A series of gain- and loss-of-function experiments, both in vitro and in vivo, provide compelling evidence that METTL3 is intricately involved in suppressing 5-FU-induced apoptosis and in the regulation of 5-FU sensitivity in CRC cells.\u003c/p\u003e\n\u003cp\u003eMETTL3, the pioneering methyltransferase identified in RNA modification, operates in conjunction with METTL14 and WTAP, playing a crucial role in RNA methylation processes[48]. Its involvement spans various critical biological functions like cell cycle regulation, proliferation, apoptosis, and cell mobility[49]. Recently, the altered expression of METTL3 has been observed in various tumors, indicating its significant role in tumorigenesis[50]. Moreover, it has garnered attention as a promising target for therapeutic interventions in a wide range of human cancers[49]. Similarly, in the context of CRC, a significant body of research has examined METTL3\u0026apos;s role. Some studies suggest that heightened METTL3 expression boosts CRC cell growth, fostering carcinogenesis[41,52-54]. Conversely, there is a study reporting a tumor-suppressive effect of METTL3 in CRC, inhibiting cell proliferation, migration, and invasion via the p38/ERK pathway[55]. The authors posit that the dual role of METTL3 in cancer regulation could be attributed to variations in targeting pathways and the inherent heterogeneity of cancer[55]. Therefore, further investigation is warranted to elucidate the precise role of METTL3 in CRC.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; Emerging evidence links METTL3 to drug resistance in various cancer cells. For instance, it governs resistance to cisplatin in lung cancer by inducing mitophagy[25]. Moreover, METTL3 has implications in drug resistance within pancreatic cancer[27]. In MCF-7 breast cancer cells, METTL3 even promotes resistance to adriamycin through m6A-dependent pri-microRNA-221-3p maturation[56]. Nonetheless, its role in 5-FU sensitivity in CRC remains somewhat elusive. Our study sheds light on this aspect, showing that inhibiting METTL3 using RNA interference heightens 5-FU sensitivity in CRC HCT-116 and HCT-8 cells, as confirmed by CCK-8, EdU, and colony formation assays. Conversely, overexpressing METTL3 weakened 5-FU sensitivity. Previous studies have indicated METTL3\u0026apos;s influence on cell death; its knockdown induces apoptosis in HepG2 cells by modulating P53 signaling[57]. Our research validates that METTL3 knockdown aggravates 5-FU-induced apoptosis in HCT-116 and HCT-8 cells. To gain further insights into METTL3\u0026apos;s role in apoptosis, we overexpressed it in these cells, observing a decrease in 5-FU-induced apoptosis. In line with the in vitro findings, We found that METTL3 down-regulation enhanced 5-FU-induced apoptosis and attenuated xenograft tumor volume in a nude mouse model, suggesting METTL3 may protect CRC cells from 5-FU induced apoptosis and regulate the sensitivity of CRC cells to 5-FU treatment in a nude mouse model.\u003c/p\u003e\n\u003cp\u003eHowever, the potential of METTL3 in anti-apoptosis and chemotherapy resistance may vary in different cell types. For example, elevating METTL3 levels significantly heightened cisplatin sensitivity in SiHa-DDP cells. In SiHa cells, increased METTL3 expression inhibited viability and promoted apoptosis when treated with cisplatin, whereas METTL3 knockdown led to reduced sensitivity to cisplatin[58]. Another study demonstrated that METTL3 knockdown increased sorafenib resistance in hepatocellular carcinoma by eliminating METTL3-mediated FOXO3 mRNA stabilization[26]. This disparity between our findings and previous studies highlights the intricate and diverse role of METTL3 in chemotherapy resistance, warranting further in-depth exploration.\u003c/p\u003e\n\u003cp\u003eThe preceding experiments conclusively demonstrate that METTL3 profoundly influences the response of CRC cells to 5-FU treatment. This prompted us to delve into the underlying mechanisms. TRAP1, a key player associated with metastasis and prognosis in colorectal cancers, has been found to induce a multidrug-resistant phenotype in colon carcinoma cells[33,36]. Previous research has underscored the pivotal roles of TRAP1 in regulating apoptosis in CRC, as well as its involvement in modulating chemotherapy sensitivity in various tumor cells[36,59-60]. Costantino et al. discovered that overexpression of TRAP1 led to resistance against 5-FU, oxaliplatin, and irinotecan in colon carcinoma cells[36]. Additionally, elevated levels of TRAP1 were observed in cisplatin-resistant ovarian carcinoma cell lines[57], as well as paclitaxel-resistant breast carcinoma cells[60]. This body of evidence leads us to speculate that METTL3 could regulate 5-FU sensitivity and apoptosis induction by influencing TRAP1 expression in CRC cells. In our study, we observed that altering METTL3 expression led to a corresponding change in TRAP1 expression in both HCT-116 and HCT-8 cells after 5-FU treatment. Furthermore, scrutiny based on TCGA data unveiled a positive correlation between METTL3 and TRAP1 expression in CRC. Most notably, pretreatment with the specific TRAP1 inhibitor G-TPP significantly reduced the protective effect of METTL3 against both 5-FU-induced apoptosis and the cytotoxic effects of 5-FU. Conversely, TRAP1 overexpression counteracted the inhibitory effect induced by METTL3 knockdown post 5-FU treatment. These findings substantiate our hypothesis that METTL3 regulates 5-FU sensitivity and provides protection against 5-FU-induced apoptosis by modulating TRAP1 expression in CRC cells.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; As a crucial component of the m6A methyltransferase complex, METTL3 primarily regulates tumor progression through its m6A methyltransferase activity. Therefore, We speculate that METTL3 regulates 5-FU sensitivity by modulating TRAP1 expression in an m6A-dependent manner in CRC cells. Initially, we employed the online bioinformatics tool SRAMP to identify potential m6A modification sites on TRAP1. Subsequently, we assessed the total RNA m6A levels in both METTL3-overexpressing HCT-116 and METTL3-downregulated HCT-8 cells after 5-FU treatment. The results demonstrated a substantial rise in total RNA m6A levels following METTL3 up-regulation, but a significant decrease after METTL3 knockdown. Furthermore, MeRIP-qPCR assays provided additional confirmation that METTL3 modulates TRAP1 expression through an m6A-dependent mechanism. These findings reveal a novel post-transcriptional regulator of TRAP1. We then conducted a comprehensive analysis of TRAP1\u0026apos;s effects on CRC cells following 5-FU treatment. As expected, the upregulation of TRAP1 mitigated the cytotoxic impact of 5-FU on HCT-116 and HCT-8 cells. Additionally, the utilization of G-TPP led to reduced cell viability and increased apoptotic rates in CRC cells subjected to 5-FU. These outcomes further support that TRAP1 can indeed regulate the sensitivity of CRC cells to 5-FU. Our data are still in agreement with prior reports emphasizing the crucial role of TRAP1 in protecting from apoptosis and inducing chemo-resistance[61]. Recent studies have indicated that TRAP1 is implicated in mitochondrial anti-apoptotic mechanisms[36], which may account for TRAP1-related chemo-resistance.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; In summary, our study demonstrates the pivotal role of METTL3 in regulating 5-FU sensitivity in CRC cells. This novel mechanism sheds light on 5-FU resistance in CRC, presenting fresh perspectives and targets for future therapeutic approaches and drug development. However, some questions warrant further exploration to comprehensively grasp the role of METTL3 in CRC. Which specific m6A \u0026apos;reader\u0026apos; proteins recognize the m6A sites in TRAP1 mRNA? What are the downstream mechanisms of TRAP1? There might be other downstream gene or chemo-resistance related signaling pathway regulated by METTL3, which necessitates a thorough transcriptome-wide mapping of N6-methyladenosine through m6A-seq. Additionally, a potent METTL3 inhibitor has recently been introduced[62], exploring its combination with a TRAP1 inhibitor for CRC treatment holds promise for future investigation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eWe thank Dr. Baohong Yuan for her assistance in the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eQingjie Kang designed the study and drafted the manuscript; Qingjie Kang and Zhenzhou Chen performed the cell experiments. Xiaolong Liang and Xiaoyu Hu conducted the animal study. Song Xiang performed the statistical analysis. Ziwei Wang designed the study and revised the manuscript. All authors read and gave final approval to the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThis work was supported by the National Natural Science Foundation of China (81974385).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe data that support the findings of this study are available upon reasonable request from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003eThe authors declared no conflict of interest in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u0026nbsp;\u003c/strong\u003eAll animal-related procedures were approved by the Ethics Committee of The First Affiliated Hospital of Chongqing Medical University.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71:209-249.https://doi.org/10.3322/caac.21660.\u003c/li\u003e\n\u003cli\u003eSiegel RL, Wagle NS, Cercek A, Smith RA, Jemal A (2023) Colorectal cancer statistics, 2023. CA Cancer J Clin 73:233-254.https://doi.org/10.3322/caac.21772. \u003c/li\u003e\n\u003cli\u003eA. Hadjipetrou, D. Anyfantakis, C.G. Galanakis, M. Kastanakis, S (2017) Colorectal cancer, screening and primary care: a mini literature review. World J Gastroenterol. 23:6049-6058.https://doi.org/10.3748/wjg.v23.i33.6049\u003c/li\u003e\n\u003cli\u003eBhandari A, Woodhouse M, Gupta S(2017) Colorectal cancer is a leading cause of cancer incidence and mortality among adults younger than 50 years in the USA: a SEER-based analysis with comparison to other young-onset cancers.J Investig Med. 65:311-315.https://doi.org/10.1136/jim-2016-000229\u003c/li\u003e\n\u003cli\u003eC. Franzese, T. Comito, E. Toska, A. Tozzi, E. Clerici, F. De Rose, D. Franceschini, P. Navarria, G. Reggiori, S. Tomatis, et al (2019) Predictive factors for survival of oligometastatic colorectal cancer treated with Stereotactic body radiation therapy. Radiother. Oncol. 133:220-226. https://doi.org/10.1016/j.radonc.2018.10.024.\u003c/li\u003e\n\u003cli\u003eS. Advani, S. Kopetz (2019) Ongoing and future directions in the management of metastatic colorectal cancer: update on clinical trials. J. Surg. Oncol. 119:642\u0026ndash;652.https://doi.org/10.1002/jso.25441.\u003c/li\u003e\n\u003cli\u003eXie YH, Chen YX and Fang JY (2020) Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Target Ther .5:22. https://doi.org/10.1038/s41392-020-0116-z.\u003c/li\u003e\n\u003cli\u003eHammond WA, Swaika A, and Mody K (2016) Pharmacologic resistance in colorectal cancer: a review. Ther Adv Med Oncol. 8:57-84. https://doi.org/10.1177/1758834015614530.\u003c/li\u003e\n\u003cli\u003eDai W, Gao Q, Qiu J, Yuan J, Wu G, Shen G (2015) Quercetin induces apoptosis and enhances 5-FU therapeutic efficacy in hepatocellular carcinoma. Tumour Biol. 37:6307-13. https://doi.org/10.1007/s13277-015-4501-0.\u003c/li\u003e\n\u003cli\u003eVodenkova S, Buchler T, Cervena K, Veskrnova V, Vodicka P, and Vymetalkova V (2020) 5-fluorouracil and other fluoropyrimidines in colorectal cancer: Past, present and future. Pharmacol Ther. 206:107447. https://doi.org/10.1016/j.pharmthera.2019.107447.\u003c/li\u003e\n\u003cli\u003eAlasar AA, T\u0026uuml;ncel \u0026Ouml;, Gelmez AB, Sağlam B, Vatansever İE, Akg\u0026uuml;l B (2022) Genomewide m6A Mapping Uncovers Dynamic Changes in the m6A Epitranscriptome of Cisplatin-Treated Apoptotic HeLa Cells. Cells. 11:3905. https://doi.org/10.3390/cells11233905.\u003c/li\u003e\n\u003cli\u003eSethy C, Kundu CN (2021) 5-Fluorouracil (5-FU) resistance and the new strategy to enhance the sensitivity against cancer: Implication of DNA repair inhibition. Biomed Pharmacother. 137:111285. https://doi.org/10.1016/j.biopha.2021.111285.\u003c/li\u003e\n\u003cli\u003eSkarkova V, Kralova V, Vitovcova B, Rudolf E (2019) Selected Aspects of Chemoresistance Mechanisms in Colorectal Carcinoma-A Focus on Epithelial-to-Mesenchymal Transition, Autophagy, and Apoptosis. Cells. 8:234. https://doi.org/10.3390/cells8030234.\u003c/li\u003e\n\u003cli\u003eZhang L, Yu J (2013) Role of apoptosis in colon cancer biology, therapy, and prevention. Curr Colorectal Cancer Rep. 9:10. https://doi.org/10.1007/s11888-013-0188-z. \u003c/li\u003e\n\u003cli\u003eMin KW, Zealy RW, Davila S, Fomin M, Cummings JC, Makowsky D, Mcdowell CH, Thigpen H, Hafner M, Kwon SH, et al (2018) Profiling of m6A RNA modifications identified an age-associated regulation of AGO2 mRNA stability. Aging Cell. 17:e12753. https://doi.org/10.1111/acel.12753.\u003c/li\u003e\n\u003cli\u003eMa S, Chen C, Ji X, Liu J, Zhou Q, Wang G, Yuan W, Kan Q, Sun Z (2019) The interplay between m6A RNA methylation and noncoding RNA in cancer. J Hematol Oncol. 12:121. https://doi.org/10.1186/s13045-019-0805-7.\u003c/li\u003e\n\u003cli\u003eWang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, et al (2014) N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 505:117-20. https://doi.org/10.1038/nature12730. \u003c/li\u003e\n\u003cli\u003eRoundtree IA, Evans ME, Pan T, He C (2017) Dynamic RNA Modifications in Gene Expression Regulation. Cell. 169:1187-1200. https://doi.org/10.1016/j.cell.2017.05.045.\u003c/li\u003e\n\u003cli\u003eFustin JM, Kojima R, Itoh K, Chang HY, Ye S, Zhuang B, Oji A, Gibo S, Narasimamurthy R, Virshup D, et al. (2018) Two Ck1\u0026delta; transcripts regulated by m6A methylation code for two antagonistic kinases in the control of the circadian clock. Proc Natl Acad Sci U S A.115:5980-5985. https://doi.org/10.1073/pnas.1721371115.\u003c/li\u003e\n\u003cli\u003eBarbieri I, Tzelepis K, Pandolfini L, Shi J, Mill\u0026aacute;n-Zambrano G, Robson SC, Aspris D, Migliori V, Bannister AJ, Han N, et al (2017) Promoter-bound METTL3 maintains myeloid leukaemia by m6A-dependent translation control. Nature. 552:126-131. https://doi.org/10.1038/nature24678.\u003c/li\u003e\n\u003cli\u003eZheng W, Dong X, Zhao Y, Wang S, Jiang H, Zhang M, Zheng X, Gu M (2019) Multiple Functions and Mechanisms Underlying the Role of METTL3 in Human Cancers. Front Oncol. 9:1403. https://doi.org/10.3389/fonc.2019.01403.\u003c/li\u003e\n\u003cli\u003eXiang M, Liu W, Tian W, You A, Deng D (2020).RNA N-6-methyladenosine enzymes and resistance of cancer cells to chemotherapy and radiotherapy. Epigenomics. 12:801-809. https://doi.org/10.2217/epi-2019-0358.\u003c/li\u003e\n\u003cli\u003eVu LP, Pickering BF, Cheng Y, Zaccara S, Nguyen D, Minuesa G, Chou T, Chow A, Saletore Y, MacKay M,et al(2017) The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 23:1369-1376. https://doi.org/10.1038/nm.4416.\u003c/li\u003e\n\u003cli\u003eWang H, Xu B, Shi J (2019) N6-methyladenosine METTL3 promotes the breast cancer progression via targeting Bcl-2. Gene. 722:144076. https://doi.org/10.1016/j.gene.2019.\u003c/li\u003e\n\u003cli\u003eSun Y, Shen W, Hu S, Lyu Q, Wang Q, Wei T, Zhu W, Zhang J (2023) METTL3 promotes chemoresistance in small cell lung cancer by inducing mitophagy. J Exp Clin Cancer Res. 42:65. https://doi.org/10.1186/s13046-023-02638-9.\u003c/li\u003e\n\u003cli\u003eLin Z, Niu Y, Wan A, Chen D, Liang H, Chen X, Sun L, Zhan S, Chen L, Cheng C, et al (2020) RNA m6 A methylation regulates sorafenib resistance in liver cancer through FOXO3-mediated autophagy. EMBO J.39:e103181. https://doi.org/10.15252/embj.2019103181. \u003c/li\u003e\n\u003cli\u003eTaketo K, Konno M, Asai A, Koseki J, Toratani M, Satoh T, Doki Y, Mori M, Ishii H, Ogawa K (2018) The epitranscriptome m6A writer METTL3 promotes chemo- and radioresistance in pancreatic cancer cells. Int J Oncol. 52:621-629. https://doi.org/ 10.3892/ijo.2017.4219.\u003c/li\u003e\n\u003cli\u003eSong HY, Dunbar JD, Zhang YX, Guo D, Donner DB (1995) Identification of a protein with homology to hsp90 that binds the type 1 tumor necrosis factor receptor. J Biol Chem. 270:3574-81.https://doi.org/10.1074/jbc.270.8.3574 \u003c/li\u003e\n\u003cli\u003eFelts SJ, Owen BA, Nguyen P, Trepel J, Donner DB, Toft DO (2000) The hsp90-related protein TRAP1 is a mitochondrial protein with distinct functional properties. J Biol Chem. 275:3305-12. https://doi.org/10.1074/jbc.275.5.3305.\u003c/li\u003e\n\u003cli\u003eMasgras I, Sanchez-Martin C, Colombo G, Rasola A (2017) The Chaperone TRAP1 As a Modulator of the Mitochondrial Adaptations in Cancer Cells. Front Oncol. 7:58. https://doi.org/10.3389/fonc.2017.00058.\u003c/li\u003e\n\u003cli\u003eMatassa DS, Amoroso MR, Maddalena F, Landriscina M, Esposito F (2012) New insights into TRAP1 pathway. Am J Cancer Res. 2:235-48. \u003c/li\u003e\n\u003cli\u003eChen R, Pan S, Lai K, Lai LA, Crispin DA, Bronner MP, Brentnall TA (2014) Up-regulation of mitochondrial chaperone TRAP1 in ulcerative colitis associated colorectal cancer. World J Gastroenterol. 20:17037-48. https://doi.org/10.3748/wjg.v20.i45.17037.\u003c/li\u003e\n\u003cli\u003ePak MG, Koh HJ, Roh MS (2017) Clinicopathologic significance of TRAP1 expression in colorectal cancer: a large scale study of human colorectal adenocarcinoma tissues. Diagn Pathol. 12:6. https://doi.org/10.1186/s13000-017-0598-3.\u003c/li\u003e\n\u003cli\u003eLeav I, Plescia J, Goel HL, Li J, Jiang Z, Cohen RJ, Languino LR, Altieri DC (2010) Cytoprotective mitochondrial chaperone TRAP-1 as a novel molecular target in localized and metastatic prostate cancer. Am J Pathol. 176:393-401. https://doi.org/10.2353/ajpath.2010.090521.\u003c/li\u003e\n\u003cli\u003eMontesano Gesualdi N, Chirico G, Pirozzi G, Costantino E, Landriscina M, Esposito F (2007) Tumor necrosis factor-associated protein 1 (TRAP-1) protects cells from oxidative stress and apoptosis. Stress. 10:342-350. https://doi.org/10.1080/10253890701314863.\u003c/li\u003e\n\u003cli\u003eCostantino E, Maddalena F, Calise S, Piscazzi A, Tirino V, Fersini A, Ambrosi A, Neri V, Esposito F, Landriscina M (2009) TRAP1, a novel mitochondrial chaperone responsible for multi-drug resistance and protection from apoptotis in human colorectal carcinoma cells. Cancer Lett.279:39-46. https://doi.org/10.1016/j.canlet.2009.01.018.\u003c/li\u003e\n\u003cli\u003eYu J, Li Y, Wang T, Zhong X (2018).Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLoS One. 13:e0198604. https://doi.org/10.1371/journal.pone.0198604. \u003c/li\u003e\n\u003cli\u003eXiang S, Wang Y, Lei D, Luo Y, Peng D, Zong K, Liu Y, Huang Z, Mo S, Pu X, et al (2023) Donor graft METTL3 gene transfer ameliorates rat liver transplantation ischemia-reperfusion injury by enhancing HO-1 expression in an m6A-dependent manner. Clin Immunol. 251:109325.https://doi.org/10.1016/j.clim.2023.109325. \u003c/li\u003e\n\u003cli\u003eLi Y, Xiao J, Bai J, Tian Y, Qu Y, Chen X, Wang Q, Li X, Zhang Y, Xu J (2019) Molecular characterization and clinical relevance of m6A regulators across 33 cancer types. 18:137. https://doi.org/10.1186/s12943-019-1066-3.\u003c/li\u003e\n\u003cli\u003eTsai HY, Bronner MP, March JK, Valentine JF, Shroyer NF, Lai LA, Brentnall TA, Pan S, Chen R (2022) Metabolic targeting of NRF2 potentiates the efficacy of the TRAP1 inhibitor G-TPP through reduction of ROS detoxification in colorectal cancer. Cancer Lett. 549:215915. https://doi.org/10.1016/j.canlet.2022.215915.\u003c/li\u003e\n\u003cli\u003eXiang S, Liang X, Yin S, Liu J, Xiang Z (2020) N6-methyladenosine methyltransferase METTL3 promotes colorectal cancer cell proliferation through enhancing MYC expression. Am J Transl Res. 12:1789-1806.\u003c/li\u003e\n\u003cli\u003eOnyoh EF, Hsu WF, Chang LC, Lee YC, Wu MS, Chiu HM (2019) The Rise of Colorectal Cancer in Asia: Epidemiology, Screening, and Management. Curr Gastroenterol Rep.21:36. https://doi.org/10.1007/s11894-019-0703-8. \u003c/li\u003e\n\u003cli\u003eSiegel RL, Jakubowski CD, Fedewa SA, Davis A, Azad NS (2020) Colorectal Cancer in the Young: Epidemiology, Prevention, Management. Am Soc Clin Oncol Educ Book. 40:1-14.https://doi.org/10.1200/EDBK_279901.\u003c/li\u003e\n\u003cli\u003eChang CK, Chiu PF, Yang HY, Juang YP, Lai YH, Lin TS, Hsu LC, Yu LC, Liang PH (2021) Targeting Colorectal Cancer with Conjugates of a Glucose Transporter Inhibitor and 5-Fluorouracil. J Med Chem. 64:4450-4461. https://doi.org/10.1021/acs.jmedchem.0c00897.\u003c/li\u003e\n\u003cli\u003eXie T, Geng J, Wang Y, Wang L, Huang M, Chen J, Zhang K, Xue L, Liu X, Mao X, et al (2017) FOXM1 evokes 5-fluorouracil resistance in colorectal cancer depending on ABCC10. Oncotarget.8:8574-8589. https://doi.org/10.18632/oncotarget.14351.\u003c/li\u003e\n\u003cli\u003eBaguley BC (2010) Multidrug resistance in cancer. Methods Mol Biol. 596:1-14. https://doi.org/10.1007/s12033-010-9321-2.\u003c/li\u003e\n\u003cli\u003eBukowski K, Kciuk M, Kontek R (2020) Mechanisms of Multidrug Resistance in Cancer Chemotherapy. Int J Mol Sci. 21:3233.https://doi.org/10.3390/ijms21093233.\u003c/li\u003e\n\u003cli\u003eChen CJ, Huang JY, Huang JQ, Deng JY, Shangguan XH, Chen AZ, Chen LT, Wu WH (2023) Metformin attenuates multiple myeloma cell proliferation and encourages apoptosis by suppressing METTL3-mediated m6A methylation of THRAP3, RBM25, and USP4. Cell Cycle. 22:986-1004. https://doi.org/10.1080/15384101.2023.2170521. \u003c/li\u003e\n\u003cli\u003eLiu S, Zhuo L, Wang J, Zhang Q, Li Q, Li G, Yan L, Jin T, Pan T, Sui X, et al (2020) METTL3 plays multiple functions in biological processes. Am J Cancer Res. 10:1631-1646.\u003c/li\u003e\n\u003cli\u003eDeng X, Su R, Weng H, Huang H, Li Z and Chen J (2018) RNA N(6)-methyladenosine modification in cancers: current status and perspectives. Cell Res. 28:507-517. https://doi.org/10.1038/s41422-018-0034-6.\u003c/li\u003e\n\u003cli\u003eZeng C, Huang W, Li Y, Weng H (2020) Roles of METTL3 in cancer: mechanisms and therapeutic targeting. J Hematol Oncol. 13:117. https://doi.org/10.1186/s13045-020-00951-w.\u003c/li\u003e\n\u003cli\u003eXu J, Chen Q, Tian K, Liang R, Chen T, Gong A, Mathy NW, Yu T, Chen X (2020) m6A methyltransferase METTL3 maintains colon cancer tumorigenicity by suppressing SOCS2 to promote cell proliferation. Oncol Rep. 44:973-986. https://doi.org/10.3892/or.2020.7665.\u003c/li\u003e\n\u003cli\u003eZhou D, Tang W, Xu Y, Xu Y, Xu B, Fu S, Wang Y, Chen F, Chen Y, Han Y, et al (2021) METTL3/YTHDF2 m6A axis accelerates colorectal carcinogenesis through epigenetically suppressing YPEL5. Mol Oncol. 15:2172-2184. https://doi.org/10.1002/1878-0261.12898.\u003c/li\u003e\n\u003cli\u003eChen H, Gao S, Liu W, Wong CC, Wu J, Wu J, Liu D, Gou H, Kang W, Zhai J, et al (2021) RNA N6-Methyladenosine Methyltransferase METTL3 Facilitates Colorectal Cancer by Activating the m6A-GLUT1-mTORC1 Axis and Is a Therapeutic Target. Gastroenterology. 160:1284-1300. https://doi.org/10.1053/j.gastro.2020.11.013. \u003c/li\u003e\n\u003cli\u003eDeng R, Cheng Y, Ye S, Zhang J, Huang R, Li P, Liu H, Deng Q, Wu X, Lan P, et al (2019) m6A methyltransferase METTL3 suppresses colorectal cancer proliferation and migration through p38/ERK pathways. Onco Targets Ther. 12:4391-4402. https://doi.org/10.2147/OTT.S201052. \u003c/li\u003e\n\u003cli\u003ePan X, Hong X, Li S, Meng P, Xiao F (2021) METTL3 promotes adriamycin resistance in MCF-7 breast cancer cells by accelerating pri-microRNA-221-3p maturation in a m6A-dependent manner. Exp Mol Med. 53:91-102. https://doi.org/10.1038/s12276-020-00510-w. \u003c/li\u003e\n\u003cli\u003eDominissini D, Moshitch-Moshkovitz S, Schwartz S, Salmon-Divon M, Ungar L, Osenberg S, Cesarkas K, Jacob-Hirsch J, Amariglio N, Kupiec M, et al (2012) Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature.485:201-206. https://doi.org/10.1038/nature11112.\u003c/li\u003e\n\u003cli\u003eLi R, Song Y, Chen X, Chu M, Wang ZW, Zhu X. (2021). METTL3 increases cisplatin chemosensitivity of cervical cancer cells via downregulation of the activity of RAGE. Mol Ther Oncolytics. 22:245-255. doi: 10.1016/j.omto.2021.05.013.\u003c/li\u003e\n\u003cli\u003eLandriscina M, Amoroso MR, Piscazzi A, Esposito F (2010) Heat shock proteins, cell survival and drug resistance: the mitochondrial chaperone TRAP1, a potential novel target for ovarian cancer therapy. Gynecol Oncol. 117:177-82. https://doi.org/10.1016/j.ygyno.2009.10.078.\u003c/li\u003e\n\u003cli\u003eMaddalena F, Sisinni L, Lettini G, Condelli V, Matassa DS, Piscazzi A, Amoroso MR, La Torre G, Esposito F, Landriscina M (2013) Resistance to paclitxel in breast carcinoma cells requires a quality control of mitochondrial antiapoptotic proteins by TRAP1. Mol Oncol. 7:895-906. https://doi.org/10.1016/j.molonc.2013.04.009.\u003c/li\u003e\n\u003cli\u003eAgorreta J, Hu J, Liu D, Delia D, Turley H, Ferguson DJ, Iborra F, Pajares MJ, Larrayoz M, Zudaire I, et al (2014) TRAP1 regulates proliferation, mitochondrial function, and has prognostic significance in NSCLC. Mol Cancer Res. 12:660-669.https://doi.org/10.1158/1541-7786.\u003c/li\u003e\n\u003cli\u003eBhattarai PY, Kim G, Poudel M, Lim SC, Choi HS (2021) METTL3 induces PLX4032 resistance in melanoma by promoting m6A-dependent EGFR translation. Cancer Lett.522:44-56. https://doi.org/10.1016/j.canlet.2021.09.015.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"METTL3, TRAP1, 5-FU, Chemosensitivity, CRC","lastPublishedDoi":"10.21203/rs.3.rs-3853872/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3853872/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e5-Fluorouracil (5-FU) stands as the frontline chemotherapeutic for colorectal cancer (CRC). However, the enduring challenge of chemoresistance to 5-FU persists in clinical practice, and the precise regulatory mechanisms governing 5-FU response and resistance in CRC remain elusive. This study aims to investigate the role and mechanisms of METTL3 in regulating 5-FU chemosensitivity in CRC cells. Practically, 5-FU treatment not only hindered cell viability and induced apoptosis but also led to a reduction in METTL3 expression in HCT-116 and HCT-8 cells. Through a range of assays including drug sensitivity, EdU, colony formation, TUNEL staining, and flow cytometry, we unveiled that METTL3 depletion heightened 5-FU sensitivity and augmented apoptosis induction in vitro and in vivo. Conversely, METTL3 overexpression conferred HCT-116 and HCT-8 cells with resistance to 5-FU. Mechanistically, METTL3 regulates 5-FU sensitivity and apoptosis induction by modulating TRAP1 expression. Further, m6A colorimetric ELISA and MeRIP-qPCR assays demonstrated that METTL3 regulated TRAP1 expression in an m6A-dependent manner. Furthermore, the overexpression of TRAP1 mitigated the cytotoxic effects of 5-FU on HCT-116 and HCT-8 cells. In conclusion, this study uncovers the pivotal role of the METTL3/TRAP1 axis in modulating 5-FU chemosensitivity in CRC.\u003c/p\u003e","manuscriptTitle":"The METTL3/TRAP1 Axis as a Key Regulator of 5-Fluorouracil Chemosensitivity in Colorectal Cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-15 10:42:37","doi":"10.21203/rs.3.rs-3853872/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-03-07T17:24:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-20T06:11:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5608a211-bec9-4f84-b432-3169552bb086","date":"2024-02-18T11:02:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4fdd2214-8237-4ace-9181-6938963e8371","date":"2024-02-06T00:22:07+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-02-03T14:08:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-26T20:11:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-12T01:25:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Biochemistry","date":"2024-01-11T14:47:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6a7ce830-50e4-47f4-9b44-dc3ba94ce4ea","owner":[],"postedDate":"January 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-23T16:04:55+00:00","versionOfRecord":{"articleIdentity":"rs-3853872","link":"https://doi.org/10.1007/s11010-024-05116-8","journal":{"identity":"molecular-and-cellular-biochemistry","isVorOnly":false,"title":"Molecular and Cellular Biochemistry"},"publishedOn":"2024-09-17 15:57:57","publishedOnDateReadable":"September 17th, 2024"},"versionCreatedAt":"2024-01-15 10:42:37","video":"","vorDoi":"10.1007/s11010-024-05116-8","vorDoiUrl":"https://doi.org/10.1007/s11010-024-05116-8","workflowStages":[]},"version":"v1","identity":"rs-3853872","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3853872","identity":"rs-3853872","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-20T11:00:21.680559+00:00
License: CC-BY-4.0