Transcriptional Level of Cumulus-Associated GJA1, PTX3, PRSS35, and SERPINE2 Genes with Oocytes and Embryonic Development in Water Buffalo

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-16

This study assessed the in vitro maturation and embryonic development of buffalo oocytes, finding that higher expression of cumulus-associated genes GJA1, PTX3, PRSS35, and SERPINE2 correlated with better developmental potential.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-16 · read from full text

The study evaluated how morphologically graded cumulus-oocyte complexes (COCs) from slaughterhouse-derived water buffalo ovaries (group A vs group B, differing in cumulus mass/expansion) performed during in-vitro maturation, fertilization, and embryonic culture, and assessed associated expression patterns of cumulus-associated GJA1, PTX3, PRSS35, and SERPINE2 using qRT-PCR in cumulus cells from immature and matured COCs and in fertilized early embryos. Group A COCs showed higher cumulus expansion and produced significantly higher cleavage and blastocyst rates than group B COCs, and transcriptional analysis showed significantly higher expression of the four target genes in group A compared with group B. A key caveat noted is that only groups A and B were included for the gene expression study, excluding other morphologically graded categories (C and D). This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: In the present study, the potential of different groups of cumulus-oocyte complexes (COC’s) for in-vitro maturation (IVM) and embryonic development was assessed in two groups of COC’s of water buffalo. Further, the association of the expression pattern of cumulus-associated GJA1, PTX3, PRSS35, and SERPINE2 genes and their effects on embryonic development was analyzed. Slaughterhouse-derived buffalo oocytes were graded into group A and B based on surrounding cumulus rings. Out of 1000 ovaries, an equal number of 410 COC’s were taken in both the A and B groups. In-vitro maturation (IVM) was carried out using Slaughterhouse-derived buffalo epididymis. A remarkable degree of cumulus expansion was noticed in group A (92.68%) as compared to group B (81.25%) oocytes. On IVF and embryo culture, group A COC’s produced a significantly higher rate of cleavage and blastocyst (92.682±0.7179% and 42.682±0.9683%) as compared to group B COC’s (85.365±0.7608% and 31.707±0.9688%), respectively. The transcriptional analysis of cumulus-associated GJA1, PTX3, PRSS35, and SERPINE2 genes expression by quantitative Real Time-PCR (qRT-PCR) revealed a significantly higher expression in group A as compared to group B COC’s. Result: It was revealed that oocytes having good cumulus mass had a higher developmental potential. Based on differential gene expression of cumulus-associated genes, different quality of COC’s, and the resultant embryos after IVF, it was concluded that these genes could be used as a marker for predicting the developmental competence of the oocytes. Conclusion: It concluded from the study that morphologically good quality of COC’s had a higher developmental competence. Also, the differential expressions of cumulus-associated genes in cumulus cells and embryos, we can conclude that these genes could be used as marker genes for predicting the developmental competence of buffalo’s oocytes.
Full text 132,770 characters · extracted from preprint-html · click to expand
Transcriptional Level of Cumulus-Associated GJA1, PTX3, PRSS35, and SERPINE2 Genes with Oocytes and Embryonic Development in Water Buffalo | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transcriptional Level of Cumulus-Associated GJA1, PTX3, PRSS35, and SERPINE2 Genes with Oocytes and Embryonic Development in Water Buffalo Lalit Jeena, D.K. Singh, Sandeep Rahangdale, Ajit Pratap Singh, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1289084/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract Background: In the present study, the potential of different groups of cumulus-oocyte complexes (COC’s) for in-vitro maturation (IVM) and embryonic development was assessed in two groups of COC’s of water buffalo. Further, the association of the expression pattern of cumulus-associated GJA1 , PTX3, PRSS35, and SERPINE2 genes and their effects on embryonic development was analyzed. Slaughterhouse-derived buffalo oocytes were graded into group A and B based on surrounding cumulus rings. Out of 1000 ovaries, an equal number of 410 COC’s were taken in both the A and B groups. In-vitro maturation (IVM) was carried out using Slaughterhouse-derived buffalo epididymis. A remarkable degree of cumulus expansion was noticed in group A (92.68%) as compared to group B (81.25%) oocytes. On IVF and embryo culture, group A COC’s produced a significantly higher rate of cleavage and blastocyst (92.682±0.7179% and 42.682±0.9683%) as compared to group B COC’s (85.365±0.7608% and 31.707±0.9688%), respectively. The transcriptional analysis of cumulus-associated GJA1 , PTX3, PRSS35, and SERPINE2 genes expression by quantitative Real Time-PCR (qRT-PCR) revealed a significantly higher expression in group A as compared to group B COC’s. Result: It was revealed that oocytes having good cumulus mass had a higher developmental potential. Based on differential gene expression of cumulus-associated genes, different quality of COC’s, and the resultant embryos after IVF, it was concluded that these genes could be used as a marker for predicting the developmental competence of the oocytes. Conclusion: It concluded from the study that morphologically good quality of COC’s had a higher developmental competence. Also, the differential expressions of cumulus-associated genes in cumulus cells and embryos, we can conclude that these genes could be used as marker genes for predicting the developmental competence of buffalo’s oocytes. Cumulus-oocyte complexes (COC’s) in-vitro fertilization embryo gene expression. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background In-vitro maturation (IVM), in-vitro fertilization (IVF), and gamete cryopreservation technologies provide a practical means for producing a large number of bovine embryos at a low cost for research and commercial settings [ 1 – 3 ]. Various factors have been affected the successful In-Vitro production of buffalo embryos including a low number of follicles on the ovaries, sperm mortality, in-vitro laboratory conditions. [ 4 – 5 ], a poor recovery rate of the oocytes [ 6 – 7 ], and poor in-vitro fertilization efficiency [ 8 – 10 ]. In early embryo development, defining oocyte quality remains one of the most difficult challenges. Follicular growth and maturation are prerequisites to oocyte fertilization and subsequent early embryo development [ 8 ]. Among all the events involved in this process, those taking place precisely at the pre-ovulatory stage within the cumulus-oocyte-complexes (COC’s) might offer new criteria for choosing embryos with the best development ability [ 11 – 13 ]. Previous studies emphasized the roles of cumulus mass in nurturing oocyte growth, gradual acquisition of oocyte developmental competence suggested that cumulus cells metabolize the bulk of glucose consumed by the COC’s, supplying metabolic intermediates like pyruvate, mainly through glycolysis, to the oocyte and regulating the oocyte gene transcription [ 14 – 16 ]. In the livestock sector, in-vitro fertilization (IVF) technology can be a useful tool for fruitful output in mammalian species like cows, buffaloes, goats, and pigs. The good qualities of cumulus cells (CC’s) are very important for successful in-vitro fertilization. Oocyte cumulus undoubtedly plays an important role in oocyte quality and maturation but the eject mechanism behind this is still unknown [ 17 ]. Therefore, an extensive study is required to analyze whether the developmental potential of the COC’s is associated with the expression of different cumulus genes in terms of maturation, fertilization, and embryonic development. Works of literature show that genes such as GJA1, PRSS35, PTX3 , and SERPINE2 play a crucial role in oocyte maturation, fertilization, and embryonic development [ 18 – 24 ]. However, literature elucidating these cumulus-associated gene expressions, their significance, and the effect of cumulus cell layer/mass toward the embryonic developmental process are scarce in livestock. Cumulus-associated GJA1 gene is the major gap junction α1 protein or connexin43 , essential for oocyte fertilization potential and embryo quality [ 18 ]. PRSS35 gene belongs to the trypsin class of serine proteases, which is essential for the tissue remodeling and functions of the ovary during folliculogenesis and ovulation [ 19 ]. The gene PTX3 (Pentraxin-related protein 3) is linked to extracellular matrix (ECM) hyaluronan and is a potentially reliable predictor of embryo developmental competence [ 20 ]. The SERPINE2 (serine proteases E2) gene is considered a potential pregnancy biomarker [ 21 ] and is extensively expressed in reproductive tissues [ 22 – 24 ]. Our aim was, therefore, to evaluate the effects of cumulus cell mass on oocyte competence in terms of oocytes maturation and post-fertilization developments along with the expression of GJA1 , PTX3, PRSS35 , and SERPINE2 genes in cumulus cells according to stages in oocyte maturation and embryonic developmental competence in slaughterhouse derived buffalo oocytes. Methods All the chemicals and media were purchased from Sigma-Aldrich Chemicals Company (St. Louis, Monsanto) and the disposable plastic wares were from Nunc (Roskilde, Denmark) unless otherwise mentioned. Oocyte Aspiration And Grading Under a total of 30 trials (Sample size calculated by using, n=Z 2 *P (P-1)/D 2 formula), buffalo ovaries were collected from the large animal abattoir aseptically in normal saline solution (37ºC, pH 7.0), supplemented with gentamicin (50 µg/ml). The ovaries were trimmed and washed 3-4 times in Dulbecco’s phosphate buffer saline (1X, DPBS). This was followed by a quick wash of 30-40 seconds with 70% ethanol and finally rinsed with DPBS. Oocytes were aspirated from 6-8 mm ovarian follicles by follicular aspiration method in a pre-warm (37ºC) DPBS medium. The oocytes were washed 3-4 times in TCM-199 (washing media, Hyclone), supplemented with 7.5% (v/v) fetal bovine serum (FBS, Hyclone,) plus 50 mg/ml gentamicin. Recovered oocytes were grouped into 4 categories A, B, C, and D [ 25 ], following the morphology of cumulus mass and cytoplasmic appearance of oocytes. Group A oocytes had a 3-4 compact layer of cumulus mass with evenly granular homogenous cytoplasm, whereas group B oocytes had 2-3 layers of cumulus mass with evenly granular homogenous cytoplasm. The oocytes with complete or incomplete 1-2 layers of cumulus mass with irregular dark ooplasm, and no cumulus mass with irregular dark ooplasm, were categorized under the C and D group of oocytes, respectively (Fig. 1 a). Only group A and B COC’s were taken for the gene expression study. Further, for gene expression analysis, oocytes from both groups were divided into three subsequent stages viz ., cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos. In-vitro maturation (IVM) In-vitro maturation medium containing TCM-199 Supplemented with 10µg/ml follicle-stimulating hormone (FSH), luteinizing hormone (LH), 1µg/ml estradiol, 7.5 percent (v/v) fetal bovine serum (FBS), 50 µg/ml gentamicin, and 0.8 mM/ml sodium pyruvate. It was used for in-vitro maturation of oocytes in groups of 30 oocytes per droplet. The droplets were overlaid with sterile pre-equilibrated mineral oil. The maturation process was carried out under a humidified atmosphere (99%) for 24 hours in a CO 2 incubator having a 5% CO 2 level at 37°C. The cumulus expansion and presence of the first polar body were observed under the inverted zoom microscope (Nikon, 100X), to assess the in vitro maturation of oocytes. Sperm preparation for in-vitro fertilization (IVF) and embryo culture Under 30 experimental trials, sperms were collected from abattoir-derived epididymis and processed under sterile conditions as described earlier for ovaries. Sperms were harvested from tubules of epididymis with a fine and gentle incision with a sterile surgical blade and collected in a sterile tube containing 10 ml of Bracket and Oliphant (BO) media, supplemented with 1mM caffeine sodium benzoate. The sperm concentration, morphology, and gross motility were observed under the inverted microscope (Nikon, 100X). For in-vitro fertilization, the sperms were prepared and capacitated for matured oocytes as described by Jeena et al 2018 [ 26 ]. In short, exudate sperms suspension with BO media was centrifuged at 168G for 10 min and the supernatant was discarded. This step was repeated twice. The pellet was resuspended in 5ml of BO fertilization media fortified with 1% BSA plus 50 mg/ml heparin and centrifuged at 168 G for 5 min. The harvested pellet was re-suspended in 1ml BO fertilization media and centrifuged at 168 G for 1min. The pellet was loosened with a fine bore pasture pipette and kept inside the CO 2 incubator for 30 min for capacitation and to allow good quality sperms to swim up. At the same time 30 matured oocytes from both groups A and B were transferred into a pre-equilibrated (38.5°C) 50µl BO fertilization droplet overlaid with mineral oil. After 30 min capacitated sperms with a final concentration of 10 6 were taken from the top layer of sperm suspension and co-incubated with oocytes at 5 percent CO 2 at 38.5°C temperature under a humidified atmosphere for 18 h (Fig. 1 b). After 18 h of co-incubation, oocytes were denuded with 1 percent of hyaluronidase. The presumptive zygotes (Fig. 1 c and Fig. 1 d) were cultured in RVCL media (Research Vitro Cleave Medium, COOK, Australia). Each group of embryos were assessed for their embryonic developmental stages as cleavage (Fig. 1 e), 4 cells (Fig. 1 f), compact morula (Fig. 1 g), and blastocyst development (Fig. 1 h). Primer designing The Primers for β-actin, PTX3, PRSS35, and SERPINE2 were designed by using online software PRIMER EXPRESS 3.0. The GJA1 gene primer was taken as a reference primer. Primer sequence specificity was checked by an online available database from BLAST, NCBI (Tab. 1 ). Table 1 Details of qRT-PCR (quantitative Real Time-PCR) primers S. No. Gene name Primer Sequence (5’-3’) Amplicon size 1. 1 β-actin (R) CACCCAGCACAATGAAGA 118bp β-actin (F) TGCTTGCTGATCCACATC 3. SERPINE2 (F) AAGGGTTTGTGGAGATCACG 170bp SERPINE2 (R) TAGGGCAGCTCGATGAAGTT 5. PRSS35 (F) CGACTACATCAAAGGCAGCA 179bp PRSS35 (R) ATCCCTTTCTCCTCCTTCCA 7. PTX3 (F) CCATGCGTTCCAAGAAGATT 217bp PTX3 (R) GCGACCAGTCTGTTTTCCTC 9. GJA1 (F) CCTGCCGCAATTACAACAAACAAG 425bp [25] GJA1 (R) ATCCCTAACACCCCCAATGAACCA F* forward primer; R* reverse primer Gene expression level of cumulus-associated GJA1, PTX3 , PRSS35 , and SERPINE2 genes Cumulus-oocyte complexes (COC’s) were denuded in 0.1 percent hyaluronidase for 10 min with a gentle vortex to remove the cumulus cells. The total RNA was extracted by the Trizol method from cumulus cells of both groups (A and B), and also from their subsequent stages of immature cumulus cells of COC’s, matured COC’s, and fertilized early embryos. A total of 30 COC’s from both groups were taken for RNA extraction. cDNA was prepared by using the first-strand cDNA synthesis kit (Fermentas, K1622) from an equal amount of total RNA. qRT-PCR was performed with a total volume of 20µl containing cDNA (1µl), 1pico- mole of reverse and forward primer (Table 1 ), and 10µl of 2X SYBER green master mix (Applied Biosciences). All reactions were performed in triplicate. The relative quantification of mRNA of each gene was evaluated by qRT-PCR (Applied Biosystems, 7300) using SYBR green chemistry. The relative gene expression analysis of GJA1, PTX3, PRSS35 , and SERPINE2 genes was analyzed by using Livak and Schmittgen [ 27 ] formulation i.e. , comparative 2ˉΔΔCt method. The housekeeping gene β-actin was used as an endogenous loading control to normalize the relative gene expression. Immature COC’s of group A oocyte were taken as a referral control (1.0) for the expression analysis of cumulus-associated GJA1, PTX3, PRSS35 , and SERPINE2 genes in both the groups. The purity of amplified products was checked by Ethidium Bromide (EtBr, 0.5µg/ml) stained with 1.8 percent agarose gel electrophoreses. Statistical analysis The percent data of embryonic development were transformed by arcsine transformation (log N ) and subjected to analysis of variance by Hierarchical analysis of variance design, and the mean differences were compared by Duncan’s Multiple Range Test (P<0.05). Results In-vitro maturation (IVM) of abattoir-derived buffalo oocytes Under 30 experimental trials, a total of 2070 COC’s were retrieved from 1000 slaughterhouse-derived ovaries, out of which 550 were from group A, 800 from group B (Table 2 ), and the rest of 720 were from group C and D. Only good quality COC’s of group A and B were taken for in-vitro maturation and in in-vitro fertilization. The analysis of variance of the data on embryonic development (Table 3 ) revealed a highly significant (P0.01) between the day of the experiment (bull effect), indicating that epididymal semen collected on a different day did not significantly affect embryonic development. Further, the embryonic development stages within the group differed significantly, shown in Table 3 . It was observed that the in-vitro maturation rate of group A was substantially higher as compared to group B oocytes, in terms of first polar body extrusion (Table 2 ). The cleavage (2 cells), 8 cells, morula and blastocyst development rate (Table 4 ) in group B (85.365±0.7608, 65.853±0.7608, 51.219±0.9575 and 31.707±0.9688%) COC’s were found significantly lower (P≤0.05) compared to group A (92.682±0.7179, 78.804±0.6878, 59.756±0.9466 and 42.682± 0.9683%) in respect of all the embryonic development stages. Table 2 In-vitro maturation of group A and B of oocytes. Ovaries collected from buffalo slaughterhouse Oocytes aspirated Grading of oocytes taken for study No. of oocytes set for IVM Oocytes showing polar body 1000 2070 (2.07 oocytes ovary) Group A 550 (26.57%) 508 (92.36%) Group B 800 (38.64%) 650 (81.25%) Values within parentheses indicate mean±SE% Table 3 Analysis of variance for embryonic development. Source of variation Degree of freedom Mean Square value Between Group 1 0.535** Between the day of experiment (bull effect) 28 0.401 NS Between EDS within group 3 23.812** Error 101 0.003 EDS-Embryonic development stage; ** Significant (P<0.01), NS- Non-Significant. Table 4 Mean embryonic development percentage in group A and B in-vitro fertilized oocytes. No. of oocytes in each group Embryonic development stages (Mean±SE) 2-4 cells (%) 8-16 cells Morula (%) Blastocyst (%) Group A - 410 fertilized oocytes 380 (92.682±0.7179) a 320 (78.804±0.6878) a 245 (59.756±0.9466) a 175 (42.682±0.9683) a Group B - 410 fertilized oocytes 350 (85.365±0.7608) b 270 (65.853±0.7608) b 220 (51.219±0.9575) b 130 (31.707±0.9688) b Value with different superscripts within column differs significantly (P≤0.05). Transcriptional level GJA1, PTX3, PRSS35 , and SERPINE2 genes in group A and B oocytes The immature COC’s of group A oocytes were taken as a referral control (1.0) for the expression analysis of GJA1, PTX3, PRSS35 , and SERPINE2 genes in both group A and B. Further, both the groups were divided into their three subsequent stages of cumulus cell of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos. Cumulus-associated GJA1 gene expression and oocyte integrity The relative expression of the GJA1 gene was found significantly (P≤0.05) higher in cumulus cells of immature COC’s (1.0) compared to matured cumulus cells of COC’s (0.74) and in the fertilized early embryos (0.22) of group A. The expression pattern was also significantly lower in group B immature cumulus cells of COC’s (0.82), matured cumulus cells of COC’s (0.42), and the fertilized early embryos (0.20) compared to group A (Fig. 2a). The present study revealed that the GJA1 gene was strongly associated with immature cumulus cells of COC’s, and the abundance of this gene was reduced significantly towards the progression of developmental stages till fertilization (shown in Fig. 2a-b). Figure 2a Relative quantification of the GJA1 gene in cumulus cells of COC’s and in-vitro fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature COC’s. GA-M - Group A, cumulus of matured COC’s. GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. b Transcriptional level of GJA1 gene. Lane 1 - Endogenous control β actin. Lane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells of Matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group B. Cumulus-expressed PRSS35 and PTX3 mRNA levels correlated with oocyte maturation It was observed that PRSS35 and PTX3 had significantly (P≤0.05) higher expression levels in matured cumulus cells of COC’s of both group A (1.3 and 1.3) and group B (1.2 and 1.1). Whereas, the expression levels of PRSS35 and PTX3 were significantly lower (P≤0.05) in fertilized early embryos of both group A (0.33 and 0.52) and B (0.22 and 0.24). Similar results were observed in immature cumulus cells of COC’s in group A (1.0) and B (0.91 and 0.80). The results showed that the relative transcripts of PRSS35 and PTX3 genes increased significantly in in-vitro matured stages, but were reduced markedly in fertilized early embryos irrespective of oocyte groups (Fig. 3 a-b and 4a-b). Figure 4a Relative quantification of the PTX3 gene in cumulus cells of COC’s and in-vitro fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature COC’s. GA-M - Group A, cumulus of matured COC’s. GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. b Transcriptional level of PTX3 gene. Lane 1 - Endogenous control β actin . Lane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group B. mRNA expression pattern of SERPINE2 gene in cumulus cells associated with fertilization and embryonic development : The results showed that the relative expression of the SERPINE2 gene was significantly higher (P≤0.05) in fertilized early embryos of both group A (1.6) and B (1.08). As shown in Fig. 5a, the SERPINE2 gene expression was significantly lower (P≤0.05) in matured oocytes of both groups A (0.59) and B (0.46) along with immature group B (0.79) and group A (1.0) oocytes. The expression level of the SERPINE2 gene in embryos produced by in-vitro fertilization was significantly higher in fertilized early embryos than the cumulus cells of immature and matured COC’s (Fig. 5a-b). Figure 5a Relative quantification of the SERPINE2 gene in cumulus cells of COC’s and in-vitro fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature of COC’s. GA-M - Group A, cumulus of matured COC’s. GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. b Transcriptional level of SERPINE2 gene. Lane 1 - Endogenous control β actin. Lane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells, of matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells, of matured COC’s and fertilized early embryos of group B. The overall expression pattern of cumulus-associated GJA1, PRSS35, PTX3 , and SERPINE2 genes at their subsequent developmental stages in both groups were analyzed collectively. The expressions of these genes were found significantly higher in group A compared to group B (Fig S1). The amplified products were confirmed by amplification plot, melting curve (Fig. 6 ), and agarose gel electrophoresis. The products were identified by their specific band size ( GJA1- 425bp, SERPINE2- 170bp, PRSS35- 179bp, and PTX3- 217bp) as shown in Fig. 2b, 3 b, 4b, and Fig. 5b. Discussion Cumulus cells (CC’s) originating from undifferentiated granulosa cells (GC’s) differentiate in mural granulosa cells (MGC’s) and CC’s during antrum formation in the follicle by the distribution of location. [ 5 – 6 ]. GJA1 is the major isoform of connexins between GCs (granulosa cells): MGCs–MGCs (mural granulosa cells) and MGCs–CCs (cumulus cells) [ 12 ]. Gap junctions transmit nutrients and small molecules such as ions, metabolites, amino acids, and intracellular signaling molecules from GCs to oocytes via CCs [ 18 – 19 ]. We observed the expression level of the GJA1 gene in immature cumulus cells of COC’s was significantly higher as compared to matured cumulus cells of COC’s and fertilized oocytes of both groups (A & B, Fig. 2a-b). A similar type of study was reported by Edry and workers, they found GJA1 -mediated gap junctional communication regulates oocyte meiosis resumption, and lower levels of GJA1 in cumulus cells are beneficial for oocyte maturation [ 28 ]. While Feuerstein and Mishra reported contrasting results wherein relative expression of the GJA1 gene was significantly lower in immature cumulus cells of COC’s [ 29 – 30 ]. However, GJA1 expression in cumulus cells surrounding the matured oocytes did not show any difference in developing embryos with good or poor morphology [ 29 ]. Hasegawa reported a significantly lower expression of GJA1 for embryos with good morphology [ 12 ]. Similarly, we revealed significantly lower expression of the GJA1 gene was observed in fertilized oocytes and matured cumulus cells of COC’s. PRSS35 belongs to the trypsin class of serine proteases, essential for follicular growth, ovulation, as well as for luteal formation and regression. PRSS35 gene expression was localized in theca cells of pre-antral follicles, the theca and granulosa cells of pre-ovulatory, ovulatory follicles, and developing corpus luteum [ 15 , 19 , 31 ]. Whereas, the PTX3 gene is localized in the cumulus matrix and plays a crucial role in cumulus expansion. Various cumulus proteins linked to extracellular matrix hyaluronan, are required for regulating cumulus integrity, which ensure cumulus expansion and oocyte maturation [ 14 – 15 , 18 , 20 , 32 – 35 ]. A previous study reported PRSS35 and PTX3 mRNA levels are associated with oocyte interiority and fertilization potential [ 15 ]. Our data revealed that PRSS35 and PTX3 mRNA levels are associated with the oocyte maturation potential (Fig. 2). The higher expression of PRSS35 and PTX3 genes were observed in cumulus cells of COC’s of matured oocytes of both groups (A & B, Fig. 3 a-b & Fig. 4a-b). However, it was found significantly lower in cumulus cells of immature COC’s and fertilized oocytes. Li et al [ 15 ] reported a relationship between PRSS35 expression and oocyte competence. While the expression of PTX3 has been reported to be significantly lower in cumulus cells from immature oocytes than in those from mature oocytes, which was found similar to our study. Similarly, Huang [ 32 ] demonstrated that the expression level of the PRSS35 gene plays an important role in oocyte nuclear maturation and gaining developmental competence. According to Miyakoshi the PRSS35 mRNA level increased at the time of ovulation and remained elevated in the developing corpus luteum [ 36 ]. Although the scientific literature regarding the association of the PRSS35 and PTX3 genes with the oocyte and embryo developments is less in livestock. However, some studies have been reported in a few species like mouse and human oocytes and embryos. Salustri and co-workers [ 34 ] reported the infertility of PTX3 null mice was associated with severe abnormalities of the cumulus ionophores and failure of in-vivo , but not in-vitro oocyte fertilization. Zhang [ 20 ] reported that the expression of the PTX3 gene in cumulus cells was indicative of oocyte and embryo quality. However, Diao and co-workers reported the PRSS35 -null mice to have no defects in female fertility, suggesting that the gene is non-functional for murine fertility as well as in embryonic development. Also, he did not detect any compensatory up-regulation of other proteases reported in the uterus; but, the expression of other protease-related genes cannot be ruled out [ 31 ]. However, this remains unclear in the case of mammalians. We found the higher expression of PRSS35 and PTX3 genes in cumulus cells of matured COC’s had a beneficial effect on oocyte competence and embryonic development. SERPINE2 is a Serpin peptidase inhibitor (clade E, member), which inhibits urokinase-type plasminogen activator (PLAU) and tissue-type plasminogen activator. These activators are associated with many types of reproductive processes, e.g., ovulation, embryonic development, and embryo implantation [ 22 – 24 ]. Hamel et al, reported the SERPINE2 mRNA levels in granulosa cells have been suggested to be a potential pregnancy biomarker [ 21 ]. Our data revealed that SERPINE2 mRNA levels are associated with oocyte fertilization potential. We found the expression of this gene was higher in fertilized oocytes of both groups (A & B, Fig. 5a-b). However, the expression of the SERPINE2 gene was lower in cumulus cells of immature and matured COC’s (Fig. 5a). Hamel and co-workers [ 13 ] also reported the SERPINE2 gene to be considered as a potential pregnancy biomarker and extensively expressed in reproductive tissues, the placenta, and the uterus [ 22 , 31 ]. Sadeesh et al , reported the silencing of SERPINE2 expression using small interfering RNAs or blockage of SERPINE2 protein using a specific antibody did not affect oocyte maturation [ 2 ]. However, in a mouse, higher levels of SERPINE2 were demonstrated to impair cumulus expansion and oocyte maturation [ 19 , 23 , 37 – 38 ]. Li and coworkers reported the higher SERPINE2 expression levels were detected in cumulus cells of human immature oocytes than in those of mature oocytes [ 15 ]. According to our data, we found the higher expression of the SERPINE2 gene in fertilized oocytes suggested its significant role in fertilization and embryonic development. The results of the present study showed that in all the cases, the expressions of cumulus-associated genes in group A were significantly up-regulated as compared to group B (supplementary Figure S1). The higher expression of these genes in group A COC’s can be related to higher embryonic development compared to group B COC’s showing down-regulation of all these genes compared to group A COC’s. It might be concluded that the significantly higher expression of the GJA1 gene in cumulus cells of immature COC’s along with PRSS35 and PTX3 genes in cumulus cells of matured COC’s have a positive impact on oocyte developments. Similarly, a higher expression of the SERPINE2 gene in fertilized early embryos may have beneficial effects on oocyte fertilization and embryonic development in buffalo. We found some contradictory results from a previous study which was in human embryos, where the study reported the GJA1 and SERPINE2 represent potential gene markers associated with oocyte maturation and PRSS35 may be correlated with oocyte fertilization potential [ 15 , 39 ]. However, our study model was buffalo’s embryos. Conclusion The selection of embryos with higher developmental potential has been one of the major factors in assisted reproductive technology (ART). Because, cumulus cells play a very important role in oocyte integrity and embryonic development. Although cumulus gene expression may represent a promising method compared with the currently used morphology-based method, more investigations are warranted. Thus, a prospective larger cohort study or the use of SET cumulus samples remains necessary to clarify the effectiveness. However, it was concluded from our study the morphologically good quality of COC’s had a higher developmental potential in terms of maturation, fertilization, and embryonic development as compared to oocytes having poor quality of COC’s (in both A & B groups). Based on molecular analysis of differential expressions of cumulus-associated genes we found the GJA1 gene associated with immature oocyte integrity, PTX3 and PRSS35 represent gene markers potentially associated with oocyte maturation, and SEPINE2 may be correlated with oocyte fertilization potential. In summary, GJA1, PRSS35, PTX3 , and SERPINE2 in cumulus cells of different quality of oocytes and their resultant embryos after IVF, we can conclude these genes could be used as biomarkers for predicting the developmental competence of buffalo’s oocytes. Declarations Funding Info : No funding Conflicts of interest/Competing interests: The authors declare that they have no Conflicts of interest. Ethics approval: There was no need for ethical approval for this study. Slaughterhouse-derived ovaries and epididymis were used for in-vitro transcriptional analysis of cumulus-associated genes. No live animals were used. Consent to Participate (Ethics): Not needed. In the in-vitro study, no live animals were used. Consent to Publish (Ethics): Not needed. In the in-vitro study, no live animals were used. Authors' contributions : Lalit Mohan Jeena wrote the manuscript. Bikash Chandra Sarkhel and Dharmendra Kumar helped in statistical analysis. Sandeep Rahangdale and Ajit Pratap Singh arranged the figures and references as per journal guidelines. Availability of data and material: All data and materials for the study were provided by the Director of Animal Biotechnology Centre, NDVSU Jabalpur, M.P., India. References Hansen PJ (2006) Realizing the promise of IVF in cattle - an overview. Theriogenology 65:119–125. doi: 10.1016/j Sadeesh EM (2015) In-vitro embryo production in buffalo: effects of culture system on pre-implantation development and gene expression pattern. Curr Sci 109(3):603–607 Kumar D, Shukla MK, Jeena LM, Rahangdale S, Kumari D, Singh A, Sarkhel BC (2016) Assessment of in-vitro maturation of oocytes derived from slaughterhouse goat ovaries. Ruminant Science 5(1):17–20. http://www.anandpub.com/archive-june-volume-2016-5-1-issue4 Huang RH, Zhou WH (2021) Granulosa cell biomarkers to predict oocyte and embryo quality in assisted reproductive technology. Reproductive and Developmental Medicine 5(1):30–77. .https://www.repdevmed.org/text.asp?2021/5/1/30/313684 Turathum B, Gao EM, Chian RC (2021) The Function of Cumulus Cells in Oocyte Growth and Maturation and in Subsequent Ovulation and Fertilization. Cells 2(9):2292. https://doi.org/ 10.3390/cells10092292 Nivet AL, Vigneault C, Blondin P, Sirard MA (2013) Changes in granulosa cells’ gene expression associated with increased oocyte competence in bovine. Reproduction 145(6):555–565. doi: 10.1530/REP130032 Pengfei L, Jinzhu M, Wenzhong L, George WS, Jianbo Y, Lihua L (2016) Transcriptome analysis of bovine ovarian follicles at predeviation and onset of deviation stages of a follicular wave. International Journal of Genomics 3472748:1-9. doi.org/10. 1155/2016/3472748 Da Broi MG, Giorgi VSI, Wang F, Keefe DL, Albertini D, Navarro PA (2018) Influence of follicular fluid and cumulus cells on oocyte quality: clinical implications. Journal of Assisted Reproduction Genetics 35(5):735–751. doi.org/10.1007/s10815-018-1143-3 Ferre LB, Bogliotti Y, Chitwood JL, Fresno C, Ortega HH, Kjelland ME, Ross RJ (2016) Effect of spermatozoa motility hyperactivation factors and gamete co-incubation duration on in-vitro bovine embryo development using flow cytometrically sorted spermatozoa. Reproduction Fertility and Development 29(4):805–814. doi: 10.1071/RD15289 Uhde K, van Tol HTA, Stout TAE, Bernard AJR (2018) Metabolomic profiles of bovine cumulus cells and cumulus-oocyte-complex-conditioned medium during maturation in vitro . Sci Rep 8:9477. doi.org/10.1038/s41598-018-27829-9 Anderson RA, Sciorio R, Kinnell H, Bayne RA, Thong KJ, De-Sousa PA (2009) Cumulus gene expression as a predictor of human oocyte fertilization, embryo development and competence to establish a pregnancy. Reproduction 138(4):629–637. doi: 10.1530/REP-09-0144 Hasegawa J, Yanaihara A, Iwasaki S, Mitsukawa K, Negishi M, Okai T (2007) Reduction of connexin 43 in human cumulus cells yields good embryo competence during ICSI. J Assist Reprod Genet 24:463–466. doi: 10.1007/s10815-007-9155-4 Ortiz-Escribano N, Smits K, Piepers S, Vanden-Abbeel E, Woelders H, Van-Soom A (2016) Role of cumulus cells during vitrification and fertilization of mature bovineoocytes: Effects on survival, fertilization, and blastocyst development. Theriogenology 86(2):635–641. doi: 10.1016/j Downs SM (2001) A gap-junction-mediated signal, rather than an external paracrine factor, predominates during meiotic induction in isolated mouse oocytes. Zygote 9(1):71–82. doi: 10.1017/s0967199401001071 Li HS, Lin MH, Hwu MY, Lu HC, Yeh YL, Chen JY, Lee KKR (2015) Correlation of cumulus gene expression of GJA1, PRSS35, PTX3 , and SERPINE2 with oocyte maturation, fertilization, and embryo development in human. Reproductive Biology and Endocrinology 13:93. doi: 10.1186/s12958-015-0091-3 Xia GL, Kikuchi K, Noguchi J, Izaike Y (2000) Short time priming of pig cumulus-oocyte complexes with FSH and forskolin in the presence of hypoxanthine stimulates cumulus cells to secrete a meiosis-activating substance. Theriogenology 53(9):1807–1815. doi: 10.1016/s0093-691x(00)00316-2 Ebner T, Moser M, Sommergruber M, Tews G (2003) Selection based on morphological assessment of oocytes and embryos at different stages of pre-implantation development: a review. Hum Reprod Update 9(3):251–262. 10.1093/humupd/dmg 021 Wang HX, Tong D, El-Gehani F, Tekpetey FR, Kidder GM (2008) Connexin expression and gap junctional coupling in human cumulus cells: contribution to embryo quality. Journal of Cellular and Molecular Medicine 13(5):972-84. doi: 10.1111/j.1582-4934 . 2008.00373.x Wahlberg P, Nylander A, Ahlskog N, Liu K, Ny T (2008) Expression and localization of the serine proteases high-temperature requirement factor A1, serine protease 23, and serine protease 35 in the mouse ovary. Endocrinology 149(10):5070-7. doi: 10.1210/en. 2007-1736 Zhang X, Jafari N, Barnes RB, Confino E, Milad M, Kazer RR (2005) Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertil Steril 83(1):1169–1179. doi: 10.1016/j.fertnstert.2004.11.030 Hamel M, Dufort I, Robert C, Gravel C, Leveille MC, Leader A (2008) Identification of differentially expressed markers in human follicular cells associated with competent oocytes. Molecular Human Reproduction 23(5):1118-27. dio: 10.1093/ humrep/ den048 Bedard J, Brule S, Price CA, Silversides DW, Lussier JG (2003) Serine protease inhibitor-E2 (SERPINE2) is differentially expressed in granulosa cells of dominant follicle in cattle. Molecular Reproduction Development 64(2):52–65. 10.1002/ mrd.10239 Chern SR, Li SH, Chiu CL, Chang HH, Chen CP, Chen EIT (2011) Spatiotemporal expression of SERPINE2 in the human placenta and its role in extravillous trophoblast migration and invasion. Reproduction Biology and Endocrinology 9:106. doi: 10.1186/1477-7827-9-106 Lee RK, Fan CC, Hwu YM, Lu CH, Lin MH (2011) SERPINE2 , an inhibitor of plasminogen activators, is highly expressed in the human endometrium during the secretory phase. Reproduction Biology and Endocrinology 23:9–38. doi: 10.1186/1477-7827-9-38 Jeena LM, Kumar D, Rahangdale S, Singh AP, Sarkhel BC (2019) Effect of cumulus cells of cumulus-oocyte complexes on in-vitro maturation, embryonic developmental and expression pattern of apoptotic genes after in-vitro fertilization in water buffalo (Bubalus bubalis) . Aniaml Biotechnology 31(2):135–141. dio:10.1080/10495398.2018. 1554580 Jeena L, Kumar D, Rahangdale S, Singh A, Sarkhel BC (2018) In-vitro Development Competence of Buffalo Oocytes- Effect of Oocytes Quality on Maturation, Embryonic Developments and Apoptosis. International Journal of Livestock Research 8(11):73–80. doi: 10.5455/ijlr.20180512064048 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2ˉ ∆∆Ct method. Methods 25(4):402–408. doi. org/10.1006/meth.2001.1262 Edry I, Sela-Abramovich S, Dekel N (2006) Meiotic arrest of oocytes depends on cell-to-cell communication in the ovarian follicle. Mol Cell Endocrinol 252(1–2):102–106. doi: 10.1016/j.mce.2006.03.009 Feuerstein P, Cadoret V, Dalbies-Tran R, Guerif F, Bidault R, Royere D (2007) Gene expression in human cumulus cells: one approach to oocyte competence. Hum Reprod 22(12):3069–3077. doi: 10.1093/humrep/dem336 Mishra A, Sharma GT, Kumar GS (2010) Expression profile of connexin 43 and poly A polymerase genes in buffalo ( Bubalus bubalis ) oocytes and developing embryos produced in-vitro . Journal of Applied Research 38(1):29-3. doi.org/10.1080/09712119 . 2010.9707149 Diao H, Xiao S, Li R, Zhao F, Ye X (2013) Distinct spatiotemporal expression of serine proteases Prss23 and Prss35 in periimplantation mouse uterus and dispensable function of Prss35 in fertility. PLoS One 8(2):e56757. doi:1o.1371/journal.pone.0056757 Huang X, Hao C, Shen X, Zhang Y, Liu X (2013) RUNX2, GPX3 and PTX3 gene expression profiling in cumulus cells are reflective oocyte/embryo competence and potentially reliable predictors of embryo developmental competence in PCOS patients. Reproductive Biology and Endocrinology 11:109. doi: 10.1186/1477-7827-11-109 Varani S, Elvin JA, Yan C, DeMayo J, DeMayo FJ, Horton HF, Byrne MC, Matzuk MM (2002) Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol Endocrinol 16(6):1154–1167. 10.1210/mend. 16.6.0859 Salustri A, Garlanda C, Hirsch E, De-Acetis M, Maccagno A, Bottazzi B, Doni A, Bastone A, Mantovani G, Beck-Peccoz P, Salvatori G, Mahoney DJ, Day AJ, Siracusa G, Romani L, Mantovani A (2004) PTX 3 plays a key role in the organization of the cumulus oophorus extracellular matrix and in in-vivo fertilization. Development 131:1577–1586. doi: 10.1242/dev.01056 Scarchilli L, Camaioni A, Bottazzi B, Negri V, Doni A, Deban L, Bastone A, Salvatori GA, Mantovani GS, Salustri A (2007) PTX3 interacts with inter-alpha-trypsin inhibitor: implications for hyaluronan organization and cumulus oophorus expansion. Journal of Biology and Chemistry 282(41):30161–30170. 10.1074/jbc.M7037 38200 Miyakoshi K, Murphy MJ, Yeoman RR, Mitra S, Dubay CJ, Hennebold JD (2006) The identification of novel ovarian proteases through the use of genomic and bioin-formatic methodologies. Biol Reprod 75(6):823–835. 10.1095/biolreprod.106.0522 90 Lu CH, Lee RK, Hwu YM, Lin MH, Yeh LY, Chen YJ, Lin SP, Li SH (2013) Involvement of the serine protease inhibitor, SERPINE2 , and the urokinase plasminogen activator in cumulus expansion and oocyte maturation. PLoS ONE 30(8):e74602. doi: 10.1371/journal.pone.0074602 Devjak R, Fon Tacer K, Juvan P, Virant Klun I, Rozman D, Vrtacnik Bokal E (2012) Cumulus cells gene expression profiling in terms of oocyte maturity in controlled ovarian hyperstimulation using GnRH agonist or GnRH antagonist. PLoS ONE 7(10):e47106. doi: 10.1371/journal.pone.0047106 Lonergan P, Rizos D, Gutierrez-Adan A, Moreira PM, Pintado B, de la Fuente J, Boland MP (2003) Temporal divergence in the pattern of messenger RNA expression in bovine embryos cultured from the zygote to blastocyst stage in-vitro or in-vivo . Biology of Reproduction 69(4):1424-31. doi. org/10.1095/biolreprod.103.018168 Supplementary Files FigS1.png Fig. S1 Comparative expression level of GJA1, PRSS35, PTX3, and SERPINE2 genes cumulus cells of immature and matured group A and B COC’s along with fertilized early embryos. GA - Group A and GB - Group B. RC (AI) - Referral Control (cumulus cells of immature COC’s of group A oocytes). AM - Group A, cumulus cells of matured COC’s. AF - Group A, fertilized early embryos. BI - Group B, cumulus cells of immature COC’s. BM - Group B, cumulus cells of matured COC’s. BF - Group B, fertilized early embryos. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Minor Revisions Needed 17 Feb, 2022 Reviews received at journal 27 Jan, 2022 Reviewers invited by journal 27 Jan, 2022 Editor assigned by journal 25 Jan, 2022 First submitted to journal 23 Jan, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1289084","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":79605914,"identity":"7bcb1773-87a4-4a60-9bc5-cd5073ec94ca","order_by":0,"name":"Lalit Jeena","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYFAC5gYGCRDN3gAkDCyI0cII1cJzAKRFgkgtYCCRACYJa9BtAGqxqLDJ45/5/OqGHwUSDPzt3Ql4tZgdADnsTFqxxO2csps9QIdJnDm7gbAWybbDiQ23c9Ju8AC1GEjkEqPl3//E+TfPpN38Q7yWhgOJG26wH7tNnC2HGRsOSBxLTtx4JofttoyBBA9hvxxvPvhYosYucd7x489uvvljI8ff3otfCwMzA8NhSGTwGIBJ/MqhgPEDmGJ/QJTqUTAKRsEoGHkAAFurSPW6g4OPAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-6532-8814","institution":"Maulana Azad Medical College","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Lalit","middleName":"","lastName":"Jeena","suffix":""},{"id":79605915,"identity":"5b7e222a-df4c-482d-991e-bd27908ca9b3","order_by":1,"name":"D.K. Singh","email":"","orcid":"","institution":"Nanaji Deshmukh Veterinary Science University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"D.K.","middleName":"","lastName":"Singh","suffix":""},{"id":79605916,"identity":"44001e9d-692d-4886-b489-0f1544565b2e","order_by":2,"name":"Sandeep Rahangdale","email":"","orcid":"","institution":"Nanaji Deshmukh Veterinary Science University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sandeep","middleName":"","lastName":"Rahangdale","suffix":""},{"id":79605917,"identity":"1e9611bc-bfc5-4702-81d9-1e05aa84c10f","order_by":3,"name":"Ajit Pratap Singh","email":"","orcid":"","institution":"Nanaji Deshmukh Veterinary Science University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ajit","middleName":"Pratap","lastName":"Singh","suffix":""},{"id":79605918,"identity":"baef2c00-e4d0-4f1d-a304-574dc2908717","order_by":4,"name":"B.C. Chandra Sarkhel","email":"","orcid":"","institution":"Nanaji Deshmukh Veterinary Science University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"B.C.","middleName":"Chandra","lastName":"Sarkhel","suffix":""}],"badges":[],"createdAt":"2022-01-23 16:04:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1289084/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1289084/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":17815427,"identity":"b853d060-703e-4cce-9384-f9e8853187b5","added_by":"auto","created_at":"2022-01-31 18:16:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1671924,"visible":true,"origin":"","legend":"\u003cp\u003eDifferent developmental stages of buffalo embryo. \u003cstrong\u003ea\u003c/strong\u003e \u003cem\u003eIn-vitro\u003c/em\u003e maturation of different grades of the oocyte (100X). \u003cstrong\u003eb\u003c/strong\u003e Co-incubated of capacitated sperms with matured oocytes (100X). \u003cstrong\u003ec\u003c/strong\u003e Pro-nucleus after fertilization (2PN, indicated with a red arrow, 200X). \u003cstrong\u003ed\u003c/strong\u003e Secondary polar body (red arrow, 200X). \u003cstrong\u003ee\u003c/strong\u003e Cleavage (200X). \u003cstrong\u003ef\u003c/strong\u003e 4-Cells (200X). \u003cstrong\u003eg\u003c/strong\u003e Compact morula (200X). \u003cstrong\u003eh\u003c/strong\u003e Blastocyst (100X).\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/d81f05cebb76bd99ff4d38ef.png"},{"id":17814881,"identity":"b0bf5f0b-9960-45fa-be59-f6144cee8b84","added_by":"auto","created_at":"2022-01-31 18:07:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":126270,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea \u003c/strong\u003eRelative quantification of the \u003cem\u003eGJA1\u003c/em\u003e gene in cumulus cells of COC’s and \u003cem\u003ein-vitro \u003c/em\u003efertilized group A and group B oocytes.\u003cstrong\u003e \u003c/strong\u003eRC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature\u0026nbsp;COC’s. GA-M - Group A, cumulus of matured COC’s. GB-M - Group B, cumulus of matured COC’s.\u0026nbsp;GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb \u003c/strong\u003eTranscriptional level of \u003cem\u003eGJA1\u003c/em\u003e gene.\u003cstrong\u003e \u003c/strong\u003eLane 1 - Endogenous control \u003cem\u003eβ actin.\u003c/em\u003e\u0026nbsp;Lane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s,\u0026nbsp;cumulus cells of Matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group B.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/9797b12393cdf5b17b7540e3.png"},{"id":17814950,"identity":"1ff74adc-d125-4132-8b9a-bd035e332078","added_by":"auto","created_at":"2022-01-31 18:10:28","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":128668,"visible":true,"origin":"","legend":"\u003cp\u003ea Relative quantification of the \u003cem\u003ePRSS35\u003c/em\u003e gene cumulus cells of COC’s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized\u0026nbsp;\u0026nbsp;group A\u0026nbsp;and group B oocytes.\u003cstrong\u003e \u003c/strong\u003eRC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature COC’s. GA-M - Group A, cumulus of matured COC’s.\u0026nbsp;GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb \u003c/strong\u003eTranscriptional level of \u003cem\u003ePRSS35\u003c/em\u003e gene.\u003cstrong\u003e \u003c/strong\u003eLane 1 - Endogenous control \u003cem\u003eβ actin\u003c/em\u003e. Lane 5 = 100bp ladder.Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group B.\u0026nbsp;\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/11fda5d2f0c83865175f9344.png"},{"id":17815053,"identity":"5afb11fb-aa12-4bc6-af1f-8408494edf24","added_by":"auto","created_at":"2022-01-31 18:13:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":135055,"visible":true,"origin":"","legend":"\u003cp\u003ea Relative quantification of the \u003cem\u003ePTX3\u003c/em\u003e gene in cumulus cells of COC’s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized group A and group B oocytes.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eRC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature\u0026nbsp;COC’s. GA-M - Group A, cumulus of matured COC’s. GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb \u003c/strong\u003eTranscriptional level of \u003cem\u003ePTX3 \u003c/em\u003egene.\u0026nbsp;Lane 1\u003cstrong\u003e - \u003c/strong\u003eEndogenous control \u003cem\u003eβ actin\u003c/em\u003e. Lane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells of matured COC’s and fertilized early embryos of group B.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/5e6c65fa1ede56ea5e8deec6.png"},{"id":17815055,"identity":"f32a6372-e82a-4245-8771-9aeb48ba30db","added_by":"auto","created_at":"2022-01-31 18:13:28","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":149543,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e\u0026nbsp;Relative quantification of the \u003cem\u003eSERPINE2 \u003c/em\u003egene in cumulus cells of COC’s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized group A and group B oocytes.\u0026nbsp;RC GA-IM - Referral Control of group A, cumulus cells of immature COC’s. GB-IM - Group B, cumulus cells immature of COC’s. GA-M - Group A, cumulus of matured COC’s.\u0026nbsp;GB-M - Group B, cumulus of matured COC’s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb \u003c/strong\u003eTranscriptional level of \u003cem\u003eSERPINE2 \u003c/em\u003egene.\u003cstrong\u003e \u003c/strong\u003eLane 1 - Endogenous control \u003cem\u003eβ actin. \u003c/em\u003eLane 5 = 100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC’s, cumulus cells, of matured COC’s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC’s, cumulus cells, of matured COC’s and fertilized early embryos of group B.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/850a0eae3d337c171357e61f.png"},{"id":17814953,"identity":"9709d1bc-6f13-4c94-839a-7047346feae4","added_by":"auto","created_at":"2022-01-31 18:10:28","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":474293,"visible":true,"origin":"","legend":"\u003cp\u003eAmplification plot and melting curve graph of \u003cem\u003eGJA1, PRSS35, PTX3 \u003c/em\u003eand \u003cem\u003eSERPINE2\u003c/em\u003e genes.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/392a6c8c69a39d0a029727a9.png"},{"id":17815428,"identity":"4d4185b4-15e4-4c6f-aeba-64247c45e6e6","added_by":"auto","created_at":"2022-01-31 18:16:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":999787,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/fa894127-1a74-4551-8fa1-a1c7faf6fc3c.pdf"},{"id":17815052,"identity":"70a47126-6647-42eb-a2b0-106a08a8c283","added_by":"auto","created_at":"2022-01-31 18:13:28","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":115920,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1 \u003c/strong\u003eComparative expression level of \u003cem\u003eGJA1, PRSS35, PTX3, \u003c/em\u003eand \u003cem\u003eSERPINE2\u003c/em\u003e genes cumulus cells of immature and matured group A and B COC’s along with fertilized early embryos. GA - Group A and GB - Group B. RC (AI) - Referral Control (cumulus cells of immature COC’s of group A oocytes). AM - Group A, cumulus cells of matured COC’s. AF - Group A, fertilized early embryos. BI - Group B, cumulus cells of immature COC’s. BM - Group B, cumulus cells of matured COC’s. BF - Group B, fertilized early embryos.\u003c/p\u003e","description":"","filename":"FigS1.png","url":"https://assets-eu.researchsquare.com/files/rs-1289084/v1/4bbd9f45d35b126670860376.png"}],"financialInterests":"","formattedTitle":"\u003cp\u003eTranscriptional Level of Cumulus-Associated \u003cem\u003eGJA1, PTX3, PRSS35, and SERPINE2\u003c/em\u003e Genes with Oocytes and Embryonic Development in Water Buffalo\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eIn-vitro\u003c/em\u003e maturation (IVM), \u003cem\u003ein-vitro\u003c/em\u003e fertilization (IVF), and gamete cryopreservation technologies provide a practical means for producing a large number of bovine embryos at a low cost for research and commercial settings [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Various factors have been affected the successful In-Vitro production of buffalo embryos including a low number of follicles on the ovaries, sperm mortality, in-vitro laboratory conditions. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], a poor recovery rate of the oocytes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and poor \u003cem\u003ein-vitro\u003c/em\u003e fertilization efficiency [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In early embryo development, defining oocyte quality remains one of the most difficult challenges. Follicular growth and maturation are prerequisites to oocyte fertilization and subsequent early embryo development [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among all the events involved in this process, those taking place precisely at the pre-ovulatory stage within the cumulus-oocyte-complexes (COC\u0026rsquo;s) might offer new criteria for choosing embryos with the best development ability [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Previous studies emphasized the roles of cumulus mass in nurturing oocyte growth, gradual acquisition of oocyte developmental competence suggested that cumulus cells metabolize the bulk of glucose consumed by the COC\u0026rsquo;s, supplying metabolic intermediates like pyruvate, mainly through glycolysis, to the oocyte and regulating the oocyte gene transcription [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the livestock sector, \u003cem\u003ein-vitro\u003c/em\u003e fertilization (IVF) technology can be a useful tool for fruitful output in mammalian species like cows, buffaloes, goats, and pigs. The good qualities of cumulus cells (CC\u0026rsquo;s) are very important for successful \u003cem\u003ein-vitro\u003c/em\u003e fertilization. Oocyte cumulus undoubtedly plays an important role in oocyte quality and maturation but the eject mechanism behind this is still unknown [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Therefore, an extensive study is required to analyze whether the developmental potential of the COC\u0026rsquo;s is associated with the expression of different cumulus genes in terms of maturation, fertilization, and embryonic development. Works of literature show that genes such as \u003cem\u003eGJA1, PRSS35, PTX3\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e play a crucial role in oocyte maturation, fertilization, and embryonic development [\u003cspan additionalcitationids=\"CR19 CR20 CR21 CR22 CR23\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. However, literature elucidating these cumulus-associated gene expressions, their significance, and the effect of cumulus cell layer/mass toward the embryonic developmental process are scarce in livestock.\u003c/p\u003e \u003cp\u003eCumulus-associated \u003cem\u003eGJA1\u003c/em\u003e gene is the major gap junction \u003cem\u003eα1\u003c/em\u003e protein or \u003cem\u003econnexin43\u003c/em\u003e, essential for oocyte fertilization potential and embryo quality [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. \u003cem\u003ePRSS35\u003c/em\u003e gene belongs to the trypsin class of serine proteases, which is essential for the tissue remodeling and functions of the ovary during folliculogenesis and ovulation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The gene \u003cem\u003ePTX3\u003c/em\u003e (Pentraxin-related protein 3) is linked to extracellular matrix (ECM) hyaluronan and is a potentially reliable predictor of embryo developmental competence [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The \u003cem\u003eSERPINE2\u003c/em\u003e (serine proteases E2) gene is considered a potential pregnancy biomarker [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and is extensively expressed in reproductive tissues [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur aim was, therefore, to evaluate the effects of cumulus cell mass on oocyte competence in terms of oocytes maturation and post-fertilization developments along with the expression of \u003cem\u003eGJA1\u003c/em\u003e, \u003cem\u003ePTX3, PRSS35\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e genes in cumulus cells according to stages in oocyte maturation and embryonic developmental competence in slaughterhouse derived buffalo oocytes.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003eAll the chemicals and media were purchased from Sigma-Aldrich Chemicals Company (St. Louis, Monsanto) and the disposable plastic wares were from Nunc (Roskilde, Denmark) unless otherwise mentioned.\u003c/p\u003e\n\u003ch2\u003eOocyte Aspiration And Grading\u003c/h2\u003e\n\u003cp\u003eUnder a total of 30 trials (Sample size calculated by using, n=Z\u003csup\u003e2\u003c/sup\u003e*P (P-1)/D\u003csup\u003e2\u003c/sup\u003e formula), buffalo ovaries were collected from the large animal abattoir aseptically in normal saline solution (37\u0026ordm;C, pH 7.0), supplemented with gentamicin (50 \u0026micro;g/ml). The ovaries were trimmed and washed 3-4 times in Dulbecco\u0026rsquo;s phosphate buffer saline (1X, DPBS). This was followed by a quick wash of 30-40 seconds with 70% ethanol and finally rinsed with DPBS. Oocytes were aspirated from 6-8 mm ovarian follicles by follicular aspiration method in a pre-warm (37\u0026ordm;C) DPBS medium. The oocytes were washed 3-4 times in TCM-199 (washing media, Hyclone), supplemented with 7.5% (v/v) fetal bovine serum (FBS, Hyclone,) plus 50 mg/ml gentamicin. Recovered oocytes were grouped into 4 categories A, B, C, and D [\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e], following the morphology of cumulus mass and cytoplasmic appearance of oocytes. Group A oocytes had a 3-4 compact layer of cumulus mass with evenly granular homogenous cytoplasm, whereas group B oocytes had 2-3 layers of cumulus mass with evenly granular homogenous cytoplasm. The oocytes with complete or incomplete 1-2 layers of cumulus mass with irregular dark ooplasm, and no cumulus mass with irregular dark ooplasm, were categorized under the C and D group of oocytes, respectively (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). Only group A and B COC\u0026rsquo;s were taken for the gene expression study. Further, for gene expression analysis, oocytes from both groups were divided into three subsequent stages \u003cem\u003eviz\u003c/em\u003e., cumulus cells of immature COC\u0026rsquo;s, cumulus cells of matured COC\u0026rsquo;s and fertilized early embryos.\u003c/p\u003e\n\u003ch2\u003e\u003cspan class=\"BoldItalic\"\u003eIn-vitro\u003c/span\u003e \u003cstrong\u003ematuration (IVM)\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eIn-vitro\u003c/em\u003e maturation medium containing TCM-199 Supplemented with 10\u0026micro;g/ml follicle-stimulating hormone (FSH), luteinizing hormone (LH), 1\u0026micro;g/ml estradiol, 7.5 percent (v/v) fetal bovine serum (FBS), 50 \u0026micro;g/ml gentamicin, and 0.8 mM/ml sodium pyruvate. It was used for \u003cem\u003ein-vitro\u003c/em\u003e maturation of oocytes in groups of 30 oocytes per droplet. The droplets were overlaid with sterile pre-equilibrated mineral oil. The maturation process was carried out under a humidified atmosphere (99%) for 24 hours in a CO\u003csub\u003e2\u003c/sub\u003e incubator having a 5% CO\u003csub\u003e2\u003c/sub\u003e level at 37\u0026deg;C. The cumulus expansion and presence of the first polar body were observed under the inverted zoom microscope (Nikon, 100X), to assess the \u003cem\u003ein vitro\u003c/em\u003e maturation of oocytes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSperm preparation for\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003ein-vitro\u003c/span\u003e \u003cstrong\u003efertilization (IVF) and embryo culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUnder 30 experimental trials, sperms were collected from abattoir-derived epididymis and processed under sterile conditions as described earlier for ovaries. Sperms were harvested from tubules of epididymis with a fine and gentle incision with a sterile surgical blade and collected in a sterile tube containing 10 ml of Bracket and Oliphant (BO) media, supplemented with 1mM caffeine sodium benzoate. The sperm concentration, morphology, and gross motility were observed under the inverted microscope (Nikon, 100X). For \u003cem\u003ein-vitro\u003c/em\u003e fertilization, the sperms were prepared and capacitated for matured oocytes as described by Jeena \u003cem\u003eet al\u003c/em\u003e 2018 [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]. In short, exudate sperms suspension with BO media was centrifuged at 168G for 10 min and the supernatant was discarded. This step was repeated twice. The pellet was resuspended in 5ml of BO fertilization media fortified with 1% BSA plus 50 mg/ml heparin and centrifuged at 168 G for 5 min. The harvested pellet was re-suspended in 1ml BO fertilization media and centrifuged at 168 G for 1min. The pellet was loosened with a fine bore pasture pipette and kept inside the CO\u003csub\u003e2\u003c/sub\u003e incubator for 30 min for capacitation and to allow good quality sperms to swim up. At the same time 30 matured oocytes from both groups A and B were transferred into a pre-equilibrated (38.5\u0026deg;C) 50\u0026micro;l BO fertilization droplet overlaid with mineral oil. After 30 min capacitated sperms with a final concentration of 10\u003csup\u003e6\u003c/sup\u003e were taken from the top layer of sperm suspension and co-incubated with oocytes at 5 percent CO\u003csub\u003e2\u003c/sub\u003e at 38.5\u0026deg;C temperature under a humidified atmosphere for 18 h (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). After 18 h of co-incubation, oocytes were denuded with 1 percent of hyaluronidase. The presumptive zygotes (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed) were cultured in RVCL media (Research Vitro Cleave Medium, COOK, Australia). Each group of embryos were assessed for their embryonic developmental stages as cleavage (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee), 4 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef), compact morula (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg), and blastocyst development (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eh).\u003c/p\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003ePrimer designing\u003c/h2\u003e\n\u003cp\u003eThe Primers for \u003cem\u003e\u0026beta;-actin, PTX3, PRSS35, and SERPINE2\u003c/em\u003e were designed by using online software PRIMER EXPRESS 3.0. The \u003cem\u003eGJA1\u003c/em\u003e gene primer was taken as a reference primer. Primer sequence specificity was checked by an online available database from BLAST, NCBI (Tab. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eDetails of qRT-PCR (quantitative Real Time-PCR) primers\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eS. No.\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGene name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eAmplicon size\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e1.\u003c/p\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e(R)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCACCCAGCACAATGAAGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e118bp\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e (F)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGCTTGCTGATCCACATC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e3.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eSERPINE2\u003c/em\u003e (F)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGGGTTTGTGGAGATCACG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e170bp\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eSERPINE2\u003c/em\u003e (R)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTAGGGCAGCTCGATGAAGTT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e5.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePRSS35\u003c/em\u003e (F)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGACTACATCAAAGGCAGCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e179bp\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePRSS35\u003c/em\u003e (R)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATCCCTTTCTCCTCCTTCCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e7.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePTX3\u003c/em\u003e (F)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCATGCGTTCCAAGAAGATT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e217bp\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ePTX3\u003c/em\u003e (R)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCGACCAGTCTGTTTTCCTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e9.\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eGJA1\u003c/em\u003e (F)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTGCCGCAATTACAACAAACAAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e425bp\u003csup\u003e[25]\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eGJA1\u003c/em\u003e (R)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATCCCTAACACCCCCAATGAACCA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003eF* forward primer; R* reverse primer\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003e\u003cstrong\u003eGene expression level of cumulus-associated\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eGJA1, PTX3\u003c/span\u003e, \u003cspan class=\"BoldItalic\"\u003ePRSS35\u003c/span\u003e, \u003cstrong\u003eand\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eSERPINE2\u003c/span\u003e \u003cstrong\u003egenes\u003c/strong\u003e\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eCumulus-oocyte complexes (COC\u0026rsquo;s) were denuded in 0.1 percent hyaluronidase for 10 min with a gentle vortex to remove the cumulus cells. The total RNA was extracted by the Trizol method from cumulus cells of both groups (A and B), and also from their subsequent stages of immature cumulus cells of COC\u0026rsquo;s, matured COC\u0026rsquo;s, and fertilized early embryos. A total of 30 COC\u0026rsquo;s from both groups were taken for RNA extraction. cDNA was prepared by using the first-strand cDNA synthesis kit (Fermentas, K1622) from an equal amount of total RNA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eqRT-PCR was performed with a total volume of 20\u0026micro;l containing cDNA (1\u0026micro;l), 1pico- mole of reverse and forward primer (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e), and 10\u0026micro;l of 2X SYBER green master mix (Applied Biosciences). All reactions were performed in triplicate. The relative quantification of mRNA of each gene was evaluated by qRT-PCR (Applied Biosystems, 7300) using SYBR green chemistry. The relative gene expression analysis of \u003cem\u003eGJA1, PTX3, PRSS35\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e genes was analyzed by using Livak and Schmittgen [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e] formulation \u003cem\u003ei.e.\u003c/em\u003e, comparative 2ˉ\u0026Delta;\u0026Delta;Ct method. The housekeeping gene \u003cem\u003e\u0026beta;-actin\u003c/em\u003e was used as an endogenous loading control to normalize the relative gene expression. Immature COC\u0026rsquo;s of group A oocyte were taken as a referral control (1.0) for the expression analysis of cumulus-associated \u003cem\u003eGJA1, PTX3, PRSS35\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e genes in both the groups. The purity of amplified products was checked by Ethidium Bromide (EtBr, 0.5\u0026micro;g/ml) stained with 1.8 percent agarose gel electrophoreses.\u003c/p\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eThe percent data of embryonic development were transformed by arcsine transformation (log\u003csub\u003eN\u003c/sub\u003e) and subjected to analysis of variance by Hierarchical analysis of variance design, and the mean differences were compared by Duncan\u0026rsquo;s Multiple Range Test (P\u0026lt;0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u0026nbsp;\u003c/div\u003e"},{"header":"Results","content":"\u003ch2\u003e\u003cspan class=\"BoldItalic\"\u003eIn-vitro\u003c/span\u003e \u003cstrong\u003ematuration (IVM) of abattoir-derived buffalo oocytes\u003c/strong\u003e\u003c/h2\u003e\n\u003cp\u003eUnder 30 experimental trials, a total of 2070 COC\u0026rsquo;s were retrieved from 1000 slaughterhouse-derived ovaries, out of which 550 were from group A, 800 from group B (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e), and the rest of 720 were from group C and D. Only good quality COC\u0026rsquo;s of group A and B were taken for \u003cem\u003ein-vitro\u003c/em\u003e maturation and in \u003cem\u003ein-vitro\u003c/em\u003e fertilization. The analysis of variance of the data on embryonic development (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e) revealed a highly significant (P\u0026lt;0.01) between-group difference (A and B) for all the embryonic stages. However, there was no significant difference (P\u0026gt;0.01) between the day of the experiment (bull effect), indicating that epididymal semen collected on a different day did not significantly affect embryonic development. Further, the embryonic development stages within the group differed significantly, shown in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eIt was observed that the \u003cem\u003ein-vitro\u003c/em\u003e maturation rate of group A was substantially higher as compared to group B oocytes, in terms of first polar body extrusion (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The cleavage (2 cells), 8 cells, morula and blastocyst development rate (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e) in group B (85.365\u0026plusmn;0.7608, 65.853\u0026plusmn;0.7608, 51.219\u0026plusmn;0.9575 and 31.707\u0026plusmn;0.9688%) COC\u0026rsquo;s were found significantly lower (P\u0026le;0.05) compared to group A (92.682\u0026plusmn;0.7179, 78.804\u0026plusmn;0.6878, 59.756\u0026plusmn;0.9466 and 42.682\u0026plusmn; 0.9683%) in respect of all the embryonic development stages.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003e\u003cem\u003eIn-vitro\u003c/em\u003e maturation of group A and B of oocytes.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eOvaries collected from buffalo slaughterhouse\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eOocytes aspirated\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGrading of oocytes taken for study\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eNo. of oocytes set for IVM\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eOocytes showing polar body\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e1000\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e2070\u003c/p\u003e\n\u003cp\u003e(2.07 oocytes ovary)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGroup A\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e550 (26.57%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e508 (92.36%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGroup B\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e800 (38.64%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e650 (81.25%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"5\"\u003eValues within parentheses indicate mean\u0026plusmn;SE%\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eAnalysis of variance for embryonic development.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSource of variation\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eDegree of freedom\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMean Square value\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBetween Group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.535**\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBetween the day of experiment (bull effect)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.401\u003csup\u003eNS\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBetween EDS within group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e23.812**\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eError\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e101\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.003\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\"\u003eEDS-Embryonic development stage; ** Significant (P\u0026lt;0.01), NS- Non-Significant.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab4\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eMean embryonic development percentage in group A and B \u003cem\u003ein-vitro\u003c/em\u003e fertilized oocytes.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003cth style=\"height: 70px;\" rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eNo. of oocytes in each group\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" colspan=\"4\" align=\"left\"\u003e\n\u003cp\u003eEmbryonic development stages (Mean\u0026plusmn;SE)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 35px;\"\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e2-4 cells (%)\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003e8-16 cells\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eMorula (%)\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"height: 35px;\" align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eBlastocyst (%)\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 61px;\"\u003e\n\u003ctd style=\"height: 61px;\" align=\"left\"\u003e\n\u003cp\u003eGroup A - 410 fertilized oocytes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e380\u003c/p\u003e\n\u003cp\u003e(92.682\u0026plusmn;0.7179)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e320\u003c/p\u003e\n\u003cp\u003e(78.804\u0026plusmn;0.6878)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e245\u003c/p\u003e\n\u003cp\u003e(59.756\u0026plusmn;0.9466)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e175\u003c/p\u003e\n\u003cp\u003e(42.682\u0026plusmn;0.9683)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 61px;\"\u003e\n\u003ctd style=\"height: 61px;\" align=\"left\"\u003e\n\u003cp\u003eGroup B - 410 fertilized oocytes\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e350\u003c/p\u003e\n\u003cp\u003e(85.365\u0026plusmn;0.7608)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e270\u003c/p\u003e\n\u003cp\u003e(65.853\u0026plusmn;0.7608)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e220\u003c/p\u003e\n\u003cp\u003e(51.219\u0026plusmn;0.9575)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"height: 61px;\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e130\u003c/p\u003e\n\u003cp\u003e(31.707\u0026plusmn;0.9688)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr style=\"height: 13.3438px;\"\u003e\n\u003ctd style=\"height: 13.3438px;\" colspan=\"5\"\u003eValue with different superscripts within column differs significantly (P\u0026le;0.05).\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptional level\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eGJA1, PTX3, PRSS35\u003c/span\u003e, \u003cstrong\u003eand\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eSERPINE2\u003c/span\u003e \u003cstrong\u003egenes in group A and B oocytes\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe immature COC\u0026rsquo;s of group A oocytes were taken as a referral control (1.0) for the expression analysis of \u003cem\u003eGJA1, PTX3, PRSS35\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e genes in both group A and B. Further, both the groups were divided into their three subsequent stages of cumulus cell of immature COC\u0026rsquo;s, cumulus cells of matured COC\u0026rsquo;s and fertilized early embryos.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCumulus-associated\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eGJA1\u003c/span\u003e \u003cstrong\u003egene expression and oocyte integrity\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe relative expression of the\u0026nbsp;\u003cem\u003eGJA1\u003c/em\u003e\u0026nbsp;gene was found significantly (P\u0026le;0.05) higher in cumulus cells of immature COC\u0026rsquo;s (1.0) compared to matured cumulus cells of COC\u0026rsquo;s (0.74) and in the fertilized early embryos (0.22) of group A. The expression pattern was also significantly lower in group B immature cumulus cells of COC\u0026rsquo;s (0.82), matured cumulus cells of COC\u0026rsquo;s (0.42), and the fertilized early embryos (0.20) compared to group A (Fig.\u0026nbsp;2a). The present study revealed that the\u0026nbsp;\u003cem\u003eGJA1\u003c/em\u003e\u0026nbsp;gene was strongly associated with immature cumulus cells of COC\u0026rsquo;s, and the abundance of this gene was reduced significantly towards the progression of developmental stages till fertilization (shown in Fig.\u0026nbsp;2a-b).\u003c/p\u003e\n\u003cp\u003eFigure\u0026nbsp;2a Relative quantification of the \u003cem\u003eGJA1\u003c/em\u003e gene in cumulus cells of COC\u0026rsquo;s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC\u0026rsquo;s. GB-IM - Group B, cumulus cells immature COC\u0026rsquo;s. GA-M - Group A, cumulus of matured COC\u0026rsquo;s. GB-M - Group B, cumulus of matured COC\u0026rsquo;s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb\u003c/strong\u003e Transcriptional level of \u003cem\u003eGJA1\u003c/em\u003e gene. Lane 1 - Endogenous control \u003cem\u003e\u0026beta; actin.\u003c/em\u003e Lane 5\u0026thinsp;=\u0026thinsp;100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells of Matured COC\u0026rsquo;s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells of matured COC\u0026rsquo;s and fertilized early embryos of group B.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCumulus-expressed\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003ePRSS35\u003c/span\u003e \u003cstrong\u003eand\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003ePTX3\u003c/span\u003e \u003cstrong\u003emRNA levels correlated with oocyte maturation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt was observed that \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e had significantly (P\u0026le;0.05) higher expression levels in matured cumulus cells of COC\u0026rsquo;s of both group A (1.3 and 1.3) and group B (1.2 and 1.1). Whereas, the expression levels of \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e were significantly lower (P\u0026le;0.05) in fertilized early embryos of both group A (0.33 and 0.52) and B (0.22 and 0.24). Similar results were observed in immature cumulus cells of COC\u0026rsquo;s in group A (1.0) and B (0.91 and 0.80). The results showed that the relative transcripts of \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e genes increased significantly in \u003cem\u003ein-vitro\u003c/em\u003e matured stages, but were reduced markedly in fertilized early embryos irrespective of oocyte groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea-b and 4a-b).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFigure\u0026nbsp;4a Relative quantification of the \u003cem\u003ePTX3\u003c/em\u003e gene in cumulus cells of COC\u0026rsquo;s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC\u0026rsquo;s. GB-IM - Group B, cumulus cells immature COC\u0026rsquo;s. GA-M - Group A, cumulus of matured COC\u0026rsquo;s. GB-M - Group B, cumulus of matured COC\u0026rsquo;s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb\u003c/strong\u003e Transcriptional level of \u003cem\u003ePTX3\u003c/em\u003e gene. Lane 1 \u003cstrong\u003e-\u003c/strong\u003e Endogenous control \u003cem\u003e\u0026beta; actin\u003c/em\u003e. Lane 5\u0026thinsp;=\u0026thinsp;100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells of matured COC\u0026rsquo;s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells of matured COC\u0026rsquo;s and fertilized early embryos of group B.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emRNA expression pattern of\u003c/strong\u003e \u003cspan class=\"BoldItalic\"\u003eSERPINE2\u003c/span\u003e \u003cstrong\u003egene in cumulus cells associated with fertilization and embryonic development\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eThe results showed that the relative expression of the \u003cem\u003eSERPINE2\u003c/em\u003e gene was significantly higher (P\u0026le;0.05) in fertilized early embryos of both group A (1.6) and B (1.08). As shown in Fig.\u0026nbsp;5a, the \u003cem\u003eSERPINE2\u003c/em\u003e gene expression was significantly lower (P\u0026le;0.05) in matured oocytes of both groups A (0.59) and B (0.46) along with immature group B (0.79) and group A (1.0) oocytes. The expression level of the \u003cem\u003eSERPINE2\u003c/em\u003e gene in embryos produced by \u003cem\u003ein-vitro\u003c/em\u003e fertilization was significantly higher in fertilized early embryos than the cumulus cells of immature and matured COC\u0026rsquo;s (Fig.\u0026nbsp;5a-b).\u003c/p\u003e\n\u003cp\u003eFigure\u0026nbsp;5a Relative quantification of the \u003cem\u003eSERPINE2\u003c/em\u003e gene in cumulus cells of COC\u0026rsquo;s and \u003cem\u003ein-vitro\u003c/em\u003e fertilized group A and group B oocytes. RC GA-IM - Referral Control of group A, cumulus cells of immature COC\u0026rsquo;s. GB-IM - Group B, cumulus cells immature of COC\u0026rsquo;s. GA-M - Group A, cumulus of matured COC\u0026rsquo;s. GB-M - Group B, cumulus of matured COC\u0026rsquo;s. GA-F - Group A, fertilized early embryos. GB-F - Group B, fertilized early embryos. \u003cstrong\u003eb\u003c/strong\u003e Transcriptional level of \u003cem\u003eSERPINE2\u003c/em\u003e gene. Lane 1 - Endogenous control \u003cem\u003e\u0026beta; actin.\u003c/em\u003e Lane 5\u0026thinsp;=\u0026thinsp;100bp ladder. Lane 2, 3, 4 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells, of matured COC\u0026rsquo;s and fertilized early embryos of group A. Lane 6, 7, 8 - Cumulus cells of immature COC\u0026rsquo;s, cumulus cells, of matured COC\u0026rsquo;s and fertilized early embryos of group B.\u003c/p\u003e\n\u003cp\u003eThe overall expression pattern of cumulus-associated \u003cem\u003eGJA1, PRSS35, PTX3\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e genes at their subsequent developmental stages in both groups were analyzed collectively. The expressions of these genes were found significantly higher in group A compared to group B (Fig S1). The amplified products were confirmed by amplification plot, melting curve (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e), and agarose gel electrophoresis. The products were identified by their specific band size (\u003cem\u003eGJA1-\u003c/em\u003e425bp, \u003cem\u003eSERPINE2-\u003c/em\u003e170bp, \u003cem\u003ePRSS35-\u003c/em\u003e179bp, and \u003cem\u003ePTX3-\u003c/em\u003e217bp) as shown in Fig.\u0026nbsp;2b, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, 4b, and Fig.\u0026nbsp;5b.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCumulus cells (CC\u0026rsquo;s) originating from undifferentiated granulosa cells (GC\u0026rsquo;s) differentiate in mural granulosa cells (MGC\u0026rsquo;s) and CC\u0026rsquo;s during antrum formation in the follicle by the distribution of location. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eGJA1\u003c/em\u003e is the major isoform of connexins between GCs (granulosa cells): MGCs\u0026ndash;MGCs (mural granulosa cells) and MGCs\u0026ndash;CCs (cumulus cells) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Gap junctions transmit nutrients and small molecules such as ions, metabolites, amino acids, and intracellular signaling molecules from GCs to oocytes via CCs [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. We observed the expression level of the \u003cem\u003eGJA1\u003c/em\u003egene in immature cumulus cells of COC\u0026rsquo;s was significantly higher as compared to matured cumulus cells of COC\u0026rsquo;s and fertilized oocytes of both groups (A \u0026amp; B, Fig.\u0026nbsp;2a-b). A similar type of study was reported by Edry and workers, they found \u003cem\u003eGJA1\u003c/em\u003e-mediated gap junctional communication regulates oocyte meiosis resumption, and lower levels of \u003cem\u003eGJA1\u003c/em\u003e in cumulus cells are beneficial for oocyte maturation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. While Feuerstein and Mishra reported contrasting results wherein relative expression of the \u003cem\u003eGJA1\u003c/em\u003egene was significantly lower in immature cumulus cells of COC\u0026rsquo;s [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. However, \u003cem\u003eGJA1\u003c/em\u003eexpression in cumulus cells surrounding the matured oocytes did not show any difference in developing embryos with good or poor morphology [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Hasegawa reported a significantly lower expression of \u003cem\u003eGJA1\u003c/em\u003e for embryos with good morphology [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Similarly, we revealed significantly lower expression of the \u003cem\u003eGJA1\u003c/em\u003egene was observed in fertilized oocytes and matured cumulus cells of COC\u0026rsquo;s.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePRSS35\u003c/em\u003e belongs to the trypsin class of serine proteases, essential for follicular growth, ovulation, as well as for luteal formation and regression. \u003cem\u003ePRSS35\u003c/em\u003e gene expression was localized in theca cells of pre-antral follicles, the theca and granulosa cells of pre-ovulatory, ovulatory follicles, and developing corpus luteum [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Whereas, the \u003cem\u003ePTX3\u003c/em\u003e gene is localized in the cumulus matrix and plays a crucial role in cumulus expansion. Various cumulus proteins linked to extracellular matrix hyaluronan, are required for regulating cumulus integrity, which ensure cumulus expansion and oocyte maturation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR33 CR34\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. A previous study reported \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e mRNA levels are associated with oocyte interiority and fertilization potential [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur data revealed that \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e mRNA levels are associated with the oocyte maturation potential (Fig.\u0026nbsp;2). The higher expression of \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e genes were observed in cumulus cells of COC\u0026rsquo;s of matured oocytes of both groups (A \u0026amp; B, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-b \u0026amp; Fig.\u0026nbsp;4a-b). However, it was found significantly lower in cumulus cells of immature COC\u0026rsquo;s and fertilized oocytes. Li et al [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] reported a relationship between PRSS35 expression and oocyte competence. While the expression of \u003cem\u003ePTX3\u003c/em\u003e has been reported to be significantly lower in cumulus cells from immature oocytes than in those from mature oocytes, which was found similar to our study. Similarly, Huang [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] demonstrated that the expression level of the \u003cem\u003ePRSS35\u003c/em\u003e gene plays an important role in oocyte nuclear maturation and gaining developmental competence. According to Miyakoshi the \u003cem\u003ePRSS35\u003c/em\u003e mRNA level increased at the time of ovulation and remained elevated in the developing corpus luteum [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Although the scientific literature regarding the association of the \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e genes with the oocyte and embryo developments is less in livestock. However, some studies have been reported in a few species like mouse and human oocytes and embryos.\u003c/p\u003e \u003cp\u003eSalustri and co-workers [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] reported the infertility of \u003cem\u003ePTX3\u003c/em\u003e null mice was associated with severe abnormalities of the cumulus ionophores and failure of \u003cem\u003ein-vivo\u003c/em\u003e, but not \u003cem\u003ein-vitro\u003c/em\u003e oocyte fertilization. Zhang [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] reported that the expression of the \u003cem\u003ePTX3\u003c/em\u003e gene in cumulus cells was indicative of oocyte and embryo quality. However, Diao and co-workers reported the \u003cem\u003ePRSS35\u003c/em\u003e-null mice to have no defects in female fertility, suggesting that the gene is non-functional for murine fertility as well as in embryonic development. Also, he did not detect any compensatory up-regulation of other proteases reported in the uterus; but, the expression of other protease-related genes cannot be ruled out [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, this remains unclear in the case of mammalians. We found the higher expression of \u003cem\u003ePRSS35 and PTX3 genes\u003c/em\u003e in cumulus cells of matured COC\u0026rsquo;s had a beneficial effect on oocyte competence and embryonic development.\u003c/p\u003e \u003cp\u003e \u003cem\u003eSERPINE2\u003c/em\u003e is a Serpin peptidase inhibitor (clade E, member), which inhibits urokinase-type plasminogen activator (PLAU) and tissue-type plasminogen activator. These activators are associated with many types of reproductive processes, e.g., ovulation, embryonic development, and embryo implantation [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Hamel et al, reported the SERPINE2 mRNA levels in granulosa cells have been suggested to be a potential pregnancy biomarker [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur data revealed that \u003cem\u003eSERPINE2 mRNA\u003c/em\u003e levels are associated with oocyte fertilization potential.\u003c/p\u003e \u003cp\u003eWe found the expression of this gene was higher in fertilized oocytes of both groups (A \u0026amp; B, Fig.\u0026nbsp;5a-b). However, the expression of the \u003cem\u003eSERPINE2\u003c/em\u003e gene was lower in cumulus cells of immature and matured COC\u0026rsquo;s (Fig.\u0026nbsp;5a). Hamel and co-workers [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] also reported the \u003cem\u003eSERPINE2\u003c/em\u003e gene to be considered as a potential pregnancy biomarker and extensively expressed in reproductive tissues, the placenta, and the uterus [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Sadeesh \u003cem\u003eet al\u003c/em\u003e, reported the silencing of \u003cem\u003eSERPINE2\u003c/em\u003e expression using small interfering RNAs or blockage of \u003cem\u003eSERPINE2\u003c/em\u003e protein using a specific antibody did not affect oocyte maturation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, in a mouse, higher levels of \u003cem\u003eSERPINE2\u003c/em\u003e were demonstrated to impair cumulus expansion and oocyte maturation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Li and coworkers reported the higher \u003cem\u003eSERPINE2\u003c/em\u003e expression levels were detected in cumulus cells of human immature oocytes than in those of mature oocytes [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. According to our data, we found the higher expression of the \u003cem\u003eSERPINE2\u003c/em\u003e gene in fertilized oocytes suggested its significant role in fertilization and embryonic development.\u003c/p\u003e \u003cp\u003eThe results of the present study showed that in all the cases, the expressions of cumulus-associated genes in group A were significantly up-regulated as compared to group B (supplementary Figure S1). The higher expression of these genes in group A COC\u0026rsquo;s can be related to higher embryonic development compared to group B COC\u0026rsquo;s showing down-regulation of all these genes compared to group A COC\u0026rsquo;s. It might be concluded that the significantly higher expression of the \u003cem\u003eGJA1\u003c/em\u003e gene in cumulus cells of immature COC\u0026rsquo;s along with \u003cem\u003ePRSS35\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e genes in cumulus cells of matured COC\u0026rsquo;s have a positive impact on oocyte developments. Similarly, a higher expression of the \u003cem\u003eSERPINE2\u003c/em\u003e gene in fertilized early embryos may have beneficial effects on oocyte fertilization and embryonic development in buffalo.\u003c/p\u003e \u003cp\u003eWe found some contradictory results from a previous study which was in human embryos, where the study reported the \u003cem\u003eGJA1\u003c/em\u003e and \u003cem\u003eSERPINE2\u003c/em\u003e represent potential gene markers associated with oocyte maturation and \u003cem\u003ePRSS35\u003c/em\u003e may be correlated with oocyte fertilization potential [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, our study model was buffalo\u0026rsquo;s embryos.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe selection of embryos with higher developmental potential has been one of the major factors in assisted reproductive technology (ART). Because, cumulus cells play a very important role in oocyte integrity and embryonic development. Although cumulus gene expression may represent a promising method compared with the currently used morphology-based method, more investigations are warranted. Thus, a prospective larger cohort study or the use of SET cumulus samples remains necessary to clarify the effectiveness. However, it was concluded from our study the morphologically good quality of COC\u0026rsquo;s had a higher developmental potential in terms of maturation, fertilization, and embryonic development as compared to oocytes having poor quality of COC\u0026rsquo;s (in both A \u0026amp; B groups). Based on molecular analysis of differential expressions of cumulus-associated genes we found the \u003cem\u003eGJA1\u003c/em\u003e gene associated with immature oocyte integrity, \u003cem\u003ePTX3\u003c/em\u003e and \u003cem\u003ePRSS35\u003c/em\u003e represent gene markers potentially associated with oocyte maturation, and \u003cem\u003eSEPINE2\u003c/em\u003e may be correlated with oocyte fertilization potential. In summary, \u003cem\u003eGJA1, PRSS35, PTX3\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e in cumulus cells of different quality of oocytes and their resultant embryos after IVF, we can conclude these genes could be used as biomarkers for predicting the developmental competence of buffalo\u0026rsquo;s oocytes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Info\u003c/strong\u003e\u003cstrong\u003e:\u0026nbsp;\u003c/strong\u003eNo funding\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest/Competing interests:\u003c/strong\u003e The authors declare that they have no Conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval:\u0026nbsp;\u003c/strong\u003eThere was no need for ethical approval for this study. Slaughterhouse-derived ovaries and epididymis were used for \u003cem\u003ein-vitro\u003c/em\u003e transcriptional analysis of cumulus-associated genes. No live animals were used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate (Ethics):\u0026nbsp;\u003c/strong\u003eNot needed. In the in-vitro study, no live animals were used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish (Ethics):\u003c/strong\u003e Not needed. In the in-vitro study, no live animals were used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003cstrong\u003e: Lalit Mohan Jeena wrote the manuscript. Bikash Chandra Sarkhel and\u0026nbsp;\u003c/strong\u003eDharmendra Kumar helped in statistical analysis. Sandeep Rahangdale and Ajit Pratap Singh arranged the figures and references as per journal guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material:\u003c/strong\u003e All data and materials for the study were provided by the Director of Animal Biotechnology Centre, NDVSU Jabalpur, M.P., India.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHansen PJ (2006) Realizing the promise of IVF in cattle - an overview. Theriogenology 65:119\u0026ndash;125. doi:\u003cdiv class=\"ExternalRefDOI\"\u003e10.1016/j\u003c/div\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadeesh EM (2015) \u003cem\u003eIn-vitro\u003c/em\u003e embryo production in buffalo: effects of culture system on pre-implantation development and gene expression pattern. Curr Sci 109(3):603\u0026ndash;607\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar D, Shukla MK, Jeena LM, Rahangdale S, Kumari D, Singh A, Sarkhel BC (2016) Assessment of \u003cem\u003ein-vitro\u003c/em\u003e maturation of oocytes derived from slaughterhouse goat ovaries. Ruminant Science 5(1):17\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.anandpub.com/archive-june-volume-2016-5-1-issue4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang RH, Zhou WH (2021) Granulosa cell biomarkers to predict oocyte and embryo quality in assisted reproductive technology. Reproductive and Developmental Medicine 5(1):30\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://www.repdevmed.org/text.asp?2021/5/1/30/313684\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurathum B, Gao EM, Chian RC (2021) The Function of Cumulus Cells in Oocyte Growth and Maturation and in Subsequent Ovulation and Fertilization. Cells 2(9):2292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/ 10.3390/cells10092292\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNivet AL, Vigneault C, Blondin P, Sirard MA (2013) Changes in granulosa cells\u0026rsquo; gene expression associated with increased oocyte competence in bovine. Reproduction 145(6):555\u0026ndash;565. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1530/REP130032\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePengfei L, Jinzhu M, Wenzhong L, George WS, Jianbo Y, Lihua L (2016) Transcriptome analysis of bovine ovarian follicles at predeviation and onset of deviation stages of a follicular wave. International Journal of Genomics 3472748:1-9. doi.org/10. 1155/2016/3472748\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDa Broi MG, Giorgi VSI, Wang F, Keefe DL, Albertini D, Navarro PA (2018) Influence of follicular fluid and cumulus cells on oocyte quality: clinical implications. Journal of Assisted Reproduction Genetics 35(5):735\u0026ndash;751. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1007/s10815-018-1143-3\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerre LB, Bogliotti Y, Chitwood JL, Fresno C, Ortega HH, Kjelland ME, Ross RJ (2016) Effect of spermatozoa motility hyperactivation factors and gamete co-incubation duration on \u003cem\u003ein-vitro\u003c/em\u003e bovine embryo development using flow cytometrically sorted spermatozoa. Reproduction Fertility and Development 29(4):805\u0026ndash;814. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1071/RD15289\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUhde K, van Tol HTA, Stout TAE, Bernard AJR (2018) Metabolomic profiles of bovine cumulus cells and cumulus-oocyte-complex-conditioned medium during maturation \u003cem\u003ein vitro\u003c/em\u003e. Sci Rep 8:9477. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1038/s41598-018-27829-9\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson RA, Sciorio R, Kinnell H, Bayne RA, Thong KJ, De-Sousa PA (2009) Cumulus gene expression as a predictor of human oocyte fertilization, embryo development and competence to establish a pregnancy. Reproduction 138(4):629\u0026ndash;637. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1530/REP-09-0144\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasegawa J, Yanaihara A, Iwasaki S, Mitsukawa K, Negishi M, Okai T (2007) Reduction of connexin 43 in human cumulus cells yields good embryo competence during ICSI. J Assist Reprod Genet 24:463\u0026ndash;466. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10815-007-9155-4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrtiz-Escribano N, Smits K, Piepers S, Vanden-Abbeel E, Woelders H, Van-Soom A (2016) Role of cumulus cells during vitrification and fertilization of mature bovineoocytes: Effects on survival, fertilization, and blastocyst development. Theriogenology 86(2):635\u0026ndash;641. doi: \u003cdiv class=\"ExternalRefDOI\"\u003e10.1016/j\u003c/div\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDowns SM (2001) A gap-junction-mediated signal, rather than an external paracrine factor, predominates during meiotic induction in isolated mouse oocytes. Zygote 9(1):71\u0026ndash;82. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1017/s0967199401001071\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi HS, Lin MH, Hwu MY, Lu HC, Yeh YL, Chen JY, Lee KKR (2015) Correlation of cumulus gene expression of \u003cem\u003eGJA1, PRSS35, PTX3\u003c/em\u003e, and \u003cem\u003eSERPINE2\u003c/em\u003e with oocyte maturation, fertilization, and embryo development in human. Reproductive Biology and Endocrinology 13:93. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12958-015-0091-3\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia GL, Kikuchi K, Noguchi J, Izaike Y (2000) Short time priming of pig cumulus-oocyte complexes with FSH and forskolin in the presence of hypoxanthine stimulates cumulus cells to secrete a meiosis-activating substance. Theriogenology 53(9):1807\u0026ndash;1815. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0093-691x(00)00316-2\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbner T, Moser M, Sommergruber M, Tews G (2003) Selection based on morphological assessment of oocytes and embryos at different stages of pre-implantation development: a review. Hum Reprod Update 9(3):251\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/humupd/dmg 021\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang HX, Tong D, El-Gehani F, Tekpetey FR, Kidder GM (2008) Connexin expression and gap junctional coupling in human cumulus cells: contribution to embryo quality. Journal of Cellular and Molecular Medicine 13(5):972-84. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1582-4934\u003c/span\u003e\u003c/span\u003e. 2008.00373.x\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWahlberg P, Nylander A, Ahlskog N, Liu K, Ny T (2008) Expression and localization of the serine proteases high-temperature requirement factor A1, serine protease 23, and serine protease 35 in the mouse ovary. Endocrinology 149(10):5070-7. doi: 10.1210/en. 2007-1736\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang X, Jafari N, Barnes RB, Confino E, Milad M, Kazer RR (2005) Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertil Steril 83(1):1169\u0026ndash;1179. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fertnstert.2004.11.030\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamel M, Dufort I, Robert C, Gravel C, Leveille MC, Leader A (2008) Identification of differentially expressed markers in human follicular cells associated with competent oocytes. Molecular Human Reproduction 23(5):1118-27. dio: 10.1093/ humrep/ den048\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBedard J, Brule S, Price CA, Silversides DW, Lussier JG (2003) Serine protease inhibitor-E2 (SERPINE2) is differentially expressed in granulosa cells of dominant follicle in cattle. Molecular Reproduction Development 64(2):52\u0026ndash;65. 10.1002/ mrd.10239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChern SR, Li SH, Chiu CL, Chang HH, Chen CP, Chen EIT (2011) Spatiotemporal expression of \u003cem\u003eSERPINE2\u003c/em\u003e in the human placenta and its role in extravillous trophoblast migration and invasion. Reproduction Biology and Endocrinology 9:106. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1477-7827-9-106\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee RK, Fan CC, Hwu YM, Lu CH, Lin MH (2011) \u003cem\u003eSERPINE2\u003c/em\u003e, an inhibitor of plasminogen activators, is highly expressed in the human endometrium during the secretory phase. Reproduction Biology and Endocrinology 23:9\u0026ndash;38. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1477-7827-9-38\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeena LM, Kumar D, Rahangdale S, Singh AP, Sarkhel BC (2019) Effect of cumulus cells of cumulus-oocyte complexes on \u003cem\u003ein-vitro\u003c/em\u003e maturation, embryonic developmental and expression pattern of apoptotic genes after \u003cem\u003ein-vitro\u003c/em\u003e fertilization in water buffalo \u003cem\u003e(Bubalus bubalis)\u003c/em\u003e. Aniaml Biotechnology 31(2):135\u0026ndash;141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edio:10.1080/10495398.2018. 1554580\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeena L, Kumar D, Rahangdale S, Singh A, Sarkhel BC (2018) \u003cem\u003eIn-vitro\u003c/em\u003e Development Competence of Buffalo Oocytes- Effect of Oocytes Quality on Maturation, Embryonic Developments and Apoptosis. International Journal of Livestock Research 8(11):73\u0026ndash;80. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5455/ijlr.20180512064048\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2ˉ\u003csup\u003e∆∆Ct\u003c/sup\u003e method. Methods 25(4):402\u0026ndash;408. doi. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eorg/10.1006/meth.2001.1262\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdry I, Sela-Abramovich S, Dekel N (2006) Meiotic arrest of oocytes depends on cell-to-cell communication in the ovarian follicle. Mol Cell Endocrinol 252(1\u0026ndash;2):102\u0026ndash;106. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mce.2006.03.009\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeuerstein P, Cadoret V, Dalbies-Tran R, Guerif F, Bidault R, Royere D (2007) Gene expression in human cumulus cells: one approach to oocyte competence. Hum Reprod 22(12):3069\u0026ndash;3077. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/humrep/dem336\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMishra A, Sharma GT, Kumar GS (2010) Expression profile of connexin 43 and poly A polymerase genes in buffalo (\u003cem\u003eBubalus bubalis\u003c/em\u003e) oocytes and developing embryos produced \u003cem\u003ein-vitro\u003c/em\u003e. Journal of Applied Research 38(1):29-3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1080/09712119\u003c/span\u003e\u003c/span\u003e. 2010.9707149\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiao H, Xiao S, Li R, Zhao F, Ye X (2013) Distinct spatiotemporal expression of serine proteases Prss23 and Prss35 in periimplantation mouse uterus and dispensable function of Prss35 in fertility. PLoS One 8(2):e56757. doi:1o.1371/journal.pone.0056757\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang X, Hao C, Shen X, Zhang Y, Liu X (2013) \u003cem\u003eRUNX2, GPX3\u003c/em\u003e and \u003cem\u003ePTX3\u003c/em\u003e gene expression profiling in cumulus cells are reflective oocyte/embryo competence and potentially reliable predictors of embryo developmental competence in PCOS patients. Reproductive Biology and Endocrinology 11:109. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1477-7827-11-109\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVarani S, Elvin JA, Yan C, DeMayo J, DeMayo FJ, Horton HF, Byrne MC, Matzuk MM (2002) Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol Endocrinol 16(6):1154\u0026ndash;1167. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/mend. 16.6.0859\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalustri A, Garlanda C, Hirsch E, De-Acetis M, Maccagno A, Bottazzi B, Doni A, Bastone A, Mantovani G, Beck-Peccoz P, Salvatori G, Mahoney DJ, Day AJ, Siracusa G, Romani L, Mantovani A (2004) \u003cem\u003ePTX\u003c/em\u003e3 plays a key role in the organization of the cumulus oophorus extracellular matrix and in \u003cem\u003ein-vivo\u003c/em\u003e fertilization. Development 131:1577\u0026ndash;1586. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/dev.01056\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eScarchilli L, Camaioni A, Bottazzi B, Negri V, Doni A, Deban L, Bastone A, Salvatori GA, Mantovani GS, Salustri A (2007) \u003cem\u003ePTX3\u003c/em\u003e interacts with inter-alpha-trypsin inhibitor: implications for hyaluronan organization and cumulus oophorus expansion. Journal of Biology and Chemistry 282(41):30161\u0026ndash;30170. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M7037 38200\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyakoshi K, Murphy MJ, Yeoman RR, Mitra S, Dubay CJ, Hennebold JD (2006) The identification of novel ovarian proteases through the use of genomic and bioin-formatic methodologies. Biol Reprod 75(6):823\u0026ndash;835. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1095/biolreprod.106.0522 90\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu CH, Lee RK, Hwu YM, Lin MH, Yeh LY, Chen YJ, Lin SP, Li SH (2013) Involvement of the serine protease inhibitor, \u003cem\u003eSERPINE2\u003c/em\u003e, and the urokinase plasminogen activator in cumulus expansion and oocyte maturation. PLoS ONE 30(8):e74602. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0074602\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDevjak R, Fon Tacer K, Juvan P, Virant Klun I, Rozman D, Vrtacnik Bokal E (2012) Cumulus cells gene expression profiling in terms of oocyte maturity in controlled ovarian hyperstimulation using GnRH agonist or GnRH antagonist. PLoS ONE 7(10):e47106. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0047106\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLonergan P, Rizos D, Gutierrez-Adan A, Moreira PM, Pintado B, de la Fuente J, Boland MP (2003) Temporal divergence in the pattern of messenger RNA expression in bovine embryos cultured from the zygote to blastocyst stage \u003cem\u003ein-vitro\u003c/em\u003e or \u003cem\u003ein-vivo\u003c/em\u003e. Biology of Reproduction 69(4):1424-31. doi. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eorg/10.1095/biolreprod.103.018168\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Cumulus-oocyte complexes (COC’s), in-vitro fertilization, embryo, gene expression.","lastPublishedDoi":"10.21203/rs.3.rs-1289084/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1289084/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eIn the present study, the potential of different groups of cumulus-oocyte complexes (COC’s) for \u003cem\u003ein-vitro\u003c/em\u003e maturation (IVM) and embryonic development was assessed in two groups of COC’s of water buffalo. Further, the association of the expression pattern of cumulus-associated\u0026nbsp;\u003cem\u003eGJA1\u003c/em\u003e,\u003cem\u003e\u0026nbsp;PTX3, PRSS35,\u003c/em\u003e\u0026nbsp;and\u003cem\u003e\u0026nbsp;SERPINE2\u003c/em\u003e\u0026nbsp;genes and their effects on embryonic development was analyzed. Slaughterhouse-derived buffalo oocytes were graded into group A and B based on surrounding cumulus rings. Out of 1000 ovaries, an equal number of 410 COC’s were taken in both the A and B groups.\u0026nbsp;\u003cem\u003eIn-vitro\u0026nbsp;\u003c/em\u003ematuration (IVM) was carried out using Slaughterhouse-derived buffalo epididymis. A remarkable degree of cumulus expansion was noticed in group A (92.68%) as compared to group B (81.25%) oocytes. On IVF and embryo culture, group A COC’s produced a significantly higher rate of cleavage and blastocyst (92.682±0.7179% and 42.682±0.9683%) as compared to group B COC’s (85.365±0.7608% and 31.707±0.9688%), respectively. The transcriptional analysis of cumulus-associated\u0026nbsp;\u003cem\u003eGJA1\u003c/em\u003e,\u003cem\u003e\u0026nbsp;PTX3, PRSS35,\u003c/em\u003e\u0026nbsp;and\u003cem\u003e\u0026nbsp;SERPINE2\u003c/em\u003e\u0026nbsp;genes expression by quantitative Real Time-PCR (qRT-PCR) revealed a significantly higher expression in group A as compared to group B COC’s.\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResult:\u003c/strong\u003e It was revealed that oocytes having good cumulus mass had a higher developmental potential. Based on differential gene expression of cumulus-associated genes, different quality of COC’s, and the resultant embryos after IVF, it was concluded that these genes could be used as a marker for predicting the developmental competence of the oocytes.\u003cstrong\u003e \u003c/strong\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eIt concluded from the study that morphologically good quality of COC’s had a higher developmental competence. Also, the differential expressions of cumulus-associated genes in cumulus cells and embryos, we can conclude that these genes could be used as marker genes for predicting the developmental competence of buffalo’s oocytes.\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Transcriptional Level of Cumulus-Associated GJA1, PTX3, PRSS35, and SERPINE2 Genes with Oocytes and Embryonic Development in Water Buffalo","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-01-31 18:07:26","doi":"10.21203/rs.3.rs-1289084/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor Revisions Needed","date":"2022-02-18T04:56:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-01-27T15:25:19+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-01-27T12:33:01+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-01-25T16:52:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2022-01-23T11:04:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"72a8cff3-5638-4862-8b45-1c565e46fdc1","owner":[],"postedDate":"January 31st, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-03-31T02:30:01+00:00","versionOfRecord":[],"versionCreatedAt":"2022-01-31 18:07:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1289084","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1289084","identity":"rs-1289084","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-27T02:00:06.600101+00:00
License: CC-BY-4.0